WO2001038365A1 - A novel polypeptide-zinc finger protein 79 and the polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new kind of polypeptide-zinc finger protein 79 and the polynucleotide encoding said polypeptide and a process for producing the polypeptide by recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of diseases, such as cancer, hemopathy, HIV infection, immune diseases and inflammation. The antagonist of the polypeptide and therapeutic use of the same is also disclosed. In addition, it refers to the use of polynucleotide encoding said zinc finger protein 79.

Description

 Explanation book

 A new peptide, zinc finger protein 79 and polynucleotides encoding this polypeptide

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a zinc finger protein 79, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Background technique

 Transcriptional regulation of eukaryotic genes is very important for the normal expression of genes and exerts biological functions. Usually, transcriptional regulatory factors complete this process. Transcriptional regulatory factors are involved in the body to determine which tissues and developmental stages of genes begin to transcribe. If the genes encoding such proteins are mutated, not only the gene itself cannot be expressed normally, but many genes regulated by it cannot be normal. Perform transcription and expression. The regulation of gene expression by transcription factors is mainly accomplished through the combination of transcription factors with specific DNA sequences, the interaction between transcription factors, and the interaction of transcription factors with conventional transcriptional mechanisms. Based on the structural motifs, known DNA-binding proteins can be divided into two main categories: proteins containing helix-turn-helix motifs and zinc finger proteins [Kama l Chowdhury, Heid i Rohdewohld et a l., Nuc le ic Ac ids Research, 1988, 16: 9995-10011].

 Zinc finger proteins are members of multiple gene families encoding zinc ion-mediated nucleotide binding proteins. Zinc finger proteins can be divided into various families according to their structural characteristics. Various types of zinc finger proteins have been isolated from various organisms such as yeast, fruit fly, rat and human. The Drosophila Kruppe l gene is similar to the zinc finger protein, and it has the most important biological function in the body. These genes all contain the characteristic continuous repeats of the zinc finger protein, the C2-H2 zinc finger protein domain. Studies have found that these proteins are related to the activation and suppression of gene transcription. Abnormal expression of these proteins will cause various developmental disorders, the development of various tumors, various genetic diseases and immune system diseases [Kama l Chowdhury, He id i Rohdewohld et a l., Nucleic Ac ids Research, 1988, 16: 9995-10011].

All members of the zinc finger protein Kruppe l family contain a conserved finger repeat (F / Y) XCXXCXXXFXXXXXLXXHXXXHTGE P of 28-30 amino acids in length, and some of the specific amino acid residue sites are highly conserved. This sequence contains multiple copies in many different zinc finger proteins, with different copy numbers (different number of zinc fingers) and different functions. The binding of zinc finger protein to DNA of different lengths depends on the number of finger structures. The multi-finger structure may be related to the binding stability of the complex, which is the site of RNA polymerase transcription. Studies have found that the zinc finger domain interconnected regions of many zinc finger proteins are also highly conserved. This region usually contains the following sequences: H i s- Thr- G ly- G ly- Lys- Pro- (Tyr, Phe) -X-Cys, in which histidine and cysteine are binding sites for metal ions, and X is a variable amino acid residue. This region is necessary for the formation of zinc finger structures. The number of finger structures will directly affect the binding of zinc finger proteins to DNA of different lengths, and the multi-finger structure is related to the binding stability of the complex [Jeremy M. Berg, Annu. Rev. Biophys. Chem, 1990, 19: 405-421].

 Human T-cell leukemia virus I (HTLV-l) is a pathogen of mature T-cell leukemia, which can cause typical spastic paraplegia [Hinuma, Y. etal., Proc. Natl. Acad. Sci. USA, 1981, 78: 6476 -6480] [Poiesz, B. eta 1., Nature, 1981, 294, 268- 271] [0same, M. etal., Lancer, 1985, 1031]. HTLV-1 regulates its 5-terminal long repeat (LTR) expression by the host's nuclear factor. The LTR contains three areas, one of which is called the U5RE area. This region can bind to a protein called HUB1, which can inhibit the expression of LTR at the transcriptional level [Koichi, 0. et al., Nucleic Acids Res, 1997, 25 (24): 5025-5032].

 HUB1 has 671 amino acid residues, including five finger domains of zinc finger proteins, and a Kruppel-like box (KRAB) domain. The zinc finger structure of HUB1 is located between the 518th amino acid and 657 amino acid at the C-terminus. This zinc finger protein belongs to the inhibitory protein in the Kruppel family type mentioned above and is a new member of the Kruppel family. The KRAN domain of HUB1 is located between amino acids 196 and 261, and is rich in charged nuclear amino acids, most of which are located near the N-terminus near the Kruppel zinc finger structure and the start site for regulating transcriptional repression [Bellefroid, EJ et al., DNA, 1989, 8: 377-387]. The Kruppel-like box domain of Xing 1 belongs to type A in KRAB: proline rich between 32-75 and 403-443, leucine rich between 98-185, and glycine rich between 470-503.

 The binding core motif sequence of HUB1 and U5RE is TCCACCCC ;. For HUB1 as a whole, amino acids at the N-terminus of 1-75 are necessary for its inhibitory function, and amino acids 74-184 are the inhibitory domains of HUB1. The leucine-rich region of the inhibitory domain plays a crucial role in protein-protein interactions.

 The polypeptide of the present inventor has 60% identity and 75% homology with HUB1 at the protein level, and has a similar domain, so it is named zinc finger protein 79, and it is speculated that it has similar biological functions.

As the zinc finger protein 79 protein plays an important role in important body functions as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more zinc finger protein 79 proteins involved in these processes, especially The amino acid sequence of this protein was identified. The isolation of the new zinc finger protein 79 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important. Disclosure of invention It is an object of the present invention to provide an isolated novel polypeptide, zinc finger protein 79, and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a zinc finger protein 79. Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a zinc finger protein 79.

 Another object of the present invention is to provide a method for producing zinc finger protein 79.

 Another object of the present invention is to provide an antibody against the polypeptide-zinc finger protein 79 of the present invention. Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the polypeptide-zinc finger protein 79 of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of zinc finger protein 79.

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID D. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (0) A polynucleotide whose polynucleotide sequence is at least 70% identical to (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1 76-1 591 in SEQ ID NO: 1; and (b) a sequence having 1 in SEQ ID NO: 1 -2039 sequence.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the zinc finger protein 79 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of zinc finger protein 79 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a mutation in a biological sample The amount or biological activity of a polypeptide of the invention.

The present invention also relates to a pharmaceutical composition, which contains the polypeptide of the present invention or a mimic, activator, antagonist Antibiotics or inhibitors and pharmaceutically acceptable carriers.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of zinc finger egg 79.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

 The following terms used in this specification and claims have the following meanings unless specifically stated otherwise:

 "Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with zinc finger protein 79, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind zinc finger protein 79.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with zinc finger protein 79, can block or regulate the biological or immunological activity of zinc finger protein 79. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind zinc finger protein 79.

"Regulation" refers to a change in the function of zinc finger protein 79, including an increase or decrease in protein activity, Changes in binding properties and any other biological, functional or immune properties of zinc finger protein 79.

 "Substantially pure '" means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify zinc finger protein 79 using standard protein purification techniques. Essentially pure Zinc finger protein 79 can generate a single main band on non-reducing polyacrylamide gel. The purity of zinc finger protein 79 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions with reduced stringency allow non-specific binding, because the conditions with reduced stringency require the binding of two sequences to each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALI GN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences (Higgins, D. G., and P. M. Sharp (1988) Gene 73: 237-244) according to different methods such as the Cluster method. The C l uster method arranges each group of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:

 Number of matching residues between sequence A and sequence B

 X 100 Number of residues in sequence A-number of spacer residues in sequence A-number of spacer residues in sequence B

The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in emzumo logy 183: 625-645). "Similarity "Refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in alignment between amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; Positively charged amino acids can include lysine and arginine; amino acids with similarly charged head groups that have similar hydrophilicity can include leucine, isoleucine, and valine; glycine And alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? It can specifically bind to the epitope of zinc finger protein 79.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated zinc finger protein 79" means that zinc finger protein 79 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify zinc finger protein 79 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the zinc finger protein 79 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, zinc finger protein 79, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptide of the present invention may be a naturally purified product, or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, nymphs, and mammalian cells) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

The invention also includes fragments, derivatives and analogs of zinc finger protein 79. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the zinc finger protein 79 of the present invention. A fragment, derivative or analog of the polypeptide of the invention may be: U) In such a way, one or more amino acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon; or (Π ) A type in which a group on one or more amino acid residues is substituted with another group to include a substituent; or (III) a type in which a mature polypeptide is mixed with another compound

(Such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol) or UV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or used to purify the polypeptide) Sequences or protease sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2039 bases, and its open reading frame (176-1591) encodes 471 amino acids. Based on the amino acid sequence homology comparison, it was found that this peptide has 60 »/ with HUB1. Homology, it can be deduced that the zinc finger protein 79 has similar structure and function of HUB1.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to the present invention under strict conditions. The polynucleotide is a polynucleotide that can hybridize. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0. iy »SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° / ° F i co ll, 42 ° C, etc .; or (3) only in two Hybridization occurs only when the sequence identity is at least 95%, and more preferably 97%, and the polypeptide encoded by the hybridizable polynucleotide has the same biology as the mature polypeptide shown in SEQ ID NO: Function and activity.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding zinc finger protein 79.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the zinc finger protein 79 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been developed for mRNA extraction, and kits are also commercially available (Q i agene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecule Cloning, A Labora tory Manua, Collspring Harbor Labora tory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of zinc finger protein 79 transcripts; (4) passing Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probes used here are usually the gene sequence information of the present invention Based on chemically synthesized DNA sequences. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of the zinc finger protein 79 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method of applying a PCR technique to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) may be preferably used. The primers used for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using the zinc finger protein 79 coding sequence, and a method for producing a polypeptide according to the present invention by recombinant technology.

 In the present invention, the polynucleotide sequence encoding the zinc finger protein 79 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; MSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding zinc finger protein 79 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence 歹 'J can be effectively linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the _PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters , Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a zinc finger protein 79 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or S f 9; animal cells such as CH0, COS or Bowes melanoma cells, etc. .

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaC I. The steps used are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant zinc finger protein 79 (Scence, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding human zinc finger protein 79 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cell has grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction). The cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief explanation of attached picture

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Fig. 1 is a comparison diagram of amino acid sequence homology of zinc finger protein 79 and HUB1 of the present invention. The upper sequence is zinc finger protein 79 and the lower sequence is HUB1. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated zinc finger protein 79. 79kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally in accordance with the general conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spr ing Harbor Labora tory Pres s, 1989) , Or as recommended by the manufacturer.

 Example 1: Cloning of zinc finger protein 79

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isola t ion Kit (a product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. A Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5 cc. The bacteria formed a cDNA library. Dye termina te cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0847h09 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the full-length cDNA contained in the 0847h09 clone was 2039bp (such as Seq ID NO: 1 (Shown), from 176bp to 1591bp there is a 1415bp open reading frame (0RF), which encodes a new protein (as shown in Seq ID N0: 2). We named this clone pBS-0847h09, and the encoded protein was named zinc finger protein 79. Example 2: Homologous search of cDNA clones

 The sequence of the zinc finger protein 79 of the present invention and the protein sequence encoded by the zinc finger protein 79 were coded using the Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10] in Genbank , Swissport and other databases for homology search. The gene with the highest homology to the zinc finger protein 79 of the present invention is a known HUB1, and its encoded protein has the accession number D30612 in Genbank. The results of the protein homologue are shown in Figure 1, and the two are highly homologous, with an identity of 60% and a similarity of 75%. Example 3: Cloning of a gene encoding zinc finger protein 79 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:

 Primerl: 5'- GGAGAACTTGGAGAACCTGCTGCG -3 '(SEQ ID NO: 3)

 Primer2: 5'- TATCAAAGAACTAATAAAAGGCTT -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 mmol / L KC1, 10 mmol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primers in a 50 μ 1 reaction volume, 1U of Taq DNA polymerase (C 1 on te ch). The reaction was performed on a PE 9600 DNA thermal cycler (PerkinElmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen product). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-2023bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of zinc finger protein 79 gene expression:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. The cx- ³² P dATP was used to prepare labeled DNA probes by random primers. The DNA probe used was the PCR-amplified zinc finger protein 79 coding region sequence (176bp to 1591bp) shown in Figure 1. The 32P-labeled probe (about 2 X 10 ⁶ cpm / ml) and the RNA-transferred The nitrocellulose membrane was hybridized overnight at 42 ° C in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH 7.4) -5 χ SSC-5 χ Denhardt's solution and 200 μ _§ / ηι1 salmon essence DNA. After hybridization, the filter was washed in 1 x SSC-0.1 ° /. SDS at 55 ° (: 30 min.), And then analyzed and quantified using a Phosphor Imager. Example 5: In vitro of recombinant zinc finger protein 79 Expression, isolation and purification

 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed. The sequences are as follows:

 Primer3: 5,-CCCCATATGATGAAGGGCAACTACGAGTCTCTC -3, (Seq ID No: 5) Primer 4: 5,-CCCGAATTCTTACAAAACTCCCCCTCCACTCCC -3, (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and EcoRI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively. The Ndel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. PCR was performed using the pBS-0847h09 plasmid containing the full-length target gene as a template. The PCR reaction conditions are as follows: a total volume of 50 μ1 containing pBS- 0847h09 plasmid 10 pg, primers Primer-3 and Primer are separated separately; j is lOpmol, Advantage polymerase Mix

(Clontech) 1 μ1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, 25 cycles. Nde I and EcoR I were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into Ca. bacillus DH5CC by the calcium chloride method.

After the LB plate (final concentration 30 _g / ml) was cultured overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0847h09) with the correct sequence was selected, and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) plySs (product of Novagen) by the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 g / ml), the host strain BL21. (PET-0847h09) was at 37. C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue incubating for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). Purified the target protein zinc finger protein 79. After SDS-PAGE electrophoresis, a single band was obtained at 79 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of Anti-Zinc Finger Protein 79 Antibody

A peptide synthesizer (product of PE company) was used to synthesize the following zinc finger protein 79-specific peptides: NH ₂ -Met-Lys-G 1 y-Asn-Tyr-G 1 u- Ser- Leu- 1 1 e-Ser-Me t-Asp-Tyr-A 1 a- Π e-COOH (SEQ ID NO: 7 ). The peptide was coupled with hemocyanin and bovine serum albumin to form a complex. For the method, please refer to: Avrameas, et al. Iramunochemi s try, 1969; 6: 43 „Use 4mg of the hemocyanin peptide complex plus complete Freund's The rabbits were immunized with the drug, and then boosted with hemocyanin-polypeptide complex and incomplete Freund's adjuvant 15 days later. Titer of antibody in serum. Total IgG was isolated from antibody-positive home serum using protein A-Sepharose. Peptide was bound to a cyanogen bromide-activated Se _P har ₀ se4B column and affinity chromatography was performed from total I Anti-peptide antibody was isolated from gG. The immunoprecipitation method proved that the purified antibody could specifically bind to zinc finger protein 79. Example 7: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same basic hybridization method after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides; 2. The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecule region is greater than 85% or there are more than 1 consecutive bases, then the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe l (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5 '-GGGCAACTACGAGTCTCTCATCTCCATGGATTATGCTATAA-3' {SEQ ID NO: 8] Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5 '-GGGATCGACGAGTCTCTCATATCGATGGATTAGTATCGTAA-3' {SEQ ID NO: 9] For other commonly used reagents not listed in the following specific experimental procedures and their preparation methods, please refer to the literature: DNA PROBES GH Keller; MM Manak; Stockton Press, 1989 ( USA) and more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1. DNA extraction from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Use cold homogenate buffer (0.25mol / L sucrose; 25 ol / L Tris-HCl, pH7.5; 25mmol / LnaCl; 25mmol / L MgCl ₂ ) to suspend the precipitate (about 10ml / g) ₀ 4) in 4 "C Use an electric homogenizer to homogenize the tissue suspension at full speed until the tissue is completely broken. 5) Centrifuge at 1,000 g for 10 minutes. 6) Resuspend the cell pellet (1-5 ml per 0.1 g of the original tissue sample), Centrifuge at 1000g for another 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1mi per 0.1 g of the initial tissue sample), and then follow the following phenol extraction method.

 2. DM extraction of phenol

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x 10 ⁸ cells / ml) with a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

 3. DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1-5 X 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 _μg / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, mix well and set to _20. C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° (:) after packing.

 Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe in order to follow the experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), and dry in 0.5 mol / L Tris-HCl ( _P H7.0), 3 mol / L NaCl Leave on filter paper for 5 minutes (twice) and dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3μl Probe (0. IOD / Ιθμ 1), add 2 μ IKinase buffer, 8-10 uCi γ- "P- dATP + 2U Kinase to make up to a final volume of 20 μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Start collecting the first peak before ³² P-Probe washes out (can be monitored by Monitor;).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

 8) After the collection of the first peak is combined, the P-Probe (the second peak is free γ--dATP) is prepared.

 Pre-hybridization

 Place the sample membrane in a plastic bag, add 3- lOmg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA).), Seal the bag, 68. C water bath for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1 SDS, 40. C wash for 15 minutes (twice).

 4) 0.1xSSC, 0.1% SDS, wash at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 4) In 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray autoradiography:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot). Experimental results:

The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above four probe hybrid spots; whereas the hybridization experiments performed under low-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger. To the radioactivity of the hybridization spots of the other three probes. Therefore probe 1 can be used to characterize and characterize Quantitative analysis of the presence and differential expression of the polynucleotides of the present invention in different tissues. Industrial applicability

 The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, H IV infection, and immune diseases.

 The polypeptide of the present invention and its antagonists, agonists and inhibitors can be directly used in the treatment of diseases, for example, it can treat various malignant tumors and cancers; development disorders, various diseases caused by metabolic disorders of the immune system, and the like.

 The members of the zinc finger protein family are numerous and widely distributed in organisms, most of which are eukaryotic transcription regulators, which are responsible for activating or inhibiting the expression of various genes in eukaryotes. Studies have found that members of this family are expressed in various human tissues, including hematopoietic cells, brain, nervous system, epidermal tissue, various tissues related to secretion and absorption, and tumor and immortal cell lines. Organization, etc. Therefore, members of this family play a very important role in the differentiation and development of various tissues in the body. They can effectively control the transcription levels of various genes in the body, and their abnormal expression may lead to abnormal differentiation and proliferation of cells, thereby causing various diseases, such as cancer and various immune system diseases.

 In particular, with regard to zinc finger protein 79, the polypeptide or fragment or derivative thereof of the present invention can be used to prevent and treat various diseases caused by abnormal expression, differentiation and proliferation of cells. These diseases include but are not limited to the following: Cancers of various cells and tissues, including acute leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, chronic monocytic leukemia, lymphoma, lymphosarcoma, myeloma, neuroma , Glioma, meningiomas, neurofibromas, and astrocytomas; and diseases of various tissues and organs, including adrenal gland, thyroid, lung, pancreas, liver, prostate, uterus, bladder, kidney, testis and stomach Intestine (small intestine, colon, rectum and stomach); also includes some diseases related to metabolic disorders, including diseases such as hyperthyroidism, hypothyroidism, gastritis, colon polyps, gastroduodenal ulcers and other diseases.

 Abnormal expression of zinc finger protein 79 may also cause a variety of acquired and hereditary diseases and diseases caused by the metabolic disorder of the immune system, such as: split-hand, congenital reproductive tract malformations, Bezier syndrome and other diseases.

The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) zinc finger protein 7. Agonists increase biological functions such as zinc finger protein 79 stimulating cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or a membrane preparation expressing zinc finger protein 79 can be cultured with labeled zinc finger protein 79 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined. Antagonists of zinc finger protein 79 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of zinc finger protein 79 can bind to zinc finger protein 79 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

 When screening compounds as antagonists, zinc finger protein 79 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between zinc finger protein 79 and its receptor. In the same manner as described above for screening compounds, receptor deletions and analogs that act as antagonists can be screened. Polypeptide molecules capable of binding to zinc finger protein 79 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the zinc finger protein 79 molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the zinc finger protein 79 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by injecting zinc finger protein 79 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies against zinc finger protein 79 include, but are not limited to, hybridoma technology (Koh le _r and Milstei n. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morris on etal, PNAS, 1985, 81: 685 1). The existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against zinc finger protein 79.

 Antibodies to Zinc Finger Protein 79 can be used in immunohistochemistry to detect zinc finger protein 79 in biopsy specimens.

 Monoclonal antibodies that bind to zinc finger protein 79 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, zinc finger protein 79 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP, and toxins are bound to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill zinc finger protein 79-positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to zinc finger protein 79. Administration of an appropriate amount of antibody can stimulate or block the production or activity of zinc finger protein 79.

The invention also relates to a diagnostic test method for quantitative and localized detection of zinc finger protein 79 levels. These tests It is well known in the art and includes FI SH assays and radioimmunoassays. The level of zinc finger protein 79 detected in the test can be used to explain the importance of zinc finger protein 79 in various diseases and to diagnose diseases where zinc finger protein 79 functions.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding zinc finger protein 79 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism caused by the absence or abnormal / inactive expression of zinc finger protein 79. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated zinc finger protein 79 to inhibit endogenous zinc finger protein 79 activity. For example, a variant zinc finger protein 79 may be a shortened zinc finger protein 79 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signal transduction activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of zinc finger protein 79. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a zinc finger protein 79 into a cell. Methods for constructing a recombinant viral vector carrying a polynucleotide encoding a zinc finger protein 79 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding zinc finger protein 79 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit zinc finger protein 79 mRNA are also within the scope of this invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.

Polynucleotides encoding zinc finger protein 79 are useful in the diagnosis of diseases related to zinc finger protein 79. A polynucleotide encoding zinc finger protein 79 can be used to detect the expression of zinc finger protein 79 or the abnormal expression of zinc finger protein 79 in a disease state. For example, the DNA sequence encoding zinc finger protein 79 can be used to hybridize biopsy specimens to determine the expression of zinc finger protein 79. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These technologies and methods are all mature and open technologies. Kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue. Zinc finger protein 79 specific primers can also be used to detect zinc finger protein 79 transcription products by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.

 Detection of mutations in the zinc finger protein 79 gene can also be used to diagnose zinc finger protein 79-related diseases. Zinc finger protein 79 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type zinc finger protein 79 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequences can be located on chromosomes. These primers are then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergaraon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in CDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for staining Structural changes in the body, such as deletions or translocations that are visible from the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase Figure resolution and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Zinc finger protein 7 9 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dosage range of zinc finger protein 7 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

List

 (1) General information:

(i i) Name of the invention: Zinc finger protein 79 and its coding sequence

 (i i i) Number of sequences: 9

(2) Information of SEQ ID NO: 1:

 (i) Sequence characteristics:

 (A) Length: 2039bp

 (B) Type: Nucleic acid

 (C) Chain: double strand

 (D) Topological structure: linear

 (i i) Molecular type: cDNA

 (x i) Sequence description: SEQ I D NO: 1:

GGAGAACTTGGAGAACCTGCTGCGCAACAGGAACTTCTGGATCCTGCGGCTCCCTCCAGG TATTAAGGGAGATATCCCAAAGGTGCCTGTGGCATTTGATGATGTCTCCATCTGATCGAGATCGAGATCAC

TTCAGATGTGGCTTTCAAAAGCCAGCAGTCTACATCCATGACACCTTTTGGACGTCCAGC CACTGACCTGCCTGAAGCCTCTGAGGGACAAGTGACTTTTACTCAGTTGGGTAGCTATCC CCTCCCACCTCCAGTTGGCGAGCAGGTGTTCTCATGCCACCACTGTGGCAAGAATCTCAG

CAGCGAGACACCCCCCACCACCTGCCCACACTGTGCCAGGACTTTTACTCACCCATCAAGACT TACCTACCATCTTCGGGTCCATAACAGCACTGAGCGTCCTTTCCCCTGTCCTGATTGCCC CA AGCGCTTTGCTG ACCAGGCTCGACTCACCAGCCACCGG AGAGCTCATGCAAGCG AA AG "19 • I9S" ID Old dsy 丄 «IV ^ 10 3¾d 丄 9 £ ΐ 丄 -I9S uiO • I3S Ι¾Λ dsy slid ΐ dsy sAq« IV Old Λ 90ΐ

 "10 dsy ¾1V 丄 • I3S ^ 丄 A dsy" 9 9L

OJd OJd ¾1V OJd "0" 10 "10" ID 19

■ I3S 3U dsy -im 311 OJd "ID" TO dsy ¾

^ 丄 9Π "19" ID ^ 10 ¾IV "10 dsy" 19 丄 usy ΐ £

"10" 10 911 "10 -I9S noq ΙΒΛ dsy U19 usy 91

^S li 丄: isw SS ⁵ 11 11 ΰ 1 ss "Ί0 丄" jsy ΐ

■ Z: 0Ν αΐ 0HS :? ? (ΐ ^χ )

# ^: ^ ^ 去 ^ πυ Miscellaneous ¾: Face ^ (8) Sound ¾ψι ^: m)

 : Π)

 ^ Z: 0N GI i) HS (£)

V1V0I113II9VI1V111ID00VVVIVI0VV1110IVV0V01V300VV1V3IV3D00VV 1861

001DVVVV3D103DV0VV0V0IV0V1V9V0V0V9V10DVI013101V1IV0V19V1VDI1 U6I

00VD0V3VV0V0V310110113I31I0VI3ID3VV11IV00V30VVV001100V0VD0DD Ϊ98Ϊ

11V1VV0VVDV1I0VVDVD9VVVV0VVDV1VDVVV3111131V3310IVD0V3D30V0DV 1081

VV00130V0VVV0VDD3VVV0111IVDVDDVIVVDVV3V1I330VDVDI11VV001I11D I I

I01I30IV0V0V0IIDVDV1V1DDI9900II1VV0IVV31V3VD90I31V1IV11VV10V 1891

3V300VDVV0311DD309V9191DI00VV0V0VVD3IVVVVDV3900V30VDVD1D01V1 U9I

V101ID01V3I139010ID101VVV3D1VVV101I110V99000V00I0V000VV000D1 ί 9 S I

V10019VDDVV30V0V0V1DI09VV01DVDVV31010001DD00I0I10VVD1I0000I 10Π

DVVIV3IDD33100VDDV0DDVV0D3V030VD190VDIV0DDV01DV1V01D0000101D 1 ^ 1

00V00IVV3V3300V3110D3I03V33V00VV01DVDV0VDVVV3VI303D1130V!) 0V0 ί 8Π

99IDIDVI3DIDai330DVlDD00DD0V000033V0V3DlVD9D0V0DV0VVV01VV13D IZil

V00V00VV00001V3I100V0VVD0010IDV0IDDI01I0V311DDD0DD0V0D00V3V0 19Π

V301DOOD0033V3DVV013010DVOOVOOVV30301V01130V9VVIOV30IOVOIDV3 1031

D1303DVI1331030V0D00V3V3VDDIV01V0VD0VD003D1V0130000313V03003 IHI

8Sf00 / 00ND / XDd S9 £ 8e / I0 O 151 Gly Gin Val Thr Phe Thr Gin Leu Gly Ser Tyr Pro Leu Pro Pro

166 Pro Val Gly Glu Gin Val Phe Ser Cys His His Cys Gly Lys Asn

181 Leu Ser Gin Asp Met Leu Leu Thr His Gin Cys Ser His Ala Thr

196 Glu His Pro Leu Pro Cys Ala Gin Cys Pro Lys His Phe Thr Pro

211 Gin Ala Asp Leu Ser Ser Thr Ser Gin Asp His Ala Ser Glu Thr

226 Pro Pro Thr Cys Pro His Cys Ala Arg Thr Phe Thr His Pro Ser

241 Arg Leu Thr Tyr His Leu Arg Val His Asn Ser Thr Glu Arg Pro

256 Phe Pro Cys Pro Asp Cys Pro Lys Arg Phe Ala Asp Gin Ala Arg

271 Leu Thr Ser His Arg Arg Ala His Ala Ser Glu Arg Pro Phe Arg

286 Cys Ala Gin Cys Gly Arg Ser Phe Ser Leu Lys lie Ser Leu Leu

301 Leu His Gin Arg Gly His Ala Gin Glu Arg Pro Phe Ser Cys Pro

316 Gin Cys Gly lie Asp Phe Asn Gly His Ser Ala Leu lie Arg His

331 Gin Met lie His Thr Gly Glu Arg Pro Tyr Pro Cys Thr Asp Cys

346 Ser Lys Ser Phe Met Arg Lys Glu His Leu Leu Asn His Arg Arg

361 Leu His Thr Gly Glu Arg Pro Phe Ser Cys Pro His Cys Gly Lys

376 Ser Phe lie Arg Lys His His Leu Met Lys His Gin Arg lie His

391 Thr Gly Glu Arg Pro Tyr Pro Cys Ser Tyr Cys Gly Arg Ser Phe

406 Arg Tyr Lys Gin Thr Leu Lys Asp His Leu Arg Ser Gly His Asn

421 Gly Gly Cys Gly Gly Asp Ser Asp Pro Ser Gly Gin Pro Pro Asn

436 Pro Pro Gly Pro Leu lie Thr Gly Leu Glu Thr Ser Gly Leu Gly

451 Val Asn Thr Glu Gly Leu Glu Thr Asn Gin Trp Tyr Gly Glu Gly

466 Ser Gly Gly Gly Val Leu

 (4) Letter from SEQ ID NO: 3,

 (i) Sequence characteristics

 (A) Length: 24 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 i) Sequence description: SEQ ID NO: 3:

 GGAGAACTTGGAGAACCTGCTGCG 24 (5) SEQ ID NO: 4

(i) Sequence characteristics (A) Length: 24 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 4:

 TATCAAAGAACTAATAAAAGGCTT

(6) Information of SEQ ID NO: 5

 (i) Sequence characteristics

 (A) Length: 32 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 5:

 CAGCCATGGCGGGGAAGAAGAATGTTCTGTCG 32

(7) Information of SEQ ID NO: 6

 (i) Sequence characteristics

 (A) Length: 29 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 6

CCCGGATCCCGCTGCTTGGCCTTCTTCAC

(8) Information of SEQ ID NO: 7:

 (i) Sequence characteristics:

 (A) Length: 15 amino acids

 (B) Type: Amino acid

(D) Topological structure: linear (ii) Molecular type: peptide

 (xi) Sequence description: SEQ ID NO: 7:

Met-Ala-Gly-Lys-Lys-Asn-Va l-Leu-Ser-Ser-Leu-A la-Va 1— Tyr—A la

(9) Information of SEQ ID NO: 8

 (i) Sequence characteristics

 (A) Length: 41 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 4:

 GGGCAACTACGAGTCTCTCATCTCCATGGATTATGCTATAA

(10) Information of SEQ ID NO: 9

 (i) Sequence characteristics

 (A) Length: 41 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (ii) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 9:

 GGGATCGACGAGTCTCTCATATCGATGGATTAGTATCGTAA

Claims

Claim

1. An isolated polypeptide-zinc finger protein 79, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (0) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 176-1 to 591 in SEQ ID NO: 1 or positions 1-2 to 039 in SEQ ID NO: 1. the sequence of.

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having zinc finger protein 79 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing zinc finger protein 79;

(b) Isolating a polypeptide having zinc finger protein 79 activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to zinc finger protein 79.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of zinc finger protein 79.

12. The compound according to claim 11, characterized in that it is an antisense sequence of the polynucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof.

 13. An application of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of zinc finger protein 79 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of zinc finger protein 79; or for peptide fingerprinting Identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist The agent or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of zinc finger protein 79.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HI V infection and immune diseases and drugs of various inflammations.