WO2001038376A1 - A new polypeptide-zinc finger protein 46 and the polynucleotide encoding it - Google Patents

Abstract

The present invention discloses a new polypeptide-zinc finger protein 46, the polynucleotide encoding it and a method producing the polypeptide by recombinant DNA technology. The present invention further discloses a method treating various disorders, e.g. malignant neoplasm, hematopathy, HIV infection and immunological disease and various inflammation etc. The present invention also discloses an agonist of the polypeptide and its therapeutic use. The present invention further discloses the use of the new polynucleotide encoding zinc finger protein 46.

Description

 Manual

 A new polypeptide-human zinc finger protein 46 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human zinc finger protein 46, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Background technique

 Transcriptional regulation of eukaryotic genes is very important for the normal expression of genes and exerts biological functions. Usually, transcriptional regulatory factors complete this process. Transcriptional regulatory factors are involved in the body to determine which tissues and developmental stages of genes begin to transcribe. If the genes encoding such proteins are mutated, not only the gene itself cannot be expressed normally, but many genes regulated by it cannot be normal. Perform transcription and expression. The regulation of gene expression by transcription factors is mainly accomplished through the combination of transcription factors with specific DNA sequences, the interaction between transcription factors, and the interaction of transcription factors with conventional transcriptional mechanisms. Based on the structural motifs, known DNA-binding proteins can be divided into two main categories: proteins containing helix-turn-helix motifs and zinc finger proteins [Kamal Chowdhury, Heidi Rohdewohld et al., Nucleic Acids Research, 1988, 16: 9995-10011].

 Zinc finger proteins are members of multiple gene families encoding zinc ion-mediated nucleotide binding proteins. Zinc finger proteins can be divided into various families according to their structural characteristics. Various types of zinc finger proteins have been isolated from various organisms such as yeast, fruit fly, rat and human. The Drosophila Kruppel gene is similar to the zinc finger protein, which has the most extensive distribution and has important biological functions in the body. These genes all contain the characteristic continuous repeats of the zinc finger protein, the C2-H2 zinc finger protein domain. Studies have found that these proteins are related to the transcriptional activation and suppression of genes, and abnormal expression of these proteins will cause various developmental disorders, the occurrence of various tumors, various genetic diseases and immune system diseases [Kamal Chowdhury, Heidi Rohdewohld et al., Nucleic Acids Research, 1988, 16: 9995-10011].

All members of the zinc finger protein Kruppel family contain conserved finger repeats (F / Y) XCXXCXXXFXXXXXLXXHXXXHTGEKP of 28-30 amino acids long, some of which have highly conserved amino acid residues. This sequence contains multiple copies in many different zinc finger proteins. The number of copies is different (the number of zinc fingers is different) and the function is also different. The binding of zinc finger proteins to DNA of different lengths depends on the number of finger structures. Finger structure may be related to the binding stability of the complex, which is the site of RNA polymerase transcription. Studies have found that the zinc finger domain interconnect region of many zinc finger proteins is also highly conserved. This region usually contains the following sequences: His-Thr-Giy- Gly- Lys-Pro- (Tyr, Phe) -X-Cys, in which histidine and cysteine are binding sites for metal ions, and X is a variable amino acid residue. This region is necessary for the formation of zinc finger structures. The number of finger structures will directly affect the binding of zinc finger proteins to DM of different lengths, and the multi-finger structure is related to the binding stability of the complex [Jeremy M. Berg, Annu. Rev. Biophys. Chem, 1990, 19: 405-421].

 In 1991, Rosati M and others cloned several members of the human structurally related zinc finger protein subfamily. The members of the subfamily contained a Kruppel zinc finger motif at the C-terminus, and two conserved N-terminus Amino acid patterns, namely FPB-A and FPB-B. Among them, FPB-B is present in all family members, while FPB-A is present in some members and not in some members. These two structural patterns are formed during the selective splicing of precursor mRNA [Rosati M., Marino M et al., 1991, Nucleic Acids Res, 19: 5661-5667].

 The new human zinc finger protein of the present invention is 55% identical and 68% similar to the known human zinc finger protein 41 at the protein level. Moreover, the amino acid sequences of both contain the characteristic continuous finger repeats of the human zinc finger protein Kruppel family and the structurally connected regions of the fingers. Therefore, the novel human zinc finger protein of the present invention is similar to human zinc finger protein 41, is also a member of the human zinc finger protein Kruppel family, and has similar biological functions. It is used in the body to diagnose and treat various related malignancies, cancers, development, and metabolic disorders.

 As mentioned above, the human zinc finger protein 46 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so it has been necessary to identify more involved in these processes Human zinc finger protein 46 protein, especially the amino acid sequence of this protein is identified. Isolation of the new zinc finger protein 46 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding for DM. Disclosure of invention

 It is an object of the present invention to provide an isolated novel polypeptide, human zinc finger protein 46, and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human zinc finger protein 46.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human zinc finger protein 46.

 Another object of the present invention is to provide a method for producing human zinc finger protein 46.

Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human zinc finger protein 46. Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human zinc finger protein 46.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human zinc finger protein 46.

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID D. 2;

(b) a polynucleotide complementary to the polynucleotide ( _a );

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 167-1429 in SEQ ID NO: 1; and (b) a sequence having 1-3703 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human zinc finger protein 46 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human zinc finger protein 46 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease, or other diseases caused by abnormal expression of human zinc finger protein 46.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Class Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with human zinc finger protein 46, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human zinc finger protein 46.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human zinc finger protein 46 when combined with human zinc finger protein 46. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human zinc finger protein 46.

 "Regulation" refers to a change in the function of human zinc finger protein 46, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human zinc finger protein 46.

 "Substantially pure" means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify human zinc finger protein 46 using standard protein purification techniques. Substantially pure human zinc finger protein 46 produces a single main band on a non-reducing polyacrylamide gel. The purity of human zinc finger protein 46 can be analyzed by amino acid sequence.

"Complementary" or "complementary" refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "CT-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands The efficiency and strength of inter-strand hybridization have a significant effect.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences be combined with each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method compares groups of sequences by checking the distance between all pairs. Arranged into clusters. Then the clusters are assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B

 X 100 The number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or using methods known in the art such as: Totun Hein to determine the percent identity between nucleic acid sequences ( Hein J., (1990) Methods in emzumology 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence. "Antisense strand" means

"Sense strand" A complementary nucleic acid strand.

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.

"Antibody" means a complete antibody molecule and its fragments, such as Fa,? (') ₂ and? , Which can be specific An epitope that binds human zinc finger protein 46.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and peptides in the natural state of living cells are not isolated and purified, but the same polynucleotides or peptides are separated and purified if they are separated from other substances existing in the natural state. .

 As used herein, "isolated human zinc finger protein 46" means that human zinc finger protein 46 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human zinc finger protein 46 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human zinc finger protein 46 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human zinc finger protein 46, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or exclude the starting methionine residue.

The invention also includes fragments, derivatives and analogs of human zinc finger protein 46. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the human zinc finger protein 46 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (in) such One, wherein the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such one, wherein Polypeptide sequences resulting from the fusion of additional amino acid sequences into mature polypeptides (such as leader sequences or secreted sequences or sequences used to purify this polypeptide or proteinogen sequences) As explained herein, such fragments, derivatives and analogs are considered It is within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 3703 bases, and its open reading frame (78-1655) encodes 420 amino acids. According to amino acid sequence homology comparison, it is found that this polypeptide is 55% identical to human zinc finger protein 41. It can be inferred that the human zinc finger protein 46 has a similar structure and function to human zinc finger protein 41.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 Γ; or (2) hybridization When adding denaturants, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 And active.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human zinc finger protein 46.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human zinc finger protein 46 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate fflRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human zinc finger protein 46 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the method (4), the protein product of human zinc finger protein 46 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

Amplification of DNA / RNA by PCR (Saiki, et al. Science 1985; 230: 1350-1354) are preferred for obtaining the genes of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-cMA terminal rapid amplification method) can be preferably used, and the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger e t al. PNAS, 1977, 74: 546 3- 5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human zinc finger protein 46 coding sequence, and a method for producing a polypeptide according to the present invention by recombinant technology.

 In the present invention, a polynucleotide sequence encoding human zinc finger protein 46 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, etal. Gene, 1987, 56: 125) expressed in bacteria; MSXND expression vectors (Lee) expressed in mammalian cells and Na thans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human zinc finger protein 46 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mo l ecul ar Cl on ing, a Labora tory Manua l, co ld Spr ing Harbor Laborat ory. New York, 1989) . The DNA sequence 歹 ij can be effectively linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E. coli; the PL promoter of lambda phage Eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoters, retroviral LTRs, and some other known controllable genes in prokaryotic or eukaryotic cells or their Promoters expressed in viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 bases on the late side of the origin of replication Pairs of SV40 enhancers, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers. In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human zinc finger protein 46 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S 2 or Sf 9; animal cells such as CH0, COS, or Bowes s melanoma cells Wait.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after exponential growth and used. The (12 ₎ method is used, and the steps used are well known in the art. Alternatively, MgC l ₂ can be used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryote, the following can be used DNA transfection methods: calcium phosphate co-precipitation, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human zinc finger protein 46 (Scence, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding human human zinc finger protein 46 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, HPLC Analysis (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of amino acid sequence homology of human zinc finger protein 46 and human zinc finger protein 41 of the present invention. The upper sequence is human zinc finger protein 46, and the lower sequence is human zinc finger protein 41. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human zinc finger protein 46. 46kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as Sambrook et al., Molecular Cloning: The conditions described in the laboratory manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of human zinc finger protein 46

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Using QuikmRNA Isolationist

(Qiegene product) Isolate poly (A) mRNA from total RNA. 2ug poly (A) mRNA was reverse-transcribed to form cDM. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and AB I 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0638F05 was new DNA. The inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers. The results showed that the 0638F05 clone contained a full-length cDNA of 3703bp (as shown in Seq ID NO: 1), and a 1263bp open reading frame (0RF) from 167bp to 1429bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone PBS-0638F05 and the encoded protein was named human zinc finger protein 46. Example 2: Homologous search of cDNA clones

Using the sequence of the human zinc finger protein 46 of the present invention and the protein sequence encoded by the same, the Blast program is used. (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], homology search was performed in databases such as Genbank and Swissport. The gene with the highest homology to the human zinc finger protein 46 of the present invention is a known human zinc finger protein 41, and its accession number to Genbank is X60155. The protein homology results are shown in Figure 1. The two are highly homologous, with an identity of 55% and a similarity of 68%. Example 3: Cloning of a gene encoding human zinc finger protein 46 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Primerl: 5'- GATGAAGTAAAATTTATTTTTCTT -3, (SEQ ID NO: 3)

 Primer2: 5,-TGAAGAATTCGACTTAATTTAGAC -3, (SEQ ID NO: 4)

 Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Conditions for the amplification reaction: 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primer, 1 U in a reaction volume of 50 μ 1 Taq DNA polymerase (Clomech). The reaction was performed on a PE9600 DNA thermal cycler (Perk in-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, β-ac tin was set as a positive control and template blank was set as a negative control. Amplified products were purified using a kit from QI AGEN and ligated to a pCR vector using a TA cloning kit (product of Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-3703bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of human zinc finger protein 46 gene expression:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. I.e. with 4M guanidine isothiocyanate - 25mM sodium citrate, 0.2M sodium acetate _(P H4.0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water. Using 20 gRNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ^{32 Ρ-} DNA probe labeled with a- ³² P dATP by random priming method. The DNA probe used was the PCR amplified human zinc finger protein 46 coding region sequence (167bp to 1429bp) shown in FIG. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, place the filter at 1 x SSC- Wash in 0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant human zinc finger protein 46

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer3: 5'- CATGCTAGCATGCTGGAAAACTATAGTCACCTTG -3, (Seq ID No: 5) Primer4: 5'- CATGGATCCTTACTTCTCAGCATTCCTCTTCTTTTTT -3, (Seq ID No: 6) These two primers contain Nhel and BamHI restriction sites, respectively. The coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively. The Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. The pBS-0638F05 plasmid containing the full-length target gene was used as a template for the PCR reaction. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS-0638F05 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, 25 cycles in total. Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed with colibacillus DH5cx by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 μg / ml), positive clones were selected by colony PCR method and sequenced. Selected positive clones with the correct sequence (pET- 0638F05) the recombinant plasmid by the calcium chloride method to transform E. coli BL21 (DE3) _P lySs (Novagen Co.). In LB liquid medium containing kanamycin (final concentration 30 μg / ml), the host strain BL21 (pET-0638F05) was cultured at 37 ′ to the logarithmic growth phase, IPTG was added to a final concentration of 1 mmol / L, and continued Incubate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by ultrasonication. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). Purified the target protein human zinc finger protein 46. After SDS-PAGE electrophoresis, a single band was obtained at 46 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-human zinc finger protein 46 antibody

 A peptide synthesizer (product of PE company) was used to synthesize the following human zinc finger protein 46-specific peptides:

NH ₂ -Met-Leu-Glu-Asn-Tyr-Ser-His-Leu-Val-Ser-Val-Gly-Tyr-His-Val-COOH (SEQ ID NO: 7).

The polypeptide is coupled to hemocyanin and bovine blood albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Immunize rabbits with ½ g of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, use hemocyanin peptide complex plus incomplete Freund's adjuvant Boost your immunity once. A 15 g / ml bovine serum albumin peptide complex-coated titer plate was used as the ELI SA to determine the antibody titer in rabbit serum. Total AgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharos e4B column, and the anti-peptide antibody was separated from the total I gG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human zinc finger protein 46. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.

 The members of the zinc finger protein family are numerous and widely distributed in organisms, most of which are eukaryotic transcription regulators, which are responsible for activating or inhibiting the expression of various genes in eukaryotes. Studies have found that members of this family are expressed in various human tissues, including hematopoietic cells, brain, nervous system, epidermal tissue, various tissues related to secretion and absorption, and tumor and immortal cell lines. Organization, etc. Therefore, members of this family play a very important role in the differentiation and development of various tissues in the body. They can effectively control the transcription levels of various genes in the body, and their abnormal expression may lead to abnormal differentiation and proliferation of cells, thereby causing various diseases, such as cancer and various immune system diseases.

 In particular, with regard to the novel human zinc finger protein of the present invention, the polypeptide and fragments or derivatives thereof can be used to prevent and treat various diseases caused by abnormal expression, differentiation and proliferation of cells. These diseases include but are not limited to the following: cancers of various cells and tissues, including leukemia, lymphoma, lymphosarcoma, myeloma, neuroma, glioma, meningiomas, neurofibromas, and astrocytomas; And diseases of various tissues and organs, including adrenal, thyroid, lung, pancreas, liver, prostate, uterus, bladder, kidney, testis, and gastrointestinal tract (small intestine, colon, rectum, and stomach); also include some related to metabolic disorders Diseases include diseases such as hyperthyroidism, hypothyroidism, gastritis, colon polyps, and gastroduodenal ulcers.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human zinc finger protein 46. Agonists enhance human zinc finger protein 46 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human zinc finger protein 46 can be cultured with labeled human zinc finger protein 46 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human zinc finger protein 46 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human zinc finger protein 46 can bind to human zinc finger protein 46 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

When screening compounds as antagonists, human zinc finger protein 46 can be added to bioanalytical assays, Whether a compound is an antagonist is determined by measuring its effect on the interaction between human zinc finger protein 46 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human zinc finger protein 46 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human zinc finger protein 46 molecules should generally be labeled.

 The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the human zinc finger protein 46 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced by direct injection of human zinc finger protein 46 into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. . Techniques for preparing monoclonal antibodies to human zinc finger protein 46 include, but are not limited to, hybridoma technology (Kohler and Milstei n. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morris on e t a l, PNAS, 1 985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human zinc finger protein 46.

 Anti-human zinc finger protein 46 antibodies can be used in immunohistochemical techniques to detect human zinc finger protein 46 in biopsy specimens.

 Monoclonal antibodies that bind to human zinc finger protein 46 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human zinc finger protein 4 6 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human zinc finger protein 46 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to human zinc finger protein 46. Administration of an appropriate amount of antibody can stimulate or block the production or activity of human zinc finger protein 46.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human zinc finger protein 46 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays. The levels of human zinc finger protein 46 detected in the test can be used to explain the importance of human zinc finger protein 46 in various diseases and to diagnose diseases in which human zinc finger protein 46 functions.

The polypeptides of the present invention can also be used for peptide mapping, for example, the polypeptides can be physically, chemically or enzymatically Specific cleavage and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, preferably mass spectrometry. The polynucleotide encoding human zinc finger protein 46 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human zinc finger protein 46. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human zinc finger protein 46 to inhibit endogenous human zinc finger protein 46 activity. For example, a variant human zinc finger protein 46 may be a shortened human zinc finger protein 46 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human zinc finger protein 46. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human zinc finger protein 46 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding human zinc finger protein 46 can be found in the existing literature (Sambrook, eta l.). In addition, a recombinant polynucleotide encoding human zinc finger protein 46 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and nuclear domains that inhibit human zinc finger protein 46 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human zinc finger protein 46 can be used for the diagnosis of diseases related to human zinc finger protein 46. The polynucleotide encoding human zinc finger protein 46 can be used to detect the expression of human zinc finger protein 46 or the abnormal expression of human zinc finger protein 46 in a disease state. Such as encoding human zinc finger protein 46! ) NA sequence can be used to hybridize biopsy specimens to determine the expression of human zinc finger protein 46. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available. A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue. Human zinc finger protein 46 specific primers can also be used to detect the transcription products of human zinc finger protein 46 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.

Detection of mutations in the human zinc finger protein 46 gene can also be used to diagnose human zinc finger protein 46-related diseases. Person Zinc finger protein 46 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human zinc finger protein 46 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific c library.

 Fluorescent in situ hybridization (FI SH) of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus i ck, Mende l ian Inher i tance in Man (available online with Johns Hopk ins University Welch Med i cal l ibrary). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be combined with Use after suitable drug carrier combination. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptide of the present invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human zinc finger protein 46 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human zinc finger protein 46 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

(1) General information:

 (i i) Name of the invention: human zinc finger protein 46 and its coding sequence

 (i i i) sequence number: 7

(2) Information of SEQ ID NO: 1:

 (i) Sequence characteristics:

 (A) Length: 3703bp

 (B) Type: Nucleic acid

 (C) Chain: double strand

 (D) Topological structure: linear

 (Π) Molecular type: cDM

 (x i) Sequence description: SEQ ID NO: 1:

 1

 61 TGCCAAATTCAAGGGACCCGTGACATTAAAGGATGTTATTGTGGAATTCACCAAGGAAGA

 481 AAAGGGCAAATCCTATGACTGTGATAAATGTGGGAAATCTTTCTCTAAAAATGAAGACCT 601 AATATTTTACCACCTATCATCTCTCAGTAGACATCTGAGAACCCATGCAGGAGAGAGAACC

781 GAAGGCATACCTCATGGTACATCAGAAAACACACACAGGGGAGAAACCCTATGAGTGTAA

1021 ATGCTTCTACCAGAAGTCAGCCCTCACAGTACATCAGCGAACTCACACAGGGGAGAAACC 1141 GAGAAAACACACAGAGGAGAGAAGCTCTATGAATGCACAGAATGTGGCAAATCTTTTGCTGT Uli

 i9oe

III011i911Dili01I09IlIV0I1330IDVD001D0I13I133VD30311V311VDVV tOO £

 03IIOVOI0001010I31VIVVII3VI3DIV30000IV30V30IIV003300f) OIOO IO 19 L Z

imO / OOM3 / ID <I or 9Z. £ 8 £ / 10 OAV

AACATATGAAATAAACATTGTCTAAATTAAGTCGAATTGTTCA

(3) Information of SEQ ID NO: 2:

 (i) Sequence characteristics:

 (A) Length: 420 amino acids

 (B) Type: Amino acid

 (D) Topological structure: linear

 (ii) Molecular type: peptide

 (xi) Sequence description: SEQ ID NO: 2:

 Met Leu Glu Asn Tyr Ser His Leu Val Ser Val Gly Tyr His Val

Asn Lys Pro Asn Ala Val Phe Lys Leu Lys Gin Gly Lys Glu Pro

Trp lie Leu Glu Val Glu Phe Pro His Arg Gly Phe Pro Glu Asp

Leu Trp Ser He His Asp Leu Glu Ala Arg Tyr Gin Glu Ser Gin

Ala Gly Asn Ser Arg Asn Gly Glu Leu Thr Lys His Gin Lys Thr

His Thr Thr Glu Lys Ala Cys Glu Cys Lys Glu Cys Gly Lys Phe

Phe Cys Gin Lys Ser Ala Leu lie Val His Gin His Thr His Ser

Lys Gly Lys Ser Tyr Asp Cys Asp Lys Cys Gly Lys Ser Phe Ser

Lys Asn Glu Asp Leu lie Arg His Gin Lys lie His Thr Arg Asp Lys Thr Tyr Glu Cys Lys Glu Cys Lys Lys lie Phe Tyr His Leu

Ser Ser Leu Ser Arg His Leu Arg Thr His Ala Gly Glu Lys Pro Tyr Glu Cys Asn Gin Cys Glu Lys Ser Phe Tyr Gin Lys Pro His

Leu Thr Glu His Gin Lys Thr His Thr Gly Glu Lys Pro Phe Glu Cys Thr Glu Cys Gly Lys Phe Phe Tyr Val Lys Ala Tyr Leu Met

Val His Gin Lys Thr His Thr Gly Glu Lys Pro Tyr Glu Cys Lys

Glu Cys Gly Lys Ala Phe Ser Gin Lys Ser His Leu Thr Val His 241 Gin Arg Met His Thr Gly Glu Lys Pro Tyr Lys Cys Lys Glu Cys

256 Gly Lys Phe Phe Ser Arg Asn Ser His Leu Lys Thr His Gin Arg

271 Ser His Thr Gly Glu Lys Pro Tyr Glu Cys Lys Glu Cys Arg Lys

286 Cys Phe Tyr Gin Lys Ser Ala Leu Thr Val His Gin Arg Thr His

301 Thr Gly Glu Lys Pro Phe Glu Cys Asn Lys Cys Gly Lys Thr Phe

316 Tyr Tyr Lys Ser Asp Leu Thr Lys His Gin Arg Lys His Thr Gly

331 Glu Lys Pro Tyr Glu Cys Thr Glu Cys Gly Lys Ser Phe Ala Val

346 Asn Ser Val Leu Arg Leu His Gin Arg Thr His Thr Gly Glu Lys

361 Pro Tyr Ala Cys Lys Glu Cys Gly Lys Ser Phe Ser Gin Lys Ser

376 His Phe lie lie His Gin Arg Lys His Thr Gly Glu Lys Pro Tyr

391 Glu Cys Gin Glu Cys Gly Glu Thr Phe lie Gin Lys Ser Gin Leu

406 Thr Ala His Gin Lys Thr His Thr Lys Lys Arg Asn Ala Glu Lys

(4) Information of SEQ ID NO: 3

 (i) Sequence characteristics

 (A) Length: 24 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 3:

 GATGAAGTAAAATTTATTTTTCTT

(5) Information of SEQ ID NO: 4

 (i) Sequence characteristics

 (A) Length: 24 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (ii) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 4:

TGAAGAATTCGACTTAATTTAGAC (6) Information of SEQ ID NO: 5

 (i) Sequence characteristics

 (A) Length: 32 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 5:

CAGCCATGGCGGGGAAGAAGAATGTTCTGTCG

(7) Information of SEQ ID NO: 6

 (i) Sequence characteristics

 (A) Length: 29 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 6:

CCCGGATCCCGCTGCTTGGCCTTCTTCAC

(8) Information of SEQ ID NO: 7:

 (i) Sequence characteristics:

 (A) Length: 15 amino acids

 (B) Type: Amino acid

 (D) Topological structure: linear

 (ii) Molecular type: peptide

 (xi) Sequence description: SEQ ID NO: 7:

 Met-Ala-Gly-Lys-Lys-Asn-Va 1-Leu-Ser-Ser-Leu-Ala-Va 1-Tyr-Ala

Claims

Claim

1. An isolated polypeptide-human zinc finger protein 46, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

(b) a polynucleotide complementary to the polynucleotide ( _a ); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence at positions 167-1429 in SEQ ID NO: 1 or a sequence at positions 1-3703 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having human zinc finger protein 46 activity, characterized in that the method includes:

(a) culturing the engineered host cell of claim 8 under the condition of expressing human zinc finger protein 46;

(b) Isolating a polypeptide having human zinc finger protein 46 activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human zinc finger protein 40.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human zinc finger protein 46.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. An application of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human zinc finger protein 46 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human zinc finger protein 46; or for peptide fingerprinting Atlas identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human zinc finger protein 46 abnormality.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.