WO2001009322A1 - Recepteurs couples a la proteine de liaison guanosine triphosphate, genes correspondants, et leur production et utilisation - Google Patents

Recepteurs couples a la proteine de liaison guanosine triphosphate, genes correspondants, et leur production et utilisation Download PDF

Info

Publication number
WO2001009322A1
WO2001009322A1 PCT/JP2000/005069 JP0005069W WO0109322A1 WO 2001009322 A1 WO2001009322 A1 WO 2001009322A1 JP 0005069 W JP0005069 W JP 0005069W WO 0109322 A1 WO0109322 A1 WO 0109322A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
dna
sequence
present
seq
Prior art date
Application number
PCT/JP2000/005069
Other languages
English (en)
Japanese (ja)
Inventor
Toshio Ota
Takao Isogai
Tetsuo Nishikawa
Koji Hayashi
Kaoru Saito
Jun-Ichi Yamamoto
Shizuko Ishii
Tomoyasu Sugiyama
Ai Wakamatsu
Keiichi Nagai
Tetsuji Otsuki
Toshimitsu Kishimoto
Kazuhiro Yano
Kouji Kanzaki
Yoshihisa Inoue
Original Assignee
Helix Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Helix Research Institute filed Critical Helix Research Institute
Priority to AU61816/00A priority Critical patent/AU6181600A/en
Publication of WO2001009322A1 publication Critical patent/WO2001009322A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to novel guanosine triphosphate binding protein-coupled receptors, their genes, and their production and use.
  • G protein-coupled receptors are a general term for a group of cell membrane receptors that transmit signals into cells through the activation of trimeric GTP-binding proteins. G protein-coupled receptors are also called “seven transmembrane receptors” because of their structural properties, which have seven transmembrane domains in the molecule. G protein-coupled receptors transmit information on various physiologically active substances from the cell membrane to the cell via the activation of the trimeric GTP-binding protein and the resulting change in intracellular second messengers. Intracellular second messengers controlled by the trimeric GTP-binding protein are well known, such as cAMP via adenylate cyclase and Ca 2+ via phosphoivase C.
  • G protein-coupled receptors are very diverse, including proteinaceous hormones, chemokines, peptides, amines, lipid-derived substances, and proteases such as thrombin.
  • ligands for G protein-coupled receptors are very diverse, including proteinaceous hormones, chemokines, peptides, amines, lipid-derived substances, and proteases such as thrombin.
  • the number of G protein-coupled receptors whose genes have been identified is less than 300 in humans excluding sensory organ receptors, but the number of G protein-coupled receptors whose ligands have been identified is about Only 140 types of unknown ligands There are more than 100 types of "quality coupled receptors".
  • G protein-coupled receptor-related diseases are extremely common, including genetic diseases, cranial nervous system, circulatory system, digestive system, immune system, motor system, urogenital system, etc.
  • recently many pharmaceutical companies own the orphan G protein-coupled receptor revealed by genome analysis, and are spending less time searching for ligands and elucidating physiological functions.
  • physiological ligands for novel G protein-coupled receptors For example, calcitonin gene-related peptide receptor (J. Biol. Chem.
  • the orphan G protein-coupled receptor has received a great deal of attention as a potential target for new drug development.
  • it has been difficult to develop its agonist, angonist.
  • it has been proposed to create a drug targeting the Saiichi-Fan G protein-coupled receptor by combining an enhanced compound library with high-throughput screening (Trends Pharmacol. Sci. (97) 18: 430, Br. J. Pharm. (98) 125: 1387).
  • the receptor G protein-coupled receptor identified by genetic manipulation is converted into physiological agonies by functional screening using changes in intracellular second messenger cAMP and Ca 2+ as indices.
  • An object of the present invention is to provide novel G protein-coupled receptors and their genes, as well as their production and use. Furthermore, it aims to provide the molecule as a target for drug development research.
  • the present inventors firstly used oligocap method, which was originally developed to isolate full-length cDNAs, by using multiple oligos from human placental tissue cDNA libraries to obtain multiple full-length cDNAs. Released.
  • C-PLACE1003238 increased when an inhibitor was added to nerve cells that had been induced to differentiate by treatment with retinoic acid, suggesting a relationship with neurological diseases.
  • C-PLACE1003238 showed high expression in tissues such as lung, placenta, and skin in normal tissues. When the expression in tumor tissue was compared with the expression in normal tissue, the expression was increased in colon cancer and Teng's carcinoma. On the other hand, expression was decreased in testicular cancer compared to normal.
  • C-PLACE1003238 was suggested to be associated with cancer and Alzheimer's disease.
  • the present invention relates to a novel G protein-coupled receptor C-PLACE1003238, DNA encoding the receptor, and their production and use.
  • step (b) selecting a compound that reduces the binding activity detected in step (a) as compared to the binding activity in the absence of the test sample;
  • step (c) selecting a compound that suppresses or enhances the change in the cells detected in step (b), as compared to the change in the cells in the absence of the test sample,
  • a pharmaceutical composition comprising the compound according to (11) as an active ingredient,
  • nucleotide having a chain length of at least 15 nucleotides which is complementary to the DNA consisting of the nucleotide sequence of SEQ ID NO: 1 or a complementary strand thereof.
  • G protein-coupled receptor means a cell membrane receptor that transmits a signal into a cell through activation of a GTP-binding protein.
  • ligand means a physiological substance that binds to a G protein-coupled receptor and transmits a signal into cells.
  • physiological substance means in vivo Means a compound that binds to a G protein-coupled receptor.
  • agonist refers to a compound capable of transmitting a signal into a cell by binding to a G protein-coupled receptor, and is a physiological substance, an artificially synthesized compound, or a naturally-derived compound. including.
  • angigonist refers to a compound that inhibits binding of a ligand to a G protein-coupled receptor or transmission of a signal into a cell, and is a physiologically synthesized or artificially synthesized substance.
  • the present invention provides a novel G protein-coupled receptor and a DNA encoding the protein.
  • the human-derived cDNA clone included in the present invention and isolated by the present inventors was named "C-PLACE1003238".
  • the nucleotide sequence of the cDNA is shown in SEQ ID NO: 1
  • the amino acid sequence of the protein encoded by the cDNA is shown in SEQ ID NO: 2.
  • the protein encoded by the cDNA showed significant amino acid sequence homology with a known G protein-coupled receptor. Specifically, it showed 25% homology to “human Platelet Activating Factor (PAF) receptor”.
  • PAF Platelet Activating Factor
  • C-PLACE1003238 cDNA encodes a protein belonging to the G protein-coupled receptor family.
  • G protein-coupled receptors have the activity of transmitting signals into cells through activation of G proteins by the action of their ligands, and as described above, include genetic diseases, cerebral nervous system, circulatory system It has been implicated in numerous areas of disease, including the digestive, immune, motor, and genitourinary systems.
  • the expression characteristics of the C-PLACE1003238 protein suggest a link to cancer and Alzheimer's.
  • the C-PLACE1003238 protein can be used for screening agonists and angiogonists that regulate the function of the C-PLACE1003238 protein, and these molecules are important targets for drug development for the above diseases.
  • the present invention also provides a protein functionally equivalent to the C-PLACE1003238 protein.
  • “functionally equivalent” means that the target protein has a biological property equivalent to that of the C-PLACE1003238 protein.
  • Biological properties of the C-PLACE1003238 protein include an activity of transmitting a signal into a cell through activation of a trimeric GTP-binding protein. Trimeric GTP-binding proteins are classified into three categories, depending on the type of intracellular signaling system activated: Gq, which increases Ca2 + , Gs, which increases cAMP, and Gi, which suppresses cAMP. (Trends Pharmacol. Sci. (9 9) 20: 118). Therefore, whether the protein of interest has the same biological properties as the C-PLACE1003238 protein can be determined, for example, by detecting changes in intracellular cAMP concentration or calcium concentration due to its activation. It is possible to evaluate.
  • One embodiment of a method for preparing a protein functionally equivalent to the C-PLACE1003238 protein includes a method of introducing a mutation into an amino acid sequence in a protein.
  • Such methods include, for example, site-directed mutagenesis (Current Protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. Jhon Wily & Sons Section 8.1-8.5).
  • Amino acid mutations in proteins can also occur in nature.
  • one or more amino acids may be substituted, deleted, or inserted in the amino acid sequence (SEQ ID NO: 2) of the C-PLACE1003238 protein, whether artificial or natural.
  • the number and location of amino acid mutations in these proteins are not limited as long as the function of the C-PLACE1003238 protein is maintained.
  • the number of mutations is typically within 10% of all amino acids, preferably within 5% of all amino acids, more preferably all amino acids.
  • Another embodiment of the method for preparing a protein functionally equivalent to the C-PLACE1003238 protein includes a method utilizing a hybridization technique or a gene amplification technique. That is, if a person skilled in the art is familiar with the hybridization technology (Current Protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. Jh Based on the DNA sequence (-? 1 ⁇ £ 1003238) encoding the protein (SEQ ID NO: 1) or a part thereof, the DM originated from the same or heterologous organism was obtained using on Wily & Sons Section 6.3-6.4).
  • a protein encoded by a DNA that hybridizes to the encoding DNA and that is functionally equivalent to the C-PLACE1003238 protein is also included in the protein of the present invention.
  • organisms for isolating such proteins include, but are not limited to, rats, mice, egrets, chicks, birds, and sea lions, in addition to humans.
  • stringent hybridization conditions for isolating a DNA encoding a protein functionally equivalent to the C-PLACE1003238 protein usually, conditions of about “lxSSC, 0.1% SDS, 37.C” are used.
  • the more severe condition is a condition of “0.5xSSC, 0.13 ⁇ 4SDS, 42 ° C”
  • the more severe condition is a condition of “0.2xSSC, 0.13 ⁇ 4SDS, 65 ° C”.
  • a protein encoded by DNA isolated using such a hybridization technique usually has high homology in amino acid sequence with the C-PLACE1003238 protein.
  • High homology refers to sequence homology of at least 40% or more, preferably 60% or more, and more preferably 80% or more (eg, 90% or more and 95% or more).
  • Homology identification can be determined using the BLAST search algorithm. Also, using a gene amplification technique (PCR) (Current protocols in Molecular Biology edit it. Ausubel et al. (1987) Publish.
  • PCR gene amplification technique
  • the present invention also includes a partial peptide of the protein of the present invention.
  • This partial peptide includes a peptide that binds to a ligand but does not transmit a signal.
  • An affinity column prepared based on such a peptide can be suitably used for screening of a ligand.
  • the partial peptide of the protein of the present invention can also be used for preparing an antibody.
  • the partial peptide of the present invention can be produced, for example, by a genetic technique, a known peptide synthesis method, or by cleaving the protein of the present invention with an appropriate peptidase.
  • the partial peptide of the present invention usually has 8 amino acid residues or more, preferably 12 amino acid residues or more (for example, 15 amino acid residues or more).
  • the protein of the present invention can be prepared as a recombinant protein or as a natural protein.
  • the recombinant protein may be prepared, for example, by introducing a vector into which a DNA encoding the protein of the present invention has been inserted into an appropriate host cell and purifying the protein expressed in the transformant, as described later. Is possible.
  • a natural protein can be prepared, for example, using an affinity column to which an antibody against the protein of the present invention described later is bound (Current Protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. Jhon Wily & Sons Section 16.1- 16.19).
  • the antibody used for affinity purification may be a polyclonal antibody or a monoclonal antibody.
  • the present invention also provides a DNA encoding the protein of the present invention.
  • the form of the DNA of the present invention is not particularly limited as long as it can encode the protein of the present invention, and includes genomic DNA, chemically synthesized DNA, and the like in addition to cDNA. Further, as long as it can encode the protein of the present invention, MA having an arbitrary nucleotide sequence based on the degeneracy of the genetic code is included.
  • the DNA of the present invention can be obtained by a hybridization method using a DNA sequence encoding the C-PLACE1003238 protein (SEQ ID NO: 1) or a part thereof as a probe, or a primer synthesized based on these DNA sequences. It can be isolated by a conventional method such as a PCR method using the above method.
  • the present invention also provides a vector into which the DNA of the present invention has been inserted.
  • the vector of the present invention is not particularly limited as long as it stably retains the inserted DNA.
  • Escherichia coli is used as a host
  • the pBluescript vector (Stratagene) may be used as a cloning vector. And the like are preferred.
  • an expression vector is particularly useful.
  • the expression vector is not particularly limited as long as it is a vector that expresses the protein in a test tube, in E. coli, in a cultured cell, or in an individual organism.
  • a pBEST vector Promega Escherichia coli, pET vector (Invitrogen), cultured cells! ME18S-FL3 vector (GenBank Accession No. AB009864), pCEP 4 vector (Invitrogen), or a living organism
  • the pME18S vector Mol Cell Biol. 8: 466-472 (1988)
  • Insertion of the DNA of the present invention into a polynucleotide can be carried out by a conventional method, for example, by a ligase reaction using a restriction enzyme site (Current protocols in Molecular Biology edit.Ausubel et al. 1987) Publish. John Wiley & Sons. Section 11.4-11.11).
  • the present invention also provides a transformant carrying the DNA of the present invention or the vector of the present invention.
  • the host cell into which the vector of the present invention is introduced is not particularly limited, and various host cells may be used depending on the purpose.
  • the production system for protein production is in vit There are ro and in vivo production systems. Examples of eukaryotic cells for highly expressing a protein include COS cells, CH0 cells, and 293 cells.
  • Transduction of vectors into host cells can be performed, for example, by calcium phosphate precipitation, electropulse perforation (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons. Section 9.1-9.9), ribofect It can be performed by a known method such as the Yumin method (GIBC0-BRL) or the microinjection method.
  • the present invention also provides nucleotides having a chain length of at least 15 nucleotides, which are complementary to DNA encoding the protein of the present invention (MA consisting of the nucleotide sequence of SEQ ID NO: 1 or a complementary strand thereof).
  • the “complementary strand” refers to one strand of the double-stranded nucleic acid consisting of A: T (U in the case of RNA) and G: C base pairs with respect to the other strand.
  • the term "complementary” is not limited to a case where the sequence is completely complementary to at least 15 contiguous nucleotide regions, but is at least 70%, preferably at least 80%, more preferably 90%, and still more preferably 95%.
  • the algorithm for determining homology may use the algorithm described in this specification.
  • Such nucleotides can be used as a probe for detecting and isolating the DNA of the present invention, and as a primer for amplifying the DNA of the present invention. When used as a primer, it usually has a chain length of 15 bp to 100 bp, preferably 15 bp to 35 bp. When used as a probe, a nucleotide having a chain length of at least 15 bp containing at least a part or the entire sequence of the DNA of the present invention is used. Such nucleotides preferably specifically hybridize to DNA encoding the protein of the present invention.
  • the term “specifically hybridizes” means that it hybridizes with a DNA encoding the protein of the present invention (SEQ ID NO: 1) under ordinary hybridization conditions, preferably under stringent conditions, and other conditions. Means that it does not hybridize with DNA encoding the protein.
  • SEQ ID NO: 1 DNA encoding the protein of the present invention
  • These nucleotides can be used for testing and diagnosing abnormalities of the protein of the present invention. For example, a probe using these nucleotides as a probe or primer Abnormal expression of the DNA encoding the protein of the present invention can be examined by hybridization or RT-PCR.
  • DNA encoding the protein of the present invention and its expression control region are amplified by polymerase chain reaction (PCR) using these nucleotides as primers, and DNLP is analyzed by methods such as RFLP analysis, SSCP, and sequencing. Inspection and diagnosis of A sequence abnormalities.
  • PCR polymerase chain reaction
  • these nucleotides include antisense DNA for suppressing the expression of the protein of the present invention.
  • the antisense DNA has a chain length of at least 15 bp or more, preferably 100 bp, more preferably 500 bp or more, and usually has a chain length of 3000 bp or less, preferably 2000 bp or less in order to cause an antisense effect.
  • Such antisense DNA may be applied to gene therapy of diseases caused by abnormalities (functional abnormality or abnormal expression) of the protein of the present invention.
  • the antisense DNA is, for example, based on the sequence information of the DNA encoding the protein of the present invention (for example, SEQ ID NO: 1), based on the phosphorothioate method (Stein, 1988 Physicochemical properties of phosphorothioate oligodeoxynucleotides. Nucleic Acids Res. 16, 3209-21 (1988)).
  • the nucleotides of the present invention can be used, for example, by utilizing viral vectors such as retrovirus vectors, adenovirus vectors, adeno-associated virus vectors, and non-viral vectors such as ribosomes, and the like. It may be possible to administer to patients by the in vivo method or the in vivo method.
  • viral vectors such as retrovirus vectors, adenovirus vectors, adeno-associated virus vectors, and non-viral vectors such as ribosomes, and the like. It may be possible to administer to patients by the in vivo method or the in vivo method.
  • the present invention also provides an antibody that binds to the protein of the present invention.
  • the form of the antibody of the present invention is not particularly limited, and includes a polyclonal antibody, a monoclonal antibody, and a part thereof having antigen-binding properties. It also includes all classes of antibodies. Furthermore, the antibodies of the present invention also include special antibodies such as humanized antibodies.
  • the antibody of the present invention can be obtained by synthesizing an oligonucleotide corresponding to the amino acid sequence of the protein of the present invention according to a conventional method, and immunizing a rabbit ( Current protocols in Molecular Biology edit.Ausub el et al. (1987) Publish. John Wiley & Sons. Section 11.12-11.13).
  • a monoclonal antibody a mouse is immunized with a protein expressed and purified in Escherichia coli according to a conventional method, and a hybridoma cell obtained by fusing the spleen cell and myeloma cell thereof is prepared. It can be obtained from dorma cells (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons. Section 11.4-11.11).
  • Antibodies that bind to the protein of the present invention may be used, for example, for the examination and diagnosis of abnormal expression or structural abnormality of the protein of the present invention, in addition to purification of the protein of the present invention.
  • proteins are extracted from tissues, blood, cells, or the like, and the presence or absence of abnormalities in expression or structure is detected through detection of the proteins of the present invention by Western blotting, immunoprecipitation, or ELISA. Inspection ⁇ Can be diagnosed.
  • an antibody that binds to the protein of the present invention for the purpose of treating a disease associated with the protein of the present invention.
  • the antibody of the present invention can act as an agonist of the protein of the present invention.
  • a human antibody or a humanized antibody is preferred because of its low immunogenicity.
  • Human antibodies include mice in which the immune system has been replaced by humans (for example, functional transplant of megabase human immunoglobulin loci recapitulates human antibody responses in mice, Mendez, MJ et al. (1997) Nat. Genet. 15: 146 -156 ”).
  • a humanized antibody can be prepared by genetic recombination using the hypervariable region of a monoclonal antibody (Methods in Enzymology 203, 99-121 (1991)).
  • the present invention also provides a method for screening for a ligand that binds to the protein of the present invention, using the protein of the present invention.
  • This screening method includes (a) a step of bringing a test sample into contact with a protein of the present invention or a partial peptide thereof, and (b) a step of selecting a compound that binds to the protein or a partial peptide thereof.
  • test sample is not particularly limited.
  • various G protein-coupled receptor Gand activity was prepared by applying known compounds or peptides (for example, those registered in a chemical file) or phage display method (J. Mol. Biol. (1991) 222, 301-310). Random 'peptides can be used.
  • culture supernatants of microorganisms, natural components derived from plants and marine organisms, etc. are also subject to screening.
  • Other biological tissue extracts including brain, cell extracts
  • Examples include, but are not limited to, expression products of a gene library.
  • the protein of the present invention used for screening is, for example, a form expressed on the cell surface.
  • the cells may be in the form of a cell membrane fraction or in the form of being bound to an affinity column.
  • Specific screening techniques include, for example, a method of contacting a test sample with an affinity column for the protein of the present invention to purify a compound that binds to the protein of the present invention, and a number of known methods such as a West Western plotting method. Methods are available. When these methods are used, the test sample is appropriately labeled, and the binding to the protein of the present invention can be detected using the label.
  • a cell membrane expressing the protein of the present invention is prepared and immobilized on a chip, and dissociation of the trimeric GTP-binding protein upon ligand binding is confirmed by surface plasmon resonance (surface plasmon resonance). It is also possible to use a method of detecting with resonance; (Nature Biotechnology (99) 17: 1105).
  • the binding activity between the test sample and the protein of the present invention can be detected by using, as an index, a change in cells caused by binding of the test sample to the protein of the present invention expressed on the cell surface.
  • changes include, but are not limited to, changes in intracellular Ca 2+ levels and changes in cAMP levels.
  • agonist activity for G protein-coupled receptors can be measured by the GTP-S binding method.
  • a cell membrane expressing a G protein-coupled receptor was labeled with 35 S in a solution of 20 mM HEPES (pH 7.4), 100 mM NaCl, 10 mM MgCl 2 , and 50 ⁇ M GDP.
  • 20 mM HEPES pH 7.4
  • 100 mM NaCl 100 mM NaCl
  • 10 mM MgCl 2 mM MgCl 2
  • 50 ⁇ M GDP 50 ⁇ M GDP
  • G protein-coupled receptors share a system that transduces signals into cells via activation of trimeric GTP-binding proteins.
  • Trimeric GTP-binding proteins are classified into three types, Gq-type that increases Ca2 + , Gs-type that increases cAMP, and Gi-type that suppresses cAMP, depending on the type of intracellular signaling system that is activated. . Applying this fact, Gq protein subunit is chimerized with other G protein subunits, and a positive signal at the time of ligand screening is consequently increased to Ca2 + , which is a Gq intracellular transduction pathway. Is possible.
  • Elevated Ca 2+ levels can be detected using as indicators the changes in the repo overnight gene system having TRE (TP A responsive element) upstream, a staining indicator such as Fluor-3, and the fluorescent protein aequorin.
  • TRE TP A responsive element
  • Gs protein subunits are chimerized with other G protein subunits, and a positive signal results in an increase in cAMP, a Gs intracellular transduction pathway, and a reporter having a CRE (cAMP-responsive element) upstream. Changes in the overnight gene system can be used as an index (Trends Pharmacol. Sci. (99) 20: 118).
  • host cells that express the protein of the present invention in this screening system there are no particular restrictions on the host cells that express the protein of the present invention in this screening system, and various host cells may be used depending on the purpose.
  • examples include COS cells, CH0 cells, HEK293 cells, and the like.
  • vectors for expressing the protein of the present invention in vertebrate cells include a promoter located upstream of a gene encoding the protein of the present invention, a splice site, a polyadenylation site, and a transcription termination sequence of RNA.
  • those having a replication origin and the like can be suitably used.
  • pSV2dhfr Mol. Cell. Biol.
  • Insertion of the DNA of the present invention into a vector can be performed by a ligase reaction using a restriction enzyme site according to a conventional method (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons. Section IV.4-- 11.11).
  • the introduction of the vector into a host cell can be performed, for example, by the calcium phosphate precipitation method or the electric pulse perforation method (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons. Section 9.1) -9.9), Lvov method (GIBC0-BRL), FuGENE6 reagent (Boehringer-Mannheim), microinjection, and other known methods.
  • the present invention also provides a method for screening a compound having an activity of inhibiting the binding of the protein of the present invention to its ligand.
  • This screening method comprises the steps of: (a) contacting a ligand of the protein or its partial peptide in the presence of a test sample with a ligand, and detecting the binding activity between the protein or its partial peptide and the ligand; b) selecting a compound that reduces the binding activity detected in step (a) as compared to the binding activity in the absence of the test sample.
  • test sample is not particularly limited.
  • a compound group obtained by combinatorial 'chemistry—technology (Tetrahedron (1995) 51, 8135-8137), or a phage' display method (J. Mol. Biol. (1991) 222, 30-310) can be used.
  • culture supernatants of microorganisms and natural components derived from plants and marine organisms are also targets for screening.
  • Other examples include, but are not limited to, brain and other biological tissue extracts, cell extracts, expression products of gene libraries, synthetic low molecular weight compounds, synthetic peptides, natural compounds, and the like.
  • the protein of the present invention used for screening is, for example, a form expressed on the cell surface.
  • Morphology of the cells as a cell membrane fraction or bound to an affinity column It may be in a form.
  • a specific screening method for example, a method in which a ligand is labeled with a radioisotope or the like, and the ligand is contacted with the protein of the present invention in the presence of a test sample, and then compared with the case where detection is performed in the absence of a test sample Then, a method of detecting a compound that reduces the binding activity between the protein and the ligand of the present invention based on the label attached to the ligand can be used.
  • the screening can be performed using the intracellular change as an index.
  • a compound expressing the protein of the present invention is brought into contact with a ligand in the presence of a test sample, and a compound that reduces the change in the cell is selected as compared to the case where the ligand is detected in the absence of the test sample.
  • a compound that inhibits the binding between the protein of the present invention and a ligand Cells expressing the protein of the present invention can be prepared in the same manner as in the above-described screening for a ligand that binds to the protein of the present invention.
  • the compound isolated by this screening is a candidate for the agonist of the protein of the present invention.
  • the present invention also provides a method for screening a compound that inhibits or promotes the activity of the protein of the present invention.
  • This screening method comprises the steps of (a) contacting a cell expressing the protein of the present invention with a ligand of the protein in the presence of a test sample, and (b) a change in cells caused by binding of the ligand to the protein of the present invention. And (c) selecting a compound that suppresses or enhances the change in the cells detected in step (b) as compared to the change in the cells in the absence of the test sample.
  • the compound group obtained by the combinatorial chemistry technique, the phage display method, etc. may be used in the same manner as the above-mentioned compound screening method of the present invention for inhibiting the binding of the protein to the ligand.
  • Random peptides produced by application, culture supernatants of microorganisms, natural components derived from plants and marine organisms, biological tissue extracts, cell extracts, gene library expression products, synthetic low molecular weight compounds , Go Synthetic peptides, natural compounds and the like can be used.
  • a compound isolated by screening a compound that inhibits the binding between the protein of the present invention and a ligand can be used as a test sample.
  • Cells expressing the protein of the present invention can be prepared in the same manner as in the above-described screening for a ligand that binds to the protein of the present invention. Changes in the cells after contact with the test sample can be detected using changes in intracellular Ca 2+ levels and cAMP levels as indices, as in the above-described screening method. In addition, when detecting intracellular signal transduction, it is also possible to detect using a measurement system such as a repo overnight system using luciferase or the like as a reporter gene.
  • a measurement system such as a repo overnight system using luciferase or the like as a reporter gene.
  • the sample is determined to be a compound that inhibits the activity of the protein of the present invention.
  • the test sample enhances the change in the cells, the compound is determined to be a compound that promotes the activity of the protein of the present invention.
  • “promoting or inhibiting the activity of the protein of the present invention” as used herein refers to whether the action of the protein of the present invention is a direct action or an indirect action on the protein of the present invention. It means that the activity of the protein of the invention is promoted or inhibited.
  • compounds isolated by this screening include compounds that act on the protein or ligand of the present invention to inhibit or promote their binding to thereby inhibit or promote the activity of the protein of the present invention, Also included are compounds that do not inhibit or promote binding itself, but which, as a result, inhibit or promote the activity of the proteins of the invention. Such compounds include, for example, compounds that do not inhibit the binding of the protein of the present invention to the ligand, but inhibit or promote a signal transduction pathway in cells.
  • a compound isolated by the screening method of the present invention is used as a pharmaceutical
  • the isolated compound itself is administered directly to a patient or administered as a pharmaceutical composition formulated by a known pharmaceutical method. It is also possible to do.
  • medicine P for example, medicine P
  • a physiologically acceptable carrier or vehicle specifically, sterile water, physiological saline, vegetable oil, emulsifier, suspending agent and the like.
  • Administration to a patient can be generally performed by a method known to those skilled in the art, such as oral administration, nasal administration, intraarterial injection, intravenous injection, and subcutaneous injection.
  • the dose varies depending on the weight and age of the patient, the administration method, and the like, but those skilled in the art can appropriately select an appropriate dose.
  • the compound can be encoded by MA, the DNA may be incorporated into a gene therapy vector to perform gene therapy.
  • FIG. 1 is a view showing alignment between C-PLACE1003238 and a previously reported G protein-coupled receptor.
  • TMn in the figure indicates the n-th transmembrane site.
  • FIG. 2 is a continuation of FIG.
  • FIG. 3 is a continuation of FIG. BEST MODE FOR CARRYING OUT THE INVENTION
  • MRNA was extracted from human placental tissues by the method described in Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1989). Further, oligo (d) was prepared according to the method described in Molecular Cloning, A Laboratory Manual, Second Edition, Co Id Spring Harbor Laboratory Press (1989). P
  • the vector was cut with Dral II and the vector PME18SFL3 (GenBank AB009864) was cloned by determining the direction of the cDNA to prepare a cDNA library.
  • the cloned site of PME18SFL3 is an asymmetric Drall site, and a complementary Sfil site is added to the end of the cDNA fragment. It is inserted unidirectionally downstream of the promotion.
  • a part of the cDNA library prepared in Example 1 was introduced into Escherichia coli DH10B by electroporation using Gene Pulser (Biorad). Transformants were selected by culturing on LB agar medium containing 50 g / mL of ampicillin. These transformants were cultured overnight in an LB medium containing 50 g / mL of ampicillin, and the plasmid was extracted using a plasmid automatic extractor PI100 (manufactured by Kurabo Industries, Ltd.).
  • the plasmid DNA of clones obtained from these transformants was subjected to DNA sequencing.
  • a sequencing reagent BigDye Terminator Cycle Sequencing FS Ready Reaction Kit, manufactured by PE Biosystems
  • perform the sequencing reaction according to the manual and then use a DNA sequencer (ABI PRISM 377, manufactured by PE Biosystems) to determine the 5 and 5 Or 3, the base sequence from the end was analyzed.
  • ME761FW represented by SEQ ID NO: 7
  • ME1250RV represented by SEQ ID NO: 8
  • the 5′-end sequence and the 3′-end sequence of the cDNA clone determined in (2) were separately classi? Ed. That is, the single-pass sequence data from the 5 'end and 3' end determined for the cDNA clones were subjected to BLAST analysis between each sequence, and clones considered to be derived from the same gene were grouped.
  • the consensus sequence with a homology of 95% or more is 300 base pairs or more at the 5 'end sequence
  • the consensus sequence with a homology of 90% or more is 200 base pairs or more at the 3' end sequence
  • the 'terminal sequence group' was further subjected to grouping (clustering) so that the 5 'terminal sequence and 3' terminal sequence of the same clone belonged to the same group (cluster).
  • 5 ′ terminal sequence data of the clone sequence was characterized based on the following method.
  • ATGpr [A. Salamov, T. Nishika a, ⁇ . ⁇ . Swindells. Asse ssing protein coding region integrity in cDNA sequencing projects.Bioin formatics 14: 384-390 (1998)]
  • the ATGprl value is a value that predicts the possibility of the full length from the calculated value. The higher the ATGprl value, the higher the possibility of the full length.
  • the maximum ATGprl value and maximum ATGpr2 value indicate the maximum ATGprl value and ATGpr2 value predicted from all start codons contained in the 5 'end sequence of the clone sequence, and these values were used for characterization. .
  • 5 'terminal sequence For each 3' terminal sequence, determined from homology search using GenBank Was. For the human EST sequence, the sequence was determined to be identical when the length of the comparison sequence portion with the 5 'terminal sequence was 90% or more over 200 bases or more. The number of EST sequences was used directly for characterization and used as an index of novelty. Clones having 5′-terminal sequences and 3′-terminal sequences that are not identical to not only mRNA sequences but also EST sequences are genes encoding novel sequences. Similarly, clones with a small number of 5'-terminal sequences or 3'-terminal sequences with a small number of identical EST sequences were also determined to be cDNA clones encoding the novel sequences.
  • All 5 'terminal sequences included in class 1 If at least one of the 3' terminal sequences is identical to the mRNA sequence, that class is identical to the class 1 that is identical to the mRNA sequence. did.
  • the class 1 is non-full length with respect to the mMA sequence or human EST sequence.
  • the ATGpr program [A. Salamov, T. Nishikawa, MB Swindells. Assessing protein coding region integrity in cDNA sequencing projects. Bioinformatics 14: 384-390 (1998)] Regarding the ATGprl value derived from the start codon, the maximum value of the ATGprl value for all the 5 'terminal sequences contained in the class evening was defined as the ATGprl value in the class evening.
  • ATGpr2 values were similar (4) The number of human EST sequences determined to be identical by homology search using BlastN in GenBank.
  • the maximum value of the number of EST sequences was calculated for each of the 5 5 terminal sequences and 3 'terminal sequences included in the class, and the number of identical EST sequences of the 5' terminal sequence and the number of identical EST sequences of the 3 'terminal sequence in the cluster were calculated. did.
  • clusters identical to the mRNA sequences of humans and other organisms (including the licensed sequences) and non-full-length clusters were excluded. From those clusters, those that met one of the following conditions were selected.
  • At least one clone contains a clone with high novelty and full length.
  • the full-length rate is low, but the full-length class still contains new clones.
  • the nucleotide sequence of the full-length cDNA was determined for the cDNA clones selected from (1) to (10) and derived from human placental tissue, which were determined to be highly likely to be novel.
  • Primer walking is performed mainly by primer walking according to the Diodexoxy-Mine-All-In-One method using a custom synthesized DNA primer (sequencing is performed according to the manual using a DNA sequencing reagent manufactured by PE Biosystems using a custom synthesized DNA primer). After the reaction, the DNA base sequence was analyzed using the company's sequencer). The full-length nucleotide sequence was finally determined by completely overlapping the partial nucleotide sequence determined by the above method. Next, a deduced amino acid sequence was determined from the determined nucleotide sequence of the full-length cDNA.
  • nucleotide sequence of cDNA clone C-PLACE1003238 as an example of a cDNA clone derived from human placental tissue, which was selected as described in (1) to (10) and determined to be highly likely to be full-length, Is shown in SEQ ID NO: 1.
  • C deduced from the base sequence The amino acid sequence of the gene product encoded by DNA clone C-PLACE1003238 is shown in SEQ ID NO: 2.
  • ATGpr is a program developed by AA Salamov, T. Nishikaa, and MB Swindells of the Helix Institute to predict whether a translation initiation codon exists based on the characteristics of the sequence around the ATG codon [AA Salamov , T. Nishikawa, MB Swindells, Bioinformatics, 14: 384-390 (1998); http: //www.hri.co.jp/atgpr/]. The results were expressed as the expected value of the ATG being the true start codon (hereinafter sometimes referred to as ATGprl) (0.05-0.94).
  • DNA for nylon membrane spots was prepared as follows. That is, E. coli is cultured in each well of a 96-well plate (37 ° C, 16 hours in LB medium), a part of the culture is suspended in sterilized water dispensed into 96-well plates, and the suspension is incubated at 100 ° C. After treatment with C for 10 minutes, it was used as a sample for the PCR reaction. PCR was performed using a TaKaRa PCR Amplification Kit (manufactured by Takarasha) with a reaction solution of 20 ⁇ L per reaction according to the protocol.
  • the primer was paired with the sequencing primer ME761FW (5 'tacggaagtgttacttctgc3' / SEQ ID NO: 7) and ME1250 RV (5, tgtgggaggttttttctcta3, / SEQ ID NO: 8).
  • ME761FW 5 'tacggaagtgttacttctgc3' / SEQ ID NO: 7
  • ME1250 RV 5, tgtgggaggtttttttctcta3, / SEQ ID NO: 8).
  • M13M4 5 ′ gttt tcccagtcacgac3 ′ / SEQ ID NO: 9
  • M13RV 5 ′ caggaaacagctatgac3 ′ / SEQ ID NO: 10.
  • the PCR reaction was performed at 95 ° C for 5 minutes with GeneAmp System9600 (manufactured by PE Biosystems), followed by 10 cycles at 95 ° C for 10 seconds and 68 ° C for 1 minute. Twenty cycles were performed at 98 ° C for 20 seconds, 60 ° C for 3 minutes, and performed at 72 ° C for 10 minutes. After the PCR reaction, 2 jl of the reaction solution was subjected to 1% agarose gel electrophoresis, and the DNA was stained with a bromide reagent to confirm the amplified cDNA.
  • a plasmid containing the cDNA insert was prepared by the alkali extraction method (J Sambrook, EF Fritsh, T Maniatis, oleolecular Cloning, A laboratory manual / 2nd edition, Cold Spring Harbor Laboratory Press, 1989). did.
  • DNA was dispensed into each well of a 384-well plate.
  • DNA spotting on the nylon membrane was performed using a 384-bin tool of Biomek 2000 Laboratory Automation System (manufactured by Beckman Cole Yuichi). That is, a 384-well plate containing DNA was set. 384 independent pins of a pin tool were simultaneously immersed in the DNA solution, and the DNA was sprinkled on the needles. By gently pressing the needle against the nylon membrane, the DNA attached to the needle was spotted on the nylon membrane.
  • a 1st strand cDNA labeled with a radioisotope was used as a hybridization probe.
  • the synthesis of 1st strand cDNA was performed using Thermoscript (TM ) RT-PCR System (GIBC0). That is, the 1. 5 jug of each tissue derived m RNA of human Bok (Clontech Co.), using a 1 L 50 ⁇ Ol igo (dT ) 20, supplied with the addition of 50 ⁇ Ci [ct 33 P] dATP 1st strand cDNA was synthesized according to the protocol described in The probe was purified using a ProbeQuant ( TM ) G-50 micro column (manufactured by Amersham Pharmacia Biotech) according to the attached protocol.
  • TM Thermoscript
  • Washing is performed by washing the nylon membrane three times in a washing solution 1 (2X SSC, 1% SDS) at room temperature (about 26 ° C) for 20 minutes, and then in a washing solution 2 (0.1X SSC, 1% SDS). At 65. C was washed three times for 20 minutes.
  • the autoradiogram was obtained using an image plate of BAS2000 (manufactured by Fuji Photo Film Co., Ltd.). That is, the hybridized nylon film was wrapped in Saran wrap, brought into close contact with the photosensitive surface of the image plate, placed in a radioisotope-sensitive cassette, and allowed to stand in a dark place for 4 hours. The radioisotope activity recorded on the image plate was analyzed using BAS2000, and converted and recorded as an autoradiogram image file electronically.
  • the detection sensitivity of gene expression analysis was determined by preparing a probe complementary to the DNA spotted on the membrane and examining the increase in probe signal intensity in the hybridization depending on the probe concentration.
  • PLACE1008092 (identical to GenBank Accession No. AF107253) was used as DNA.
  • a DNA array of PLACE1008092 was prepared by the method described above.
  • mRNA of PLACE1008092 was synthesized in vitro, and this RNA was used as type III to synthesize and use a 1st strand cDNA labeled with a radioisotope in the same manner as in the probe preparation method described above.
  • PLACE100 8092 mRNA in vitro use the pBluescript SK (-) A recombinant plasmid was constructed such that the 5 'end of PLACE1008092 was joined to the side. That is, PLACE1008092 integrated into the restriction site of Dralll of PME18SFL3 was cut with the restriction enzyme Xhol to cut out PLACE1008092.
  • pBluescript SK (-) cut with Xhol and PLACE 1008092 cut out were ligated using DNA ligation kit ver.2 (Takarasha).
  • Genes related to the differentiation of nerve cells are useful genes for treating neurological diseases. Genes whose expression is changed by inducing differentiation of cells of the nervous system are considered to be related to neurological diseases.
  • RA retinoic acid
  • Undifferentiated NT2 cells are OPT I-MEM I (GIBC0 BRL, Catalog No. 31985), 103 ⁇ 4 (v / v) fetal bovine serum (GIBC0 BRL), l% (v / v) penicillin-streptomycin (NTB cells) subcultured in a medium (GIBCO BRL).
  • NT2 cells cultured in the presence of retinoic acid refer to undifferentiated NT2 cells as D-MEM (GIBC0 BRL, Catalog No.
  • NT2 cells cultured in the presence of HA and further cultured with an inhibitor are retinoic acid-added NT2 cells that have passed 05 weeks, a medium containing a cell division inhibitor D-MEM (GIBC0 BRL Catalog 3 ⁇ 4 ⁇ .11965), 103 ⁇ 4 (v / v) fetal bovine serun l3 ⁇ 4 (v / v) penicilli n-streptomyciiu 10 M Retinoic acids 10 ⁇ M FudR (5-Fluoro-2, -deoxyuridin e: GIBCO BRL ), 10 / M Urd (Uridine: GIBCO BRL), 1 ⁇ MaraC (Cytosine 5-D-Arabinofuranoside: GIBCO BRL) Two weeks after transfer to cells.
  • D-MEM cell division inhibitor
  • D-MEM cell division inhibitor
  • each cDNA was measured in undifferentiated NT2 cells, NT2 cells cultured in the presence of RA, or NT2 cells cultured in the presence of RA and further cultured with an inhibitor.
  • Ultraviolet rays are known to have considerable effects on health.
  • the ozon layer The increased exposure to UV damage associated with destruction has been recognized as a risk factor for skin cancer (United States Environmental Protection Age ncy: Ozone Depletion Home Page, http://www.epa.gov / ozone /) 0 Genes whose expression changes when ultraviolet light acts on skin epidermal cells are considered to be related to skin ultraviolet damage.
  • the mean (MM 2 ) and the sample variance ( Sl 2 , s 2 2 ) of the signal values for each gene in each cell were determined, and the composite sample variance s 2 was determined from the sample variances of the two cells to be compared.
  • t (,-M 2 ) / s / (l / 3 + l / 3) 1/2 was determined.
  • the difference in gene expression between both cells is P-0.05 or P-0.01, respectively. It was determined that there was.
  • the expression of PLACE10 03238 was reduced by ultraviolet irradiation after 4 hours or 24 hours.
  • the amino acid sequence whose amino-terminal signal sequence and transmembrane region were predicted was predicted to be secreted and membrane proteins.
  • the amino acid sequence hit in a certain functional domain is based on the hit data, for example, PROSITE (http: ⁇ www.expasy.ch / cgi-bin / prosite-list.pl).
  • the function of the protein can be predicted by referring to one of the functional categories in ()). It is also possible to search for functional domains in PR0SITE.
  • PLACE1003238 a transmembrane region was detected in the deduced amino acid sequence by SOSUI.
  • Pfajii detected seven transmembrane receptor attitudes in the deduced amino acid sequence of PLACE1003238.
  • PLACE1003238 is encoded in the clone based on the results of a homology search performed on the GenBank, Swiss-Prot, and UniGene databases, and the results of a domain search for the amino acid sequence deduced from the full-length nucleotide sequence. Protein function prediction and category classification were performed. PLACE1003238 was classified as a secretory 'membrane protein and a glycoprotein-related protein.
  • Reagent kit for plasmid extraction QIAprep® Spin Miniprep Kit (QIAGEN)
  • Reagent kit for nucleotide sequence analysis ABI PRISM® BigDye Terminator Cycle Sequence Kit (PE Biosysterns)
  • Oligonucleotide primer for nucleotide sequence analysis CP-38 from CP38-1 to CP38-6
  • T7 and M13 Reverse are oligonucleotide primers for analyzing common nucleotide sequences on a vector.
  • the salt sequence of each primer is shown below.
  • CP38-2 CTCTGCAGATACACTTCAGT / SEQ ID NO: 1 2
  • CP38-3 CATMGTCAGTCAAGCCGAA / SEQ ID NO: 13
  • T7 TAATACGACTCACTATAGGG / SEQ ID NO: 17
  • the tube was immersed in a water bath and heated at 42 ° C for 45 seconds. 4) The tube was placed on ice for about 2 minutes.
  • N3 buffer (attached to the kit) was added for neutralization.
  • PCR Polymerase-Chain Reaction
  • the 96-well ram uses a 96-well fill plate (multi-screen-HV plate: Millipore) with a fixed amount of column particles (Sephadex G-50 Medium: Amersham / Pharmacia / Neotech) and a column loader (multi-screen 45 ⁇ L).
  • a column loader was collected by fractionation using a millipore), packed with purified water (300 / L), swollen for about 2 hours, and then centrifuged at 2,000 rpm for 5 minutes.
  • This sequence has 1077 bases of 0RF (from 362 to 1435 of SEQ ID NO: 1).
  • the amino acid sequence deduced from 0RF (358 amino acids, SEQ ID NO: 2) had a hydrophobic region thought to be seven transmembrane domains characteristic of a G protein-coupled receptor. See FIGS. 1-3. This suggested that this gene encodes a G protein-coupled receptor.
  • C-PLACE1003238 a novel G protein-coupled receptor gene of the present invention, in normal human tissues was examined.
  • PCR primer for C-PLACE1003238 expression analysis A sense primer and an antisense primer were designed and manufactured using gene analysis software Vector NTI ver.5.2 (Informax). The nucleotide sequences of the primers are shown below. This primer produces a 113 base pair PCR product.
  • reaction solution having the following composition was prepared in a 15 mL Falcon tube, and kept in ice.
  • the plate was covered with a plastic cover sheet and left on ice for 15 minutes.
  • Electrophoresed at a constant voltage of 100 V for 40 minutes was Electrophoresed at a constant voltage of 100 V for 40 minutes.
  • the electrophoresis buffer used was a tris-borate buffer.
  • PCR Polymerase chain reaction
  • CDNA from patient tissues For cDNAs from prostate, colon, stomach, ligament, testis, and brain tumor, cDNAs from the corresponding tissues from normal humans and cancer patients were purchased from BioChains Institute and used. Regarding cDNA derived from Alzheimer's disease patients, cDNAs derived from the frontal lobe and hippocampus of Alzheimer's disease patients and normal adults were purchased from BioChain Institute and used.
  • the DNA polymerase used was TaKaRa LA Taq TM (Takara Shuzo).
  • reaction mixture of the following composition was prepared in a 1.5 mL eppendorf tube and kept on ice.
  • Electrophoresis was performed at a constant voltage of 100 V for 40 minutes.
  • the C-PLACE1003238 of the present invention may be applicable to the diagnosis of cancer (colon cancer, Tengler cancer, testis cancer), the diagnosis of Alzheimer's disease, and the screening of preventive and therapeutic drugs. .
  • a vector carrying the cDNA of the present invention was constructed. From the base several nucleotides upstream of the translation initiation codon ATG of C-PLACE1003238 to the downstream containing the stop codon was amplified by PCR and subcloned into the expression vector pCEP4. Industrial applicability
  • a novel G protein-coupled receptor C-PLACE1003238
  • a gene encoding the protein a vector containing the gene, a host cell containing the vector
  • a method for producing the protein Furthermore, a method for screening a compound that modifies the activity of the protein was provided. That is, the gene or a protein that is a translation product thereof can be used for screening for ligands or for screening agonists or angelic gonists useful as pharmaceuticals.
  • the protein of the present invention, its gene, or a compound that modulates the activity of the protein is expected to be used for the development of a new preventive or therapeutic agent for a disease associated with the G protein-coupled receptor protein of the present invention.

Abstract

L'invention porte sur un grand nombre d'ADNc pleine longueur qui sont isolés d'une bibliothèque d'ADNc de tissu placentaire humain selon un procédé oligocap qui a été mis au point à l'origine pour isoler des ADNc pleine longueur. Parmi ces ADNc a été isolé un clone (C-PLACE1003238) codant un récepteur couplé à la protéine G et possédant une région hydrophobe en apparence constituée de 7 domaines transmembranaires. La comparaison de l'expression de C-PLACE1003238 dans des tissus tumoraux avec l'expression de celui-ci dans des tissu normaux indique que son expression est améliorée dans le cancer du côlon et le cancer du pancréas, mais est réduite dans le cancer des testicules. La comparaison de la dose d'expression du gène C-PLACE1003238 du cerveau d'un patient atteint de la maladie d'Alzheimer avec l'expression de celui-ci chez un adulte normal indique que son expression est réduite dans le lobe frontal du patient atteint de la maladie d'Alzheimer, mais est élevée dans l'hyppocampus. Tous ces faits donnent à penser que C-PLACE1003238 pourrait avoir une relation avec le cancer et avec la maladie d'Alzheimer.
PCT/JP2000/005069 1999-07-29 2000-07-28 Recepteurs couples a la proteine de liaison guanosine triphosphate, genes correspondants, et leur production et utilisation WO2001009322A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU61816/00A AU6181600A (en) 1999-07-29 2000-07-28 Guanosine triphosphate-binding protein coupled receptors, genes thereof and production and use of the same

Applications Claiming Priority (12)

Application Number Priority Date Filing Date Title
JP24803699 1999-07-29
JP11/248036 1999-07-29
JP11/300253 1999-08-27
JP30025399 1999-08-27
US15959099P 1999-10-18 1999-10-18
US60/159,590 1999-10-18
JP2000/118776 2000-01-11
JP2000118776 2000-01-11
US18332200P 2000-02-17 2000-02-17
US60/183,322 2000-02-17
JP2000/183767 2000-05-02
JP2000183767 2000-05-02

Publications (1)

Publication Number Publication Date
WO2001009322A1 true WO2001009322A1 (fr) 2001-02-08

Family

ID=27554186

Family Applications (4)

Application Number Title Priority Date Filing Date
PCT/JP2000/005062 WO2001009349A1 (fr) 1999-07-29 2000-07-28 Nouveaux genes codant pour une proteine de type serine protease
PCT/JP2000/005069 WO2001009322A1 (fr) 1999-07-29 2000-07-28 Recepteurs couples a la proteine de liaison guanosine triphosphate, genes correspondants, et leur production et utilisation
PCT/JP2000/005068 WO2001009321A1 (fr) 1999-07-29 2000-07-28 Gene codant pour une nouvelle proteine de type tsp1
PCT/JP2000/005070 WO2001009323A1 (fr) 1999-07-29 2000-07-28 Recepteurs couples a des proteines de liaison guanosine triphosphate, genes correspondants et production et utilisation de ceux-ci

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/JP2000/005062 WO2001009349A1 (fr) 1999-07-29 2000-07-28 Nouveaux genes codant pour une proteine de type serine protease

Family Applications After (2)

Application Number Title Priority Date Filing Date
PCT/JP2000/005068 WO2001009321A1 (fr) 1999-07-29 2000-07-28 Gene codant pour une nouvelle proteine de type tsp1
PCT/JP2000/005070 WO2001009323A1 (fr) 1999-07-29 2000-07-28 Recepteurs couples a des proteines de liaison guanosine triphosphate, genes correspondants et production et utilisation de ceux-ci

Country Status (2)

Country Link
AU (4) AU6181500A (fr)
WO (4) WO2001009349A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120003149A1 (en) * 2009-02-20 2012-01-05 Takao Hamakubo Novel monoclonal antibody, and use thereof
US9920123B2 (en) 2008-12-09 2018-03-20 Genentech, Inc. Anti-PD-L1 antibodies, compositions and articles of manufacture

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002010388A2 (fr) * 2000-08-01 2002-02-07 Amgen Inc. Molecules du type recepteur de complement c3b/c4b et utilisations de ces molecules

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998050549A2 (fr) * 1997-05-07 1998-11-12 Human Genome Sciences, Inc. Deux recepteurs couples par des proteines g: gpcr2 induit par veb (ebi-2) et gpcr de type gde-1
EP0913471A2 (fr) * 1997-10-23 1999-05-06 Smithkline Beecham Corporation Clone HNEAA81 de CADN codant pour un récepteur 7-transmembranaire humain
WO1999029849A1 (fr) * 1997-12-11 1999-06-17 Incyte Pharmaceuticals, Inc. Recepteurs couples a la proteine g associes a une reaction immunitaire
WO1999063087A1 (fr) * 1998-06-02 1999-12-09 Millennium Pharmaceuticals, Inc. Recepteur couple a la proteine g designe recepteur 2871
WO2000008133A1 (fr) * 1998-08-06 2000-02-17 Merck & Co., Inc. NOUVELLE SEQUENCE D'ADNc D'UN NOUVEAU RECEPTEUR COUPLE A LA PROTEINE G

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5858716A (en) * 1997-05-30 1999-01-12 Smithkline Beecham Corporation H2CAA71 polynucleotides
EP0890646A3 (fr) * 1997-06-10 2001-07-18 Smithkline Beecham Plc HE2NW40 Sérine protéase
JP2001517441A (ja) * 1997-09-24 2001-10-09 メルク エンド カムパニー インコーポレーテッド Ｇタンパク質共役糖タンパク質ホルモン受容体ｈｇ３８
EP1017709A4 (fr) * 1997-09-24 2001-12-12 Merck & Co Inc Recepteur hormonal glycoproteique aomf05 couple par proteines g
EP0950711A3 (fr) * 1998-02-06 2003-09-17 Akzo Nobel N.V. Récepteurs de Gonadotropine
JP2002507406A (ja) * 1998-03-26 2002-03-12 ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティ 細胞外ロイシンリッチ反復領域を有する新規な哺乳動物ｇ−タンパク質共役型レセプター
IL139686A0 (en) * 1998-06-02 2002-02-10 Genentech Inc Secreted and transmembrane polypeptides and nucleic acids encoding the same

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998050549A2 (fr) * 1997-05-07 1998-11-12 Human Genome Sciences, Inc. Deux recepteurs couples par des proteines g: gpcr2 induit par veb (ebi-2) et gpcr de type gde-1
EP0913471A2 (fr) * 1997-10-23 1999-05-06 Smithkline Beecham Corporation Clone HNEAA81 de CADN codant pour un récepteur 7-transmembranaire humain
WO1999029849A1 (fr) * 1997-12-11 1999-06-17 Incyte Pharmaceuticals, Inc. Recepteurs couples a la proteine g associes a une reaction immunitaire
WO1999063087A1 (fr) * 1998-06-02 1999-12-09 Millennium Pharmaceuticals, Inc. Recepteur couple a la proteine g designe recepteur 2871
WO2000008133A1 (fr) * 1998-08-06 2000-02-17 Merck & Co., Inc. NOUVELLE SEQUENCE D'ADNc D'UN NOUVEAU RECEPTEUR COUPLE A LA PROTEINE G

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SATO S. ET AL.: "Prediction of the coding sequence of unidentified human genes. 1. The coding sequences of 40 new genes (KIAA0001-KIAA0040) deduced by analysis of randomly sampled cDNA clones from human immature myeloid cell line KG-1", DNA RESEARCH, vol. 1, 1994, pages 27 - 35, XP002933329 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9920123B2 (en) 2008-12-09 2018-03-20 Genentech, Inc. Anti-PD-L1 antibodies, compositions and articles of manufacture
US20120003149A1 (en) * 2009-02-20 2012-01-05 Takao Hamakubo Novel monoclonal antibody, and use thereof
US9155805B2 (en) * 2009-02-20 2015-10-13 Perseus Proteomics Inc. Monoclonal antibody, and use thereof

Also Published As

Publication number Publication date
AU6315800A (en) 2001-02-19
WO2001009321A1 (fr) 2001-02-08
WO2001009349A1 (fr) 2001-02-08
WO2001009323A1 (fr) 2001-02-08
AU6181500A (en) 2001-02-19
AU6181600A (en) 2001-02-19
AU6181100A (en) 2001-02-19

Similar Documents

Publication Publication Date Title
US6537775B1 (en) Gene involved in cadasil, method of diagnosis and therapeutic application
EP1067182A2 (fr) Proteine secretoire ou proteine de membrane
JP2004526444A (ja) Ｓｔｅａｐ関連タンパク質
JPWO2002103005A1 (ja) グアノシン三リン酸結合タンパク質共役型の受容体
WO2001048189A1 (fr) Nouveaux recepteurs couples a une proteine de liaison au guanosine triphosphate, genes de ces derniers, et production et utilisation de ces derniers
US20030181706A1 (en) Inflammation-associated polynucleotides
JP2001515349A (ja) Ｔｍ４ｓｆヒト腫瘍関連抗原
JP4344519B2 (ja) ＮＦ−κＢ活性化遺伝子
US20030186333A1 (en) Down syndrome critical region 1-like protein
EP1292676B1 (fr) Mutation associée a l'épilepsie
WO2001009322A1 (fr) Recepteurs couples a la proteine de liaison guanosine triphosphate, genes correspondants, et leur production et utilisation
EP1284289A1 (fr) Methode d'etude de maladies allergiques
WO2001004299A1 (fr) Facteur regulant l'agglutination de la proteine beta-amyloide
JP2004516813A (ja) 関連腫瘍マーカー
WO2001009320A1 (fr) Gene codant pour une nouvelle proteine de type facteur de ribosylation adp (arf)
US20030068311A1 (en) Transmembrane protein differentially expressed in cancer
US20030073162A1 (en) Signal peptide-containing proteins
US7148011B2 (en) Method of testing for allergic diseases
WO2005047546A2 (fr) Methodes diagnostiques et pronostiques et compositions pour troubles relatifs a la capture et a la plasticite
US20030104418A1 (en) Diagnostic markers for breast cancer
US20030190624A1 (en) Genes expressed with high specificity in kidney
JP2002171977A (ja) 新規なヒトｓｈ２蛋白質
US20030175787A1 (en) Vesicle membrane proteins
JP2005500049A (ja) 有機化合物
US20030087253A1 (en) Polynucleotide markers for ovarian cancer

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP