WO2001038368A1 - A novel polypeptide-human rna helicase 43 and the polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention disclosed a new kind of polypeptide-human RNA helicase 43 and the polynucleotide encoding said polypeptide and a process for producing the polypeptide by recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of diseases, such as cancer, hemopathy, HIV infection, immune diseases and inflammation. The antagonist of the polypeptide and therapeutic use of the same is also disclosed. In addition, it refers to the use of polynucleotide encoding said human RNA helicase 43.

Description

 Explanation book

 A new polypeptide-human RNA helicase 43 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human RNA helicase 43, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique

 The structural change of RNA requires the catalysis of enzymes. Among them, the role of RM helicase is to unravel the spiral structure of RNA, thereby facilitating further processes such as transcription, translation, splicing, and splicing.

 RNA helicase is an important protein found in many organisms, such as Drosophila DBP80, mouse mDEAD5, yeast TIF1 / 2, mammalian elF-4A, and so on. (Biochim Biophys Acta 1998 Apr 29; 1397 (2): 131-6)

 In the structural research of RNA helicase, it was found that the hepatitis C virus NS3 gene encodes an RNA helicase, which has many domains, including ATP-binding domain (GxGK), DExH domain, and RNA-binding domain (QRxGRxGR) and many more. According to the experimental results of the mutation, the domain with higher arginine abundance plays an important role in RM binding. According to research, it has been found that different domains work together and interact with each other. Therefore, changes in either of these domains will affect the activity of RNA helicase. (Virus Genes 1999; 19 (1): 33-43)

 In the splicing process of snRNA, RNA helicase is required to catalyze RM to perform the unwinding process repeatedly. An RNA helicase (DBP2) was cloned in human tissues, which has 3400 nucleotides and 1041 amino acids. By FISH mapping, the gene encoding DBP2 was mapped to human chromosome 6p21.3. (Nucleic Acids Res 1998 May 1; 26 (9): 2063-8)

 The results of Northern hybridization show that RNA helicase is expressed in almost all human tissues. (Biochem Biophys Res Commun 1997 Nov 17; 240 (2): 335-40) Recent research found that the carboxyl terminus of RNA helicase has a 110 amino acid domain, which is a two-way nuclear transport domain. This The functional domain determines the localization of RNA helicase in the nucleus. At the same time, RNA helicase is also a glutathione S-transferase secretion regulatory protein. (Mol Cell Biol 1999 May; 19 (5): 3540-50)

RNA helicase has a very important interaction with 3 'exonuclease, so we speculate that RNA helicase plays an important role in the entire gene expression regulation process. (Genes Dev 1999 Oct 1; 13 (19): 2594-603)

 In the study of mouse embryonic development, although the specific role of RNA helicase cannot be clearly understood in the current research, the complex transcription pattern and extensive time-space expression of genes encoding RNA helicase have proved that RNA helicase genes are closely related to RNA metabolism in many tissues and organ formation during embryonic development. (Biochem Biophys Res Commun 1999 Sep 7; 262 (3): 677-84)

 Eukaryotic Initiation Factor (EIF) 4A acts as an RNA helicase to unravel the secondary structure of 5 'untranslated eukaryotic mRM. This result has been proven by biochemistry and biodynamics. (J Biol Chem 1999 Apr 30; 274 (18): 12236-44)

 During the replication of the retrovirus, mRNA must be released into the cytoplasm for translation and packaging. This process is regulated by cis-acting factor (CTE) and other factors. Studies have found that RM helicase is a cofactor for CTE. The level of RNA helicase expression can affect the expression of CTE-related genes and the mRNA expression of HIV. (Proc Natl Acad Sci US A. 1999 Jan 19; 96 (2): 709-14) Studies have shown that RNA helicase is involved in the transcriptional regulation of many genes that depend on cAMP stimulation, and RNA helicase is responsible for the second messenger The role of cAMP determines that RNA helicase has a role in the signal transduction pathway. RNA helicases play an important role in early embryonic development and ectodermal differentiation. (Proc Natl Acad Sci U S A 1998 Nov 10; 95 (23): 13709-13)

 The results of chromosomal localization of RNA helicase obtained by FISH method prove that genes encoding RNA helicase are related to genes of many malignant diseases, hereditary diseases and autoimmune diseases. (Nucleic Acids Res 1998 May 1; 26 (9): 2063-8)

According to the results of amino acid homology comparison, the polypeptide of the present invention was inferred and identified as a new human RNA helicase 43 (HRnaH43), and its homologous protein was a discovered human RNA helicase, the protein number is AF106680 _o

 Since the human RNA helicase 43 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there is always a need in the art to identify more human RM helicases involved in these processes. Protein, especially the amino acid sequence of this protein. The isolation of the new human helicase 43 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding for DM. Disclosure of invention

It is an object of the present invention to provide isolated new polypeptides-human RM helicase 43 and tablets thereof. Paragraphs, analogs and derivatives.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human RNA helicase 43.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human RNA helicase 43.

 Another object of the present invention is to provide a method for producing human RNA helicase 43.

 Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human RNA helicase 43.

 Another object of the present invention is to provide analog compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human RNA helicase 43.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human RNA helicase 43.

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID D. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence of positions 232-1 to 395 in SEQ ID NO: 1; and (b) a sequence of 1- in SEQ ID NO: 1 1861-bit sequence.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human RNA helicase 43 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

The present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of human RNA helicase 43 protein, which comprises detecting the presence of Mutates, or detects the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human RNA helicase 43.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

An "agonist" refers to a molecule that, when combined with human RNA helicase 43, can cause changes in the protein and thereby regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human RNA helicase 43. An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human RNA helicase 43 when combined with human RNA helicase 43. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human RM helicase 43.

 "Regulation" refers to a change in the function of human MA helicase 43 including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immunological changes in human RNA helicase 43.

 By "substantially pure" is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human MA helicase 43 using standard protein purification techniques. The substantially pure human RNA helicase 43 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human RNA helicase 43 polypeptide can be analyzed by amino acid sequence analysis.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALI GN program (La ser genes s of tware package, DNASTAR, Inc., Mad Son Wis s.). The MEGALI GN program can compare two or more sequences (Higgins, DG and PM Sharp (1988) Gene 73: 237-244) according to different methods such as the Cluster method. The Cluster method checks all The distance between the pairs arranges the groups of sequences into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B

X 100 Number of residues in sequence A-number of spacer residues in sequence A-number of spacer residues in sequence B The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Me thods in emzumo l ogy 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') ₂ and F _V , which can specifically bind to the epitope of human RNA helicase 43.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

As used herein, "isolated human RNA helicase 43" means that human RM helicase 43 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human RNA helicase 43 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human RNA helicase 43 polypeptide can be analyzed by amino acid sequence. The present invention provides a new polypeptide, human RM helicase 43, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of human RNA helicase 43. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human RNA helicase 43 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) Such a type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or UV) a type in which the additional amino acid sequence is fused into the mature polypeptide and formed by the polypeptide sequence ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1861 bases, and its open reading frame (232-1395) encodes 387 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 34% homology with human RNA helicase. It can be deduced that the human RNA helicase 43 has a similar structure and function as human RNA helicase.

 Dagger

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; The coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence (and optional additional coding sequences) of the mature polypeptide and non-coding sequences.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human RNA helicase 43.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding human RM helicase 43 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or Phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human RNA helicase 43 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human RNA helicase 43 gene.

 A method of applying a PCR technique to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human RM helicase 43 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .

In the present invention, a polynucleotide sequence encoding human A helicase 43 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "carrier" refers to a bacterial substance known in the art Granules, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors. Vectors suitable for use in the present invention include, but are not limited to:

T7 promoter expression vector (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vector expressed in mammalian cells (Lee and Nathans, J Bio Chera. 263: 3521, 1988) and in insect cells A vector derived from a baculovirus. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human RNA helicase 43 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DM sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the replication initiation point, polyoma enhancers and adenoviral enhancers on the late side of the replication initiation point.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding human RNA helicase 43 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells. Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCli. The procedures used are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human RNA helicase 43 (Scence, 1984; 224: 1431). Generally, the following steps are taken:

(1) using the polynucleotide (or variant) encoding human human RNA helicase 43 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of amino acid sequence homology of human RNA helicase 43 and human RM helicase of the present invention. The upper sequence is human RNA helicase 43 and the lower sequence is human RNA helicase. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".

FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of isolated human RNA helicase 43. FIG. 43 kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of human RNA helicase 43

 Total RNA from human fetal brain was extracted by guanidine isothiocyanate / phenol / chloroform method. Using Quik mRNA Isolation Kit

(Qiegene product) Isolate poly (A) mRNA from total RNA. 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5α. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0842hl2 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the 0842hl2 clone contained a full-length cDNA of 1861bp (as shown in Seq IDN0: 1), and a 1164bp open reading frame (0RF) from 232bp to 1395bp, encoding a new protein (such as Seq ID NO: 2). We named this cloned _P BS- _0842hl2, encoding a protein named human RNA helicase 43. Example 2: Homologous search of cDNA clones

 Using the sequence of the human RNA helicase 43 of the present invention and the protein sequence encoded by it, the Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], Homology search in databases such as Genbank and Swissport. The gene with the highest homology to the human RM helicase 43 of the present invention is a known human RNA helicase, which encodes a protein with accession number AF106680 in Genbank. The results of protein homology are shown in Figure 1. The two are highly homologous, with an identity of 34% and a similarity of 54%. Example 3: Cloning of a gene encoding human RNA helicase 43 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:

Primerl: 5 '-GGAGCGGCCGGTACTGTTGAAAG-3' (SEQ ID NO: 3) Primer2: 5, — GAAAACCATTTTTATTATCATTAC— 3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 mmol / L KC1, 10 mmol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primers in a 50 μ 1 reaction volume, 1U Taq polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-1861bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of human RNA helicase 43 gene expression:

Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. I.e. with 4M guanidinium isothiocyanate -25mM sodium citrate, 0.2M sodium acetate _(P H4.0) of the tissue was homogenized phenol, 1 volume and 1/5 volume of chloroform - isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ§ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. A- ³² P dATP was used to prepare labeled DNA probes by random primer method. The DNA probe used was the PCR amplified human RNA helicase 43 coding region sequence (232bp to 1395bp) shown in FIG. A 32P-labeled probe (about 2 x 10 ⁶ cpra / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH 7.4) -5 x SSC-5 x Denhardt's solution and 200 μg / ml salmon sperm DNA. After hybridization, the filter was washed in 1 <SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant human RNA helicase 43

 According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

Primer 3: 5,-CCCCATATGATGAAGGAAGAAAACACAGGAGCCG- 3, (Seq ID No: 5) Primer 4: 5,-CCCGGATCCTCAAACTGCATCCATTCCTCGCATTG- 3, (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively , Followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively. The Ndel and BamHI restriction sites correspond to the expression vector plasmid _P ET-28b (+) (Novagen Company product, Cat. No. 69865.3). The PCR reaction was performed using the pBS-0842hl2 plasmid containing the full-length target gene as a template. The PCR reaction conditions are as follows: a total volume of 50 μ1 contains 10 pg of pBS-0842hl2 plasmid, primers Primer-3 and Primer- 4 points, and ¹ J is lOpmol, Advantage polymerase Mix

(Clontech) 1 μ1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into the colibacillus DH5 alpha by the calcium chloride method, containing kanamycin

After the LB plates (final concentration 30 g / ml) were cultured overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0842hl2) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. The host strain BL21 (pET-0842hl2) was 37 in LB liquid medium containing kanamycin (final concentration 30 g / ml). C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 ol / L, and continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge was used which could bind 6 histidine (6His-Tag).

(Product from Novagen) Chromatography was performed to obtain purified human RNA helicase 43 of interest. After SDS-PAGE electrophoresis, a single band was obtained at 43 kDa (Figure 2). The band was transferred to a PVDF membrane, and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-human MA helicase 43 antibody

A peptide synthesizer (product of PE company) was used to synthesize the following human RNA helicase 43-specific peptides: NH ₂ -Met-Lys-Glu-Glu-Asn-Thr-Gly-Ala-Gly-Ala-Glu-Ala- Lys-Arg-Thr- C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 _{M g} / ral bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human RNA helicase 43. Example 7: Use of a polynucleotide fragment of the present invention as a hybridization probe

Selecting suitable oligonucleotide fragments from the polynucleotides of the present invention has various uses as hybridization probes, such as using the probes to hybridize to genomic or cDNA libraries of normal tissues or pathological tissues from different sources. In order to identify whether it contains a polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, the probe may further be used to detect the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in normal tissue or Whether the expression in pathological tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the probes from the hybridization are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

5 '-GAAAACACAGGAGCCGGAGCAGAAGCAAAGAGAACCAACTT-3' (SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 5 '-GAAAAATCGGGAGCCGGAATCGAAGCAAAGAGATCGAACTTC-3' (SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental steps, please refer to the literature: Let PROBES GH Keller; MMManak; Stockton Press, 1989 (USA ), And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" U998 Second Edition) [US] Sambruck et al., Science Press.

 Sample Preparation:

1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (approximately 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 μl / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 mmol / L MgCl ₂ ). 4) At 4 ^U C, homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, phenol extraction method for DNA

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells (1 × 10 ⁸ cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1 ° / ». If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, and then Turn upside down to drain residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DM pellet with a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1- 5 χ 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml, respectively. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, mix and let stand at -20 ° C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ^U C after packing. Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and gently mark the spotting position and sample number on them with a pencil. Two NC membranes are required for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Caught in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.1 IOD / Ιθμ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB

 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) were collected after the first peak were combined to ³² P- Probe (second peak to prepare the desired free γ- ³² Ρ- dATP) ₀ Pre-hybridization

 Place the sample membrane in a plastic bag, and add 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1mg / ml CT DNA (calf thymus DNA).), After sealing the bag, 68 ° C water Rock shake for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight.

 Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray auto-development:

 -70 ° C, X-ray autoradiography (compression time depends on the radioactivity of the hybrid spot).

 Experimental results:

 的 In the hybridization experiments performed under low-intensity membrane washing conditions, there is no significant difference in the radioactivity intensity of the above four probe hybrid spots; while in the hybridization experiments performed under low-intensity membrane washing conditions, the radio spot intensity of probe 1 is significantly stronger The radioactivity of the hybridization spots of the other three probes. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. Industrial applicability

 The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.

The polypeptide (human RNA helicase 43) of the present invention plays an important role in the entire expression regulation process of genes, and its main function is to catalyze the unwinding process of RNA, thereby facilitating further transcription and translation Translation, editing, stitching, etc. It has been found through research that RNA helicase also has the following functions: (1) RNA helicase gene encoding RNA is closely related to RNA metabolism in many tissues and organ development in embryonic development; (2) RNA helicase is unlocking 5 '' Untranslated eukaryotic mRNA plays a role in the secondary structure process; (3) RNA helicase is a co-factor of cis-acting factor (CTE), and the level of RNA helicase expression can affect HIV mRNA Expression levels; (4) Genes encoding RNA helicases are associated with genes for many malignant, genetic, and autoimmune diseases.

 The research on the function of the polypeptide of the present invention needs further development. According to the existing research, the polypeptide of the present invention can be used for the diagnosis and treatment of many diseases, including but not limited to the following: malignant tumors, endocrine system diseases, nervous system diseases, immunity Diseases, human acquired immune deficiency syndrome (AIDS), etc.

 Various tumors include: including epithelial tissue (such as basal epithelium, squamous epithelium, mucus cells, etc.), (such as fibrous tissue, adipose tissue, cartilage tissue, smooth muscle tissue, vascular and lymphatic endothelial tissue, etc.), hematopoietic tissue ( (Such as B cells, T cells, tissue cells, etc.), central nervous tissue, peripheral nerve tissue, endocrine tissue, gonadal tissue, special tissue (such as dental tissue, etc.) derived tumors, such as gastric cancer, liver cancer, colorectal cancer, breast Cancer, lung cancer, prostate cancer, cervical cancer, pancreatic cancer, esophageal cancer, etc.

 The polypeptide of the present invention is an immunomodulator and has an immune promoting or immunosuppressing effect. The polypeptide of the present invention can be used for the treatment of diseases including non-reactivity of immune response, or abnormal immune response, or ineffective host defense. The polypeptides and antibodies of the present invention also have effects on damage, defects or disorders of immune tissues, especially for hematopoietic diseases (such as malignant anemia), skin diseases (such as psoriasis), and autoimmune diseases (such as rheumatoid arthritis). ), Radiation diseases and the production and regulation of immune lymphocytes are extremely closely related.

 Developmental disorders include spina bifida, craniocerebral fissure, anencephaly malformation, brain bulge, foramencephalic malformation, Down syndrome, congenital hydrocephalus, aqueduct malformation, cartilage hypoplasia, dwarfism, spinal epiphyseal dysplasia, Pseudochondral dysplasia, Langer-Giedion syndrome, funnel chest, gonad hypoplasia, congenital adrenal hyperplasia, upper urethral tract, cryptorchidism, with short stature (such as Conradi syndrome and Danbolt-Closs syndrome) , Congenital glaucoma or cataract, congenital lens position abnormality, congenital blepharoplasia, retinal dysplasia, congenital optic nerve atrophy, congenital sensorineural hearing loss, cracked hand and feet, teratosis, Williams syndrome, Alagilie Syndrome, Bayer Syndrome, etc.

The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human RM helicase 43. Agonists enhance biological functions such as human RM helicase 43 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, a mammalian cell or a membrane preparation expressing human RNA helicase 43 and a labeled Human RM helicase 43-from culture. The ability of the drug to increase or block this interaction is then determined. Antagonists of human RM helicase 43 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human RNA helicase 43 can bind to human RM helicase 43 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

 When screening compounds as antagonists, human RNA helicase 43 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human RNA helicase 43 and its receptor . Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human A helicase 43 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human RNA helicase 43 molecules should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against the human RM helicase 43 epitope. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.

Polyclonal antibodies can be produced by injecting human RNA helicase 43 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies to human RM helicase 43 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). ₀ Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single-chain antibodies against human RNA helicase 43.

 Anti-human MA helicase 43 antibodies can be used in immunohistochemical techniques to detect human RNA helicase 43 in biopsy specimens.

 Monoclonal antibodies that bind to human RNA helicase 43 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human RNA helicase 43 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP, By exchanging disulfide bonds, toxins are bound to antibodies. This hybrid antibody can be used to kill human A helicase 43 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to human RNA helicase 43. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human RNA helicase 43.

 The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human RM helicase 43. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of human RNA helicase 43 detected in the test can be used to explain the importance of human RNA helicase 43 in various diseases and to diagnose diseases in which human RNA helicase 43 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding human RNA helicase 43 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human RNA helicase 43. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human RM helicase 43 to inhibit endogenous human RNA helicase 43 activity. For example, a mutated human RNA helicase 43 may be a shortened human RNA helicase 43 lacking a signaling functional domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of RM helicase 43 in humans. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human RNA helicase 43 into a cell. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human RNA helicase 43 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human RNA helicase 43 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human RNA helicase 43 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DM, and ribozymes can be obtained by any existing RNA or DM synthesis technology, such as the technology of solid phase phosphate amide synthesis of oligonucleotides has been widely used. Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. RNA polymerase Promoter downstream. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human RM helicase 43 can be used for the diagnosis of diseases related to human MA helicase 43. The polynucleotide encoding human RNA helicase 43 can be used to detect the expression of human RNA helicase 43 or the abnormal expression of human RNA helicase 43 in a disease state. For example, the DNA sequence encoding human RNA helicase 43 can be used to hybridize biopsy specimens to determine the expression of human RM helicase 4 3. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microcroix) or a DNA chip (also known as a "gene chip"), and used to analyze differential expression analysis of genes and genes in tissues. diagnosis. Human RNA helicase 43 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human RNA helicase 43 transcription products.

 Detection of mutations in the human RNA helicase 43 gene can also be used to diagnose human RNA helicase 43 related diseases. The forms of human RNA helicase 43 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human RNA helicase 43 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nort Hern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.

 In short, PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries. Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human RNA helicase 43 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human RNA helicase 43 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. table

(1) General information:

(ii) Title of invention: Human RNA Helicase 43 and its coding sequence

(iii) Number of sequences: 9

(2) Information of SEQ ID NO: 1:

 (i) Sequence characteristics:

(A) Length: 1861b _P

 (B) Type: Nucleic acid

 (C) Chain: double strand

 (D) Topological structure: linear

 (ii) Molecular type: cDNA

(xi) Sequence description: SEQ ID NO: 1:

(3) Information of SEQ ID NO: 2:

 (i) Sequence characteristics:

 (A) Length: 387 amino acids

 (B) Type: Amino acid

 (D) Topological structure: linear

 (Π) Molecular type: Polypeptide

 (xi) Sequence description: SEQ ID NO: 2:

 Met Lys Glu Glu Asn Thr Gly Ala Gly Ala Glu Ala Lys Arg Thr

Asn Phe Phe Leu Lys Gin Gly Arg Arg His Glu Ser Lys Asp Lys

Ser Ser Lys Lys His Lys Ser Glu Glu His Asn Asp Lys Glu His

Ser Ser Asp Lys Gly Arg Glu Arg Leu Asn Ser Ser Glu Asn Gly

Glu Asp Arg His Lys Arg Lys Glu Arg Lys Ser Ser Arg Gly Arg

Ser His Ser Arg Ser Arg Ser Arg Glu Arg Arg His Arg Ser Arg

Ser Arg Glu Arg Lys Lys Ser Arg Ser Arg Ser Arg Glu Arg Lys Lys Ser Arg Ser Arg Ser Arg Glu Arg Lys Lys Ser Arg Ser Arg

Ser Arg Glu Arg Lys Arg Arg lie Arg Ser Arg Ser Arg Ser Arg 136 Ser Arg His Arg His Arg Thr Arg Ser Arg Ser Arg Thr Arg Ser

151 Arg Ser Arg Asp Arg Lys Lys Arg He Glu Lys Pro Arg Arg Phe

166 Ser Arg Ser Leu Ser Arg Thr Pro Ser Pro Pro Pro Phe Arg Gly

181 Arg Asn Thr Ala Met Asp Ala Gin Glu Ala Leu Ala Arg Arg Leu

196 Glu Arg Ala Lys Lys Leu Gin Glu Gin Arg Glu Lys Glu Met Val

211 Glu Lys Gin Lys Gin Gin Glu lie Ala Ala Ala Ala Ala Ala Thr

226 Gly Gly Ser Val Leu Asn Val Ala Ala Leu Leu Ala Ser Gly Thr

241 Gin Val Thr Pro Gin lie Ala Met Ala Ala Gin Met Ala Ala Leu

256 Gin Ala Lys Ala Leu Ala Glu Thr Gly He Ala Val Pro Ser Tyr

271 Tyr Asn Pro Ala Ala Val Asn Pro Met Lys Phe Ala Glu Gin Glu

286 Lys Lys Arg Lys Met Leu Trp Gin Gly Lys Lys Glu Gly Asp Lys

301 Ser Gin Ser Ala Glu lie Trp Glu Lys Leu Asn Phe Gly Asn Lys

316 Asp Gin Asn Val Lys Phe Arg Lys Leu Met Gly lie Lys Ser Glu

331 Asp Glu Ala Gly Cys Ser Ser Val Asp Glu Glu Ser Tyr Lys Thr

346 Leu Lys Gin Gin Glu Glu Val Phe Arg Asn Leu Asp Ala Gin Tyr

361 Glu Met Ala Arg Ser Gin Thr His Thr Gin Arg Gly Met Gly Leu

376 Gly Phe Thr Ser Ser Met Arg Gly Met Asp Ala Val

(4) Information of SEQ ID NO: 3

 (i) Sequence characteristics

 (A) Length: 23 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (ii) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 3:

 GGAGCGGCCGGTACTGTTGAAAG

(5) Information of SEQ ID NO: 4

 (i) Sequence characteristics

 (A) Length: 24 bases

(B) Type: Nucleic acid (c) Chain: single chain

 (D) Topological structure: linear

 (ii) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 4:

 GAAAACCATTTTTATTATCATTAC 24

(6) Information of SEQ ID NO: 5

 (i) Sequence characteristics

 (A) Length: 34 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 5:

CCCCATATGATGAAGGAAGAAAACACAGGAGCCG

(7) Information of SEQ ID NO: 6

 (i) Sequence characteristics

 (A) Length: 35 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 6:

 CCCGGATCCTCAAACTGCATCCATTCCTCGCATTG

(8) Information of SEQ ID NO: 7:

 (U sequence characteristics:

 (Α) Length: 15 amino acids

 (B) Type: Amino acid

 (D) Topological structure: linear

(ii) Molecular type: peptide ioo / OOO / CMHS 89ε8ε / οι OAV

 ςΐ≤.V§J—

 ΐ

 l

Claims

Claim

1. An isolated polypeptide-human RNA helicase 43, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to the polynucleotide; or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 232-1395 in SEQ ID NO: 1 or the sequence of positions 1-1861 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human RNA helicase 43 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing human RNA helicase 43;

 (b) Isolating a polypeptide having human RNA helicase 43 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is an antibody capable of specifically binding to human RNA helicase 43.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human RM helicase 43.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of the polynucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof.

 13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human RM helicase 43 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human RNA helicase 43; or for peptides Fingerprint identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist The agent or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of human RNA helicase 43.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.