WO2001030823A1 - Nouveau polypeptide, proteine humaine canal circulaire 69, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine canal circulaire 69, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001030823A1
WO2001030823A1 PCT/CN2000/000375 CN0000375W WO0130823A1 WO 2001030823 A1 WO2001030823 A1 WO 2001030823A1 CN 0000375 W CN0000375 W CN 0000375W WO 0130823 A1 WO0130823 A1 WO 0130823A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human
sequence
seq
Prior art date
Application number
PCT/CN2000/000375
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Bio Road Gene Development Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Bio Road Gene Development Ltd. filed Critical Shanghai Bio Road Gene Development Ltd.
Priority to AU12641/01A priority Critical patent/AU1264101A/en
Publication of WO2001030823A1 publication Critical patent/WO2001030823A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human cyclopene 69, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Intercellular communication plays an important role in multicellular organisms. Because of the delicate division of labor between cells, some cell populations depend on other cell populations and require other cell populations to respond to them. This sophisticated intercellular communication network can control cell growth, division, death, differentiation to form tissues, and various other life processes.
  • the formation of loops is related to actin fibers. It is now known that there are a number of genes involved in the assembly and function of the loop, one of which is a family of genes containing the Kelch domain.
  • the Kelch protein family contains two common structures, with a BTB / P0Z region in the N segment and a kelch repeat in the C segment [Sol tys ik— Espanola M et al, Mol biol Cel l 1999 Jul].
  • the kelch protein family that has been discovered is actin-binding protein, or is related to actin.
  • the Kelch protein family plays an important role in the physiological processes related to the cytoskeleton during development, such as loop formation, nerve fiber localization, cell fusion, and cell morphogenesis [Sol tys ik-espanola M, Mol biol Cel l 1999; Phi l ips J, J Cel l biol 1998;].
  • the kelch protein is located on the inner side of the loop, which keeps the side of the loop tightly bound.
  • Kelch protein mutations can prevent the delivery of cytoplasm to the eggs by the guard trophoblast cells around the egg [Xue F, Cooley L, Cel l 1993 Mar 12].
  • Kel-1 protein causes early growth arrest in larvae [Ohmachi M, genes Cels 1999]. Since the loop structure and kelch protein were found in the sperm and egg formation of many organisms including humans, it can be considered that the effect of kelch protein on sperm and egg formation is universal. Another example is that the kelch protein Mayven found in the brain may play a role in the dynamic organization of the brain cell actin cytoskeleton [Sol tys ik-Espanola M, Mol Biol Cel l 1999].
  • the human gene of the present invention has 74% homology with the fruit fly ke l ch protein at the protein level. Its with The kelch protein family's characteristic domain, the kel ch domain, is very similar and contains several highly conserved amino acid residues in the kel ch domain. Based on the above points, the new gene of the present invention is considered to be a gene encoding a human similar to the kelch domain of the ke lch protein family, named human cyclopeptide 69. Based on this, it is inferred that it is similar to the kelch domain and has similar biology. Learn function.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a method for producing human tubulin 69.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human tubulin 69.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human cyclin 69.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human cyclopene 69.
  • a novel isolated human tubulin 69 the polypeptide is of human origin, and comprises: a polypeptide having the amino acid sequence of SEQ ID NO: 2, or a conservative variant polypeptide thereof, or An active fragment, or an active derivative or analog thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • a polynucleotide encoding the isolated polypeptides, the polynucleotide comprising a nucleotide sequence having at least 75 nucleotides with a nucleotide sequence selected from the group consisting of % Identity: (a) a polynucleotide encoding the above-mentioned human tubulin 69; (b) a polynucleotide complementary to the polynucleotide (a).
  • the polynucleotide encodes a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 462-2342 in SEQ ID NO: 1; and (b) a sequence having 1-3488 in SEQ ID NO: 1 Sequence of bits.
  • a vector containing the above-mentioned polynucleotide is provided, and the vector transformed by the vector is provided.
  • transduced host cells directly transformed or transduced by the aforementioned polynucleotides.
  • FIG. 1 is a comparison diagram of the amino acid sequence homology of the human cyclotron protein 69 and Drosophila Ke l ch protein of the present invention.
  • the upper sequence is human cyclopeptin 69 and the lower sequence is Drosophila Ke lch protein.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human tubulin 69.
  • 69kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state. .
  • isolated human tubulin 69 means that human tubulin 69 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human tubulin 69 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on non-reducing polyacrylamide gels. The purity of human cyclopeptide 69 can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human tubulin 69, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic host (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the present invention also includes fragments, derivatives, and analogs of human tubulin 69.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human loopulin 69 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may So: (I) a type in which one or more amino acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be a genetic codon Encoded; or (II) such a type in which a group on one or more amino acid residues is substituted with another group to contain a substituent; or (II I) such a type in which the mature polypeptide is A compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or used for purification) in which an additional amino acid sequence is fused into a mature polypeptide The sequence of this polypeptide or protease sequence) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence that is 3488 bases in length and its open reading frame (462-2342) encodes 626 amino acids. According to the amino acid sequence homology comparison, it was found that the polypeptide has 74% homology with Drosophila Ke l ch protein, and it can be deduced that the human loop protein 69 has similar structure and function to Drosophila Kelch protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • D can be a coded or non-coded chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is a polynucleotide A replacement form, which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes.
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) L ° / ⁇ Denaturing agents are added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /.
  • Hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human tubulin 69.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence of the present invention encoding human tubulin 69 can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecule Cloning, A Labora tory Manua, Cold Spring Harbor Laboratory. New York, 1989).
  • cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be screened from these cD libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the human cyclin 69 transcript; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product for detecting the expression of the human cyclopene 69 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method (Sa ik i, e t a l. Sc ience 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human tubulin 69 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding a human tubulin 69 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7-based, expressed in bacteria Promoter expression vectors (Rosenberg, etal.
  • pMSXND expression vectors expressed in mammalian cells (Lee and Na thans, J Bio Chem. 263: 3521, 1988) and in insect cells Expression of a baculovirus-derived vector.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human tubulin 69 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, etal. Mo lecu lar C loning, a Labora tory Manua l, co ld Spr ing Harbor Labora tory. New York, 1989)
  • the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: E.
  • Expression vectors also include ribosome binding sites and transcription terminators for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are expressed by DM A cis-acting factor, usually about 10 to 300 base pairs, acts on a promoter to enhance gene transcription. Examples include Including starting late side of the replication of 100-270 bp SV40 enhancer, adenovirus enhancers, and the like enhancer on the late side of the replication origin polyoma.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a human cyclotron protein 69 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the D sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. Alternatively, MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant human cyclopeptin 69 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the ke l ch protein plays an important role in sperm, egg formation, and the formation of loops, nerve fiber localization, cell fusion, and cell morphology maintenance during development.
  • Ke l ch protein mutations can cause diseases such as abnormal egg formation and developmental disorders.
  • the polypeptide fragments or derivatives thereof of the present invention can be used to treat and prevent diseases such as infertility and congenital dysfunction caused by abnormal sperm and egg formation or sperm-egg binding disorders, and can also be used to treat and prevent embryonic dysplasia And related genetic diseases; various organs, tissues, etc.
  • polypeptide fragments or derivatives thereof of the present invention can also be used to treat and prevent diseases caused by abnormal development of the nervous system, such as neuromuscular diseases, including but not limited to: congenital dyskinesia, congenital paralysis, spinal muscular atrophy, etc. ; Neurological diseases, congenital mental retardation and other diseases.
  • neuromuscular diseases including but not limited to: congenital dyskinesia, congenital paralysis, spinal muscular atrophy, etc. ; Neurological diseases, congenital mental retardation and other diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human loop protein 69.
  • Agonists enhance biological functions such as human tubulin 69 to stimulate cell proliferation, and antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or human expressing Membrane formulations of tubulin 69 were cultured with labeled human tubulin 69. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human tubulin 69 include antibodies, compounds, receptor deletions, and analogs that have been screened. Antagonists of human tubulin 69 can bind to human tubulin 69 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human tubulin 69 can be added to bioanalytical assays to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human tubulin 69 and its receptor.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human tubulin 69 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human cyclotronin 69 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides antibodies directed against the human epithelin 69 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human cyclopeptin 69 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for the preparation of monoclonal antibodies to human tubulin 69 include, but are not limited to, hybridoma technology (Kohl er and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human variable regions are available Some technologies (Morr i son etal, PNAS, 1985, 81: 6851), and the existing technology for producing single-chain antibodies (US Pat. No. 4946778) can also be used to produce single-chain antibodies against human tubulin 69 .
  • Anti-human tubulin 69 antibodies can be used in immunohistochemistry to detect human tubulin 69 in biopsy specimens.
  • Monoclonal antibodies that bind to human tubulin 69 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human cyclopeptin 69 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human cyclosulin 69 positive cells.
  • the antibodies of the present invention can be used for the treatment or prevention of diseases related to human tubulin 69. Administration of appropriate doses of the antibody can stimulate or block the production or activity of human tubulin 69.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human tubulin 69.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human tubulin 69 detected in the test can be used to explain the importance of human tubulin 69 in various diseases and to diagnose diseases in which human tubulin 69 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human tubulin 69 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormalities in cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human tubulin 69.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human tubulin 69 to inhibit endogenous human tubulin 69 activity.
  • a mutated human tubulin 69 may be a shortened human tubulin 69 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human tubulin 69.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer a polynucleotide encoding human cyclopeptin 69 into cells.
  • Constructing a Recombinant Carrying a Polynucleotide Encoding a Human Cyclin 69 Methods for grouping viral vectors can be found in the existing literature (Sambrook, eta l.).
  • a recombinant polynucleotide encoding human tubulin 69 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human loopulin 69 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human tubulin 69 can be used for the diagnosis of diseases related to human tubulin 69.
  • a polynucleotide encoding human tubulin 69 can be used to detect the expression of human tubulin 69 or the abnormal expression of human tubulin 69 in a disease state.
  • the DNA sequence encoding human tubulin 69 can be used to hybridize biopsy specimens to determine the expression of human tubulin 69.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • RNA-polymerase chain reaction (RT-PCR) in vitro amplification using human loop protein 69 specific primers can also detect the transcription product of human loop protein 69.
  • Detecting mutations in the human tubulin 69 gene can also be used to diagnose human tubulin 69-related diseases.
  • the forms of human cyclopene 69 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human tubular protein 69 DM sequence. Mutations can be detected using existing techniques such as Southern imprinting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification.
  • This sequence will specifically target a Human chromosomes are in specific locations and can hybridize to them.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for labeling chromosome positions.
  • an important first step is to locate these DM sequences on the chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendelian Inherance in Man (available online with Johns Hopk ins Universe Wetch Medica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all of the affected individuals and the mutation is not observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers Liquid, glycerin and their combinations.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as medicines for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Together with these containers, there may be manufactured, used or sold pharmaceutical products or An indicative prompt given by a government regulatory agency for biological products that reflects the permission of the government regulatory agency that produces, uses, or sells it to be administered to the human body.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human Cyclin 69 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human cyclotron 69 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • the 0934e08 cDNA sequence is new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the results showed that the full-length cDNA contained in the 0934e08 clone was 3488bp (as shown in Seq ID N0: l), and there was a 1881bp open reading frame (0RF) from 462bp to 2342bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0934e08 the encoded egg White matter is named human cyclopeptin 69.
  • Example 2 Homologous search of cDNA clones
  • the sequence of the human cyclopeptin 69 and the protein sequence encoded by the present invention were analyzed using the Blas t program (Basic local Algorithm search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403 -10], perform a homology search in databases such as Genbank, Swissport, etc.
  • the gene with the highest homology to the human cyclopene 69 of the present invention is a known Drosophila Kelch protein, which encodes a protein in the Genbank
  • the accession number is AL035424.
  • the protein homology results are shown in Figure 1. The two are highly homologous, and their identity is 74%. The similarity is 861 ⁇ 2.
  • Example 3 Cloning of the gene encoding human cyclopeptin 69 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primer 1 5'- TGTTTCATCTTTATTCATTATCC-3 '(SEQ ID NO: 3)
  • Primer2 5'- CGCCGCTTATATCTTATAGGATT-3 '(SEQ ID NO: 4)
  • Pr iraerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions A reaction volume of 50 ⁇ 1 contains 50 mmol / L KC1, 10 crypto ol / L Tri s-Cl, ( ⁇ 8.5 ⁇ ), 1.5-sided ol / L MgCl 2 , 200 ⁇ mol / L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the result of D sequence analysis showed that the DM sequence of the PCR product was exactly the same as that of l-3488bp shown in SEQ ID NO: 1.
  • RNA probes were the human loop protein 69 coding region sequence (462bp to 2342bp) amplified by PCR as shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25niM KH 2 P0 4 (pH7. 4)-5 x SSC-5 X Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filters were placed in 1 x SSC-0. 1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In Vitro Expression, Isolation and Purification of Recombinant Human Cyclin 69
  • Primer3 5'- CATCCATGGCATCCACCTCTGAAGTCCCTGC ATT- 3 '(Seq ID No: 5)
  • Pr imer4 5'- CATGGATCCCCTAATTTTACAGTCACAACACAAG-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ncol and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
  • Ncol and BamHI restriction sites correspond to the expression vector plasmid pET-
  • Ncol and BaraHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into coliform bacteria DH5 ⁇ using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR and sequenced. Selected positive clones with the correct sequence (P ET-0934e08) the recombinant plasmid by the calcium chloride method to transform E. coli BL21 (DE3) plySs (Novagen Co.). In kanamycin-containing (final concentration 30
  • the host strain BL21 (pET-0934e08) was cultured at 37 ° C. to a logarithmic growth phase, IPTG was added to a final concentration of 1 ol / L, and the culture was continued for 5 hours. Collect bacterial cells by centrifugation The supernatant was collected by centrifugation and chromatographed using an affinity chromatography column His s. Bind Quick Car tr idge (product of Novagen) capable of binding to 6 histidines (6His-Tag). The purified target protein was obtained. Cyclin 69 accomplishedAfter SDS-PAGE electrophoresis, a single band was obtained at 69 kDa ( Figure 2).
  • a peptide synthesizer (product of PE company) was used to synthesize the following human cyclopeptin 69-specific peptides:
  • polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For the method, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43.
  • Rabbits were immunized with 4 mg_L of the cyanocyanine peptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once. ⁇ Using a 15 g / ml bovine serum albumin peptide complex-coated titer plate as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Seph ar 0 S e4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human cyclopeptin 69.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine canal circulaire 69, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine canal circulaire 39.
PCT/CN2000/000375 1999-10-27 2000-10-27 Nouveau polypeptide, proteine humaine canal circulaire 69, et polynucleotide codant pour ce polypeptide WO2001030823A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU12641/01A AU1264101A (en) 1999-10-27 2000-10-27 A novel polypeptide-human circular canal protein 69 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99119866 CN1303865A (zh) 1999-10-27 1999-10-27 一种新的多肽——人环管蛋白69和编码这种多肽的多核苷酸
CN99119866.2 1999-10-27

Publications (1)

Publication Number Publication Date
WO2001030823A1 true WO2001030823A1 (fr) 2001-05-03

Family

ID=5281157

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000375 WO2001030823A1 (fr) 1999-10-27 2000-10-27 Nouveau polypeptide, proteine humaine canal circulaire 69, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1303865A (fr)
AU (1) AU1264101A (fr)
WO (1) WO2001030823A1 (fr)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SOLTYSIK-ESPANOLA M. ET AL.: "Characterization of Mayven, a novel actin-binding protein predominantly expressed in brain", MOL. BIOL. CELL, vol. 10, no. 7, July 1999 (1999-07-01), pages 2361 - 2375 *

Also Published As

Publication number Publication date
CN1303865A (zh) 2001-07-18
AU1264101A (en) 2001-05-08

Similar Documents

Publication Publication Date Title
WO2001038377A1 (fr) Nouveau polypeptide - la proteine humaine 95 contenant un bromodomaine- et un polynucleotide codant pour ledit polypeptide
WO2001038371A1 (fr) Nouveau polypeptide glutamate arnt synthetase 58 d'origine humaine et polycnucleotide codant pour ce polypeptide
WO2001031030A1 (fr) Nouveau polypeptide, phosphodiesterase 21 humaine de type acide sphingomyelinase, et polynucleotide codant pour ce polypeptide
WO2001030823A1 (fr) Nouveau polypeptide, proteine humaine canal circulaire 69, et polynucleotide codant pour ce polypeptide
WO2001029228A1 (fr) Nouveau polypeptide, caseine kinase humaine 48, et polynucleotide codant pour ce polypeptide
WO2001031024A1 (fr) Nouveau polypeptide, threonine synthetase 71, et polynucleotide codant pour ce polypeptide
WO2001030818A1 (fr) Nouveau polypeptide, proteine de liaison 33 a l'arn, et polynucleotide codant pour ce polypeptide
WO2001038545A1 (fr) Nouveau polypeptide, acetyle galactosyle transferase 45 humain et polynucleotide codant ce polypeptide
WO2001030837A1 (fr) Nouveau polypeptide, galectine 15, et polynucleotide codant pour ce polypeptide
WO2001038375A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 58 et polynucleotide codant pour ce polypeptide
WO2001031001A1 (fr) Nouveau polypeptide, facteur auxiliaire 28 du facteur de demarrage de la traduction, et polynucleotide codant pour ce polypeptide
WO2001030826A1 (fr) Nouveau polypeptide, une serine/threonine kinase 29, et polynucleotide codant pour ce polypeptide
WO2001030835A1 (fr) Nouveau polypeptide, pogo transposase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001030840A1 (fr) Nouveau polypeptide, une proteine 57 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001038389A1 (fr) Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001030832A1 (fr) Nouveau polypeptide, proteine a doigt de zinc hkznf-23, et un polynucleotide codant pour ce polypeptide
WO2001030819A1 (fr) Nouveau polypeptide, tropomoduline humaine 39, et polynucleotide codant pour ce polypeptide
WO2001030825A1 (fr) Nouveau polypeptide, facteur humain d'epissage 25, et polynucleotide codant pour ce polypeptide
WO2001027283A1 (fr) Nouveau polypeptide, proteine 16 de type transcriptase humaine inverse, et polynucleotide codant pour ce polypeptide
WO2001029075A1 (fr) Nouveau polypeptide, proteine 129 activant la proteine g, et polynucleotide codant pour ce polypeptide
WO2001031022A1 (fr) Nouveau polypeptide, arginyl arnt synthetase 44, et polynucleotide codant pour ce polypeptide
WO2001027285A1 (fr) Nouveau polypeptide, methyltransferase humaine dpb 41 et polynucleotide codant pour ce polypeptide
WO2001031032A1 (fr) Nouveau polypeptide, sous-unite 42 d'ht atpase c humaine vacuolaire, et polynucleotide codant pour ce polypeptide
WO2001038370A1 (fr) Nouvelle sous-unite 49 de l'activateur de transcription polypeptidique et polynucleotide codant ce polypeptide
WO2001038372A1 (fr) Nouveau polypeptide proteine humaine de type a expression amelioree des cellules de paneth et polynucleotide codant ledit polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP