WO2001020031A2 - Polymorphismes dans un gene klotho - Google Patents

Polymorphismes dans un gene klotho Download PDF

Info

Publication number
WO2001020031A2
WO2001020031A2 PCT/GB2000/003457 GB0003457W WO0120031A2 WO 2001020031 A2 WO2001020031 A2 WO 2001020031A2 GB 0003457 W GB0003457 W GB 0003457W WO 0120031 A2 WO0120031 A2 WO 0120031A2
Authority
WO
WIPO (PCT)
Prior art keywords
risk
klotho gene
polymoφhism
disease
nucleotide
Prior art date
Application number
PCT/GB2000/003457
Other languages
English (en)
Other versions
WO2001020031A3 (fr
Inventor
Kazuhide Hasegawa
Yasuhiro Kikuchi
Hirofumi Nakano
Helen Molloy
Mathias Chiano
Original Assignee
Kyowa Hakko Kogyo Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9921485.0A external-priority patent/GB9921485D0/en
Application filed by Kyowa Hakko Kogyo Co Ltd filed Critical Kyowa Hakko Kogyo Co Ltd
Priority to AU70257/00A priority Critical patent/AU7025700A/en
Priority to EP00958842A priority patent/EP1210426A2/fr
Priority to JP2001523802A priority patent/JP2003514513A/ja
Publication of WO2001020031A2 publication Critical patent/WO2001020031A2/fr
Publication of WO2001020031A3 publication Critical patent/WO2001020031A3/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/172Haplotypes

Definitions

  • the present invention relates to a method for determining polymorphism(s) in a gene, as well as means for using such a method in therapeutic applications.
  • the present invention relates to a method for the diagnosis of a disease or a predisposition to a disease by screening for the presence of polymorphism(s) in a gene.
  • the present invention relates to the diagnosis of a disease or a predisposition to all or a sub-set of disease states, including age-related disease states such as metabolic syndrome, obesity, skin disorders, osteoporosis and disorders of lung function.
  • the present invention further relates to directed treatment of such disease states.
  • the present invention relates to a kit for diagnosis for susceptibility or predisposition to a number of diseases, including age-related disease, and to components for inclusion in said kit.
  • chronic disease is a significant drain on resources in both developing and developed nations.
  • diseases of the lungs - such as asthma and emphysema - and of the cardiovascular system - such as atherosclerosis - are of particular relevance to public health.
  • Chronic age related disease may also manifest itself in a multiplicity of metabolic disorders - such as obesity and high blood pressure. Consequently, the costs for both national and international public health programmes attempting to deal with the consequences of these diseases are substantial. It would therefore be desirable to provide a means for screening individuals to identify those who are predisposed to disease and especially to identify to which chronic diseases they are susceptible.
  • treatment of chronic diseases can be effective in slowing the progression of the disease, but only after the disease has been diagnosed.
  • prophylactic treatments such as hormone replacement therapy (HRT).
  • HRT hormone replacement therapy
  • BMD bone mineral density
  • HRT is generally not able to bring about a reversal of osteoporosis. That is to say, it is not capable of inducing an increase in BMD of sufferers.
  • klotho A relatively new gene, termed klotho, has been identified that is involved in the suppression of several ageing phenotypes (Kuro-o et al (1997) Nature, 390:45-51). These investigators have shown that mice possessing a defect in klotho gene expression exhibit a number of conditions that may be associated with ageing. This defect was deemed to have been caused by a severe hypomorphic mutation in the 5' upstream region. As a result, this defect may result in only a slight transcription of the klotho gene and hence only a slight suppression of ageing phenotypes. Accordingly, this type of defect, which may result in only a slight transcription of the klotho gene, may have limited relevance to the clinician.
  • the human klotho gene has also been isolated (Matsumura et al. (1998) Biochem. Biophys. Res. Comm. 242: 626-630).
  • the isolated human klotho cDNA encodes a protein of 1, 012 amino acids and shows about 86% identity to the mouse klotho protein (Kuro-o et al ibid).
  • An association has also been described between a CA-microsatellite repeat located downstream of the final exon (that is, in the non-coding 3' region) of the human klotho gene, and bone loss in post menopausal women (Ogata et al. 1998 Abstract T302 ASBMR-IBMS Second Joint Meeting).
  • the present invention seeks to provide additional means for diagnosis of disease and/or predisposition to disease.
  • the present invention also seeks to provide diagnosis and/or treatment of disease that solves or at least ameliorates the disadvantages associated with the prior art.
  • the present invention relates to methods for «ter alia identifying and/or diagnosing the presence or absence of one or more risk polymorphisms within a klotho gene sequence.
  • these methods relate to screens to determine the presence or absence of a risk polymorphism such as single nucleotide polymorphism (SNP).
  • SNP single nucleotide polymorphism
  • the methods of the present invention may also be used to determine the relative position of multiple risk polymo ⁇ hisms within a klotho gene sequence in order to provide a set of risk polymorphisms or a haplotype for a klotho gene in an individual.
  • the identified risk polymorphisms may be used to diagnose a disease and/or predisposition to disease by correlating the identified polymo ⁇ hisms with inherited genetic factors and/or phenotypic traits.
  • the identified polymo ⁇ hisms in a klotho gene may be used as targets for the discovery of agents (such as modulators) which may be effectively used to prevent or delay or treat a disease or a predisposition to a disease associated with these genetic variations.
  • typically the klotho gene is taken from an individual or is in a sample taken from an individual.
  • a method of diagnosis for a disease or a predisposition to a disease associated with a risk polymo ⁇ hism in a klotho gene from an individual wherein the risk polymo ⁇ hism is located in a region of the klotho gene selected from the group consisting of a 5' region of the klotho gene, an exon of the klotho gene and an intron of the klotho gene; wherein the method comprises: (i) genotyping a klotho gene; and (ii) determining whether the genotype comprises a risk genotype.
  • typically the individual is a human.
  • the risk polymo ⁇ hism is located in a 5' region of a klotho gene.
  • a method for identifying an SNP risk polymo ⁇ hism associated with a risk SNP risk polymo ⁇ hism in a klotho gene comprises: (i) genotyping for said SNP risk polymo ⁇ hism associated with a risk SNP risk polymo ⁇ hism in a klotho gene; and (ii) determining whether the genotype is linked to a risk genotype or is in linkage disequilibrium (LD) with a risk genotype.
  • LD linkage disequilibrium
  • LD linkage disequilibrium
  • a isolated klotho gene comprising at least one SNP risk polymo ⁇ hism is located within a klotho gene at a position selected from the group consisting of: a cvtosine at nucleotide position 1 122; a deleted adenine at nucleotide position 1337; a guanine at nucleotide position 1686; a guanine at nucleotide position 2406; a cytosine at nucleotide position 12707; an adenine at nucleotide position 12753; a cytosine at nucleotide position 19489; a thymine at nucleotide position 19969; and a thymine at nucleotide position 20445.
  • kits for diagnosis of a disease or a predisposition to disease comprising: (i) means for genotyping a klotho gene; and (ii) reference means for determining whether the genotype comprises a risk genotype.
  • the risk polymo ⁇ hism is located in an exon of the klotho gene.
  • the risk polymo ⁇ hism is located in an intron of the klotho gene.
  • the treatment is or comprises hormone replacement therapy (HRT).
  • HRT hormone replacement therapy
  • the treatment is or comprises gene therapy.
  • the risk polymo ⁇ hism is an SNP risk polymo ⁇ hism.
  • the SNP risk polymo ⁇ hism is located in a 5' region of a human klotho gene.
  • the SNP risk polymo ⁇ hism is located in an exon of a human klotho gene.
  • the SNP risk polymo ⁇ hism is located in an intron of a human klotho gene.
  • the polymo ⁇ hism has a one risk polymo ⁇ hism association.
  • the polymo ⁇ hism has a two risk polymo ⁇ hism association.
  • the risk polymo ⁇ hism(s) is/are selected from SNPs of the present invention are located within said klotho gene at the following positions: nucleotide 1122 (5' region); nucleotide 1337 (5' region); nucleotide 1686 (5' region); nucleotide 2406; nucleotide 12707 (exon 2); nucleotide 12753; nucleotide 19489 (exon 4); nucleotide 19969 (exon 4); and nucleotide 20445.
  • the SNP risk polymo ⁇ hism is located in a region selected from the group consisting of: a cytosine at nucleotide position 1122; a deleted adenine at nucleotide position 1337; a guanine at nucleotide position 1686; a guanine at nucleotide position 2406: a cytosine at nucleotide position 12707; an adenine at nucleotide position 12753; a cytosine at nucleotide position 19489; a thymine at nucleotide position 19969; and a thymine at nucleotide position 20445.
  • PCR techniques are used to genotype a nucleic acids comprising a klotho gene or part thereof from an individual.
  • the screening is carried out using PCR primers.
  • genotyping (which may be a screening method) is carried out using allelic specific primers.
  • results of genotyping of klotho polymo ⁇ hisms may be used to identify patients most likely to suffer from adverse reactions to certain therapies.
  • the invention provides for diagnosis of predisposition to reduced BMD and osteoporosis.
  • the present invention is advantageous in that it facilitates the genotyping of klotho gene polymo ⁇ hisms which:
  • (i) provides for a more accurate diagnosis of predisposition to disease states and conditions.
  • a single gene such as a klotho gene
  • an individual may be identified as being predisposed to some or all of a number of chronic diseases such as age related diseases.
  • (ii) allows for the identification of individuals who are predisposed to a range of chronic diseases or who have an increased risk of contracting such diseases. A suitable therapy may then be put in place to prevent or treat or delay the onset of these diseases.
  • the term "klotho gene” may be used interchangeably with the gene coding for same - otherwise expressed as being a nucleotide sequence of interest (NOI) - and/or any biologically active fragment(s) thereof and/or the expression product thereof - otherwise expressed as EP and/or any biologically active fragment(s) thereof.
  • NOI nucleotide sequence of interest
  • NOI includes DNA, RNA and single and double stranded sequences. It also refers to sequences which are prepared by synthetic means. For some applications, the NOI is in an isolated and/or purified form.
  • the murine klotho gene and the human klotho gene have been isolated (Kuro-o et al ibid).
  • a severe hypomo ⁇ hic mutation thought to be located in the 5' upstream region, has been identified in the murine klotho gene and has been shown to be associated with certain ageing phenotypes.
  • a microsatellite repeat associated with the progression of senile osteoporosis, has been identified downstream of the final exon in the human klotho gene (Ogata et al ibid).
  • No polymo ⁇ hisms have been located in regions such as the 5' region, exonic or intronic regions of the human klotho gene.
  • the present invention provides methods for identifying and/or diagnosing polymo ⁇ hisms in a klotho gene which are associated with phenotypic traits present in certain age related disease states.
  • Such polymo ⁇ hisms may be used to identify agents capable of modulating the onset of diseases associated with the phenotypic traits of such genetic variations.
  • the klotho gene of the present invention is different to the wild type sequence.
  • wild type refers to the published wild type nucleic acid sequence for the human klotho gene - i.e. the human klotho gene published by Matsumura et al. (1998) Biochem. Biophys. Res. Comm. 242: 626-630. This sequence is contained in Genbank records, accession numbers AB009666 and AB009667.
  • some embodiments of the present invention are based on methods for identifying klotho genes other than the wild type klotho gene.
  • the genes which are to be identified include polymo ⁇ hic or variant or allelic klotho genes with risk polymo ⁇ hisms. It is to be understood that these variant klotho genes may be identified by reference to either the wild type klotho gene or another reference/control sequence.
  • the isolated klotho gene of the present invention may be introduced into a vector and expressed under in vitro, and/or in vivo and/or ex vivo conditions.
  • the expression product may be used in applications which include but are not limited to gene therapy, identification of potential pharmaceutical targets in high throughput screening (HTS) assays and forensic analysis.
  • HTS high throughput screening
  • the isolated klotho gene of the present invention comprises at least one SNP selected from the group consisting a cytosine at nucleotide position 1122; a deleted adenine at nucleotide position 1337; a guanine at nucleotide position 1686; a guanine at nucleotide position 2406; a cytosine at nucleotide position 12707; an adenine at nucleotide position 12753; a cytosine at nucleotide position 19489; a thymine at nucleotide position 19969; and a thymine at nucleotide position 20445
  • the isolated klotho gene of the present invention is introduced into a vector and expressed under in vitro, and/or in vivo and/or ex vivo conditions.
  • polymo ⁇ hism refers to the coexistence of multiple forms of a sequence.
  • multiple refers to two or more genetically determined alternative sequences or alleles in a population.
  • allele refers to a variant form of a gene occuring at a same locus or to different sequence variants found at given markers.
  • marker refers to a specific site in a gene which exhibits sequence variations between individuals.
  • sequence variations includes but is not limited to single or multiple base changes including insertions, deletions or substitutions or a variable number of sequence repeats.
  • sequence variant and “allele” are used interchangeably with the term “polymo ⁇ hism *' .
  • the risk polymo ⁇ hisms of the present invention may be located in a region of a klotho gene. Such a region is termed a polymo ⁇ hic region.
  • ''polymo ⁇ hic region is the locus or locations at which divergence occurs.
  • Polymo ⁇ hic markers include restriction fragment length polymo ⁇ hisms (RFLPs), variable number of tandem repeats (VNTR's), single nucleotide polymo ⁇ hisms (SNPs). hypervariable regions.minisatellites. dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, simple sequence repeats, and insertion elements such as Alu.
  • RFLPs restriction fragment length polymo ⁇ hisms
  • VNTR's variable number of tandem repeats
  • SNPs single nucleotide polymo ⁇ hisms
  • hypervariable regions.minisatellites dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, simple sequence repeats, and insertion elements such as Alu.
  • a polymo ⁇ hic locus may be as small as one base pair. A one base pair change may occur in a codon.
  • cognate means a sequence of three adjacent nucleotides (a trinucleotide sequence) that may designate an amino acid or a start/stop site for translation.
  • a restriction fragment length polymo ⁇ hism means a variation in DNA sequence that alters the length of a restriction fragment as described in Botstein et al., Am. J. Hum. Genet. 32, 314-331 (1980).
  • the RFLP may create or delete a restriction site, thus changing the length of the restriction fragment.
  • RFLPs have been widely used in human and animal genetic analyses (see WO 90/13668; WO90/1 1369; Donis-Keller, Cell 51, 319-337 (1987); Lander et al Genetics 121, 85-99 (1989)).
  • a heritable trait can be linked to a particular RFLP.
  • the presence of the RFLP in an individual can be used to predict the likelihood that the individual will also exhibit the trait.
  • VNTR variable number tandem repeat
  • polymo ⁇ hisms take the form of single nucleotide variations between individuals of the same species. Such single nucleotide variations may arise due to substitution of one nucleotide for another at the polymo ⁇ hic site or from a deletion of a nucleotide or an insertion of a nucleotide relative to a referenced allele. These single nucleotide variations are referred to herein as single nucleotide polymo ⁇ hism (SNPs). Such SNPs are far more frequent than RFLPS, STRs and VNTRs.
  • SNPs may occur in protein-coding sequences, in which case, one of the polymo ⁇ hic forms may give rise to the expression of a defective or other variant protein and, potentially, a genetic disease. Other SNPs may occur in noncoding regions. Some of these polymo ⁇ hisms may also result in defective protein expression (e.g.. as a result of defective splicing). Other SNPs may have no phenotypic effects.
  • SNPs may be used in the same manner as RFLPs, and VNTRs but offer several advantages. SNPs occur with greater frequency and are spaced more uniformly throughout the genome than other forms of polymo ⁇ hism. The greater frequency and uniformity of SNPs means that there is a greater probability that such a polymo ⁇ hism will be found in close proximity to a genetic locus of interest than would be the case for other polymo ⁇ hisms. Also, the different forms of characterized SNPs are often easier to distinguish that other types of polymo ⁇ hism (e.g., by use of assays employing allele-specific hybridization probes or primers).
  • one risk polymo ⁇ hism association means that a risk polymo ⁇ hism associated with a disease state would indicate that an individual was in a risk category for that disease state.
  • identification of a risk polymo ⁇ hism in a klotho gene associated with lung dysfunction - would indicate that an individual was at risk of lung disease (one risk polymo ⁇ hism association).
  • two risk polymo ⁇ hism association means that a risk polymo ⁇ hism assocated with a first disease state (such as reduced BMD) and a second disease state (such as reduced BMD and lung dysfunction) would indicate that an individual was in a very high risk category for BMD and therefore osteoporosis (two risk polymo ⁇ hism association).
  • a means for diagnosis of disease or predisposition to disease by identifying at least two risk polymo ⁇ hisms in a klotho gene.
  • a combination of data from at least two identified polymo ⁇ hisms allows for a precise diagnosis of which disease states to which an individual is susceptible.
  • the present invention provides for a method of diagnosing a disease or a predisposition disease by genotyping a klotho gene.
  • genotyping the klotho gene the methods of the present invention enable either direct diagnosis of a disease or a diagnosis of a predisposition to certain disease conditions.
  • risk polymo ⁇ hism means a polymo ⁇ hism which is associated with a disease or a predisposition to a disease or an increased susceptibility to disease.
  • the term "genotype” means a klotho gene which has been screened for the presence of at least one risk polymo ⁇ hism at a specific genetic locus. Otherwise expressed, the screened klotho gene could be called a "genotyped klotho gene”.
  • risk genotype refers to a klotho gene which comprises at least one risk polymo ⁇ hism which is associated with at least one disease phenotype or phenotypic trait.
  • phenotype means any detectable trait that is the result of one or more genes.
  • a polymo ⁇ hisms may contribute to the phenotype of an individual in different ways. Some polymo ⁇ hisms may occur within a protein coding sequence (such as an exon) and contribute to phenotype by affecting protein structure. Other polymo ⁇ hisms may occur in non coding regions (such as a promoter region or an intron) but may exert phenotypic effects indirectly via influence on replication, transcription, and translation. A single polymo ⁇ hism may affect more than one phenotypic trait. Likewise, a single phenotypic trait may be affected by polymo ⁇ hisms in different genes. Further, some polymo ⁇ hisms predispose an individual to a distinct mutation that is causally related to a certain phenotype or phenotypic trait.
  • the polymo ⁇ hisms of the invention may contribute to the phenotype of an individual in different ways. Some polymo ⁇ hisms may occur within a protein coding sequence (such as an exon) and contribute to phenotype by affecting protein structure. Other polymo ⁇ hisms may occur in non coding regions (such as a promoter region or an intron) but may exert phenotypic effects indirectly via influence on replication, transcription, and translation. A single polymo ⁇ hism may affect more than one phenotypic trait. Likewise, a single phenotypic trait may be affected by polymo ⁇ hisms in different genes. Further, some polymo ⁇ hisms predispose an individual to a distinct mutation that is causally related to a certain phenotype.
  • the genotype of four SNP risk polymo ⁇ hisms in the human klotho gene may be used individually or in combination in the form of a haplotype for the diagnosis of a number of age related disease states.
  • haplotype means a collection or a set of polymo ⁇ hic sites in a particular gene sequence, such as a klotho gene sequence that are inherited as a group (that is, are in linkage disequilibrium (LD)).
  • a disease associated haplotype such as a set of risk polymo ⁇ hism in LD
  • the identification of a disease associated haplotype facilitates the determination of which of the risk polymo ⁇ hisms are causative rather than merely linked to a disease causing allele. This information may then be used to design rational treatment approaches.
  • the determination of disease associated alleles in LD is advantageous as it allows the diagnostic testing of more than one risk polymo ⁇ hism which helps to eliminate the possibility of false positive testing.
  • the present invention provides a method for the diagnosis of predisposition to osteoporosis using the genotype of up to three SNP risk polymo ⁇ hisms in the human klotho gene, either individually or in combination in the form of a haplotype.
  • the present invention provides a method for the diagnosis of predisposition to disorders of lung function using the genotype of three SNP risk polymo ⁇ hisms in the human klotho gene, either individually or in combination in the form of a haplotype.
  • the present invention provides a method for the diagnosis of predisposition to age related skin disorders using the genotype of two SNP risk polymo ⁇ hisms in the human klotho gene, either individually or in combination in the form of a haplotype.
  • Another example of the invention in use provides for a method for the diagnosis of predisposition to metabolic syndrome using the genotype of three SNP risk polymo ⁇ hisms in the human klotho gene, either individually or in combination in the form of a haplotype.
  • the assessment of an individual's risk factor is calculated by reference also to other known genetic or physiological or dietary or other indications.
  • the invention in this way provides further information on which measurement of an individual's risk of disease or predisposition can be based.
  • the term “genotyping” means determining whether a klotho gene includes at least one risk polymo ⁇ hism.
  • the term “genotyping” is synonymous with terms such as “genetic testing”, “genetic screening”, “determining or identifying an allele or polymo ⁇ hism”, “molecular diagnostics” or any other similiar phrase.
  • any method capable of distinguishing nucleotide differences in the appropriate sample DNA sequences may also be used.
  • a number of known different methods are suitable for use in genotyping (that is, determining the genotype) for a klotho gene of the present invention. These methods include but are not limited to direct sequencing, PCR-RFLP, ARMS-PCR, TaqmanTM, Molecular beacons, hybridization to oligonucleotides on DNA chips and arrays, single nucleotide primer extension and oligo ligation assays.
  • the present invention provides a method for genotype screening of a nucleic acid comprising a klotho gene from an individual.
  • the methods for genotype screening of a nucleic acid comprising a klotho gene from an individual may require amplification of a nucleic acids from a target sample from that individual.
  • the target samples of the present invention may be any target nucleic acid comprising a klotho gene from an individual being analyzed.
  • any biological sample other than pure red blood cells
  • convenient target samples include but are not limited to whole blood, leukocytes, semen, saliva, tears,urine. fecal material, sweat, buccal, skin and hair.
  • the target sample is typically obtained from a cell or organ in which the target nucleic acid is expressed.
  • a number of different methods are suitable for use in determining the genotype for an SNP. These methods include but are not limited to direct sequencing, PCR-RFLP. ARMS-PCR. TaqmanTM, Molecular beacons, hybridization to oligonucleotides on DNA chips and arrays, single nucleotide primer extension and oligo ligation assays. Any method capable of distinguishing single nucleotide differences in the appropriate DNA sequences may also be used.
  • amplification means nucleic acid replication involving template specificity.
  • the template specificity relates to a "target sample” or “target sequence” specificity.
  • the target sequences are “targets” in the sense that they are sought to be sorted out from other nucleic acids. Consequently, amplification techniques have been designed primarily for sorting this out. Examples of amplification methods include but are not limited to polymerase chain reaction (PCR), polymerase chain reaction of specific alleles (PASA), ligase chain reaction (LCR), transcription amplification, self-sustained sequence replication and nucleic acid based sequence amplification (NASBA).
  • PCR polymerase chain reaction
  • PASA polymerase chain reaction of specific alleles
  • LCR ligase chain reaction
  • transcription amplification self-sustained sequence replication
  • NASBA nucleic acid based sequence amplification
  • Suitable means for determining genotype may be based on the TaqmanTM technique.
  • the TaqmanTM technique is disclosed in the following US patents 4,683,202; 4,683,195 and 4,965,188.
  • the use of uracil N-glycosylase which is included in TaqmanTM allelic discrimination assays is disclosed in US patent 5,035,996.
  • PCR techniques are well known in the art (see for example, EP-A-0200362 and EP-A-0201184 and US patent Nos 4 683 195 and 4 683 202).
  • the process for amplifying the target sequence consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase.
  • PCR it is possible to amplify a single copy of a specific target sequence in, for example, genomic DNA to a level detectable by several different methodologies (such as hybridisation with a labelled probe, inco ⁇ oration of biotinylated primers followed by avidin-enzyme conjugate detection and inco ⁇ oration of j2 P labelled deoxynucleotide triphosphates, such as dCTP or dATP, into the amplified sequence).
  • markers polymo ⁇ hic sites
  • One means of analysing multiple markers involves labelling each marker with a different fluorescent probe.
  • PCR products are then analysed on a fluorescence based automated sequencer.
  • any oligonucleotide sequence may be amplified with the appropriate set of primer molecules.
  • the amplified segments created by the PCR process itself are, themselves, efficient templates for subsequent PCR amplifications.
  • PCR can also be used to identify primers for amplifying suitable sections of a klotho gene in or from a human.
  • the present invention also provides a series of useful primers.
  • primer refers to a single-stranded oligonucleotide capable of acting as a point of initiation of template-directed DNA synthesis under appropriate conditions (i.e., in the presence of four different nucleoside triphosphates and an agent for polymerization, such as, DNA or RNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature.
  • the appropriate length of a primer depends on the intended use of the primer but typically ranges from 15 to 30 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template.
  • a primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize with a template.
  • primer site refers to the area of the target DNA to which a primer hybridizes.
  • primer pair means a set of primers including a 5' upstream primer that hybridizes with the 5' end of the DNA sequence to be amplified and a 3' downstream primer that hybridizes with the complement of the 3' end of the sequence to be amplified.
  • the primers of the present invention may be DNA or RNA, and single-or double-stranded. Alternatively, the primers may be naturally occurring or synthetic, but are typically prepared by synthetic means.
  • hybridisation refers to the pairing of complementary nucleic acids. Hybridisation and the strength of hybridisation (ie the strength of association between the nucleic acids) is impacted by such factors as the degree of complementarity between nucleic acids, stringency of conditions involved, the melting temperature (Tm) of the formed hybrid and the G:C ratio within the nucleic acids.
  • stringency is used in reference to the conditions of temperature, ionic strength and the presence of other compounds such as organic solvents under which the nucleic acid hybridisations are conducted.
  • Hybridizations are typically performed under stringent conditions, for example, at a salt concentration of no more than 1M and a temperature of at least 25°C.
  • stringent conditions for example, at a salt concentration of no more than 1M and a temperature of at least 25°C.
  • 5X SSPE 750 mM NaCl. 50 mM NaPhosphate, 5 mM EDTA, pH 7.4
  • a temperature of 25-30°C. are suitable for allele-specific primer hybridizations.
  • An allele-specific primer hybridizes to a site on target DNA overlapping a polymo ⁇ hism and only primes amplification of an allelic form to which the primer exhibits perfect complementarity (See Gibbs, Nucleic Acid Res. 17, 2427-2448 (1989)).
  • This primer may be used in conjunction with a second primer which hybridizes at a distal site. Amplification proceeds from the two primers leading to a detectable product signifying the particular allelic form is present.
  • a control may be performed with a second pair of primers, one of which shows a single base mismatch at the polymo ⁇ hic site and the other of which exhibits perfect complementarily to a distal site. The single-base mismatch prevents amplification and no detectable product is formed.
  • Hybridisation probes capable of specific hybridisation to detect a single base mismatch may be designed according to methods known in the art and described in Maniatas et al Molecular Cloning: A Laboratory Manual, 2 nd Ed (1989) Cold Spring Harbour.
  • the screening is carried out using PCR allele specific primers designed to amplify portions of the human klotho gene that include either nucleotide 1686, nucleotide 12707, nucleotide 19489 or nucleotide 19969.
  • PCR primers have the following nucleotide sequences.
  • the PCR primers are designed to amplify portions of the human klotho gene that includes nucleotide 1686.
  • the PCR primers are designed to amplify portions of the human klotho gene that includes nucleotide 12707.
  • the PCR primers are designed to amplify portions of the human klotho gene that includes nucleotide 19489.
  • the PCR primers are designed to amplify portions of the human klotho gene that includes nucleotide 19969.
  • the amplified nucleic acid sequences may be detected using procedures including but not limited to allele-specific probes, tiling arrays, direct sequencing, denaturing gradient gel electrophoresis and single-strand conformation polymo ⁇ hism (SCCP) analysis.
  • procedures including but not limited to allele-specific probes, tiling arrays, direct sequencing, denaturing gradient gel electrophoresis and single-strand conformation polymo ⁇ hism (SCCP) analysis.
  • Allele-specific probes can be designed that hybridize to a segment of target DNA from one individual but do not hybridize to the corresponding segment from another individual due to the presence of different polymo ⁇ hic forms in the respective segments from the two individuals.
  • probe refers to an oligonucleotide (ie a sequence of nucleotides), whether occuring naturally as in a purified restriction digest or produced synthetically, which is capable of hybridising to another oligonucleotide sequence of interest. Probes are useful in the detection, identification and isolation of particular gene sequences.
  • the hybridization probes of the present invention are typically oligonucleotides capable of binding in a base- specific manner to a complementary strand of nucleic acid.
  • the probes of the present invention may be labelled with any "reporter molecule" so that it is detectable in any detection system, including but not limited to enzyme (for example.
  • the target sequence of interest (that is, the sequence to be detected) may also be labelled with a reporter molecule.
  • the present invention is not limited to any particular detection system or label.
  • the hybridization conditions chosen for the probes of the present invention are sufficiently stringent that there is a significant difference in hybridization intensity between alleles. and preferably an essentially binary response, whereby a probe hybridizes to only one of the alleles.
  • the typical hybridisation conditions are stringent conditions as set out above for the allele specific primers of the present invention so that a one base pair mismatch may be determined.
  • the polymo ⁇ hisms of the present invention may also be identified by hybridization to nucleic acid arrays, some example of which are described in WO 95/11995.
  • the term "tiling” generally means the synthesis of a defined set of oligonucleotide probes that is made up of a sequence complementary to the sequence to be analysed (the "target sequence"), as well as preselected variations of that sequence. The variations usually include substitution at one or more base positions with one or more nucleotides.
  • the direct analysis of the sequence of polymo ⁇ hisms of the present invention may be accomplished using either the dideoxy chain termination method or the Maxam Gilbert method (see Sambrook et al.. Molecular Cloning, A Laboratory Manual (2nd Ed., CSHP. New York 1989) or using, for example, Standard ABI sequencing technology using Big Dye Terminator cycle sequencing chemistry analyzed on an ABI Prism 377 DNA sequencer. DENATURING GRADIENT GEL ELECTROPHORESIS
  • Amplification products of the present invention which are generated using PCR, may also be analyzed by the use of denaturing gradient gel electrophoresis. Different alleles may be identified based on the different sequence-dependent melting properties and electrophoretic migration of DNA in solution. Erlich, ed., PCR Technology, Principles and Applications for DNA Amplification, (W.H. Freeman and Co, New York, 1992), Chapter 7.
  • Alleles of target sequences of the present invention may also be differentiated using single- strand conformation polymo ⁇ hism (SCCP) analysis, which identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described in Orita et al., Proc. Nat. Acad. Sci. 86. 2766-2770(1989).
  • SCCP single- strand conformation polymo ⁇ hism
  • Amplified PCR products can be generated as described above, and heated or otherwise denatured, to form single stranded amplification products.
  • Single-stranded nucleic acids may refold or form secondary structures which are partially dependent on the base sequence.
  • the different electrophoretic mobilities of single- stranded amplification products may be related to base-sequence difference between alleles of target sequences.
  • These detection procedures for amplified nucleic acid sequences may be used to identify difference of one or more points of varation between a reference and test nucleic acid sequence or to compare different polymo ⁇ hic forms of the klotho gene from two or more individuals.
  • control nucleic acid sequence means a control nucleic acid sequence such as a control DNA sequence representing one or more individuals homozygous for each of the alleles being tested in that assay.
  • control DNA sequences may include but are not limited to: (i) a genomic DNA from homozygous individuals; (ii) a PCR product containing a relevant SNP amplified from homozygous individuals; or (iii) a DNA sequence containing a relevant SNP that has been cloned into a plasmid or other suitable vector.
  • the control sample may also be an alleleic ladder comprising a plurality of alleles from known set of alleles.
  • control samples there may be a plurality of control samples, each containing different alleles or sets of alleles.
  • Other reference/control samples typically include diagrammatic representations, written 5 representations, templates or any other means suitable for identifying the presence of a polymo ⁇ hism in a PCR product or other fragment of nucleic acid.
  • the terms "reference nucleic acid sequence * ', reference samples and control samples are used interchangeable throughout the text.
  • an isolated klotho gene comprising at least one SNP selected from the group consisting a cytosine at nucleotide position 1122; a deleted adenine at nucleotide position 1337; a guanine at nucleotide position 1686; a guanine at nucleotide position 2406; a cytosine at nucleotide position 12707; an adenine at nucleotide position 12753; a cytosine at nucleotide position 19489; a thymine at nucleotide position 19969; and a thymine at nucleotide position
  • the reference sequence 15 20445 may also be used as a reference fragment for application in, for example, a kit of the invention.
  • the reference sequence may be a wild type klotho gene sequence.
  • the reference sequence may be a consensus wild type klotho gene sequence.
  • the term "consensus” refers to an idealised sequence of nucleotides. or their 0 constituent bases, that represent the nucleotides most likely to occur at each position in the sequence.
  • the term “5 " region” means a region ' which is 5' to a first exon of a structural gene such as a klotho gene.
  • the term “5 " region” includes but is not limited to regions such as a 5 * non-coding region and putative promoter regions or regions comprising promoter elements.
  • promoter refers to a segment of DNA that contains the start signals for RNA polymerase and hence promotes transcription at the start of a structural gene. It also comprises the binding site of transcription factors that regulate gene expression.
  • the promoter DNA segment is typically located in a region 5' to a structural gene. That is. the promoter DNA segment is typically located it is located in a 5 'region.
  • exon means any segment of an interrupted gene that is represented in the mature RNA product.
  • an exon may be a region within a gene that codes for a polypeptide chain or domain.
  • a mature protein is composed of several domains coded by different exons within a single gene.
  • intron refers to a segment of an interrupted gene that is not represented in the mature RNA product. Introns are part of the primary nuclear transcript but are spliced out to produce mRNA, which is then transported to the cytoplasm.
  • the term "linked” describes the tendency of genes, alleles, loci or genetic markers to be inherited together (that is, the alleles are co-inherited or co-segregate with each other) as a result of their location on the same chromosome. Linkage between genes, alleles. loci or genetic markers may be measured by percent recombination between the two genes, alleles, loci or genetic markers.
  • the present invention provides for diagnoses of disease and/or predisposition to disease by combining information from a plurality of risk polymo ⁇ hisms which are either themselves linked to certain disease states or are in linkage disequilibrium (LD) with other risk polymo ⁇ hisms.
  • risk polymo ⁇ hisms which are either themselves linked to certain disease states or are in linkage disequilibrium (LD) with other risk polymo ⁇ hisms.
  • linkage disequilibrium refers to the co-inheritance of two alleles at greater frequencies than would be expected from the separate frequencies of occurence of each allele in a given control populations.
  • LD refers to the tendency of specific alleles to occur together more frequently than would be expected by chance.
  • the cause of disequilibrium is often unclear. It may be due to certain allele combinations or to a recent admixture of genetically heterogeneous populations.
  • an association of an allele (or a group of alleles) with the disease gene is expected if the disease mutation occured in the recent past so that sufficient time has not elapsed for equilibrium to be achieved through recombination events in that small chromosomal region.
  • Alleles at a given loci are in linkage equilibrium (LE) if they occur at expected frequencies.
  • the expected frequency of occurence of two alleles that are inherited independently is the frequency of the first allele multiplied by the frequency of the second allele.
  • alleles are in linkage equilibrium if the frequency of any particular set of alleles is the product of their individual population frequencies.
  • a vector is a biological tool that allows or faciliates the transfer of an entity from one environment to another.
  • Examples of vectors used in recombinant DNA techniques include but are not limited to plasmids. chromosomes, artificial chromosomes or viruses.
  • vector includes expression vectors and/or transformation vectors.
  • expression vector means a construct capable of in vivo or in vitrolex vivo expression.
  • transformation vector means a construct capable of being transferred from one species to another.
  • the vectors comprising nucleotide sequences (NOIs) of the present invention may be introduced into suitable host cells using a variety of techniques known in the art, such as transfection. transformation, electroporation and biolistic transformation.
  • transfection refers to a process using a non-viral vector to deliver a gene to a target mammalian cell.
  • Typical transfection methods include electroporation, DNA biolistics. lipid-mediated transfection, compacted DNA-mediated transfection, liposomes, immunoliposomes, lipofectin, cationic agent-mediated, cationic facial amphiphiles (CFAs) (Nature Biotechnology 1996 14; 556), multivalent cations such as spermine, cationic lipids or polylysine, 1, 2. -bis (oleoyloxy)-3-(trimethylammonio) propane (DOTAP)-cholesterol complexes (Wolff and Trubetskoy 1998 Nature Biotechnology 16: 421) and combinations thereof.
  • CFAs cationic facial amphiphiles
  • Suitable host cells include bacteria such as E. coli, yeast, filamentous fungi, insect cells, mammalian cells, typically immortalized, e.g.. mouse, CHO, human and monkey cell lines and derivatives thereof.
  • Preferred host cells are able to process the NOI expression products (EPs) to produce an appropriate mature polypeptide. Processing includes but is not limited to glycosylation, ubiquitination, disulfide bond formation and general post-translational modification.
  • the nucleotide sequence of interest (NOI) which is inserted into a vector is operably linked to a control sequence that is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector.
  • the expression product (EP) produced by a host recombinant cell may be secreted or may be contained intracellularly depending on the sequence and/or the vector used.
  • expression vectors containing the NOI can be designed with signal sequences which direct secretion of the NOI coding sequences through a particular prokaryotic or eukaryotic cell membrane.
  • the present invention also encompasses gene therapy whereby the NOI is regulated in vitrolin vivo/ex vivo.
  • expression regulation may be accomplished by administering compounds that bind to NOI or control regions associated with the NOI, or its corresponding RNA transcript to modify the rate of transcription or translation.
  • Control sequences that may be operably linked to sequences encoding the NOI include promoters/enhancers and other expression regulation signals. These control sequences may be selected to be compatible with the host cell and/or target cell in which the expression vector is designed to be used. The control sequences may be modified, for example by the addition of further transcriptional regulatory elements to make the level of transcription directed by the control sequences more responsive to transcriptional modulators.
  • operably linked means that the components described are in a relationship permitting them to function in their intended manner.
  • a regulatory sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under condition compatible with the control sequences.
  • the NOIs of the present invention can be expressed in an expression vector in which a variant gene is operably linked to a native promoter or other promoter.
  • the promoter is a eukaryotic promoter for expression in a mammalian cell.
  • the transcription regulation sequences typically include a heterologous promoter and optionally an enhancer which is recognized by the host.
  • the selection of an appropriate promoter for example t ⁇ , lac, phage promoters, glycolytic enzyme promoters and tRNA promoters, depends on the host selected.
  • Commercially available expression vectors may also be used.
  • Vectors may also include but are not limited to host-recognized replication systems, amplifiable genes, selectable markers, host sequences useful for insertion into the host genome.
  • the expression product may be isolated by conventional means of protein biochemistry and purification to obtain a substantially pure product, i.e., 80, 95 or 99% free of cell component contaminants, as described in Jacoby, Methods in Enzymology Volume 104, Academic Press, New York (1984); Scopes, Protein Purification, Principles and Practice, 2nd Edition, Springer-Verlag. New York (1987); and Deutscher (ed), Guide to Protein Purification, Methods in Enzymology, Vol. 182 (1990). If the EP is secreted, it can be isolated from the supernatant in which the host cell is grown. If not secreted, the EP can be isolated from a lysate of the host cells.
  • the invention further provides transgenic nonhuman animals capable of expressing the NOI of the present invention and or having one or more of the NOIs inactivated and/or removed.
  • Expression of an NOI is usually achieved by operably linking the NOI to a promoter and optionally an enhancer, and microinjecting the construct into a zygote. See Hogan et al., "Manipulating the Mouse Embryo, A Laboratory Manual," Cold Spring Harbor Laboratory.
  • Inactivation of NOIs can be achieved by forming a transgene in which a cloned NOI is inactivated by insertion of a positive selection marker. See Capecchi, Science 244, 1288-1292 (1989). The transgene is then introduced into an embryonic stem cell, where it undergoes homologous recombination with an endogenous variant gene. Mice and other rodents are preferred animals. Such animals provide useful drug screening systems.
  • the EPs of the present invention may include biologically active fragments, or analogs thereof, including organic molecules which simulate the interactions of the peptides.
  • biologically active fragments include any portion of the full-length polypeptide which confer a biological function on the EP, including ligand binding, and antibody binding.
  • Ligand binding includes binding by nucleic acids, proteins or polypeptides, small biologically active molecules, or large cellular structures.
  • Antibodies that specifically bind to NOIs of the present invention but not to corresponding wild type gene products are also provided.
  • Antibodies can be made by injecting mice or other animals with the NOI EP or synthetic peptide fragments thereof. Monoclonal antibodies may be screened as is described, for example, in Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1988); Goding, Monoclonal antibodies, Principles and Practice (2d ed.) Academic Press, New York (1986). Monoclonal antibodies may be tested for specific immunoreactivity with an NOI EP and lack of immunoreactivity to the corresponding wild type gene product. These antibodies are useful in diagnostic assays for detection of the variant form, or as an active ingredient in a pharmaceutical composition.
  • the NOIs of the present invention and/or a cell line that expresses the NOIs of the present invention may be used to screen for agents capable of affecting the expression of the sequences and/or the biological activity of the EPs thereof.
  • agent may include but is not limited to a chemical compound, a mixture of chemical compounds, peptides, organic or inorganic molecules a biological macromolecule, or an extract made from biological materials such as bacteria, fungi, or animal (particularly mammalian) cells or tissues.
  • the screens of the present invention may identify agonists and/or antagonists of the expression product of the present invention.
  • the NOIs of the present invention may be used in a variety of drug screening techniques.
  • the NOI or EP thereof to be employed in such a test may be free in solution, affixed to a solid support, borne on a cell surface, or located intracellularly. The abolition of binding specificity/biological activity or the formation of binding complexes between the NOI and or EP thereof and the agent being tested may be measured.
  • HTS high throughput screening
  • the invention further provides for a method of identifying a compound to prevent and/or delay and/or reduce and/or treat a disease and/or a predisposition to a disease comprising the steps of: (a) administring a compound to an animal tissue; and (b) determining whether said compound modulates an NOI of the present invention.
  • a range of compounds are administered to animal cells in tissue culture (in vitro).
  • modulators of klotho gene expression and function can be screened. Modulation of the klotho gene can either be determined by assessing whether the candidate compound affects levels of expression of a klotho gene, or whether klotho gene expression product (EP) function is affected.
  • the invention also provides for administration of candidate compounds, that may modulate a klotho gene, to animal tissues in vivo, i.e. administration of compounds to live animals and then assessing their effects by routine methods such as histopathological analysis of tissues.
  • the methods of diagnosis of predisposition to all these disease states involve determining whether an individual possesses the published wild-type sequence or the polymo ⁇ hism at one or more of the polymo ⁇ hic sites. In this respect, the genotype of the individual is compared with the phenotype of the individual.
  • the term "phenotype" means any detectable trait of an individual that is the result of one or more genes.
  • predisposition to a disease means that certain risk polymo ⁇ hisms are shown to be associated with a given disease state. They are thus over represented in individuals with disease as compared with healthy individuals and indicate that these individuals may be at higher risk for developing disease or may develop a more severe form or particular subset of a disease type.
  • the disease states which may be associated with risk polymo ⁇ hisms in the klotho gene include, but are not limited to: metabolic syndrome; obesity; skin disorders; skin atrophy; a reduction in bone mineral density (BMD); osteopaenia; osteoporosis; an age-related disease; a cancer; a cardiovascular disease; blood pressure disorders; emphysema and lung dysfunction and/or a contributory component disease component thereof.
  • the predisposition of an individual to osteoporosis may be assessed by determining whether that individual contains a risk polymo ⁇ hism of a klotho gene.
  • the therapeutic regime of the present invention may be tailored to the needs of the individual being treated and exposure to adverse side effects minimised.
  • the present invention can therefore be utilised to identify which individuals would be most likely to benefit from, for example, gene therapies.
  • Gene therapy techniques include but are not limited to techniques which replace a faulty gene, such as a klotho gene and/or which downregulate expression of the gene and/or function of the gene product.
  • the present invention provides for a method of treating age related disease in an individual, comprising the steps of: (a) genotyping a klotho gene; (b) JJ
  • the methods of diagnosis of the present invention may be suitable for use in combination with a range of treatments for those suffering or predisposed to disease conditions such as osteoporosis. These treatments include hormone replacement therapy and/or the administration of biphosphonates.
  • Another suitable treatment for osteoporosis is use of bisphosphonates.
  • Two specific treatments involve using xanthine oxidase inhibitors or substituted benzodiazepines and are described in US-A-5436258 and US-A-5441964, the contents of which are inco ⁇ orated herein by reference. Still further treatments will be known to a person of skill in the art. Potential treatments are described, for example, in JP-A-09030977, WO-A-97/06254, JP-A-09025293, WO-A-97/04799, WO-A-97/03060 and JP-A-09012592.
  • authorised treatments for osteoporosis include the use of oestrogens.
  • HRT Hormone replacement therapy
  • a prophylactic therapy that can be used to pre-empt onset of a disease (such as osteoporosis) and can be implemented before symptoms become apparent with the intention of delaying or even preventing the disease.
  • a disease such as osteoporosis
  • the invention offers the advantage that the increased risk of breast cancer associated with HRT can be accepted only by those women who are known to have a likelihood of predisposition to osteoporosis.
  • Osteoporosis is a common condition characterised by reduced bone mass, microarchitectural deterioration of bone tissue and increased fracture risk.
  • the risk of osteoporotic fracture is related to bone mineral density (BMD), which in turn is under genetic control.
  • the present invention provides for a method of treating disease in a human, comprising the steps of (a) genotyping a klotho gene in said human; (b) determining whether said genotype comprises a risk genotype; and (c) if said genotype comprises a risk genotype, applying a treatment to said human in order to prevent, delay or reduce said disease.
  • osteoporosis In pharmaceutical treatment of osteoporosis, all routes of administration are suitable and include but are not limited to oral administration, injection intravenously, intraperitoneally, intramuscularly and subcutaneously, intranasal administration and topical administration. Typical dosages and durations of treatment are as described in clinician's textbooks such as British National Formulary, inco ⁇ orated herein by reference.
  • FDA Food and Drug Administration
  • Testosterone replacement therapy may be prescribed for a man with a low testosterone level.
  • Calcitonin is a medication that slows or stops bone loss and may relieve the pain of fractures in some patients.
  • Calcitonin is approved by the FDA for the treatment of osteoporosis in postmenopausal women. While its effect in men has not been studied, evidence suggests that it may work the same in men as in women. Calcitonin is available as an injection and as a nasal spray. Its use is described in US-A-5440012.
  • Bisphosphonates are a class of drugs that have been shown to help preserve and increase bone density by slowing or stopping bone loss.
  • the FDA has approved the bisphosphonate known as alendronate for the treatment of postmenopausal osteoporosis in women; it is currently being studied for treatment of osteoporosis in men.
  • Sodium fluoride has recently been recommended for approval by an FDA committee.
  • Parathyroid hormone, calcitriol, and others are investigational drugs. It will be some time before research findings are available on these preparations. Decrease in bone mineral density can also be slowed by taken calcium supplements, and some suggested levels are 1 ,000 mg of calcium a day for women on oestrogen replacement therapy and 1,500 mg of calcium daily for women not receiving oestrogen therapy.
  • modulators of a klotho gene of the present invention include but are not limited to compounds and substances that affect the expression of the gene as well as the activity and/or amount of the expressed gene product.
  • Typical modulators suitable for use in the invention include klotho agonists and or antagonists - either of a klotho gene or of the klotho gene product; large and small molecular weight inhibitors of klotho gene expression or function; inducers and suppressors of a klotho gene; antisense sequences - including antisense oligonucleotides to a klotho gene or transcript; antibodies; klotho gene product binding proteins - including dominant negative versions of the klotho gene product that may be involved in oligomerisation; and klotho gene product kinases; or fragments, variants and derivatives thereof.
  • An example of a modulator according to the invention is an antisense oligonucleotide that binds to and prevents or reduces transcription of klotho mRNA. This modulator may be used to reduce the activity and/or amount of a klotho gene EP.
  • an antisense nucleic acid to the klotho NOIs of the present invention may be produced by any method including the synthesis of the klotho NOIs in a reverse orientation to a promoter which permits the synthesis of the coding strand.
  • This transcribed strand may combine with, for example, a natural rriRNA produced by a cell to form a duplex. These duplexes may then block either the further transcription of the mRNA and/or its translation.
  • Another suitable modulator is the EP itself, which can be administered by injection and is used to increase the activity and/or amount of the klotho EP.
  • a further embodiment of the present invention provides for a method of preventing and/or treating disease comprising administering a modulator of a klotho NOI.
  • the modulators of the klotho gene of the present invention may be suitable for a number of disease states and conditions. Such modulators may be suitable for either prophylactic administration or after a disease has been diagnosed.
  • the route of administration is suitably chosen according to the disease or condition to be treated, however, typical routes of administration of the modulator of the present invention include but are not limited to oral, rectal, intravenous, parenteral, intramuscular and sub-cutaneous routes.
  • the invention also provides for klotho modulators to be administered either as DNA or RNA and thus as a form of gene therapy, or as proteins.
  • the modulators may be delivered into cells directly by means including but not limited to liposomes, viral vectors and coated particles (gene gun).
  • the modulators of the invention may be suitable for treatment of a range of diseases and conditions. In some individuals a combination of diseases may be present or predicted wherein in others only one is diagnosed. Diseases and conditions for which modulators of the klotho may be suitably used for treatment typically include diseases such as metabolic syndrome; diabetes; obesity; skin disorders; skin atrophy; reduction in bone mineral density; osteopaenia; osteoporosis; age-related disease; cancer; cardiovascular disease; blood pressure disorders; emphysema and lung dysfunction. Syndromes such as age-related disease and metabolic syndrome are known clinically to manifest as a wide range of physiological conditions and therefore include other conditions, some of which are described in more detail in the examples and figures below.
  • the present invention also provides for a kit for diagnosis of or predisposition to disease, said kit typically comprising: (a) means for determining the genotype of a klotho gene in a human; and (b) reference means for identifying the presence of a risk polymo ⁇ hism.
  • the kit of the present inventon contains all of the necessary components to determine the presence/absence of a polymo ⁇ hism of the present invention in an individual.
  • these components include, but are not limited to, PCR primers, PCR enzymes, restriction enzymes, a DNA purification means, a DNA sampling means and any other component useful for determining a polymo ⁇ hic difference between the wildtype klotho gene and an allelic klotho variant of the present invention.
  • the kits may comprise at least one allele-specific oligonucleotide primer and/or allele-specific oligonucleotide probe.
  • kits contain one or more pairs of allele-specific oligonucleotides capable of hybridizing to different forms of a polymo ⁇ hism.
  • the allele-specific oligonucleotides may be immobilized to a substrate.
  • the same substrate can comprise allele-specific oligonucleotide probes for detecting at least the SNP risk polymo ⁇ hisms such as those discussed above.
  • Optional additional components of the kit may include, for example, means used to label (for example, an avidin enzyme conjugate and enzyme substrate and chromogen if the label is biotin), and the appropriate buffers for reverse transcription, PCR, or hybridization reactions.
  • the control/reference sample may comprise a wild type klotho gene or may contain an allele known to be associated with an age-related disease.
  • the reference/control sample may comprise actual PCR products produced by amplification of relevant disease related alleles or may contain genomic or cloned DNA from an individual with a known set of particular disease related alleles.
  • the kit also contains instructions for carrying out the methods.
  • the kit may also contain a modulator capable of overcoming the risk polymo ⁇ hism.
  • the kits may be used for detection and measurement of the risk polymo ⁇ hism, such as SNPs, in biological fluids and tissues, and for localization of an SNP in tissues.
  • the kits may also be used in simultaneously or sequentially with a modulator.
  • methods and means are described for diagnosing a disease or a predisposition to disease by genotyping a klotho gene from an individual and identifying the presence of one or more risk polymo ⁇ hisms. These risk polymo ⁇ hisms are associated either directly or indirectly with predisposition to a range of chronic diseases including osteoporosis, skin disorders, age- related disease, lung dysfunction and metabolic syndrome. Methods of treatment, kits for diagnostic pu ⁇ oses and an isolated klotho gene including all or some of a range of polymo ⁇ hisms are also described as well as methods of isolating molecules that modulate a klotho gene.
  • the present invention relates to a method of diagnosis for a disease or a predisposition to a disease associated with a risk polymo ⁇ hism in a klotho gene wherein the risk polymo ⁇ hism is an SNP risk polymo ⁇ hism; and wherein the method comprises: (i) genotyping a klotho gene; and (ii) determining whether the genotype comprises a risk genotype.
  • the present invention also relates to a method of diagnosis for a disease or a predisposition to a disease associated with a risk polymo ⁇ hism in a klotho gene from an individual; wherein the risk polymo ⁇ hism is located in a region of the klotho gene selected from the group consisting of a 5' region of the klotho gene, an exon of the klotho gene and an intron of the klotho gene; wherein the method comprises: (i) genotyping a klotho gene; and (ii) determining whether the genotype comprises a risk genotype.
  • the present invention also relates to a method of preventing and/or treating a disease or a predisposition to a disease associated with a risk polymo ⁇ hism in a klotho gene wherein the risk polymo ⁇ hism is an SNP risk polymo ⁇ hism; wherein the method comprises: (i) genotyping a klotho gene; (ii) determining the presence of a risk genotype: and (iii) applying a treatment in order to prevent, delay, reduce or treat the disease or the predisposition to the disease if said klotho gene comprises said risk genotype.
  • the present invention also relates to a method of preventing and/or treating a disease or a predisposition to a disease associated with a risk polymo ⁇ hism in a klotho gene from an individual; wherein the risk polymo ⁇ hism is located in a region of the klotho gene selected from the group consisting of a 5' region, an exon of the klotho gene and an intron of the klotho gene; wherein the method comprises: (i) genotyping a klotho gene; (ii) determining the presence of a risk genotype; and (iii) applying a treatment in order to prevent, delay, reduce or treat the disease if said klotho gene comprises said risk genotype.
  • the present invention also relates to a method for identifying an SNP risk polymo ⁇ hism associated with a known risk SNP risk polymo ⁇ hism in a klotho gene; wherein the method comprises: (i) genotyping for said SNP risk polymo ⁇ hism associated with an SNP risk polymo ⁇ hism in a klotho gene; and (ii) determining whether the genotype is linked to a risk genotype or is in linkage disequilibrium (LD) with a risk genotype.
  • LD linkage disequilibrium
  • the present invention also relates to a method of identifying a risk polymo ⁇ hism in a klotho gene that is associated with a known risk polymo ⁇ hism in a klotho gene from an individual; wherein the risk polymo ⁇ hism is located in a region of the klotho gene selected from the group consisting of a 5' region of the klotho gene, an exon of the klotho gene and an intron of the klotho gene; wherein the method comprises: (i) genotyping for said SNP risk polymo ⁇ hism associated with an SNP risk polymo ⁇ hism in a klotho gene; and (ii) determining whether the gentotype is linked to a risk genotype or is in linkage disequilibrium (LD) with a risk genotype.
  • LD linkage disequilibrium
  • the present invention also relates to an isolated klotho gene comprising at least one SNP risk polymo ⁇ hism is located within a klotho gene at a position selected from the group consisting of: a cytosine at nucleotide position 1122; a deleted adenine at nucleotide position 1337; a guanine at nucleotide position 1686; a guanine at nucleotide position 2406; a cytosine at nucleotide position 12707; an adenine at nucleotide position 12753; a cytosine at nucleotide position 19489: a thymine at nucleotide position 19969; and a thymine at nucleotide position 20445.
  • the present invention also relates to a kit for diagnosis of a disease or a predisposition to disease, wherein the kit comprises: (i) means for genotyping a klotho gene; and (ii) reference means for determining whether the genotype comprises a risk genotype.
  • a method of diagnosing disease or predisposition to disease comprising genotyping a klotho gene. 2. A method according to paragraph 1, wherein said method comprises determining whether said klotho gene includes at least one risk polymo ⁇ hism, wherein presence of said risk polymo ⁇ hism is diagnostic of disease or predisposition to disease.
  • a method according to paragraph 2, wherein said method comprises determining whether said klotho gene includes at least two risk polymo ⁇ hisms.
  • risk polymo ⁇ hism comprises a single nucleotide polymo ⁇ hism (SNP).
  • said risk polymo ⁇ hism comprises a SNP located within said klotho gene at a position selected from the group consisting of nucleotide 1 122; nucleotide 1337; nucleotide 1686; nucleotide 2406; nucleotide 12707; nucleotide 12753; nucleotide 19489; nucleotide 19969; and nucleotide 20445.
  • SNP selected from the group consisting of a cytosine at nucleotide position 1122; a deleted adenine at position 1337; a guanine at position 1686; a guanine at position 2406; a cytosine at position 12707; an adenine at position 12753; a cytosine at position 19489; a thymine at position 19969; and a thymine at position 20445.
  • said disease comprises at least one of the conditions selected from the group consisting of metabolic syndrome; obesity; skin disorders; skin atrophy; reduction in bone mineral density; osteopaenia; osteoporosis; age- related disease; cancer; cardiovascular disease; blood pressure disorders; emphysema and lung dvsfunction.
  • a method of treating disease comprising: (a) genotyping a klotho gene; (b) determining whether said genotype comprises a risk genotype; and (c) if said genotype comprises a risk genotype, administering prophylactic treatment in order to prevent, delay or reduce said disease.
  • risk polymo ⁇ hism is located in a region of a klotho gene selected from the group consisting of a 5' non-coding region, a promoter element, an exon and an intron.
  • said risk polymo ⁇ hism comprises at least one SNP located at a position selected from the group consisting of nucleotide 1122; nucleotide 1337; nucleotide 1686; nucleotide 2406; nucleotide 12707; nucleotide 12753; nucleotide 19489; nucleotide 19969; and nucleotide 20445.
  • said risk polymo ⁇ hism comprises at least one SNP selected from the group consisting of a cytosine at nucleotide position 1122; a deleted adenine at position 1337; a guanine at position 1686; a guanine at position 2406; a cytosine at position 12707; an adenine at position 12753; a cytosine at position 19489; a thymine at position 19969; and a thymine at position 20445.
  • SNP selected from the group consisting of a cytosine at nucleotide position 1122; a deleted adenine at position 1337; a guanine at position 1686; a guanine at position 2406; a cytosine at position 12707; an adenine at position 12753; a cytosine at position 19489; a thymine at position 19969; and a thymine at position 20445.
  • said disease comprises at least one of the conditions selected from the group consisting of metabolic syndrome; obesity; skin disorders; skin atrophy; reduction in bone mineral density; osteopaenia; osteoporosis; age- related disease; cancer; cardiovascular disease; blood pressure disorders; emphysema and lung dysfunction.
  • a method according to any of paragraph 9 to 14, wherein said prophylactic treatment comprises hormone replacement therapy (HRT). 16. A method according to any of paragraph 9 to 15 wherein said prophylactic treatment comprises gene therapy.
  • HRT hormone replacement therapy
  • a method of treating age related disease in a human comprising: (a) genotyping a klotho gene in said human; (b) determining whether said genotype is a risk genotype; and (c) if said genotype is a risk genotype, administering prophylactic treatment to said human for said age related disease.
  • a kit for diagnosis of disease or predisposition to disease comprising: (a) means for determining the genotype of a klotho gene; and (b) reference means for identifying presence of a risk polymo ⁇ hism.
  • An oligonucleotide primer comprising the sequence: 5' AAATCTACTTTGTCTTCCTCG 3'
  • oligonucleotide primer comprising the sequence:
  • oligonucleotide primer comprising the sequence: 5' TGAATCTGAGAAAAAGT ⁇ CATC S "
  • An oligonucleotide primer comprising the sequence: 5' CATTTATGTTAGATAATCTTAGAG 3'
  • An oligonucleotide primer comprising the sequence: 5' AGTGGAATATTGTCTTCCTC 3'
  • An oligonucleotide primer comprising the sequence: 5' CCATAGGCTGCCACAGGG 3
  • An oligonucleotide primer comprising the sequence: 5' CACCATCCTGCAGTACTATC 3' 26.
  • An oligonucleotide primer comprising the sequence: 5' TTTGGTTCAGCCAGTCCCTC 3'
  • An isolated klotho gene comprising at least one SNP selected from the group consisting a cytosine at nucleotide position 1 122; a deleted adenine at position 1337; a guanine at position
  • a method of indentification of a polymo ⁇ hism that is correlated with a known polymo ⁇ hism in a klotho gene comprising:- (a) locating a polymo ⁇ hism and correlating it with the known klotho gene polymo ⁇ hism; and (b) determining whether the new polymo ⁇ hism is linked to disease or any contributory component thereof.
  • a method according to paragraph 28, comprising determining whether the new polymo ⁇ hism is linked to a condition selected from the group consisting of metabolic syndrome: obesity; skin disorders; skin atrophy; reduction in bone mineral density; osteopaenia; osteoporosis; age-related disease; cancer; cardiovascular disease; blood pressure disorders; emphysema and lung dysfunction, or a contributory component thereof.
  • a method of treating disease comprising administering a modulator of a klotho gene.
  • said disease comprises at least one of the conditions selected from the group consisting of metabolic syndrome; diabetes; obesity; skin disorders; skin atrophy; reduction in bone mineral density; osteopaenia; osteoporosis; age- related disease; cancer; cardiovascular disease; blood pressure disorders; emphysema and lung dysfunction.
  • said modulator comprises a molecule selected from the group consisting of klotho agonists and / or antagonists; small molecular weight inhibitors of klotho gene expression or function; inducers and suppressors of a klotho gene; antisense sequences; antibodies; klotho gene product binding proteins; and klotho gene product kinases; or fragments, variants and derivatives thereof.
  • 33 A method of identifying a compound for treatment of disease, comprising: (a) administration of a compound to animal tissue; and (b) determining whether said compound modulates a klotho gene.
  • Fig 1 shows a schematic representation of the human klotho gene with the SNP risk polymo ⁇ hisms of the present invention and their correlation to disease states indicated underneath.
  • the solid coloured bar represents an association detected between an SNP and phenotype at a significance level of 0.05 or less.
  • Fig 2 shows a schematic representation of the human klotho gene with the SNP risk polymo ⁇ hisms of the present invention and their correlation to disease states indicated underneath.
  • a grey bar represents an association detected between an SNP and phenotype at a significance level of between 0.050 and 0.095.
  • the DNA sequence of the human klotho gene has been published by Matsumura et al. (1998) Biochem. Biophys. Res. Comm. 242: 626-630. This sequence which is contained in Genbank records, accession numbers AB009666 and AB009667 is referred to as the wild type sequence.
  • PCR primers were designed to amplify exons 1 to 5 of the human Klotho gene and 2 Kb of sequence 5' to exon 1, containing the putative promoter regions of the gene. These PCR products were screened to identify common polymo ⁇ hisms. SNP detection was performed by Standard ABI sequencing technology using Big Dye Terminator cycle sequencing chemistry analyzed on an ABI Prism 377 DNA sequencer.
  • LD pair- wise linkage disequilibrium
  • This analysis is based on a total of 2870 female twin subjects comprising 1025 dizygotic (DZ) pairs and 410 monozygotic (MZ) twin pairs. 1086 women (37.8%) were pre-menopausai and
  • a known technique that is suitable for genotyping the SNPs mentioned above is Taqman .
  • two allele specific probes were included in the PCR reaction along with PCR primers. Allelic discrimination was achieved by hybridization of the appropriate probe to the polymo ⁇ hic site followed by subsequent cleaving of the probe by the 5' nuclease activity of Taq polymerase during PCR extension of the primers.
  • Primers and probes thus obtained are suitable for screening nucleotide 1686, nucleotide 12707, nucleotide 19489 and nucleotide 19969.
  • Table 4 includes examples of primers and probes that are suitable for use in genotyping the klotho gene SNP risk polymo ⁇ hisms using the TaqmanTM technique
  • Example 3 Diagnosis of predisposition to osteoporosis based on genotyping of the human klotho gene
  • the homozygous T/T genotype at nucleotide 19489 was found to be associated with forearm and spine BMD in postmenopausal women.
  • the homozygous T/T genotype at nucleotide 19489 (Genbank accession number AB009666) and the homozygous G/G genotype at nucleotide 12707 (Genbank accession number AB009667) were associated decreased VOS in postmenopausal women.
  • the heterozygous G/C genotype at nucleotide 12707 was associated with lower forced expiratory volume (FEV) and forced expiratory volume/ forced vital capacity ratio (FEV/FVC) in pre-menopausai women.
  • FEV forced expiratory volume
  • FEV/FVC forced expiratory volume/ forced vital capacity ratio
  • the homozygous C/C genotype at nucleotide 19489 was associated lower FEV pre-menopausai women.
  • the C/C homozygous genotype at nucleotide 19969 was associated with lower FVC.
  • the homozygous A/A genotype at nucleotide 1686 was associated with lower serum triglyceride levels in pre-menopausai women.
  • the homozygous C/C genotype at nucleotide 12707 was also associated with lower serum triglyceride levels in pre-menopausai women.
  • the C T heterozygous genotype at nucleotide 19489 was associated with increased total fat mass and increased weight.
  • Table 1 Position and nature of SNPs identified in the human klotho gene
  • Table 2 Estimate of frequency of rarer alleles in 192 unrelated individuals.

Abstract

L'invention concerne des procédés et des moyens permettant de diagnostiquer une maladie ou une prédisposition à une maladie par génotypage d'un gène klotho à partir d'un individu et identification de l'existence d'au moins un risque de polymorphisme. Ces risques sont associés, directement ou indirectement, à la prédisposition à une gamme de maladies chroniques, notamment l'ostéoporose, des troubles cutanés, des maladies liées à l'âge, des dysfonctionnements pulmonaires et des syndromes métaboliques. L'invention traite en outre de procédés de traitement, de trousses de diagnostic et d'un gène klotho isolé comprenant tout ou partie d'une gamme de polymorphismes, ainsi que de procédés d'isolation de molécules modulant un gène klotho.
PCT/GB2000/003457 1999-09-10 2000-09-08 Polymorphismes dans un gene klotho WO2001020031A2 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU70257/00A AU7025700A (en) 1999-09-10 2000-09-08 Polymorphisms in a klotho gene
EP00958842A EP1210426A2 (fr) 1999-09-10 2000-09-08 Polymorphismes dans un gene klotho
JP2001523802A JP2003514513A (ja) 1999-09-10 2000-09-08 クロソ遺伝子中の多型

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB9921485.0 1999-09-10
GBGB9921485.0A GB9921485D0 (en) 1999-09-10 1999-09-10 Polymorphisms in a klotho gene
GB0006171.3 2000-03-14
GB0006171A GB0006171D0 (en) 1999-09-10 2000-03-14 Polymorphisms in a klotho gene

Publications (2)

Publication Number Publication Date
WO2001020031A2 true WO2001020031A2 (fr) 2001-03-22
WO2001020031A3 WO2001020031A3 (fr) 2002-03-14

Family

ID=26243878

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2000/003457 WO2001020031A2 (fr) 1999-09-10 2000-09-08 Polymorphismes dans un gene klotho

Country Status (4)

Country Link
EP (1) EP1210426A2 (fr)
JP (1) JP2003514513A (fr)
AU (1) AU7025700A (fr)
WO (1) WO2001020031A2 (fr)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002092850A2 (fr) * 2001-05-17 2002-11-21 The University Court Of The University Of Aberdeen Procede servant a diagnostiquer l'osteoporose et les troubles associes
WO2008135993A1 (fr) * 2007-05-08 2008-11-13 Tel Hashomer Medical Research Infrastructure And Services Ltd. Protéine klotho et composés apparentés destinés au traitement et au diagnostic du cancer
WO2010064247A1 (fr) 2008-12-03 2010-06-10 Tel Hashomer Medical Research Infrastructure And Services Ltd. Procédés et trousses pour déterminer une prédisposition au cancer
CN102465182A (zh) * 2010-10-29 2012-05-23 株式会社爱茉莉太平洋 检测皮肤活性物质的检测试剂盒和检测皮肤活性物质的方法
US8530392B2 (en) 2009-05-13 2013-09-10 Shionogi & Co., Ltd. Test agent for visceral obesity and use thereof
CN106957921A (zh) * 2017-05-18 2017-07-18 中国水产科学研究院珠江水产研究所 一种适合食人工配合饲料大口黑鲈klotho基因的SNP位点及其在育种中的应用
US9873748B2 (en) 2013-12-23 2018-01-23 Genentech, Inc. Bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1
EP2550972B1 (fr) 2007-04-02 2018-02-21 Genentech, Inc. Un anticorps agoniste de Klotho-béta à utiliser dans le traitement du diabète et de la résistance à l'insuline
US10555963B2 (en) 2007-05-08 2020-02-11 Tel Hashomer Medical Research Infrastructure And Services Ltd. Klotho protein and related compounds for the treatment and diagnosis of cancer
US10800843B2 (en) 2015-07-29 2020-10-13 Ngm Biopharmaceuticals, Inc. Beta klotho-binding proteins
EP3879271A1 (fr) * 2020-03-10 2021-09-15 SALION GmbH Détection de klotho
WO2022008971A2 (fr) 2020-07-09 2022-01-13 Costa Rican Social Security Fund / Caja Costarricense de Seguro Social (CCSS) Traitement d'une infection à coronavirus associé au syndrome respiratoire aigu sévère avec klotho

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4696294B2 (ja) * 2004-08-30 2011-06-08 学校法人慶應義塾 評価方法、ヒト・エストロゲン受容体遺伝子、ゲノムdna、及び診断マーカー
EA035077B1 (ru) * 2017-08-14 2020-04-24 Федеральное Государственное Бюджетное Научное Учреждение "Научно Исследовательский Институт Медицины Труда Имени Академика Н.Ф. Измерова" (Фгбну "Нии Мт") Способ прогнозирования риска развития синтропии бронхиальной астмы и метаболического синдрома

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CHEMICAL ABSTRACTS, vol. 128, no. 18, 4 May 1998 (1998-05-04) Columbus, Ohio, US; abstract no. 216023, NAGAI, RYOZO ET AL: "Molecular genetics of cardiovascular diseases" XP002172678 & RINSHO BYORI (1998), 46(3), 249-257 , *
CHEMICAL ABSTRACTS, vol. 132, no. 12, 20 March 2000 (2000-03-20) Columbus, Ohio, US; abstract no. 149834, KAWAGUCHI, HIROSHI: "klotho gene and bone metabolism" XP002172677 & BONE (OSAKA) (1999), 13(3), 89-95 , *
MATSUMURA, Y. ET AL.: "Identification of the Human Klotho Gene and Its Two Transcripts Encoding Membrane and Secreted Klotho Protein" BIOCHEM. BIOPHYS. RES. COMMUN., vol. 242, 1998, pages 626-630, XP002172676 *
OGATA, N. ET AL.: "Association of Polymorphism of Human Klotho Locus with Lumbar Spondilosys" J. BONE AND MINERAL RES., vol. 14, no. Suppl.1, 1999, page S340 XP001010330 *
YAMASHITA, T. ET AL.: "Elongation of the epiphyseal trabecular bone in transgenic mice carrying a klotho gene locus mutation that leads to a syndrome resembling aging" J. ENDOCRINOL., vol. 159, 1998, pages 1-8, XP002172675 *

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002092850A3 (fr) * 2001-05-17 2003-12-18 Univ Aberdeen Procede servant a diagnostiquer l'osteoporose et les troubles associes
WO2002092850A2 (fr) * 2001-05-17 2002-11-21 The University Court Of The University Of Aberdeen Procede servant a diagnostiquer l'osteoporose et les troubles associes
EP2550972B1 (fr) 2007-04-02 2018-02-21 Genentech, Inc. Un anticorps agoniste de Klotho-béta à utiliser dans le traitement du diabète et de la résistance à l'insuline
WO2008135993A1 (fr) * 2007-05-08 2008-11-13 Tel Hashomer Medical Research Infrastructure And Services Ltd. Protéine klotho et composés apparentés destinés au traitement et au diagnostic du cancer
US10555963B2 (en) 2007-05-08 2020-02-11 Tel Hashomer Medical Research Infrastructure And Services Ltd. Klotho protein and related compounds for the treatment and diagnosis of cancer
US9987326B2 (en) 2007-05-08 2018-06-05 Tel Hashomer Medical Research Infrastructure And Services Ltd. Klotho protein and related compounds for the treatment and diagnosis of cancer
WO2010064247A1 (fr) 2008-12-03 2010-06-10 Tel Hashomer Medical Research Infrastructure And Services Ltd. Procédés et trousses pour déterminer une prédisposition au cancer
US8530392B2 (en) 2009-05-13 2013-09-10 Shionogi & Co., Ltd. Test agent for visceral obesity and use thereof
EP2634262A2 (fr) * 2010-10-29 2013-09-04 Amorepacific Corporation Trousse de criblage de substances d'activation de la peau et comprenant le gène klotho, et procédé de criblage de substances d'activation de la peau à l'aide de celle-ci
CN102465182A (zh) * 2010-10-29 2012-05-23 株式会社爱茉莉太平洋 检测皮肤活性物质的检测试剂盒和检测皮肤活性物质的方法
KR101907567B1 (ko) 2010-10-29 2018-10-15 (주)아모레퍼시픽 Klotho 유전자를 포함하는 피부 활성물질 탐색용 키트 및 이를 이용하여 피부 활성물질을 탐색하는 방법
EP2634262A4 (fr) * 2010-10-29 2014-04-16 Amorepacific Corp Trousse de criblage de substances d'activation de la peau et comprenant le gène klotho, et procédé de criblage de substances d'activation de la peau à l'aide de celle-ci
US9884919B2 (en) 2013-12-23 2018-02-06 Genentech, Inc. Methods of treatment with bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1
US10246518B2 (en) 2013-12-23 2019-04-02 Genentech, Inc. Nucleic acids encoding bispecific antibodies binding to beta-Klotho and fibroblast growth factor receptor 1
US9873748B2 (en) 2013-12-23 2018-01-23 Genentech, Inc. Bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1
US10882921B2 (en) 2013-12-23 2021-01-05 Genentech, Inc. Host cell comprising nucleic acids encoding bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1 and antibody production
US10800843B2 (en) 2015-07-29 2020-10-13 Ngm Biopharmaceuticals, Inc. Beta klotho-binding proteins
US11667708B2 (en) 2015-07-29 2023-06-06 Ngm Biopharmaceuticals, Inc. Anti-human beta klotho antibody or binding fragment thereof and methods of their use
CN106957921A (zh) * 2017-05-18 2017-07-18 中国水产科学研究院珠江水产研究所 一种适合食人工配合饲料大口黑鲈klotho基因的SNP位点及其在育种中的应用
EP3879271A1 (fr) * 2020-03-10 2021-09-15 SALION GmbH Détection de klotho
WO2021180636A1 (fr) * 2020-03-10 2021-09-16 Salion Gmbh Détection de klotho
WO2022008971A2 (fr) 2020-07-09 2022-01-13 Costa Rican Social Security Fund / Caja Costarricense de Seguro Social (CCSS) Traitement d'une infection à coronavirus associé au syndrome respiratoire aigu sévère avec klotho

Also Published As

Publication number Publication date
AU7025700A (en) 2001-04-17
EP1210426A2 (fr) 2002-06-05
WO2001020031A3 (fr) 2002-03-14
JP2003514513A (ja) 2003-04-22

Similar Documents

Publication Publication Date Title
EP1590485A2 (fr) Polymorphismes genetiques associes a l'arthrite rhumatoide, procedes de detection et utilisations associees
US5879884A (en) Diagnosis of depression by linkage of a polymorphic marker to a segment of chromosome 19P13 bordered by D19S247 and D19S394
EP1210426A2 (fr) Polymorphismes dans un gene klotho
US20040235006A1 (en) Chemical compounds
EP1130123A2 (fr) Méthode diagnostique
EP1608783A2 (fr) Polymorphismes genetiques associes a la polyarthrite rhumatoide, methodes de detection et utilisations de ces polymorphismes
US20050059067A1 (en) Chemical compounds
AU754923B2 (en) Method to determine predisposition to hypertension
US6458541B1 (en) BDNF polymorphism and association with bipolar disorder
JP4242590B2 (ja) 慢性関節リウマチの疾患感受性遺伝子、及びその利用
US6544743B1 (en) Peroxisome proliferator-activated receptor alpha and disorders of lipid metabolism
US20070154935A1 (en) Human obesity susceptibility gene and uses thereof
US20030175797A1 (en) Association of protein kinase C zeta polymorphisms with diabetes
US20030157493A1 (en) BDNF polymorphism and association with bipolar disorder
US20030008301A1 (en) Association between schizophrenia and a two-marker haplotype near PILB gene
US20230151426A1 (en) Reticulocalbin-3 (RCN3) Variants And Treatment Of Asthma With Interleukin-4 Receptor Alpha (IL4R) Antagonists
CA2343049A1 (fr) Combinaison de marqueurs au niveau des genes recepteurs des oestrogenes et de la vitamine d, ou equivalents de ces derniers, pour le pronostic d'une reponse au traitement de l'osteoporose
EP1100962A1 (fr) Polymorphismes genetiques du gene du recepteur neurokininique 1 de l'homme et leurs utilisations pour le diagnostic et le traitement d'affections
EP1572739B1 (fr) Locus de susceptibilite a l'asthme
US6913885B2 (en) Association of dopamine beta-hydroxylase polymorphisms with bipolar disorder
WO2003054218A2 (fr) Polymorphismes nucleotidiques associes a l'osteoporose
JP2002526090A (ja) インテグリンリガンド仲介疾患の診断および処置に適当なヒトのベータ1インテグリンサブユニット遺伝子における多型性
US20070243528A1 (en) Methods for detecting polymorphisms using arms or rflp
JP2001078773A (ja) 骨粗鬆症薬剤感受性予測方法
WO2001082776A2 (fr) Procedes et compositions destines au diagnostic de la schizophrenie

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 523802

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2000958842

Country of ref document: EP

AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

WWP Wipo information: published in national office

Ref document number: 2000958842

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 2000958842

Country of ref document: EP