WO2001018233A2

WO2001018233A2 - Screening for inhibitors of lumazine synthase

Info

Publication number: WO2001018233A2
Application number: PCT/EP2000/007796
Authority: WO
Inventors: Adelbert Bacher; Simone MÖRTL
Original assignee: Adelbert Bacher; Moertl Simone
Priority date: 1999-09-03
Filing date: 2000-08-10
Publication date: 2001-03-15
Also published as: WO2001018233A9; EP1208221A2; AU7274800A; DE19942175A1; WO2001018233A3

Abstract

A method is described for screening for the presence or absence of inhibition of 6,7-dimethyl-8-ribityllumazine synthase activity comprising the following steps : (a) preparing a first aqueous mixture containing a protein having a plant-type 6,7-dimethyl-8-ribityllumazine synthase sequence, 5-amino-6-ribitylamino-2,4(1H,3H)pyrimidine-dione and 3,4-dihydroxy-2-butanone 4-phosphate; (b) reacting said first mixture during a predetermined period of time at a predetermined temperature and subsequently detecting the level of 6,7-dimethyl-8-ribityllumazine; (c) preparing a second aqueous mixture by including in said first mixture a predetermined amount of a chemical test sample; (d) reacting said second mixture during the predetermined period of time at the predetermined temperature and subsequently detecting the level of 6,7-dimethyl-8-ribityllumazine; (e) determining the presence of inhibition of 6,7-dimethyl-8-ribityllumazine synthase by observation of whether the level detected in step (d) is lower than the level detected in step (b).

Description

Method for screening for inhibitors of the biosynthesis of riboflavin

The invention relates to a method for screening for inhibitors of the biosynthesis of riboflavin. It further relates to plant-type enzymes for said method as well as DNA coding for said enzymes. Finally it relates to a method of inhibiting the biosynthesis of riboflavin in plants as well as chemical compounds exhibiting such inhibition.

A promising new approach for finding novel types of herbicides consists in screening libraries of chemical test samples for compounds that inhibit an enzyme in a biochemical pathway that is essential for plants but not for humans or animals. A most promising biosythetic pathway of this type is the pathway of riboflavin biosynthesis. All cellular organisms require riboflavin as an indispensible component of numerous redox enzymes many of which are crucial for the metabolism. All plants generate riboflavin biosynthetically, whereas all animals require a nutritional source of riboflavin. Therefore, an inhibitor for an enzyme in the biosynthesis of riboflavin in plants would not interfere with the metabolism of animals. Furthermore, the absolute amount of riboflavin for cellular activity is low. Therefore, only small amounts of the enzymes for riboflavin biosynthesis are found in cells. This in turm means that only small amounts of an inhibitor for such an enzyme would be-required.

The biosynthetic pathway of riboflavin (Fig. 1 ) has been studied in considerable detail in bacteria and yeast. The biosynthetic formation of one molecule of riboflavin (7) requires one molecule of GTP and two molecules of ribulose 5-phosphate. GTP (1 ) is initially converted to the committed product, 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinedione (3) by a sequence of deamination, side chain reduction, and dephosphorylation. The compound (3) is converted to 6,7-dimethyl-8-ribityllumazine (4) by condensation with 3,4- dihydroxy-2-butanone 4-phosphate (5) wich is obtained enzymatically from ribulose 5-phosphate (6) .

It is an object of the invention to provide a method for screening for inhibitors for an enzyme in the plant biosythesis of riboflavin, or for screening for an enzyme that is resistant to a specific inhibitor. It is a further object of the invention to provide a protein having an enzyme activity, useful in such screening method, as well as DNA coding for said protein.

It is further an object of the invention to provide inhibitors as well as a method for inhibiting an enzyme in the biosythesis of ribofiavin.

We have discovered that the genomes of plants, specifically Arabidopsis thaliana, comprise a gene that codes for a protein that comprises a leader sequence and a sequence exhibiting 6,7-dimethyl-8-ribityllumazine synthase activity. We have expressed this enzyme and found that it is useful for screening a chemical library for inhibitors, with or without the leader sequence.

Specifically we have provided a method for screening for the presence or absence of inhibition of 6,7-dimethyl-8-ribity!-lumazine synthase activity comprising the following steps:

(a) preparing a first aqueous mixture containing a protein having a plant 6,7- dimethyl-8-ribityllumazine synthase sequence, 5-amino-6-ribitylamino- 2,4(1 H,3H)pyrimidine dione and 3,4-diyhydroxy-2-butanone 4-phosphate,

(b) reacting said first mixture during a predetermined period of time at a predetermined temperature and subsequently detecting the level of 6,7- dimethyl-8-ribityllumazine, (c) preparing a second aqueous mixture by including in said first mixture a predetermined amount of a chemical test sample,

(d) reacting said second mixture during the predetermined period of time at the predetermined temperature and subsequently detecting the 6,7- dimethyl-8-ribityllumazine,

(e) determining the presence of inhibition of 6,7-dimethyl-8-ribityllumazine synthase by observation of whether the level detected in step (d) is lower that the level detected in step (b) .

Further we have provided a method for screening for the presence or absence of resistance to inhibition of 6,7-dimethyl-8-ribityllumazine sythase activity comprising the following steps:

(a) preparing a first aqueous mixture containing a protein having a mutated plant-type 6,7-dimethyl-8-ribityllumazine synthase sequence, 5-amino-6- ribitylamino-2,4(1 H,3H)pyrimidinedione and 3,4-dihydroxy-2-butanone 4- phosphate,

(b) reacting said first mixture during a predetermined period of time at a predetermined temperature and subsequently detecting the level of 6,7- dimethyl-8-ribityllumazine,

(c) preparing a second aqueous mixture by including in said first mixture a predetermined amount of a specific inhibitor for 6,7-dimethyl-8- ribityllumazine synthase activity,

(d) reacting said second mixture during the predetermined period of time at the predetermined temperature and subsequently detecting the level of 6,7-dimethyl-8-ribityllumazine,

(e) determining the presence of resistance to inhibition of 6,7-dimethyl-8- ribityllumazine synthase by observation of whether the level detected in step (d) is similar to the level detected in step (b). Based on the screening method we have thus provided a general solution of the problem of providing inhibitors as well as a method of inhibition for riboflavin biosynthesis in plants.

The invention will now be described in detail.

Identification of the lumazine synthase gene of Arabidopsis thaliana The known amino acid sequence of the ribE protein of E. coli (Mδrtl et al.) was used to search the DNA sequence data base of the Institute for Genomic Research (Rockvilie, USA) (accession number, AC004005) . Significant similarity was found with a segment of BAC clone F6E1 3 from Arabidopsis chromosome II (Fig.1 ) . The exons of the sequence had been predicted by the computer program xgrail and the predicted protein had been incorrectly assigned as riboflavin synthase.

Sequence comparison showed that the E. coli ribE protein was similar over its entire length to the sequence predicted by the Arabidopsis gene F6E1 3.1 8. However, the putative lumazine synthase gene of Arabidopsis also specifies an N-terminal peptide sequence with a high content of serine and threonine (about 67 amino acids) which is devoid of similarity to any sequence in the database and has no equivalent in the E. coli protein.

Cloning, expression and purification of lumazine synthase from Arabidopsis thaliana

Originator for the construction of an expression vector is cDNA. The ribE gene is amplified by PCR with specific primers and cDNA from the corresponding plant as template. Alternatively the cDNA may originate from an existing EST-clone. The RibE protein of A. thaliana includes a signal sequence of about 67 amino acids which was found not to be essential for enzyme activity. The amplified DNA fragment is modified by two consecutive PCR amplifications with modifying primers. In the first PCR reaction a ribosomal binding site preceding the start codon at an optimal distance is introduced at the 5 ' -end. A recognition site for a restriction enzyme, for example BamHI, Sail or Pstl is introduced at the 3 ^' -end. The preferred recognition site is BamHI . In the second PCR reaction the product of the first is used as template. At the 5 ^'-end a recognition site for the restriction enzyme EcoRI preceding the ribosomal binding site is introduced with a modifying primer. The amplified DNA fragment is inserted into a vector capable of autonomous replication in the host microorganism to give a recombinant piasmid containing said DNA. The recombinant piasmid is used to transform the host microorganism, for example Escherichia coli or Bacillus subtilis. The preferred host is E. coli. The expression of plant protein may be poor in the host organism. To enhance the expression level and/or to simplify the purification of the protein the recombinant piasmid may include a gene or a part of a gene without a stop codon preceding the ribE gene in the same reading frame. A preferred gene for this purpose is the malE gene from E. coli. The expression of such a recombinant DNA generates a fusion protein between the maltose binding protein (MBP) from E. coli and the plant RibE protein. Various constructs are shown in Fig. 3. Fig. 3A shows a construct with putative signal sequence S, Fig . 3B shows a construct without the putative signal sequence. Fig. 3C shows a construct with maltose binding protein and without putative signal sequence.

The strains harbouring the expression vectors can be cultivated in conventional culture media at 1 5 to 40°C. The preferred temperature is 37°C. The E. coli strains are induced with 0.5 to 2 mM isopropyl-β-D-thiogalactosid at an optical density from 0.5 to 0.8. The cells are incubated between 2 and 1 2 h, preferably 5 h. The cells are lysed with lysozyme and/or disrupted with a sonifier. The crude extract with MBP-ribE fusion protein is purified by affinity chromatography with an amylose resin. A protein is obtained which has the proper folding structure for exhibiting the desired enzyme activity.

Screening for the presence or absence of inhibition of 6,7-dimethyl-8- ribityllumazine synthase

Lumazine synthase catalyzes the formation of 6,7-dimethyl-8-ribityllumazine by condensation of 5-amino-6-ribitylamino-2,4(1 H,3H)pyrimidinedione with 3,4- dihydroxy-2-butanon 4-phosphate (Neuberger et al., 1 986; Volk & Bacher, 1 988) . The enzyme requires no cofactors and shows full catalytic activity in the presence of a chelator such as EDTA. 3,4-dihydroxy-2-butanon 4-phosphate is prepared enzymatically from ribulose 5-phosphate by the action of 3,4- dihydroxy-2-butanon 4-phosphate synthase (Richter et al., 1 992) . The assay can be started by adding one of the needed substances to a mixture of the others. Preferably 5-amino-6-ribitylamino-2,4(1 H,3H)pyrimidinedione is added to a solution of 3,4-dihydroxy-2-butanon 4-phosphate and enzyme in a buffer at pH 6.5 to 8.0, preferably 7.0. The reaction mixture can be incubated for 1 to 60 min at 1 0 to 40°C. Preferably it is incubated for 5 min at 37°C. The assay can be stopped by denaturing the enzyme with trichloroacetic acid, acetone or sodium dodecylsulfate. The preferred denaturing is with trichloroacetic acid. The assay is carried out with otherwise identical mixtures with and without test sample of a possible inhibitor. The enzyme product 6,7-dimethyl-8- ribityllumazine can be detected directly without derivatization, preferably photometrically, preferentially after purification by HPLC. The lumazine can be identified by absorbance at 410 nm. The extinction coefficient is 1 0300 M^"1cm^"1. The product can also be monitored fluorometrically at an absorbance wavelength at 408 nm and an emision wavelength at 487 nm. 6,7- Dimethyl-8-ribityllumazine can also be synthesized without enzymatic catalysis (Bacher et al., 1 996) . For an exact determination of the enzymatic activity it is therefore necessary to subtract the amount of lumazine formed non-catalytically from the entire amount of produced lumazine. The isolated DNA codes specifically for a protein with a plant-type sequence of 6,7- dimethyl-8-ribityllumazine synthase whereby it may have either a single open reading frame for said protein or additionally at least one further open reading frame coding for another enzyme of the flavin pathyways.

The term "plant-type sequence" means in one sense a sequence as it occurs in a plant (with or without leader sequence). In a broader and more adequate sense, it means a sequence of a sequence space which is established by using a specific plant 6,7-dimethyl-8-ribityllumazine synthase (with or without leader sequence) as a reference sequence, producing an alignment of said reference sequence with at least one other plant 6,7-dimethy!-8-ribityllumazine synthase sequence and obtaining for each position in said alignment a set of equivalent amino acids from the variability at this position. Any sequence contained in this sequence space has a very high likelihood of being functional for the intended enzyme activity and being highly homologous to plant enzymes.

It is surprising that the isolated proteins could be obtained in a form (e.g. folding form) which is functional for the intended enzyme activity. This functional competence defines a subset of substances of the much broader set of substances which all have the same sequence.

For the screening process, a specific plant enzyme may be used selected in accordance with the plant(s) targeted. It is also possible to construct a plant-type enzyme sequence (with or without leader sequence) which is on average closest to each of a subset of plant enzyme sequences of a set of plants targeted. Example 1 : Construction of an expression clone

The putative ribE gene (gene F6E1 3.1 8) of E. coli was amplified by PCR using a cDNA library (Minet et al.) as template First PCR:

The reaction mixtures contained 1 0 pmol primer 5 ^' -GfGAGAAATTAACCA TGAAGT-CATTAGCTTCGCCG-3 ^' , 1 0 pmol primer 5 ^' -TCATGTGGATCCA TGGAACGAGCCGAG-3 ^' , 1 0 ng of cDNA, 1 μl Taq polymerase, 1 0 μl of buffer (Eurogentec), 6 μl MgCI₂ (25 mM, Eurogentec) and 20 nmol of dNTPs in a total volume of 1 00 μl.

The mixture was denatured at 94°C for 5 min. 30 PCR cycles (60 sec at 95 °C, 45 sec at 50°C, 45 sec at 72°C) were performed. After another 7 min incubation at 72°C, the mixture was cooled at 4 °C, and the DNA was electrophoresed on a 0.8 % agarose gel. The band at 750 bp was purified with a gel extraction kit (Qiagen) . The DNA fragment was excised from the agarose gel with a scalpel. Three volumes of buffer QX1 (Qiagen) were added to 1 volume of the excised gel and incubated at 50°C for 1 0 min. One gel volume of isopropanol was added. To bind DNA, the sample was applied to a Qiaquick column and centrifuged for 1 min at 1 4000 rpm. The flow through was discarded. 0.75 ml buffer PE (Qiagen) were added to the column and centrifuged as before. The flow through was discarded and the column was centrifuged for an additional 1 min at 1 4000 rpm. The column was placed in a clean 1 .5 ml Eppendorf tube. 50 μl of H₂0 (bidestilled, sterile) were added to the column and it was centrifuged for 1 min at 1 4000 rpm. The flow through contained the purified DNA.

Second PCR ( Two identical PCRs with 1 00 μl each were performed to obtain a higher yield)

1 0 pmol primer CAATTTGAATTCATTAAAGAGGAGAAATTAACTATG-3 ' , 1 0 pmol 5 ^' -TCATGTGGATCCATGGAACGAGCCGAG-3 ^' , 1 μl of Taq polymerase ( 1 U), 1 0 μl of buffer (Taq-buffer, Eurogentec), 6 μl MgCI₂ (25 mM), 5 μl of purified PCR1 product and 20 nmol dNTPs in a total volume of 1 00 μl. The mixture was denatured at 94°C for 5 min. 30 PCR cycles (60 sec at 94 ^°C, 45 sec at 50°C, 45 sec at 72 °C) were performed. After another 7 min incubation at 72°C, the mixture was cooled at 4°C, and the DNA was purified with a PCR purification kit (Qiagen) .

5 volumes of buffer PB (Qiagen) were added to 1 volume of the PCR reaction, applied to a Qiaquick column and centrifuged for 1 min at 1 4000 rpm. The flow through was discarded. 0.75 ml buffer PE (Qiagen) were added to the column and centrifuged as before. Piasmid pNCO 1 1 3 (Stϋber et al., 1 980) was isolated from 20 ml overnight culture of pNCO 1 1 3 in E. coli XL-1 Blue using the piasmid isolation kit Nucleobond AX1 00 (Macherey & Nagel) .

The PCR product and the piasmid pNCO 1 1 3 were digested with the restriction enzymes EcoRI and BamHI, 20 μl OPA buffer (Pharmacia), 2 μl EcoRI (20 U, Pharmacia), 2 μl BamHI (20 U, Pharmacia), 2,5 μg PCR2 product resp. 5.0 μg pNCO 1 1 3 in a total of 1 00 μl H₂0) at 37°C for 4 h and purified with a PCR purification kit. The digested PCR2 product and the piasmid pNCO 1 1 3 were ligated together with T₄-ligase yielding piasmid pNCOπbE(AT): 50 fmol of pNCO 1 1 3, 1 00 fmol of PCR2 product, 4 μl of buffer (Gibco), and 1 μl of T₄- ligase ( 1 U, Gibco) in a total of 20 μl. The mixture was incubated overnight at 4°C, purified with a PCR purification kit and transformed into electrocompetent E. coli XL-1 Blue cells (Bullock et al., 1 987) by electroporation.

Preparation of the electrocompetent cells: One liter of Luria-Bertani-medium was inoculated with 1 0 ml of a fresh overnight culture. The cells were grown at 37 °C with vigorous shaking to an optical density of 0.5 to 0.7. The suspension was chilled on ice for 20 min and centrifuged in a cold rotor at 4000 g for 1 5 min at 4°C. The supernatant was removed and the pellet resuspended in 1 liter of ice-cold sterile 1 0 % glycerol. The cells were pelleted two times as described before and the pellet was resuspended the first time in 0.5 liter and the second time in 20 ml of ice-cold 1 0 % glycerol. The cells were again pelleted, and the pellet was resuspended to a final volume of 2 to 3 ml in ice-cold 1 0 % glycerol. The suspension was frozen in aliquots of 80 μl and stored in liquid nitrogen.

Electro-transformation using the Gene Pulser apparatus from Biorad: The electrocompetent cells were thawed at room temperature and placed on ice. 40 μl of the cell suspension were mixed with 1 μl of the ligation mixture and transferred into a sterile 0.2 cm cuvette (Biorad) . The suspension was shaked to the bottom and the cuvette was placed into the chamber slide. The chamber slide was pushed into the chamber and a pulse was applied (2,50 kV, 25 μF, Pulse Controller 200 Ohm). The cuvette was removed from the chamber and the cells were suspended in 1 ml Soc medium (2 % casein hydrolysate, 0.5 % yeast extract, 1 0 mM NaCI, 2.5 mM KCI, 1 0 mM MgCI₂, 1 0 mM MgS0₄, 20 mM glucose) . The suspension was incubated with shaking for 1 h at 37 °C and plated on LB media supplemented with 1 50 mg ampicillin per liter. Plasmids from different clones were isolated (pNCOribE(AT) 1 -1 0) .

The plasmids were isolated from 5 ml of fresh ovemiglit culture using the mini piasmid isolation kit from Qiagen. The bacterial pellet was resuspended in 0.3 ml of 50 mM Tris hydrochloride, pH 8.0 containing 1 0 mM EDTA and 1 00 μg/ml RNase. 0.3 ml of 200 mM sodium hydroxide containing 1 % SDS were added, and the mixture was incubated for 5 min at room temperature. 0.3 ml of chilled 3.0 M sodium acetate, pH 5.5 were added, and the mixture was incubated on ice for 1 0 min. The mixture was centrifuged for 1 5 min at 1 4000 rpm in a minifuge. The supernatant was removed and applied to a Qiagen-tip 20 which was previously equilibrated with 1 ml of 50 mM MOPS , pH 7.0, containing 750 mM NaCI, 1 5 % ethanol and 0.1 5 % Triton X-1 00. The Qiagen tip was washed 4 times with 1 ml of 50 mM MOPS, pH 7.0 containing 1 000 mM NaCI and 1 % ethanol. The DNA was eluted with 0.8 ml of 50 mM Tris hydrochloride, pH 8.5 containing 1 250 mM NaCI and 1 5 % ethanol. The DNA was precipitated with 0.7 volumes of isopropanol, centrifuged at 1 4000 rpm for 30 min and washed with 1 ml cold 70 % ethanol. The DNA sequence of the recombinant plasmids were determined by a automated dideoxynucleotide sequencing methode using an ABI Prism 377 DNA sequencer from Applied Biosystems Inc. with the ABI Prism Sequencing Analysis Software.

Example 2: Construction of an expression clone without the putative transit peptide sequence

The ribE gene with the exception of the first 21 6 bp coding for a putative transit peptide was amplified by PCR using piasmid pNCOribE(AT) 1 (from A. thaliana ribE expression clone ) as template. Piasmid pNCOribE(AT) 1 was isolated as described. Amino acid 73 was mutated from an arginine to methionine and a recognition site for the restriction enzyme EcoRI preceding the start codon was introduced at the 5 ' end with a modifying primer.

First PCR:

The reaction mixtures contained 1 0 pmol primer 5 ^' -

GGAGAAATTAACCATGCATGTTA-CGGGGTCTCTTATC-3 ^' , 1 0 pmol primer 5 ' -

TCATGTGGATCCATGGAACGAGCCGAG-3 ^' , 1 0 ng of cDNA, 1 μl Taq polymerase (1 U), 1 0 μl of buffer (Eurogentec), 6 μl of MgCI₂ (25 mM,

Eurogentec) and 20 nmol of dNTPs in a total volume of 1 00 μl.

The mixture was denatured at 94°C for 5 min. 30 PCR cycles (60 sec at 94°C,

45 sec at 50°C, 45 sec at 72°C) were performed. After another 7 min incubation at 72°C, the mixture was cooled at 4°C, and the DNA was electrophoresed on a 0.8 % agarose gel. The band at 500 bp was purified with a gel extraction kit (Qiagen) .

1 0 pmol primer CAATTTGAATTCATTAAAGAGGAGAAATTAACTATG-3 ' , 1 0 pmol 5 ' -TCATGTGGATCCATGGAACGAGCCGAG-3 ^' , 1 μl of Taq polymerase ( 1 U), 1 0 μl of buffer (Taq-buffer, Eurogentec), 6 μl of MgCI₂ (25 mM), 5 μl of purified PCR1 product and 20 nmol dNTPs in a total volume of 1 00 μl. The mixture was denatured at 94°C for 5 min. 30 PCR cycles (60 sec at 94°C, 45 sec at 50°C, 45 sec at 72°C) were performed. After another 7 min incubation at 72°C, the mixture was cooled at 4°C, and the DNA was purified with a PCR purification kit (Qiagen) .

The further steps were analogous to the construction of pNCOribE(AT) in Reference Example 1 . The resulting piasmid encoding a ribE protein without the putative peptide sequence is designated pNCOribE(AT)-sig.

Example 3: Construction of an malE-ribE fusion clone without putative transit peptide sequence

The ribE gene with the exception of the first 21 6 bp was amplified by PCR using piasmid pNCOribE(AT) as template and was ligated in frame at the 3 ^' -end of the malE gene.

First PCR:

The reaction mixtures contained 1 0 pmol primer 5 '-

ATAATAATAGCGGCCGCTATGCATGT-TACGGGGTCTCTTATC -3 ' , 1 0 pmol primer 5 ' -TCATGTGGATCCATGGAACGAGCCGAG-3 ^' , 1 0 ng of cDNA, 1 μl Taq polymerase ( 1 U), 1 0 μl of buffer (Eurogentec), 6 μl MgCI₂ (25 mM, Eurogentec) and 20 nmol of dNTPs in a total volume of 100 μl.

The mixture was denatured at 94°C for 5 min. 30 PCR cycles (60 sec at 94° C, 45 sec at 50° C, 45 sec at 72°C) were performed. After another 7 min incubation at 72° C, the mixture was cooled at 4° C, and the DNA was electrophoresed on a 0.8 % agarose gel. The band at 500 bp was purified with a gel extraction kit (Qiagen) .

1 0 pmol primer CAATTTGAATTCATTAAAGAGGAGAAATTAACTATG-3 ^' , 1 0 pmol 5 ^' -TCATGTGGATCCATGGAACGAGCCGAG-3 ^' , 1 μl of Taq polymerase ( 1

U), 1 0 μl of buffer (Taq-buffer, Eurogentec), 6 μl MgCI₂ (25 mM), 5 μl of purified

PCR1 product and 20 nmol dNTPs in a total volume of 1 00 μl.

The mixture was denatured at 94° C for 5 min. 30 PCR cycles (60 sec at 94° C,

45 sec at 50° C, 45 sec at 72°C) were performed. After another 7 min incubation at 72° C, the mixture was cooled at 4° C, and the DNA was purified with a PCR purification kit (Qiagen) .

Piasmid pNCOmalEribH (Fischer, 1 997) was isolated from 20 ml of a overnight culture as described for piasmid pNCO 1 1 3.

The PCR product and the piasmid pNCOmalEribH were digested with the restriction enzymes Notl and BamHI (1 0 μl BamHI buffer (NEB), 1 μl BSA (1 00x), 4 μl BamHI (20 U, NEB), 3 μl Notl (60 U, NEB), 2 μg PCR product resp. 5 μg pNCOmalEribH in a total volume of 1 00 μl) at 37° C for 3 h. The PCR product was purified with a PCR purification kit (Qiagen) . The digested piasmid was electrophoresed on an agarose gel. The band at 3400 bp was purified with a gel extraction kit (Qiagen) . Further steps were analogous to the construction of pNCOribE(AT) in Example 1 . the piasmid encoding a malE-ribE fusion protein was named pNCOmalE-ribE(AT)-sig Example 4: Preparation and purification of the ribE proteins with and without signal sequence

1 I Luria Bertani (LB) medium containing 1 60 mg ampicillin were inoculated with 40 ml overnight culture of E. coli strain XL-1 harboring piasmid pNCOribE(AT) resp. pNCOribE(AT)-sig. The culture was grown in shaking culture at 37°C. At an optical density (600 nm) of 0.6 the culture was induced with 2mM IPTG . The culture was grown for another 5 h. The cells were harvested by centrifugation for 20 min at 5000 rpm and 4°C. The cells were washed with 0.9 % NaCI solution, centrifugated as above and frozen at -20° C for storage. The cells were thawed in 20 ml 50 mM potassiumphosphate pH 7.0 containing 1 mM EDTA and 0.5 mM phenylmethylsulfonyl fluoride. The mixture was sonified 6 x 1 5 sec (Branson sonifier level 4) . The suspension was centrifuged at 1 5000 rpm at 4°C for 20 min. The supernatant was applied to a 20 ml column of Sepharose Q (Pharmacia) previously equillibrated with 50 mM potassium phosphate pH 7.0 (buffer A) , the column was washed with 60 ml buffer A and developed with a linear gradient of 200 ml buffer A containing 1 M NaCI. Fractions containing the ribE protein were identified by SDS eiectrophorese and concentrated with a Amicon cell (membran size, 30 kDa) . Aliquots containing 5 mg protein were passed through a Superdex 200 (1 .6 by 60 cm, Pharmacia) gel filtration column , which was developed with buffer A containing 1 00 mM NaCI. 38 mg ribE(AT) resp. 2 mg ribE(AT)-sig were obtained.

Example 5 : Preparation and purification of the MBP-ribE fusion proteins

0.5 I Luria Bertani (LB) medium containing 75 mg ampicillin were inoculated with 40 ml overnight culture of E. coli strain XL-1 harboring piasmid pNCOmalEribE(AT) . The culture was grown in shaking culture at 37°C. At an optical density (600 nm) of 0.5 the culture was induced with 1 mM IPTG. The culture was incubated with shaking for another 3 h. The cells were harvested by centrifugation for 20 min at 5000 rpm and 4°C. The cells were washed with 0.9 % NaCI solution, centrifuged as above and stored at -20°C. The cells were thawed in 1 0 ml 50 mM potassium phosphate, pH 7.0 containing 1 mM EDTA and 0.5 mM phenylmethylsulfonyl fluoride. The mixture was sonified 6 x 1 5 sec (Branson sonifier level 4) . The suspension was centrifuged at 1 5000 rpm at 4°C for 20 min. The supernant was diluted 1 :5 with buffer A (Example 4) and placed on a 2 ml column of amylose resin (New England Biolabs) previously equilibrated with 1 5 ml buffer A. The column was washed with 30 ml buffer A. The fusion protein was eluted from the column with 6 ml buffer A containing 1 0 mM maltose. 5 mg malE-ribE protein was obtained. The purity of the protein (56 kDa) was examined by SDS electrophorese.

Example 6: Screening for lumazine synthase activity

Preparation of 3,4-dihydroxy-2-butanon-4-phosphate:

A reaction mixture contained 1 00 mM potassium phosphate pH 7.5, 20 mM MgCI₂, 1 0 mM ribose 5-phosphate (Sigma) and 0.1 U pentose-phosphate isomerase (Sigma) and 3,4-dihydroxy-2-butanon 4-phosphate synthase (2000 U) in a total volume of 1 00 μl. The mixture was incubated at 37 °C for 20 min.

Assay of lumazine synthase activity:

Assay mixture contained 1 00 mM potassium phosphate, pH 7.0, 20 mM EDTA, 1 mM 3,4-dihydroxy-2-butanone 4-phosphate, and 5 fi\ of the enzyme sample in a total volume of 50 μl. After a preincubation time of 2 min at 37°C the reaction was started by the addition of 1 μl of 5 mM 5-amino-6-ribitylamino-2,4( 1 H,3H)- pyrimidinedione and the samples were incubated at 37°C for 5 min. The reaction was stopped by the addition of 50 ml trichloroacetic acid (1 5 %) . 6,7- Dimethyl-8-ribityllumazine was determined by reverse-phase HPLC on a column of Nucleosil RP1 8. The eluent contained 30 mM formic acid and 20 % methanol. The effluent was monitored fluorometrically (excitation, 408 nm; emission, 487 nm) . One unit of enzyme activity catalyzes the formation of 1 nmol of 6,7-dimethyl-8-ribityllumazine per h at 37°C.

Screening for inhibition of lumazine synthase activity

The screening for inhibition of lumazine synthase was done with the ribE gene product without the putative transit peptide sequence. The assays were performed with different inhibitor concentrations at constant concentrations of 5-amino-6-ribitylamino-2,4(1 H,3H)pyrimidindione, and 3,4-dihydroxy-2-butanone 4-phosphate. The amount of biomimetically formed lumazine was substracted from the total amount of lumazine.

Screening for lumazine synthase activity in the presence of 5-nitroso-6- ribitylamino-2,4(1 H,3H)pyrimidinedione (Winestock & Plaut, 1 961 ) or 5-nitro-6- ribitylamino-2,4( 1 H,3H)pyrimidinedione (Cresswell & Wood, 1 960)

500 μl potassium phosphate buffer (1 00 mM, pH 7.5) containing 1 mM EDTA and 1 0 μg enzyme, 1 00 μl inhibitor (final concentration, 0 - 1 0 mM), and 1 0 μl 5-amino-6-ribitylamino-2,4(1 H,3H)-pyrimdinedione (9 M) were combined in a 1 ml cuvette. After a preincubation time of 10 min at 37°C, the reaction was started by the addition of 20 μl 3,4-dihydroxy-2-butanone 4-phosphate and incubated for another 5 min at 37°C. The reaction was monitored photometrically at 41 0 nm. Literature

Bullock W.O., J.M. Fernandez, J.M . Short (1 987)

XL-1 Blue: a high efficiency transforming recA Escherichia coli strain with β-

Galactosidase selection

BioTechiques, 5, 376-379

Cresswell R.M and Wood H.C.S (1 960)

The biosynthesis of pteridines. Part I . the synthesis of riboflavin

J . Chem. Soc, 1 960, 4769-4775

Fischer M. ( 1 997)

Effiziente Methoden zur in vitro Mutagenese: Untersuchungen zum Mechanismus von Lumazinsynthase und GTP-Cyclohydrolase I

Thesis, Technische Universitat Munchen

Mόrtl S., M . Fischer, G. Richter, J. Tack, S. Weinkauf and A. Bacher ( 1 996) Biosynthesis of Riboflavin: Lumazine synthase of Escherichia coli J. Biol. Chem., 271 , 33201 -33207

Neuberger G. and A. Bacher (1 986)

Biosynthesis of ribofalvin. Enzymatic formation of 6,7-dimethyl-8-ribityllumazine by riboflavin synthase from Bacillus subtilis

Biochem. Biophys.Res. Commun., 1 39, 1 1 1 1 -1 1 1 6

Richter G., R. Volk, C. Krieger, H. Lahm, U. Rothlisberger and A. Bacher (1 992) Biosynthesis of riboflavin. Cloning, sequencing and expression of the gene coding for 3,4-dihydroxy-2-butanon-4-phosphate synthase of Escherichia coli J. Bacteriol., 1 74, 4050-4056 Stϋber D., H. Matile, G. Garotta (1990)

System for high-level production in Escherichia coli and rapid purification of recombinant proteins: Application to epitope mapping, preparation of antibodies and structure-function analysis in: Lefkovitz I., P. Pernis (eds.) Immunological Methods, IV, 121-152

Volk R. and A. Bacher (1988)

Biosynthesis of riboflavin. The structure of the 4-carbon precursor

J. Amer. Soc, 110, 3651-3653

Winestock CH. and Plaut G.W.E. (1961)

Synthesis and properties of certain substituted lumazines

J. Org. Chem., 26, 4456-4462

Annex A Nucleotide- and amino acid sequence of the lumazine synthase of Arabidopsis thaliana

ATGAAGTCATTAGCTTCGCCGCCGTGTCTCCGCCTGATACCGACGGCACACCGTCAGCTC M K S L A S P P C L R L I P T A H R Q

AATTCGCGTCAATCTTCCTCCGCCTGTTATATACACGGTGGCTCTTCTGTGAACAAATCC N S R Q S S S A C Y I H G G S S V N K S

AATAATCTCTCATTCTCCTCATCCACATCCGGATTTGCGTCACCACTAGCTGTAGAGAAG N N L S F S S S T S G F A S P L A V E K

GAATTACGCTCTTCATTCGTACAGACGGCTGCTGTTCGCCATGTTACGGGGTCTCTTATC E L R S S F V Q T A A V R H V T G S L I

AGAGGCGAAGGTCTTAGATTCGCCATCGTGGTAGCTCGTTTCAATGAGGTTGTGACTAAG R G E G L R F A I V V A R F N E V V T K

TTGCTTTTGGAAGGAGCGATTGAGACTTTCAAGAAGTATTCAGTCAGAGAAGAAGACATT L L L E G A I E T F K K Y S V R E E D I

GAAGTTATTTGGGTTCCTGGCAGCTTTGAAATTGGTGTTGTTGCACAAAATCTTGGGAAA E V I V P G S F E I G V V A Q N L G K

TCGGGAAAATTTCATGCTGTTTTATGTATCGGCGCTGTGATAAGAGGAGATACCACACAT S G K F H A V L C I G A V I R G D T T H

TATGATGCTGTTGCCAACTCTGCTGCGTCTGGAGTACTTTCTGCTAGCATAAATTCAGGC Y D A V A N S A A S G V L S-A S I N S G

GTTCCATGCATATTTGGTGTACTGACTTGCGAGGACATGGATCAGGCTCTGAATCGATCT V P C I F G V T C E D M D Q A L N R S

GGTGGCAAAGCCGGCAATAAGGGAGCTGAAACTGCTTTGACGGCGCTCGAAATGGCGTCG G G K A G N K G A E T A L T A L E M A S

TTGTTTGAGCACCACCTGAAATAGCTCGGCTCGTTCCAT L F E H H L K

Claims

1 . A method for screening for the presence or absence of inhibition of 6,7- dimethyl-8-ribityllumazine synthase activity comprising the following steps:

(a) preparing a first aqueous mixture containing a protein having a plant-type 6, 7-dimethyl-8-ribityllumazine synthase sequence, 5- amino-6-ribitylamino-2,4(1 H,3H)pyrimidine-dione and 3,4- dihydroxy-2-butanone 4-phosphate;

(b) reacting said first mixture during a predetermined period of time at a predetermined temperature and subsequently detecting the level of 6,7-dimethyl-8-ribityllumazine;

(c) preparing a second aqueous mixture by including in said first mixture a predetermined amount of a chemical test sample;

(d) reacting said second mixture during the predetermined period of time at the predetermined temperature and subsequently detecting the level of 6,7-dimethyl-8-ribityllumazine;

(e) determining the presence of inhibition of 6,7-dimethyl-8- ribityllumazine synthase by observation of whether the level detected in step (d) is lower than the level detected in step (b) .

2. A method for screening for the presence or absence of resistance to inhibition of 6,7-dimethyl-8-ribityllumazine synthase activity comprising the following steps:

(a) preparing a first aqueous mixture containing a protein having a mutated plant-type 6,7-dimethyl-8-ribityllumazine synthase sequence, 5-amino-6-ribityl amino-2,4(1 H,3H)pyrimidione and 3,4- dihydroxy-2-butanone 4-phosphate;

(c) preparing a second aqueous mixture by including in said first mixture a predetermined amount of a specific inhibitor for 6,7- dimethyl-8-ribityllumazine synthase activity;

(e) determining the presence of resistance to inhibition of 6,7-dimethyl- 8-ribityllumazine synthase by observation of whether the level detected in step (d) is similar to the level detected in step (b) .

3. The method according to claims 1 or 2, wherein said aqueous mixture has a pH in the range of 5.5 to 9.

4. The method according to claims 1 or 2, wherein a premixture is prepared which lacks one essential ingredient and the reaction is started by adding said ingredient.

5. The method according to claims 1 or 2, characterized in that the reaction is terminated by adding an acid or a solvent or a surfactant, preferably trichloroacetic acid or acetone or sodium dodecylsulfate.

6. The method according to one of the claims 1 to 5, characterized in that the level of 6,7-dimethyl-8-ribityllumazine is detected photometrically or fluorometrically.

7. The method according to claim 6, wherein the detection is effected in an HPLC fraction.

8. The method according to one of claims 1 to 6, characterized in that the detection is effected by incubation with riboflavin synthase and detection of riboflavin.

9. The method according to one of claims 1 or 2, characterized in that a mixture containing 3,4-dihydroxy-2-butanone 4-phosphate is prepared by incubating an aqueous mixture containing ribulose 5-phosphate with 3,4- dihydroxy-2-butanone 4-phosphate synthase.

1 0. The method according to one of claims 1 or 2, characterized in that a mixture containing 3,4-dihydroxy-2-butanone 4-phosphate is prepared by incubating an aqueous mixture containing ribose 5-phosphate with pentose-phosphate isomerase and 3,4-dihydroxy-2-butanone 4-phosphate synthase.

1 1 . An isolated protein having a plant-type 6,7-dimethyl-8-ribityllumazine synthase sequence and existing in a form functional for 6,7-dimethyl-8- ribityllumazine synthase activity.

1 2. An isolated DNA coding exclusively for

(a) a protein comprising a plant-type 6,7-dimethyl-8-ribityllumazine synthase sequence; and

(b) optionally at least one additional enzyme of the flavin biosynthetic pathways.

1 3. A method of inhibiting an enzyme with 6,7-dimethyl-8-ribityllumazine synthase activity of or in a plant by treatment with a compound selected from the group of chemical compounds that exhibit inhibition in the screening method of claim 1 .

4. A chemical compound exhibiting inhibition of a plant 6,7-dimethyl-8- ribityllumazine synthase activity in the method of claim 1 .