WO2001019866A1 - Dipeptidyl peptidases - Google Patents
Dipeptidyl peptidases Download PDFInfo
- Publication number
- WO2001019866A1 WO2001019866A1 PCT/AU2000/001085 AU0001085W WO0119866A1 WO 2001019866 A1 WO2001019866 A1 WO 2001019866A1 AU 0001085 W AU0001085 W AU 0001085W WO 0119866 A1 WO0119866 A1 WO 0119866A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dpp8
- seq
- substrate
- sequence shown
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/948—Hydrolases (3) acting on peptide bonds (3.4)
- G01N2333/95—Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
- G01N2333/964—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
- G01N2333/96425—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
Definitions
- the invention relates to a dipeptidyl peptidase, to a nucleic acid molecule which encodes it, and to uses of the peptidase .
- the dipeptidyl peptidase (DPP) IV-like gene family is a family of molecules which have related protein structure and function [1-3] .
- the gene family includes the following molecules: DPPIV (CD26), dipeptidyl amino- peptidase-like protein (DPP6) and fibroblast activation protein (FAP) [1,2,4,5].
- DPPIV- ⁇ [6] Another possible member is DPPIV- ⁇ [6] .
- the molecules of the DPPIV-like gene family are serine proteases, they are members of the peptidase family S9b, and together with prolyl endopeptidase (S9a) and acylaminoacyl peptidase (S9c) , they are comprised in the prolyl oligopeptidase family [5, 7] .
- DPPIV and FAP both have similar postproline dipeptidyl amino peptidase activity, however, unlike DPPIV, FAP also has gelatinase activity [8 , 9] .
- DPPIV substrates include chemokines such as RANTES, eotaxin, macrophage-derived chemokine and stromal-cell- derived factor 1; growth factors such as glucagon and glucagon-like peptides 1 and 2; neuropeptides including neuropeptide Y and substance P; and vasoactive peptides [10-12] .
- chemokines such as RANTES, eotaxin, macrophage-derived chemokine and stromal-cell- derived factor 1
- growth factors such as glucagon and glucagon-like peptides 1 and 2
- neuropeptides including neuropeptide Y and substance P
- vasoactive peptides [10-12] include chemokines such as RANTES, eotaxin, macrophage-derived chemokine and stromal-cell- derived factor 1; growth factors such as glucagon and glucagon-like peptides 1 and 2; neuropeptides including neuropeptid
- DPPIV and FAP also have non-catalytic activity; DPPIV binds adenosine deaminase, and FAP binds to ⁇ 3 ⁇ and ⁇ 5 ⁇ ⁇ integrin [13 -14] .
- the DPPIV-like family members are likely to have roles in intestinal and renal handling of proline containing peptides, cell adhesion, peptide metabolism, including metabolism of cytokines, neuropeptides, growth factors and chemokines, and immunological processes, specifically T cell stimulation [3 , 11 , 12] .
- DPPIV-like family members are likely to be involved in the pathology of disease, including for example, tumour growth and biology, type II diabetes, cirrhosis, autoimmunity, graft rejection and HIV infection[3, 15-18] .
- DPPIV DPPIV-specific proliferative protein kinase inhibitors
- Some DPPIV inhibitors are reported to inhibit HIV infection [21] . It is anticipated that DPPIV inhibitors will be useful in other therapeutic applications including treating diarrhoea, growth hormone deficiency, lowering glucose levels in non insulin dependent diabetes mellitus and other disorders involving glucose intolerance, enhancing mucosal regeneration and as immunosuppressants [3 , 21-24] .
- the present invention seeks to address the above identified need and in a first aspect provides a peptide which comprises the amino acid sequence shown in SEQ ID NO : 1.
- This peptide has substrate specificity for the following compounds: H-Ala-Pro-pNA, H-Gly-Pro-pNA and H-Arg-Pro-pNA. Therefore, it is a prolyl oligopeptidase and a dipeptidyl peptidase, because it is capable of hydrolysing the peptide bond C-terminal to proline in each of these compounds .
- the peptide is homologous with human DPPIV, and importantly, identity between the sequences of DPPIV and
- SEQ ID NO: 1 is observed at the region of DPPIV containing the catalytic triad residues and the two glutamate residues of the ⁇ -propeller domain essential for DPPIV enzyme activity.
- the observation of amino acid sequence homology means that the peptide which has the amino acid sequence shown in SEQ ID NO:l is a member of the DPPIV- like gene family. Accordingly the peptide was provisionally named DPPIVL1 , and is now named and described herein as DPP8.
- the following sequences of the human DPPIV amino acid sequence are important for the catalytic activity of DPPIV: (i) Tyr 627 GlyTrpSerTyrGlyGlyTyrVal; (ii) Ala 707 AspAspAsnValHisPhe; (iii) Glu 738 AspHisGlyIleAlaGln ; and (iv) Tyr 201 ValTyrGluGluGluVal [25-28] .
- the invention provides a peptide comprising the following amino acid sequences : His 736 GlyTrpSerTyrGlyGlyTyrLeu; Leu 816 AspGluAsnValHisPheAlaHis ; Glu 847 ArgHisSerIleArg and Phe 255 ValLeuGlnGluGluPhe ; which has the substrate specificity of the sequence shown in SEQ ID NO : 1.
- the invention provides a peptide which has at least 60% amino acid identity with the amino acid sequence shown in SEQ ID NO : 1 , and which has the substrate specificity of the sequence shown in SEQ
- amino acid identity is 75%.
- the amino acid identity is 95%. Amino acid identity is calculated using GAP software [GCG Version 8, Genetics Computer Group, Madison, WI , USA] as described further herein.
- the non-human DPP8 comprises the following sequences:
- DPPIV amino acid sequences
- tertiary structure of DPP8 is likely to include the seven-blade ⁇ - propeller domain and the ⁇ / ⁇ hydrolase domain of DPPIV.
- These structures in DPP8 are likely to be conferred by the regions comprising ⁇ -propeller, Gly 180 to Asp 606 , ⁇ / ⁇ hydrolase, Ser 607 to lie 882 and about 70 to 100 residues in the region Arg 39 to Gin 179 .
- ⁇ - propeller domain regulates proteolysis mediated by the catalytic triad in the ⁇ / ⁇ hydrolase domain of prolyl oligopeptidase
- truncated forms of DPP8 can be produced, which have the substrate specificity of the sequence shown in SEQ ID NO:l, comprising the regions referred to above (His 736 GlyTrpSerTyrGlyGlyTyrLeu;
- DPP8 Leu 816 AspGluAsnValHisPheAlaHis; Glu 847 ArgHisSerIleArg and Phe 55 ValLeuGlnGluGluPhe) which confer the catalytic specificity of DPP8.
- truncated forms of DPP8 which might be prepared are those in which the region conferring the ⁇ -propeller domain and the ⁇ / ⁇ hydrolase domain are spliced together.
- Other examples of truncated forms include those which are encoded by splice variants of DPP8 mRNA.
- the biochemical characterisation of DPP8 shows that DPP8 consists of 882 amino acids and has a molecular weight of about lOOkDa
- truncated forms of DPP8 which have the substrate specificity of the sequence shown in SEQ ID NO : 1
- the invention provides a fragment of the sequence shown in SEQ ID NO: 1, which has the substrate specificity of the sequence shown in SEQ ID NO : 1.
- the fragment has an amino acid sequence shown in SEQ ID NO: 3, 5 or 7.
- an asparagine residue in the peptide of the first aspect of the invention is not linked to a carbohydrate molecule.
- DPP8 expression shows that it is likely that DPP8 is expressed as a cytoplasmic protein.
- the expression of DPP8 is therefore distinguished from other DPPIV-like gene family members, which are expressed on the cytoplasmic membrane, or in other words, the cell surface membrane.
- the peptide of the first aspect of the invention is not expressed on a cell surface membrane of a cell.
- DPP8 may be fused, or in other words, linked to a further amino acid sequence, to form a fusion protein which has the substrate specificity of the sequence shown in SEQ ID NO:l.
- a fusion protein is described herein which comprises the sequence shown in SEQ ID NO:l which is linked to a further amino acid sequence: a "tag" sequence which consists of an amino acid sequence encoding the V5 epitope and a His tag.
- An example of another further amino acid sequence which may be linked with DPP8 is a glutathione S transferase (GST) domain [30] .
- GST glutathione S transferase
- Another example of a further amino acid sequence is a portion of CD8 ⁇ [8] .
- the invention provides a fusion protein comprising the amino acid sequence shown in SEQ ID NO : 1 linked with a further amino acid sequence, the fusion protein having the substrate specificity of the sequence shown in SEQ ID NO:l.
- the peptide of the first aspect of the invention may be comprised in a polypeptide, so that the polypeptide has the substrate specificity of DPP8.
- the polypeptide may be useful, for example, for altering the protease susceptibility of DPP8 , when used in in vivo applications.
- An example of a polypeptide which may be useful in -this regard, is albumin.
- the peptide of the first aspect is comprised in a polypeptide which has the substrate specificity of DPP8. As described above, the isolation and characterisation of DPP8 is necessary for identifying inhibitors of DPP8 catalytic activity, which may be useful for the treatment of disease.
- a method for identifying inhibitors of DPP8 catalytic activity has identified that various inhibitors of DPPIV and serine proteases, zinc and mimetic peptides, Ala-Pro-Gly and Lys-Pro, but not inhibitors of metalloproteinases , aspartyl proteinases or cysteinyl proteinases, inhibit DPP8 catalytic activity. Accordingly, in a fifth aspect, the invention provides a method of identifying a molecule capable of inhibiting cleavage of a substrate by DPP8 , the method comprising the following steps:
- step (a) contacting DPP8 with the molecule; (b) contacting DPP8 of step (a) with a substrate capable of being cleaved by DPP8 , in conditions sufficient for cleavage of the substrate by DPP8 ;
- DPP8 may also inhibit DPPIV and other serine proteases, .as described herein, the alignment of the DPP8 amino acid sequence with most closely related molecules, (i.e. DPPIV), reveals that the DPP8 amino acid is distinctive, particularly at the regions controlling substrate specificity. Accordingly, it is expected that it will be possible to identify inhibitors which inhibit DPP8 catalytic activity specifically, which do not inhibit catalytic activity of
- the invention provides a method of identifying a molecule capable of inhibiting specifically, the cleavage of a substrate by DPP8 , the method comprising the following steps: (a) contacting DPP8 and a further protease with the molecule;
- step (b) contacting DPP8 and the further protease of step (a) with a substrate capable of being cleaved by DPP8 and the further protease, in conditions sufficient for cleavage of the substrate by DPP8 and the further protease;
- the invention provides a method of reducing or inhibiting the catalytic activity of DPP8 , the method comprising the step of contacting DPP8 with an inhibitor of DPP8 catalytic activity.
- various inhibitors of DPPIV catalytic activity are shown herein to inhibit DPP8 catalytic activity, it is recognised that other inhibitors of DPPIV may be useful for inhibiting DPP8 catalytic activity. Examples of inhibitors suitable for use in the seventh aspect are described in [21,32,33] .
- Other inhibitors useful for inhibiting DPP8 catalytic activity can be identified by the methods of the fifth or sixth aspects of the invention, which methods are exemplified herein.
- the catalytic activity of DPP8 is reduced or inhibited in a mammal by administering the inhibitor of DPP8 catalytic activity to the mammal. It is recognised that these inhibitors have been used to reduce or inhibit DPPIV catalytic activity in vi vo , and therefore, may also be used for inhibiting DPP8 catalytic activity in vivo . Examples of inhibitors useful for this purpose are disclosed in the following [21,32-34] .
- the catalytic activity of DPP8 in a mammal is reduced or inhibited in the mammal, for the purpose of treating a disease in the mammal.
- Diseases which are likely to be treated by an inhibitor of DPP8 catalytic activity are those in which DPPIV-like gene family members are associated [3,10,11,17,21,36], including for example, neoplasia, type II diabetes, cirrhosis, autoimmunity, graft rejection and HIV infection.
- the inhibitor for use in the seventh aspect of the invention is one which inhibits the cleavage of a peptide bond C-terminal adjacent to proline.
- these inhibitors are 4- (2- aminoethyl) benzenesulfonylfluoride, aprotinin, benzamidine/HCl, Ala-Pro-Gly, H-Lys-Pro-OH HCl salt and zinc ions, for example, zinc sulfate or zinc chloride.
- the inhibitor is one which specifically inhibits DPP8 catalytic activity, and which does not inhibit the catalytic activity of other serine proteases, including, for example DPPIV or FAP.
- the invention provides a method of cleaving a substrate which comprises contacting the substrate with DPP8 in conditions sufficient for cleavage of the substrate by DPP8 , to cleave the substrate.
- Examples of molecules which can be cleaved by the method are H-Ala-Pro-pNA, H-Gly-Pro-pNA and H-Arg-Pro-pNA. The conditions sufficient for cleaving the substrate are described herein.
- Molecules which are cleaved by DPPIV including RANTES, eotaxin, macrophage-derived chemokine, stromal-cell-derived factor 1, glucagon and glucagon-like peptides 1 and 2, neuropeptide Y, substance P and vasoactive peptide are also likely to be cleaved by DPP8 [11,12] .
- the substrate is cleaved by cleaving a peptide bond C-terminal adjacent to proline in the substrate.
- the molecules cleaved by DPP8 may have Ala, or Trp, Ser, Gly, Val or Leu in the PI position, in place of Pro [11, 12] .
- the invention provides a method of detecting an activated T cell, the method comprising the step of detecting the level of DPP8 gene expression in a T cell.
- the level of DPP8 gene expression is detected by measuring the amount of DPP8 mRNA in the cell, as described herein.
- the inventors have characterised the sequence of a nucleic acid molecule which encodes the amino acid sequence shown in SEQ ID NO : 1.
- the invention provides a nucleic acid molecule which encodes the amino acid sequence shown in SEQ ID NO : 1.
- the invention provides a nucleic acid molecule which consists of the sequence shown in SEQ ID NO: 2.
- splice variants of DPP8 RNA which have an open reading frame from 2.6 to 3.1 kb in length are observed.
- a frame shift mutation or termination signal was not observed in the sequence of these splice variants, and as the coding sequence of two of the splice variants includes a sequence which encodes the amino acid sequence associated with catalytic activity, it is recognised that some of the peptides encoded by the splice variants are likely to have the substrate specificity of DPP8.
- the nucleic acid molecule is a fragment of the sequence shown in SEQ ID NO: 1 which is about 2.6 to 3.1 kb in length and which encodes a peptide which has the substrate specificity of the sequence shown in SEQ ID NO : 1.
- the nucleic acid molecule has a sequence shown in any one of SEQ ID NO.s: 4, 6 and 8.
- the invention provides a nucleic acid molecule which is capable of hybridising to a nucleic acid molecule consisting of the sequence shown in SEQ ID NO: 2 in stringent conditions, and which encodes a peptide which has the substrate specificity of the sequence shown in SEQ ID NO : 1.
- DPP8 RNA hybridises specifically to the sequence shown in SEQ ID NO:2, after washing in 2XSSC/ 1.0%SDS at 37°C, or after washing in O.lXSSC/0.1% SDS at 50°C.
- Stringent conditions are conditions in which the nucleic acid molecule is exposed to 2XSSC/ 1.0% SDS.
- the nucleic acid molecule is capable of hybridising to a molecule consisting of the sequence shown in SEQ ID NO: 2 in high stringent conditions.
- High stringent conditions are conditions in which the nucleic acid molecule is exposed to 0.1XSSC/ 0.1%SDS at 50°C.
- the inventors believe that the gene which encodes DPP8 is located at band q22 on human chromosome 15.
- the location of the DPP8 gene is distinguished from genes encoding other prolyl oligopeptidases , which are located on chromosome 2, at bands 2q24.3 and 2q23, or chromosome 7.
- the nucleic acid molecule is one capable of hybridising to a gene which is located at band q22 on human chromosome 15.
- nucleic acid molecule which encodes the amino acid sequence shown in SEQ ID NO : 1 , or which comprises has the sequence shown in SEQ ID NO: 2, could be made by producing the fragment of the sequence which is translated, using standard techniques [30,31] .
- the nucleic acid molecule does not contain 5' or 3 ' untranslated sequences.
- the invention provides a vector which comprises a nucleic acid molecule of the tenth aspect of the invention.
- the vector is capable of replication in a COS-7 cell, CHO cell or 293T cell, or E.coli.
- the vector is selected from the group consisting of ⁇ TripleEx, pTripleEx, pGEM-T Easy Vector, pSecTag2Hygro, petl5b, pEE14.HCMV.gs and pCDNA3.1/V5/His.
- the invention provides a cell which comprises a vector of the thirteenth aspect of the invention.
- the cell is an E.coli cell.
- the E. coli is MC1061, DH5 ⁇ , JM109, BL21DE3, pLysS.
- the cell is a COS-7, COS-1, 293T or CHO cell.
- the invention provides a method for making a peptide of the first aspect of the invention comprising, maintaining a cell according to the fourteenth aspect of the invention in conditions sufficient for expression of the peptide by the cell.
- the conditions sufficient for expression are described herein.
- the method comprises the further step of isolating the peptide.
- the invention provides a peptide when produced by the method of the fifteenth aspect.
- the invention provides a composition comprising a peptide of the first aspect and a pharmaceutically acceptable carrier.
- the invention provides an antibody which is capable of binding a peptide according to the first aspect of the invention.
- the antibody can be prepared by immunising a subject with purified DPP8 or a fragment thereof according to standard techniques [35] . As described herein, an antibody was prepared by immunising with transiently transfected DPP8 + cells. It is recognised that the antibody is useful for inhibiting activity of DPP8, or for detecting increased gene expression of DPP8, for the purpose of identifying an activated T cell.
- the antibody of the eighth aspect of the invention is produced by a hybridoma cell.
- the invention provides a hybridoma cell which secretes an antibody of the nineteenth aspect.
- FIGURES Figure 1 Cloning strategy for isolating full-length DPP8 cDNA and the alternative splicing variants of DPP8 observed. Representation of three splice variants is shown including loss of serine recognition site by one splice variant (T8) .
- FIG. 1 Nucleotide sequence and amino acid sequence of human DPP8. The nucleotide and predicted one letter code amino acid sequence are shown. This sequence shows no putative membrane spanning domain (deduced from hydrophobicity plots) or potential N-linked glycosylation sites. The putative serine recognition site and aspartic acid and histidine which form the Ser-Asp-His catalytic triad are marked. Base pairs are numbered in the right margin.
- Figure 3 Alignment of the deduced amino acid residue sequence of DPP8 with the C. elegans homolog of DPP8 and human DPPIV. Amino-acid residues are numbered in the right margin. Amino-acid residues identical in all three proteins are boxed.
- Filled triangles joined by lines indicate starts and ends of alternatively spliced transcripts, stPBMCdy3 -3 -10 (solid lines) , T8 (dashed lines) and T21 (solid lines) .
- the alignment was constructed using the PILEUP program in GCG .
- FIG. 4 Northern Blot analysis of DPP8 expression.
- Human multiple tissue Northern blots (CLONTECH) containing 2 ⁇ g per lane of poly A + RNA were hybridized with a 32 P labeled DPP8 probe at 68°C and washed at high stringency. The autoradiograph was exposed for 1 day at -70°C with a BIOMAX MS screen. Molecular mass markers are indicated in base pairs on the left side of each autoradiogram.
- Figure 4a Master RNA (CLONTECH) blot of poly A + RNA was hybridized with a 32 P labelled DPP8 probe at 65°C and washed at high stringency. The autoradiograph was exposed for 3 days at - 70°C with BIOMAX MS screen. DPP8 mRNA was detected in all tissues examined.
- FIG. 1 Chromosomal localization of human DPP8. Metaphase showing FISH with the biotinylated DPP8 cDNA probe. Normal male chromosomes stained with DAPI . Hybridization sites on chromosome 15 are indicated by an arrow.
- FIG. 1 Western blot analysis of transfected cell lines. Analysis of lysates of stable cell lines. DPP8 protein was seen in DPP8 /V5/His stable cell lines but not in DPP4 or vector-only stable cell lines. The electrophoretic mobility of the protein was not altered when samples were boiled. The band of greater mobility was probably a breakdown product of intact DPP8.
- FIG. 7 DPP8 enzyme activity.
- A pH-dependence of DPP8 enzyme activity.
- B DPP8 and DPPIV enzyme kinetics. Means +/- SD of absorbance change per minute, multiplied by 1000 are shown. Curve fitting assumed Michaelis-Menten kinetics .
- FIG. 8 RT-PCR analysis of DPP8 expression. PCR amplifications with primers specific for either a portion of human DPP8 that contained no alternate splicing, Val416 to Gly 679 (top of each gel) or glyceraldehyde-3 -phosphate dehydrogenase (G3PDH) (bottom of each gel.
- Top gel lanes 1-5 contain PCR products from unstimulated PBMC cDNA from five subjects.
- Bottom gel lanes 6 to 11 contain PCR products from 0KT3 -stimulated PBMC cDNA from six subjects.
- PCR products are from cDNA from lymphocytic cell lines, liver or placenta as indicated. Negative control amplifications contained reaction mix, enzyme and no cDNA template. Each PCR was performed for 35 cycles. The PCR products were electrophoresed on agarose gels and stained with ethidium bromide. The left lane of each gel contains PUC19 digested with Haelll as size markers.
- FIG. 9 Northern blot analysis of murine DPP8 expression.
- a murine Northern blot containing 10 ⁇ g per lane of total RNA was hybridized with a 32 P- labeled human DPP8 probe at 60°C and washed at low stringency. Autoradiographic exposure was for 3 days at -70°C with a BIOMAX MS screen. DETAILED DESCRIPTION OF THE INVENTION
- PBMCs Human peripheral blood monocytes
- AIM-V medium Life Technologies, Gaithersburg, MD, USA
- 2 mM -glutamine were stimulated with either 1 ⁇ g.mL " phytohaemagglutinin (Wellcome) or lOOng.mL "1 OKT3 (Orthoclone, FL, USA) for 72 h.
- the human cell lines Jurkat, CCRF-CEM, Raj i , Daudi and HepG2 were grown to confluence in Dulbecco's modified Eagle's medium (Trace Biosciences, NSW, Australia) supplemented with 10% fetal bovine serum and 2TTIM L-glutamine .
- RNA Liver and placental RNA were prepared from snap- frozen human tissue as described previously [37] . However, RNA was prepared from PBMCs and cell lines using an RNAeasy kit (Qiagen, Germany) .
- PILEUP GCG Version 8, Genetics Computer Group, Madison, WI , USA was used for multiple sequence alignments of proteins.
- a BLAST search was performed on the public expressed sequence tag (EST) database using the complete human DPPIV (GenBankTM accession number X60708) and FAP (accession number U09278) nucleotide sequences as query sequences.
- ESTAA417787 was used to design forward (caa ata gaa att gac gat cag gtg) and reverse (tct tga agg tag tgc aaa aga tgc) DPP8 primers for polymerase chain reaction (PCR) from ESTAA417787.
- the PCR conditions were as follows: 94°C for 5 min, followed by 35 cycles of 94°C for 1 minute, 55°C for 30 sec and 70°C for 1 min.
- This 484 bp PCR product was gel purified, 32 P- ⁇ labelled using Megaprime Labeling Kit
- RNA blot (CLONTECH, Palo Alto, CA, USA) that contained poly A + from 50 adult and fetal tissues immobilized in dots as per manufacturers' instructions. This Master RNA blot was also probed with DPP4 for comparison of mRNA tissue expression.
- the forward and reverse DPP8 primers were used for PCR to screen a human placental ⁇ STRETCH PLUS library (CLONTECH, Palo Alto, CA, USA) for the presence of DPP8 cDNA in the library.
- the library was then screened by standard molecular biology techniques [30,31]. After primary screening, 23 clones were selected for secondary screening, after which 22 remained positive.
- ⁇ TripleEx were converted into pTriplEx plasmids and transformed into BM25.8 E. coli recipient bacteria. The plated bacteria were screened and it was confirmed that all 22 clones were positive. Two of these clones, T8 and T21 were selected for further study.
- a 5' RACE Version 2.0 kit (Gibco BRL, Life technologies) was applied on activated T cell (ATC) and placental RNA as prescribed in the kit instructions.
- the T8 DNA sequence was used to design GSP 1 (TCC TTC CTT CAG CAT CAA TC) and GSP2 (CTT AAA AGT GAC TTT AGG ATT TGC TGT ACC) .
- 5' RACE PCR products were cloned into pGEM-T Easy®Vector (Promega Co., Madison, WI , USA) and sequenced by primer walking.
- Reverse transcriptase PCR was carried out on ATC RNA using DPP8-pr23 (GGA AGA AGA TGC CAG ATC AGC TGG) and DPP8-prl9r (TCC GTG TAT CCT GTA TCA TAG AAG) to span across the junction between the RACE product and the EST and library clones.
- DPP8-pr23 GGA AGA AGA TGC CAG ATC AGC TGG
- DPP8-prl9r TCC GTG TAT CCT GTA TCA TAG AAG
- the ATC RACE product, the ATCd3-2-l (1603bp) junction fragment and the library clone T21 were joined together and cloned into the expression vector pcDNA3.
- l/V5/His A (Invitrogen, the Netherlands) to form a DPP8 cDNA of 3.1 kb with an open reading frame of 882 aa .
- the first construct was made using three sequential cloning steps. Firstly, a Eco RV/Xba I fragment of T21 (containing 3' DPP8 , stop codon and 3' untranslated region on DPP8 cDNA) was ligated into the vector pcDNA3. l/V5/His A which had been digested with Eco RV/Xba I .
- Hybridization solution (CLONTECH) for 30 min at 68°C.
- DPP8 gene expression in mice by Northern Blot A Northern blot containing 10 ug of total liver RNA per lane was made using standard methods [31] .
- the RNA was derived from male and female mice of two strains, C57B16 and Balb/c.
- the Northern blot was prehybridized in Express Hybridization solution (CLONTECH, Palo Alto, USA) for 1 hr at 60°C.
- a 2.4kb human DPP8 cDNA (PCR product) was radiolabeled using the Megaprime Labeling kit (Amersham Pharmacia Biotech) and [ 32 P] dCTP (NEN Dupont) .
- Mouse liver RNA was reverse transcribed using the Superscript II enzyme kit (Gibco BRL, Gaithersburg, MD) as described previously [42] .
- the cDNA was diluted 1 in 4 and stored in aliquots at - 70°C.
- PCR using mouseDPP8-prlF (atg att ace ace cag gaa gcg) as the forward primer and mouseDPP8-pr2R (ate tec gac ate ttg aaa gtg ace) as the reverse primer was used to detect mouse DPP8 mRNA.
- PCR One ul of diluted cDNA was amplified in a 50 ul PCR reaction which contained: 0.2 mM dNTPs, 1 ul of 50 x Advantage 2 Polymerase Mix (Clontech) , 1 X Advantage 2 PCR buffer (Clontech) and 100 ng of each primer.
- the PCR involved an initial step of 95°C for 1 min to inactivate the TaqStart Antibody. This was followed by 35 cycles; denaturation at 95°C for 30 sec, 68°C for 1 min, followed by a final step of 68°C for 1 min.
- the amplified products were analysed by electrophoresis of 10 ⁇ l of PCR reaction on a 3:1 Nusieve gel (FMC Bioproducts, Rockville, MD) plus 0.5 ⁇ g/ml ethidium bromide in TAE buffer (0.04M Tris acetate, 0.001 M EDTA, pH 8.0). The gel was then Southern Blotted using standard techniques [31] . The Southern blot was hybridized at 60°C for 2hr with the 2.4 kb human DPP8 cDNA probe prepared as described above. Washes were performed at low stringency (2 x SSC/0.05% SDS for 1 h at 37°C followed by 0. lx SSC/0.1% SDS for 40 min at 50°C) . The blot was exposed to XAR5 Kodak film for 30 min at RT.
- Reverse transcriptase PCR was performed on human ATC RNA, human placental RNA and human liver RNA using TED primers DPP8/pr3 (GCA CTA CCT TCA AGA AAA CCT TGG) and DPP8/pr20R (TAT GGT ATT GCT GGG TCT CTC AGG) to give a 293 bp product.
- Monkey kidney fibroblast (COS-7) cells (American Type Culture Collection, CRL-1651) were grown and transfected as described previously [39] .
- Geneticin G418; Gibco-BRL was added to the medium, beginning 24 h after transfection.
- - COS cell extracts were prepared by sonication followed by differential centrifugation and neither boiled nor reduced before SDS/PAGE (10% gel) and transfer to nitrocellulose, as described previously [40,9] .
- the presence of DPP8 fused with the V5 epitope was detected using an anti-V5 mAb (Invitrogen) .
- COS cell monolayers were fixed in cold ethanol before staining with anti-V5 mAb [39,41,9] .
- DPPIV is expressed at the cell surface, so 1% Triton X-100 was used to solubilize DPPIV/V5/His . Insoluble material was removed by centrifugation. The supernatant was incubated with 1 mL Talon ® Metal Affinity Resin (Clontech) following the manufacturer's instructions for a batch/gravity flow procedure. The resin was washed with 50 mM sodium phosphate, containing 300 ⁇ IM NaCl and 5 I ⁇ M imidazole, and proteins were eluted using the same buffer containing 150 ⁇ iM imidazole. Enzyme activity was used to monitor eluted fractions.
- Enzyme assays were performed as described previously [1] . Either clarified cell extract from 1 x 10 4 sonicated COS-7 cells or purified protein derived from 1 x 10 5 cells was incubated with substrate in 70 ⁇ L phosphate buffer, pH 7.4, for 30 min at 37°C, except where otherwise indicated.
- H-Ala-Pro-pNA/HCl H-Arg-Pro-pNA acetate salt
- H-Lys- Ala-pNA.2HCl H-Asp-Pro-pNA
- H-Ala-Ala-pNA/HCl H-Ala-Ala- Pro-pNA/HCl
- H-Ala-Ala-Phe-pNA succinyl-Ala-Pro-pNA
- H- Ala-Phe-Pro-pNA and Z-Ala-Pro-p-NA from Bachem (Switzerland) .
- H-Ala-Pro-4-methoxy ⁇ NA/HCl , Z-Lys-Pro-4- methoxy ⁇ NAformate salt, H-Lys-Pro-4-methoxy ⁇ NA/HCl , Z-Ala- Pro-4-methoxy ⁇ NA, H-Gly-Pro- ⁇ NA and H-His-Ser-4- methoxy ⁇ NAacetate salt (Bachem) were tested for their ability to stain unfixed transfected cells.
- DPP8 was localized using two different probes, the DPP8 EST and the T8 clone.
- the probes were nick-translated with biotin-C 14 -dATP and hybridized in si tu at a final concentration of lOng/ul to metaphases from two normal males.
- the FISH method was modified from that previously described [37] in that chromosomes were stained before analysis with both propidium iodide (as counterstain) and DAPI (for chromosomal identification) . Images of metaphase preparations were captured by a cooled CCD camera using the Cyto Vision Ultra image collection and enhancement system (Applied Imaging International Ltd) . FISH signals and the DAPI banding pattern were merged for figure preparation.
- RNA (l ⁇ g) was reverse-transcribed using the Superscript II enzyme kit (Gibco-BRL) as described previously [42] .
- the glyceraldehyde-3 -phosphate dehydrogenase (G3PDH) control primer set was G3PDH for (ACCACAGTCCATGCCATCAC) and G3PDHrev (TCCACCACCCTGTTGCTGTA) to give a 470 -bp product .
- cDNA (diluted 1 : 4; l ⁇ g) was amplified in a 25- ⁇ L PCR mixture which contained: 0.2 mM dNTPs, 0.125 unit Amplitaq Gold enzyme (Perkin-Elmer) , 1 x buffer II (Perkin-Elmer) , 1.5 mM MgCl 2 and lOOng mL "1 each primer.
- the 35-cycle PCR was performed as follows: denaturation at 94°C for 1 min, primer annealing at 55°C for 30 s, and an extension step at 72°C for 1 min.
- the amplified products were analyzed by electrophoresis of 15 ⁇ L PCR mixture on a 3 : 1 Nusieve gel (FMC Bioproducts, Rockville, MD, USA) plus 0.5 ⁇ g mL "1 ethidium bromide in Tris/acetate/EDTA buffer (0.04 M Tris/acetate, 0.001 M EDTA, pH 8.0).
- mice were immunized with 2 xlO 7 live COS-7 (African Green Monkey Kidney) cells that had been transiently transfected with the DPP8 cDNA in the pcDNA3 vector.
- the final immunisation was with CHO (Chinese Hamster Ovary) cells stably transfected with DPP8 cDNA in the pEE14 vector.
- Spleen cells were fused with a standard fusion partner, X63Ag8 myeloma cells.
- Hybridoma culture supernatants were tested by immunoperoxidase histochemistry on monolayers of the DPP8-transfected CHO cell line, using untransfected CHO cells as the negative control . Hybridomas that produced antibody activity were cloned.
- T21 were 1669 bp and 1197 bp respectively ( Figure 1) .
- comparison of these sequences to ESTAA417787 revealed that T8 cDNA lacked a 153 bp (51aa) region that was present in T21 cDNA and ESTAA417787. This deletion would result in the loss of the catalytic serine (GWSYGG) in T8 cDNA.
- GWSYGG catalytic serine
- the 5' RACE technique was utilized on both ATC RNA and placental RNA to obtain the 5' end of the DPP8 gene.
- the RACE product obtained from activated T cell RNA was 0.2 kb larger than that from placental RNA but otherwise identical ( Figure 1) .
- the first methionine within a Kozak sequence was found 214 bp from the 5' end of the activated T cell RACE product.
- This 5' 211bp region was 70.5 % GC rich and contained a number of potential promoter and enhancer elements (Spl, Apl and ETF sites) and so was deduced to be the 5' flanking region of the DPP8 gene.
- RT-PCR was carried out to span across the junction between the RACE product and T8 cDNA library clone.
- the RT-PCR on ATC RNA produced two clones ATCd3-2- 1 and ATC3-3-10 ( Figure 1) .
- both clones had an additional insert region of 144bp (48 aa) immediately adjacent to the splice site of T8.
- Sequence homology analysis of this additional insert region found a homologous region in both the C. elegans homologue and DPP4. This clearly showed that T8 and T21 library clones represented splice variants of DPP8.
- the smaller clone ATCd3-3-10 was also found to represent another splice variant of DPP8 as it contained a 516 bp deletion at the 5' end which would result in a deletion of 175 aa .
- DPP8 is a cytoplasmic protein ( Figure 2) .
- the predicted DPP8 protein shared 51 % amino acid similarity and 27 % amino acid identity with human DPP4 ; the C termini of these proteins exhibited the most homology ( Figure 3) .
- RNA blot was probed with a 484 nt PCR product produced by the forward and reverse DDP8 primers as mentioned previously.
- the mRNA tissue expression of DPP8 was ubiquitous in all human adult and fetal tissues.
- a similar ubiquitous expression pattern was observed using DPP4 cDNA as a probe (data not shown) .
- the probes did not bind any of the negative controls on the blot .
- the human DPP8 cDNA sequence cross-hybridized with murine derived liver RNA.
- Two mRNA transcripts of murine DPP8 were present. This is a similar pattern to that observed for human DPP8. These transcripts probably represent different length 5' and 3' untranslated regions of the murine DPP8 gene.
- the presence of DPP8 mRNA in the mouse liver was also demonstrated using rt-PCR. The primers tested generated a 537bp PCR product. A Southern blot of this product confirmed that the murine DPP8 cross-hybridizes with human DPP8 ( Figure 9B) .
- DPP8 protein coding sequence
- the first construct pcDNA3.1-DPP8
- expressed DPP8 protein on its own whilst the second construct, pcDNA3.
- l-DPP8/V5/His expressed a protein with the V5 epitope and His tag fused to the C-terminus of DPP8 to facilitate analysis of protein expression.
- Mammalian expression constructs were stably transfected into COS-7 cells and cellular sonicates prepared.
- DPP8 is a dipeptidyl peptidase
- DPPIV and DPP8 suggested functional similarities, so cell lysates of DPP8- transfected cells were examined for proline-specific peptidase activity.
- DPPIV expressed in COS-7 cells with or without the V5/His tag were positive controls, and negative controls included vector-only transfected COS07 cells.
- Extracts of DPP8-transfected COS-7 cells hydrolyzed H-Ala-Pro-pNA and H-Arg-Pro-pNA but not H-Gly- Pro-pNA, H-Gly-Arg-pNA, H-Gly-Pro-toluenesulfonate or H- Gly-Pro-7-amino-4-trifluoromethylcoumarin .above the levels exhibited by untransfected COS-7 cells (data not shown) .
- the pH optimum of DPP8 enzyme activity was 7.4 (Fig. 5A) , similar to the pH 7.8 optimum DPPIV enzyme activity [43,44] .
- DPP8 exhibited little activity below pH 6.3, suggesting that it is not an enzyme of the lysosome/endosome compartment. Of all the substrates tested on cell monolayers, only Ala-Pro-4M ⁇ NA/HCl stained DPP8-transfected COS cells and CHO cells (data not shown) .
- DPP8 enzyme activity was significantly inhibited by serine proteinase inhibitors and was insensitive to inhibitors of metalloproteinases , aspartyl proteinases and cysteine proteinases.
- DPP8 enzyme activity was significantly inhibited by zinc, which completely inhibits DPPIV enzyme activity [46] .
- the peptides Ala-Pro-Gly and Lys-Pro mimic DPP8 substrates and probably competitively inhibited DPP8.
- the various splice variants of DPP8 might not encode functional protein, so the PCR was designed to detect only mRNA that contained full-length sequence (Fig. 1) .
- amplification product of the expected size (783 bp) was readily observed in OKT3 -stimulated PBMCs (six of six subjects; Fig 8) but not in unstimulated PBMCs from most subjects (four of five, Fig. 8A) , suggesting that more DPP8 mRNA is expressed in activated T cells than in unstimulated PBMCs.
- Similar RT-PCR data were obtained from PBMCs stimulated with phytohaemagglutinin (data not shown) .
- DPP8 mRNA was expressed in all B and T cell lines examined and in both liver and placenta ( Fig. 8B) .
- Anti-peptide antibody The sera of two rabbits were tested by ELISA in peptide- coated wells. Both sera bound both peptides whereas the pre- immunisation serum samples did not exhibit specific binding. Western blots on extracts of cell lines, cell lines transfected with DPP8 cDNA and activated human lymphocytes showed that a rabbit antiserum to the two DPP8 peptides binds a lOOkDa band, which is the size of DPP8. (Data not shown) .
- DPP8 a novel human DPPIV- related postproline peptidase that we have named DPP8.
- DPP8 exhibited dipeptidyl aminopeptidase but not tripeptidyl peptidase or endopeptidase activity.
- DPP8 was found to exhibit significant mRNA expression in activated T cells. Clear indications that DPP8 is a monomeric, nonglycosylated, soluble, cytoplasmic protein, which are characteristics of PEP but not of DPPIV, FAP or DPP6, were provided by our sequence and localisation data. DPP8 enzyme activity had a neutral pH optimum, suggesting that it is not active in the acidic lysosome/endosome compartment.
- DPP8 is a member of the DPPIV-like gene family, a member of the prolyl oligopeptidase family S9b, and a member of the enzyme clan SC.
- the residues in DPP8 that potentially form the charge-relay system are Ser739, Asp817 and His849 (Fig.2) .
- the dipeptidyl peptidase activity of DPP8 and the absence of detectable tripeptidyl peptidase or endopeptidase activities by purified DPP8 further support its placement in the S9b family.
- the DPP8 substrate specificity was indistinguishable from that of the structurally related peptidases DPPIV and FAP.
- DPPIV-specific inhibitors suppress both DNA synthesis and cytokine production in vi tro [48, 49, 52] .
- DPPIV-specific inhibitors decrease phorbol myristate acetate-induced tyrosine phosphorylation in human lymphocytes, further suggesting a role for DPPIV enzyme activity in lymphocyte activation [54] .
- inhibitors of DPPIV suppress arthritis [20] and prolong cardiac allograft survival in animal models [55] .
- the ability of DPP8 to cleave DPPIV substrates indicates that DPPIV inhibitors may also inhibit DPP8 and that inhibitor studies may require further interpretation. Indeed, DPP8 may be responsible for some of the physiological functions that have been assigned to DPPIV.
- FAP and DPPIV are integral membrane glycoproteins and require dimerization for catalytic activity [9, 56, 57] .
- DPP8 and PEP are non-glycosylated cytosolic proteins that are catalytically active as monomers [58] and cleave Pro-Xaa bonds [43,59] .
- the substrate specificity of PEP is distinct from DPP8.
- PEP is an endopeptidase that does not cleave if a free ⁇ -amine lies N-terminal to the proline (e.g. it does not cleave H-Ala- Pro) .
- DPPIV is similar to that of PEP in having a seven-blade ⁇ -propeller domain and an ⁇ / ⁇ -hydrolase domain [3, 39, 1] .
- the significant sequence identity between DPP8 and DPPIV indicates that the tertiary structures of DPP8 and DPPIV are similar.
- DPP8 contains 110 amino acids more than DPPIV, so it could have an additional element of tertiary structure such as an eighth propeller blade.
- DPP8 was localized to 15q22.
- the related genes DPP6 and PEP have been localized to chromosome 7 [62] and 6q22 respectively [63] .
- Two human disease loci have been mapped to 15q22. These loci are an autosomal recessive deafness locus [64] and a form of Bardet-Biedl syndrome, type 4 [65] .
- Two of the clinical manifestations of Bardet-Biedl syndrome are obesity and diabetes. Attractin [66] and DPPIV have roles in obesity [67] and diabetes [22, 68, 15] respectively and as their substrate specificities overlap with that of DPP8, it is possible that DPP8 may be involved in Bardet- Biedl syndrome .
- DPPIV is expressed on the surface of T cells and is a costimulatory molecule called CD26 [3] .
- CD26-negative cell lines have residual DPPIV enzyme activity and PBMC have non-DPPIV derived activity against Ala-Pro substrates [69], indicating the existence of other peptidase (s) with
- DPPIV-like activity exhibits a peptidase activity similar to DPPIV but is a 70-80 kDa cell surface glycoprotein [70] and is therefore distinct from DPP8.
- the predicted sizes of splice variants of DPP8 ranged from 2.6 to 3.1 kb whereas the large transcripts seen in most tissues examined in the Northern blots were 8.5 kb and 5.0 kb respectively.
- DPPIV and DPP6 two other members of the DPPIV-like gene family, DPPIV and DPP6 , exhibit mRNA transcripts in Northern blots that are much larger than the cDNA size [60, 61] .
- the major transcripts for DPP8 mRNA and its splice variants lie within the 5 kb band while the 8.5 kb transcript (s) may contain additional 5' and 3' untranslated sequences.
- DPP8 appears to be like DPPIV in having a ubiquitous mRNA expression pattern by Northern analysis while being upregulated in activated T cells.
- the similarities between DPP8 and DPPIV suggest that DPP8 may, like DPPIV, play a role in T cell costimulation and proliferation.
- the development of DPP8 specific antibodies or inhibitors will facilitate work in this area.
- DPP8 dipeptidyl aminopeptidase DPP8 with structural and functional similarities to DPPIV and FAP.
- DPPIV dipeptidyl aminopeptidase
- FAP tumor growth and liver disease
- Fibroblast activation protein A dual-specificity serine protease expressed in reactive human tumor stromal fibroblasts Journal of Biological Chemistry 274: 36505-12.
- Fibroblast activation protein A cell surface dipeptidyl peptidase and gelatinase expressed by stellate cells at the tissue remodelling interface in human cirrhosis Hepatology 29 : 1768-78.
- Dipeptidyl peptidase IV (DPPIV/CD26) : biochemistry and control of cell -surface expression.
- Dipeptidyl peptidase IV in the immune system Effects of specific enzyme inhibitors on activity of dipeptidyl peptidase IV and proliferation of human lymphocytes, Biol . Chem . Hoppe Seyler. 372 , 305-11.
- DFNB16 maps to human chromosome 15q21-q22, J. Med. Genet . 34 , 1015-7.
- Attractin DPPT-L
- DPPT-L Attractin
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Physical Education & Sports Medicine (AREA)
- Tropical Medicine & Parasitology (AREA)
- AIDS & HIV (AREA)
- Transplantation (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Rheumatology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2001523643A JP4748908B2 (ja) | 1999-09-10 | 2000-09-11 | ジペプチジルペプチダーゼ |
| DE60029230T DE60029230T2 (de) | 1999-09-10 | 2000-09-11 | Dipeptidyl-peptidasen |
| EP00962085A EP1214344B1 (en) | 1999-09-10 | 2000-09-11 | Dipeptidyl peptidases |
| CA002384135A CA2384135A1 (en) | 1999-09-10 | 2000-09-11 | Dipeptidyl peptidases |
| US10/070,464 US6881564B1 (en) | 1999-09-10 | 2000-09-11 | Dipeptidyl peptidases |
| AU73946/00A AU767005B2 (en) | 1999-09-10 | 2000-09-11 | Dipeptidyl peptidases |
| US10/825,632 US7148338B2 (en) | 1999-09-10 | 2004-04-15 | Nucleic acids encoding dipeptidyl peptidases |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AUPQ2762 | 1999-09-10 | ||
| AUPQ2762A AUPQ276299A0 (en) | 1999-09-10 | 1999-09-10 | Peptide and nucleic acid molecule |
| AUPQ5709 | 2000-02-18 | ||
| AUPQ5709A AUPQ570900A0 (en) | 2000-02-18 | 2000-02-18 | Peptide and nucleic acid molecule |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10070464 A-371-Of-International | 2000-09-11 | ||
| US10/070,464 A-371-Of-International US6881564B1 (en) | 1999-09-10 | 2000-09-11 | Dipeptidyl peptidases |
| US10/825,632 Division US7148338B2 (en) | 1999-09-10 | 2004-04-15 | Nucleic acids encoding dipeptidyl peptidases |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2001019866A1 true WO2001019866A1 (en) | 2001-03-22 |
Family
ID=25646142
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2000/001085 Ceased WO2001019866A1 (en) | 1999-09-10 | 2000-09-11 | Dipeptidyl peptidases |
Country Status (9)
| Country | Link |
|---|---|
| US (2) | US6881564B1 (enExample) |
| EP (1) | EP1214344B1 (enExample) |
| JP (1) | JP4748908B2 (enExample) |
| AT (1) | ATE332366T1 (enExample) |
| CA (1) | CA2384135A1 (enExample) |
| DE (1) | DE60029230T2 (enExample) |
| DK (1) | DK1214344T3 (enExample) |
| ES (1) | ES2269178T3 (enExample) |
| WO (1) | WO2001019866A1 (enExample) |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001079473A3 (en) * | 2000-04-18 | 2002-04-25 | Rachel A Meyers | 21953, a human prolyl oligopeptidase family member and uses thereof |
| WO2002034900A1 (en) * | 2000-10-27 | 2002-05-02 | The University Of Sydney | Dipeptidyl peptidases |
| WO2002066627A1 (en) * | 2001-02-16 | 2002-08-29 | Bayer Aktiengesellschaft | Regulation of human dipeptidyl peptidase 8 |
| WO2003033524A2 (en) | 2001-10-12 | 2003-04-24 | Probiodrug Ag | Peptidyl ketones as inhibitors of dpiv |
| WO2002031134A3 (en) * | 2000-10-12 | 2003-07-17 | Ferring Bv | Novel serine protease genes related to dppiv |
| WO2004017989A1 (en) | 2002-08-09 | 2004-03-04 | Prosidion Ltd. | Methods for improving islet signaling in diabetes mellitus and for its prevention |
| WO2005106021A1 (en) * | 2004-04-28 | 2005-11-10 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with dipeptidyl-peptidase 8 (dpp8) |
| US7470700B2 (en) | 2003-08-13 | 2008-12-30 | Takeda Pharmaceutical Company Limited | Dipeptidyl peptidase inhibitors |
| US7625939B2 (en) | 2005-11-14 | 2009-12-01 | Probiodrug Ag | Cyclopropyl-fused pyrrolidine derivatives as dipeptidyl peptidase IV inhibitors |
| US7638638B2 (en) | 2003-05-14 | 2009-12-29 | Takeda San Diego, Inc. | Dipeptidyl peptidase inhibitors |
| US7728146B2 (en) | 2006-04-12 | 2010-06-01 | Probiodrug Ag | Enzyme inhibitors |
| EP1353684B1 (de) * | 2001-01-02 | 2011-05-04 | KeyNeurotek Pharmaceuticals AG | Verwendung von dipeptidylpeptidase iv und aminopeptidase-n inhibitoren zur behandlung von ischämie-induzierter neurodegeneration |
| US7960384B2 (en) | 2006-03-28 | 2011-06-14 | Takeda Pharmaceutical Company Limited | Dipeptidyl peptidase inhibitors |
| US8084605B2 (en) | 2006-11-29 | 2011-12-27 | Kelly Ron C | Polymorphs of succinate salt of 2-[6-(3-amino-piperidin-1-yl)-3-methyl-2,4-dioxo-3,4-dihydro-2H-pyrimidin-1-ylmethy]-4-fluor-benzonitrile and methods of use therefor |
| US8222411B2 (en) | 2005-09-16 | 2012-07-17 | Takeda Pharmaceutical Company Limited | Dipeptidyl peptidase inhibitors |
| US8906901B2 (en) | 2005-09-14 | 2014-12-09 | Takeda Pharmaceutical Company Limited | Administration of dipeptidyl peptidase inhibitors |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR9813233A (pt) * | 1997-09-29 | 2000-08-22 | Point Therapeutics Inc | Estimulação de células hematopoéticas in vitro |
| US6979697B1 (en) * | 1998-08-21 | 2005-12-27 | Point Therapeutics, Inc. | Regulation of substrate activity |
| WO2001019866A1 (en) * | 1999-09-10 | 2001-03-22 | The University Of Sydney | Dipeptidyl peptidases |
| US20040047853A1 (en) * | 2000-06-09 | 2004-03-11 | Dahl Soren W | Purified proenzyme of dipeptidyl peptidase i (pro-dppi) |
| IL158923A0 (en) | 2001-06-27 | 2004-05-12 | Smithkline Beecham Corp | Fluoropyrrolidines as dipeptidyl peptidase inhibitors |
| JP4771661B2 (ja) | 2001-11-26 | 2011-09-14 | トラスティーズ オブ タフツ カレッジ | Post−プロリン開裂酵素の擬ペプチド性阻害剤 |
| US7169926B1 (en) | 2003-08-13 | 2007-01-30 | Takeda Pharmaceutical Company Limited | Dipeptidyl peptidase inhibitors |
| US7678909B1 (en) | 2003-08-13 | 2010-03-16 | Takeda Pharmaceutical Company Limited | Dipeptidyl peptidase inhibitors |
| US7732446B1 (en) | 2004-03-11 | 2010-06-08 | Takeda Pharmaceutical Company Limited | Dipeptidyl peptidase inhibitors |
| WO2005108997A1 (en) * | 2004-05-11 | 2005-11-17 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with dipeptidyl-peptidase 6 (dpp6) |
| EP1753730A1 (en) | 2004-06-04 | 2007-02-21 | Takeda Pharmaceutical Company Limited | Dipeptidyl peptidase inhibitors |
| WO2006019965A2 (en) | 2004-07-16 | 2006-02-23 | Takeda San Diego, Inc. | Dipeptidyl peptidase inhibitors |
| US20060063719A1 (en) * | 2004-09-21 | 2006-03-23 | Point Therapeutics, Inc. | Methods for treating diabetes |
| EP3314004A1 (en) * | 2015-06-26 | 2018-05-02 | DuPont Nutrition Biosciences ApS | Aminopeptidases for protein hydrolyzates |
| US11613785B2 (en) | 2017-01-09 | 2023-03-28 | Onkosxcel Therapeutics, Llc | Predictive and diagnostic methods for prostate cancer |
| DE102018107224A1 (de) * | 2018-02-21 | 2019-08-22 | Immatics Biotechnologies Gmbh | Peptide und Kombinationen von Peptiden nicht-kanonischen Ursprungs zur Verwendung in der Immuntherapie gegen verschiedene Krebsarten |
Family Cites Families (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4977085A (en) * | 1984-02-29 | 1990-12-11 | The Board Of Regents Of The Univ. Of California | Cloning and expression of yeast STE13 and Dpp2 genes encoding dipeptidyl aminopeptidase A and B |
| US5231126A (en) * | 1985-04-01 | 1993-07-27 | Shi Guan Yi | Beta-crystalline form of isotactic polypropylene and method for forming the same |
| CN1130406C (zh) * | 1997-02-07 | 2003-12-10 | 埃克森美孚化学专利公司 | 结合有聚乙烯大分子单体的丙烯聚合物 |
| US20040132158A1 (en) | 1999-01-11 | 2004-07-08 | Incyte Corporation | Human peptidases |
| WO2001019866A1 (en) | 1999-09-10 | 2001-03-22 | The University Of Sydney | Dipeptidyl peptidases |
| WO2001046277A2 (en) * | 1999-12-22 | 2001-06-28 | Exxonmobil Chemical Patents, Inc. | Polypropylene-based adhesive compositions |
| US20030198953A1 (en) | 2000-03-30 | 2003-10-23 | Spytek Kimberly A. | Novel proteins and nucleic acids encoding same |
| IL155245A0 (en) | 2000-10-12 | 2003-11-23 | Ferring Bv | Novel serine protease genes related to dppiv |
| US20020123538A1 (en) * | 2000-12-29 | 2002-09-05 | Peiguang Zhou | Hot-melt adhesive based on blend of amorphous and crystalline polymers for multilayer bonding |
| US6774069B2 (en) * | 2000-12-29 | 2004-08-10 | Kimberly-Clark Worldwide, Inc. | Hot-melt adhesive for non-woven elastic composite bonding |
| US7550528B2 (en) * | 2002-10-15 | 2009-06-23 | Exxonmobil Chemical Patents Inc. | Functionalized olefin polymers |
| US7700707B2 (en) * | 2002-10-15 | 2010-04-20 | Exxonmobil Chemical Patents Inc. | Polyolefin adhesive compositions and articles made therefrom |
| EP2261292B1 (en) * | 2002-10-15 | 2014-07-23 | ExxonMobil Chemical Patents Inc. | Polyolefin adhesive compositions |
| US7223822B2 (en) * | 2002-10-15 | 2007-05-29 | Exxonmobil Chemical Patents Inc. | Multiple catalyst and reactor system for olefin polymerization and polymers produced therefrom |
-
2000
- 2000-09-11 WO PCT/AU2000/001085 patent/WO2001019866A1/en not_active Ceased
- 2000-09-11 CA CA002384135A patent/CA2384135A1/en not_active Abandoned
- 2000-09-11 DE DE60029230T patent/DE60029230T2/de not_active Expired - Lifetime
- 2000-09-11 AT AT00962085T patent/ATE332366T1/de active
- 2000-09-11 US US10/070,464 patent/US6881564B1/en not_active Expired - Fee Related
- 2000-09-11 ES ES00962085T patent/ES2269178T3/es not_active Expired - Lifetime
- 2000-09-11 EP EP00962085A patent/EP1214344B1/en not_active Expired - Lifetime
- 2000-09-11 JP JP2001523643A patent/JP4748908B2/ja not_active Expired - Fee Related
- 2000-09-11 DK DK00962085T patent/DK1214344T3/da active
-
2004
- 2004-04-15 US US10/825,632 patent/US7148338B2/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| C.A. ABBOTT ET AL.: "Two highly conserved glutamic acid residues in the predicted beta propeller domain of dipeptidyl peptidase IV are required for its enzyme activity", FEBS LETTERS, vol. 458, 1999, pages 278 - 284, XP002950654 * |
| DATABASE PROTEIN [online] 15 February 2000 (2000-02-15), T. KAWAKAMI ET AL.: "NEDO human cDNA sequencing project", XP002950653, Database accession no. (BAA91059) * |
| E. JACOTOT ET AL.: "Dipeptidyl-peptidase IV-beta, a novel form of cell-surface-expressed protein with dipeptidyl-pepditase IV activity", EUROPEAN JOURNAL OF BIOCHEMISTRY, vol. 239, 1996, pages 248 - 258, XP002950670 * |
| G.W. MCCAUGHAN: "Molecular pathogenesis of liver disease: An approach to hepatic inflammation, cirrhosis and liver transplant tolerance", IMMUNOLOGICAL REVIEWS, vol. 174, 2000, pages 172 - 191, XP002950671 * |
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001079473A3 (en) * | 2000-04-18 | 2002-04-25 | Rachel A Meyers | 21953, a human prolyl oligopeptidase family member and uses thereof |
| WO2002031134A3 (en) * | 2000-10-12 | 2003-07-17 | Ferring Bv | Novel serine protease genes related to dppiv |
| US7157241B2 (en) | 2000-10-12 | 2007-01-02 | Ferring Bv | Serine protease genes related to DPPIV |
| US6844180B2 (en) | 2000-10-12 | 2005-01-18 | Ferring Bv | Serine protease genes related to DPPIV |
| US7276365B2 (en) | 2000-10-27 | 2007-10-02 | The University Of Sydney | Dipeptidyl peptidases |
| WO2002034900A1 (en) * | 2000-10-27 | 2002-05-02 | The University Of Sydney | Dipeptidyl peptidases |
| US7888094B2 (en) | 2000-10-27 | 2011-02-15 | Catherine Anne Abbott | Dipeptidyl peptidases |
| US7662944B2 (en) | 2000-10-27 | 2010-02-16 | The University Of Sydney | Nucleic acid molecules encoding prolyl dipeptidyl peptidases |
| EP1353684B1 (de) * | 2001-01-02 | 2011-05-04 | KeyNeurotek Pharmaceuticals AG | Verwendung von dipeptidylpeptidase iv und aminopeptidase-n inhibitoren zur behandlung von ischämie-induzierter neurodegeneration |
| WO2002066627A1 (en) * | 2001-02-16 | 2002-08-29 | Bayer Aktiengesellschaft | Regulation of human dipeptidyl peptidase 8 |
| WO2003033524A2 (en) | 2001-10-12 | 2003-04-24 | Probiodrug Ag | Peptidyl ketones as inhibitors of dpiv |
| WO2004017989A1 (en) | 2002-08-09 | 2004-03-04 | Prosidion Ltd. | Methods for improving islet signaling in diabetes mellitus and for its prevention |
| US7638638B2 (en) | 2003-05-14 | 2009-12-29 | Takeda San Diego, Inc. | Dipeptidyl peptidase inhibitors |
| US7470700B2 (en) | 2003-08-13 | 2008-12-30 | Takeda Pharmaceutical Company Limited | Dipeptidyl peptidase inhibitors |
| US7579357B2 (en) | 2003-08-13 | 2009-08-25 | Takeda Pharmaceutical Company Limited | Dipeptidyl peptidase inhibitors |
| WO2005106021A1 (en) * | 2004-04-28 | 2005-11-10 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with dipeptidyl-peptidase 8 (dpp8) |
| US8906901B2 (en) | 2005-09-14 | 2014-12-09 | Takeda Pharmaceutical Company Limited | Administration of dipeptidyl peptidase inhibitors |
| US8222411B2 (en) | 2005-09-16 | 2012-07-17 | Takeda Pharmaceutical Company Limited | Dipeptidyl peptidase inhibitors |
| US7625939B2 (en) | 2005-11-14 | 2009-12-01 | Probiodrug Ag | Cyclopropyl-fused pyrrolidine derivatives as dipeptidyl peptidase IV inhibitors |
| US7960384B2 (en) | 2006-03-28 | 2011-06-14 | Takeda Pharmaceutical Company Limited | Dipeptidyl peptidase inhibitors |
| US7728146B2 (en) | 2006-04-12 | 2010-06-01 | Probiodrug Ag | Enzyme inhibitors |
| US8084605B2 (en) | 2006-11-29 | 2011-12-27 | Kelly Ron C | Polymorphs of succinate salt of 2-[6-(3-amino-piperidin-1-yl)-3-methyl-2,4-dioxo-3,4-dihydro-2H-pyrimidin-1-ylmethy]-4-fluor-benzonitrile and methods of use therefor |
Also Published As
| Publication number | Publication date |
|---|---|
| DE60029230D1 (de) | 2006-08-17 |
| ATE332366T1 (de) | 2006-07-15 |
| DK1214344T3 (da) | 2006-11-06 |
| DE60029230T2 (de) | 2007-06-06 |
| ES2269178T3 (es) | 2007-04-01 |
| EP1214344B1 (en) | 2006-07-05 |
| JP4748908B2 (ja) | 2011-08-17 |
| US6881564B1 (en) | 2005-04-19 |
| EP1214344A4 (en) | 2004-03-10 |
| US7148338B2 (en) | 2006-12-12 |
| US20040191826A1 (en) | 2004-09-30 |
| CA2384135A1 (en) | 2001-03-22 |
| EP1214344A1 (en) | 2002-06-19 |
| JP2003509041A (ja) | 2003-03-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1214344B1 (en) | Dipeptidyl peptidases | |
| Abbott et al. | Cloning, expression and chromosomal localization of a novel human dipeptidyl peptidase (DPP) IV homolog, DPP8 | |
| Smyth et al. | Expression of recombinant human granzyme B. A processing and activation role for dipeptidyl peptidase I. | |
| US7662944B2 (en) | Nucleic acid molecules encoding prolyl dipeptidyl peptidases | |
| Ajami et al. | Dipeptidyl peptidase 9 has two forms, a broad tissue distribution, cytoplasmic localization and DPIV-like peptidase activity | |
| Baudin | New aspects on angiotensin-converting enzyme: from gene to disease | |
| McGuire et al. | Generation of active myeloid and lymphoid granule serine proteases requires processing by the granule thiol protease dipeptidyl peptidase I. | |
| Corvol et al. | [18] Peptidyl dipeptidase A: Angiotensin I-converting enzyme | |
| Skidgel et al. | Angiotensin converting enzyme (ACE) and neprilysin hydrolyze neuropeptides: a brief history, the beginning and follow-ups to early studies | |
| Lee et al. | Proteolytic Processing of Big Endothelin-3 by the Kell Blood Group Protein: Presented in part in abstract form at the 40th annual meeting of the American Society of Hematology, December, 1998. | |
| Hecquet et al. | Human bradykinin B2 receptor is activated by kallikrein and other serine proteases | |
| Kisiel et al. | Characterization of a protein C activator from Agkistrodon contortrix contortrix venom. | |
| Bermpohl et al. | Rat dipeptidyl peptidase IV (DPP IV) exhibits endopeptidase activity with specificity for denatured fibrillar collagens | |
| US6753176B2 (en) | Aggrecan degrading metallo proteases | |
| Abbott et al. | The Family of CD26/DPIV and Related Ectopeptidases: The DPIV family | |
| Gotoh et al. | Activity of dipeptidyl peptidase IV and post-proline cleaving enzyme in sera from osteoporotic patients. | |
| Smyth et al. | A novel substrate-binding pocket interaction restricts the specificity of the human NK cell-specific serine protease, Met-ase-1. | |
| AU767005B2 (en) | Dipeptidyl peptidases | |
| Umland et al. | Mouse ADAM33: two splice variants differ in protein maturation and localization | |
| JP2003000249A (ja) | クローディンによるMT−MMPsを介したproMMP−2活性化 | |
| Boudjennah et al. | Expression of collagenase/gelatinase activity from basement‐membrane fibronectin: Isolation after limited proteolysis of a bovine lens capsule and molecular definition of this thiol‐dependent zinc metalloproteinase | |
| Turner et al. | Structural studies of aminopeptidase P: A novel cellular peptidase | |
| Soubrier et al. | Angiotensin I-converting enzyme (ACE) gene structure and polymorphism: Relation to enzyme function and gene expression | |
| Bauer | Cytosol nonspecific dipeptidase | |
| AU2002214788B2 (en) | Dipeptidyl peptidases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2384135 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2001 523643 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2000962085 Country of ref document: EP Ref document number: 73946/00 Country of ref document: AU |
|
| WWP | Wipo information: published in national office |
Ref document number: 2000962085 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10070464 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 73946/00 Country of ref document: AU |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2000962085 Country of ref document: EP |