WO2001009322A1 - Guanosine triphosphate-binding protein coupled receptors, genes thereof and production and use of the same - Google Patents

Abstract

A plural number of full-length cDNAs are isolated from a human placental tissue cDNA library by an oligocap method which has been originally developed for isolating full-length cDNAs. Among these cDNAs, a clone (C-PLACE1003238) encoding a G protein-coupled receptor, which has a hydrophobic region seemingly consisting of 7 transmembrane domains, is isolated. Comparison of the expression of C-PLACE1003238 in tumor tissues with the expression thereof in normal tissues indicates that its expression is enhanced in colonic cancer and pancreatic cancer but reduced in testicular cancer. Comparison of the expression dose of C-PLACE1003238 gene in the brain of a patient with Alzheimer's disease with the expression dose thereof in a normal adult indicates that its expression is lowered in the frontal lobe of the patient with Alzheimer's disease but elevated in the hippocampus. These facts suggest that C-PLACE1003238 might relate to cancer and Alzheimer's disease.

Description

 Description Phosphate binding protein-coupled receptors and their genes,

 And their manufacture and use

Technical field

 The present invention relates to novel guanosine triphosphate binding protein-coupled receptors, their genes, and their production and use. Background art

G protein-coupled receptors (GPCRs) are a general term for a group of cell membrane receptors that transmit signals into cells through the activation of trimeric GTP-binding proteins. G protein-coupled receptors are also called “seven transmembrane receptors” because of their structural properties, which have seven transmembrane domains in the molecule. G protein-coupled receptors transmit information on various physiologically active substances from the cell membrane to the cell via the activation of the trimeric GTP-binding protein and the resulting change in intracellular second messengers. Intracellular second messengers controlled by the trimeric GTP-binding protein are well known, such as cAMP via adenylate cyclase and Ca ²⁺ via phosphoivase C. Recently, it has become clear that many cellular proteins are targets, such as channel-mediated control and phosphorylation enzyme activation (Annu. Rev. Neurosci. (97) 20: 399). Substrates (ligands) for G protein-coupled receptors are very diverse, including proteinaceous hormones, chemokines, peptides, amines, lipid-derived substances, and proteases such as thrombin. At present, the number of G protein-coupled receptors whose genes have been identified is less than 300 in humans excluding sensory organ receptors, but the number of G protein-coupled receptors whose ligands have been identified is about Only 140 types of unknown ligands There are more than 100 types of "quality coupled receptors". However, it is assumed that there are at least 400, and sometimes as many as 1000, G protein-coupled receptors in the actual human genome (Trends Pharmacol. Sci. (97) 18: 430). This means that the number of orphan G-protein co-receptors with unknown functions will explode with the rapid progress of genome analysis in the future.

 Over 90% of drugs created by global pharmaceutical companies so far target interactions in the extracellular space, of which about half of small molecule drugs related to G protein-coupled receptors is occupying. The reason is that G protein-coupled receptor-related diseases are extremely common, including genetic diseases, cranial nervous system, circulatory system, digestive system, immune system, motor system, urogenital system, etc. In the area of Therefore, recently many pharmaceutical companies own the orphan G protein-coupled receptor revealed by genome analysis, and are spending less time searching for ligands and elucidating physiological functions. Against the background of this situation, there have recently been reports of successful searches for physiological ligands for novel G protein-coupled receptors. For example, calcitonin gene-related peptide receptor (J. Biol. Chem. (96) 271: 11325), orexin (Cell (98) 92: 573) and propylactin-releasing peptide (Nature (98) 393: 272) The case mentioned above had a great impact as basic research in the life science field.

In particular, the orphan G protein-coupled receptor has received a great deal of attention as a potential target for new drug development. In general, since no specific ligand has been found for orphan G protein-coupled receptor, it has been difficult to develop its agonist, angonist. However, in recent years, it has been proposed to create a drug targeting the Saiichi-Fan G protein-coupled receptor by combining an enhanced compound library with high-throughput screening (Trends Pharmacol. Sci. (97) 18: 430, Br. J. Pharm. (98) 125: 1387). In other words, the receptor G protein-coupled receptor identified by genetic manipulation is converted into physiological agonies by functional screening using changes in intracellular second messenger cAMP and Ca ²⁺ as indices. This is to discover strikes and perform in vivo functional analysis. At this time, by using a compound library to increase the screening throughput, it was possible to discover specific surrogate agonists and orphan gonist for orphan G protein-coupled receptor, and eventually to identify specific diseases. Therapeutic drug development would also be theoretically possible. Disclosure of the invention

 An object of the present invention is to provide novel G protein-coupled receptors and their genes, as well as their production and use. Furthermore, it aims to provide the molecule as a target for drug development research.

 In order to solve the above-mentioned problems, the present inventors firstly used oligocap method, which was originally developed to isolate full-length cDNAs, by using multiple oligos from human placental tissue cDNA libraries to obtain multiple full-length cDNAs. Released.

 The nucleotide sequence of one of the isolated cDNAs was determined, and its structural analysis revealed that the cDNA had a G protein-coupled receptor because it had seven hydrophobic regions, which are thought to be transmembrane domains. (This clone was named "C-PLAC E1003238j") o

The expression of C-PLACE1003238 increased when an inhibitor was added to nerve cells that had been induced to differentiate by treatment with retinoic acid, suggesting a relationship with neurological diseases. In addition, since expression is reduced by ultraviolet irradiation, it may be related to skin cancer. In addition, C-PLACE1003238 showed high expression in tissues such as lung, placenta, and skin in normal tissues. When the expression in tumor tissue was compared with the expression in normal tissue, the expression was increased in colon cancer and Teng's carcinoma. On the other hand, expression was decreased in testicular cancer compared to normal. In addition, as a result of comparing the expression level of the C-PLACE1003238 gene in the brain of Alzheimer's disease patients with that in normal adults, it was found that the expression was decreased in the frontal lobe of Alzheimer's disease patients and increased in the hippocampus. These facts Thus, C-PLACE1003238 was suggested to be associated with cancer and Alzheimer's disease.

 The present invention relates to a novel G protein-coupled receptor C-PLACE1003238, DNA encoding the receptor, and their production and use.

 (1) the DNA according to any one of the following (a) to (d), which encodes a guanosine triphosphate binding protein-coupled receptor;

 (a) DNA encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2.

(b) DNA containing the coding region of the nucleotide sequence of SEQ ID NO: 1.

 (c) a DNA encoding a protein comprising the amino acid sequence of SEQ ID NO: 2 with one or more amino acids substituted, deleted, added and / or inserted.

 (d) a DNA consisting of the nucleotide sequence of SEQ ID NO: 1 that hybridizes under stringent conditions to MA.

 (2) DNA encoding a partial peptide of a protein consisting of the amino acid sequence of SEQ ID NO: 2,

 (3) a vector containing the DNA of (1) or (2),

 (4) a transformant carrying the DNA of (1) or (2) or the vector of (3),

 (5) a protein or peptide encoded by the DNA of (1) or (2),

 (6) The production of the protein or peptide according to (5), comprising the steps of: expressing the protein or peptide using the transformant according to (4); and recovering the expressed protein or peptide. Method,

 (7) A method for screening a ligand that binds to a protein according to (5),

 (a) contacting a test sample with the protein or peptide according to (5),

(b) selecting a compound that binds to the protein or peptide; (8) A method for screening a compound having an activity of inhibiting the binding of the protein according to (5) to a ligand thereof,

 (a) contacting a ligand with the protein or its partial peptide according to (5) in the presence of a test sample, and detecting the binding activity between the protein or its partial peptide and a ligand;

 (b) selecting a compound that reduces the binding activity detected in step (a) as compared to the binding activity in the absence of the test sample;

 (9) A method for screening a compound that inhibits or promotes the activity of the protein according to (5),

 (a) contacting a cell expressing the protein with a ligand for the protein in the presence of a test sample;

 (b) detecting a change in a cell due to binding of the ligand to the protein,

(c) selecting a compound that suppresses or enhances the change in the cells detected in step (b), as compared to the change in the cells in the absence of the test sample,

 (10) an antibody that binds to the protein according to (5),

 (11) a compound isolated by the screening according to any of (7) to (9),

 (12) A pharmaceutical composition comprising the compound according to (11) as an active ingredient,

 (13) a nucleotide having a chain length of at least 15 nucleotides, which is complementary to the DNA consisting of the nucleotide sequence of SEQ ID NO: 1 or a complementary strand thereof.

 In the present invention, “G protein-coupled receptor” means a cell membrane receptor that transmits a signal into a cell through activation of a GTP-binding protein.

In the present invention, "ligand" means a physiological substance that binds to a G protein-coupled receptor and transmits a signal into cells. Here, "physiological substance" means in vivo Means a compound that binds to a G protein-coupled receptor.

 In the present invention, “agonist” refers to a compound capable of transmitting a signal into a cell by binding to a G protein-coupled receptor, and is a physiological substance, an artificially synthesized compound, or a naturally-derived compound. including.

 In the present invention, the term “angigonist” refers to a compound that inhibits binding of a ligand to a G protein-coupled receptor or transmission of a signal into a cell, and is a physiologically synthesized or artificially synthesized substance. Compounds, including naturally occurring compounds.

 The present invention provides a novel G protein-coupled receptor and a DNA encoding the protein. The human-derived cDNA clone included in the present invention and isolated by the present inventors was named "C-PLACE1003238". The nucleotide sequence of the cDNA is shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the cDNA is shown in SEQ ID NO: 2. As a result of the BLAST search, the protein encoded by the cDNA showed significant amino acid sequence homology with a known G protein-coupled receptor. Specifically, it showed 25% homology to “human Platelet Activating Factor (PAF) receptor”. In addition, the proteins encoded by the C-PLACE1003238 cDNA isolated by the present inventors all retained hydrophobic regions, which are considered to be seven transmembrane domains characteristic of G protein-coupled receptors. From these facts, it is considered that C-PLACE1003238 cDNA encodes a protein belonging to the G protein-coupled receptor family. G protein-coupled receptors have the activity of transmitting signals into cells through activation of G proteins by the action of their ligands, and as described above, include genetic diseases, cerebral nervous system, circulatory system It has been implicated in numerous areas of disease, including the digestive, immune, motor, and genitourinary systems. In particular, the expression characteristics of the C-PLACE1003238 protein suggest a link to cancer and Alzheimer's. The C-PLACE1003238 protein can be used for screening agonists and angiogonists that regulate the function of the C-PLACE1003238 protein, and these molecules are important targets for drug development for the above diseases.

The present invention also provides a protein functionally equivalent to the C-PLACE1003238 protein. Here, “functionally equivalent” means that the target protein has a biological property equivalent to that of the C-PLACE1003238 protein. Biological properties of the C-PLACE1003238 protein include an activity of transmitting a signal into a cell through activation of a trimeric GTP-binding protein. Trimeric GTP-binding proteins are classified into three categories, depending on the type of intracellular signaling system activated: Gq, which increases Ca2 ⁺ , Gs, which increases cAMP, and Gi, which suppresses cAMP. (Trends Pharmacol. Sci. (9 9) 20: 118). Therefore, whether the protein of interest has the same biological properties as the C-PLACE1003238 protein can be determined, for example, by detecting changes in intracellular cAMP concentration or calcium concentration due to its activation. It is possible to evaluate.

 One embodiment of a method for preparing a protein functionally equivalent to the C-PLACE1003238 protein includes a method of introducing a mutation into an amino acid sequence in a protein. Such methods include, for example, site-directed mutagenesis (Current Protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. Jhon Wily & Sons Section 8.1-8.5). . Amino acid mutations in proteins can also occur in nature. In the present invention, one or more amino acids may be substituted, deleted, or inserted in the amino acid sequence (SEQ ID NO: 2) of the C-PLACE1003238 protein, whether artificial or natural. And / or a protein mutated by addition, etc., which is functionally equivalent to the C-PLACE1003238 protein. The number and location of amino acid mutations in these proteins are not limited as long as the function of the C-PLACE1003238 protein is maintained. The number of mutations is typically within 10% of all amino acids, preferably within 5% of all amino acids, more preferably all amino acids.

It is considered to be within 1%.

Another embodiment of the method for preparing a protein functionally equivalent to the C-PLACE1003238 protein includes a method utilizing a hybridization technique or a gene amplification technique. That is, if a person skilled in the art is familiar with the hybridization technology (Current Protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. Jh Based on the DNA sequence (-? 1 ^ £ 1003238) encoding the protein (SEQ ID NO: 1) or a part thereof, the DM originated from the same or heterologous organism was obtained using on Wily & Sons Section 6.3-6.4). It is usually possible to isolate a DNA highly homologous thereto from a sample and obtain a protein functionally equivalent to the C-PLACE1003238 protein from the DNA. A protein encoded by a DNA that hybridizes to the encoding DNA and that is functionally equivalent to the C-PLACE1003238 protein is also included in the protein of the present invention.

 Examples of organisms for isolating such proteins include, but are not limited to, rats, mice, egrets, chicks, birds, and sea lions, in addition to humans.

 As stringent hybridization conditions for isolating a DNA encoding a protein functionally equivalent to the C-PLACE1003238 protein, usually, conditions of about “lxSSC, 0.1% SDS, 37.C” are used. The more severe condition is a condition of “0.5xSSC, 0.1¾SDS, 42 ° C”, and the more severe condition is a condition of “0.2xSSC, 0.1¾SDS, 65 ° C”. Thus, as the hybridization conditions become more stringent, isolation of DNA having higher homology to the probe sequence can be expected. However, the combination of the above SSCs, SDS and temperature conditions is merely an example, and those skilled in the art will appreciate that the above or other factors that determine the stringency of hybridization (eg, probe concentration, probe length, hybridization, etc.). It is possible to realize the same stringency as above by appropriately combining the reaction times.

A protein encoded by DNA isolated using such a hybridization technique usually has high homology in amino acid sequence with the C-PLACE1003238 protein. High homology refers to sequence homology of at least 40% or more, preferably 60% or more, and more preferably 80% or more (eg, 90% or more and 95% or more). Homology identification can be determined using the BLAST search algorithm. Also, using a gene amplification technique (PCR) (Current protocols in Molecular Biology edit it. Ausubel et al. (1987) Publish. John Wiley & Sons Section 6.1-6.4), a DNA sequence encoding the C-PLACE1003238 protein (SEQ ID NO: Primers were designed based on a part of 1), a DNA fragment having high homology to the DNA sequence encoding C-PLACE1003238 protein was isolated, and a protein functionally equivalent to C-PLACE1003238 protein was obtained based on the DNA. It is also possible to obtain

 The present invention also includes a partial peptide of the protein of the present invention. This partial peptide includes a peptide that binds to a ligand but does not transmit a signal. An affinity column prepared based on such a peptide can be suitably used for screening of a ligand. Further, the partial peptide of the protein of the present invention can also be used for preparing an antibody. The partial peptide of the present invention can be produced, for example, by a genetic technique, a known peptide synthesis method, or by cleaving the protein of the present invention with an appropriate peptidase. The partial peptide of the present invention usually has 8 amino acid residues or more, preferably 12 amino acid residues or more (for example, 15 amino acid residues or more).

The protein of the present invention can be prepared as a recombinant protein or as a natural protein. The recombinant protein may be prepared, for example, by introducing a vector into which a DNA encoding the protein of the present invention has been inserted into an appropriate host cell and purifying the protein expressed in the transformant, as described later. Is possible. On the other hand, a natural protein can be prepared, for example, using an affinity column to which an antibody against the protein of the present invention described later is bound (Current Protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. Jhon Wily & Sons Section 16.1- 16.19). The antibody used for affinity purification may be a polyclonal antibody or a monoclonal antibody. In addition, in vitro translation (for example, “0n the fidelity of mRNA translation in the nuclease-treated rabbit reticulocyte lysate system. Dasso, MC, Jackson, RJ (1989) thigh 17: 3129-31 The protein of the present invention can also be prepared as described above.

 The present invention also provides a DNA encoding the protein of the present invention. The form of the DNA of the present invention is not particularly limited as long as it can encode the protein of the present invention, and includes genomic DNA, chemically synthesized DNA, and the like in addition to cDNA. Further, as long as it can encode the protein of the present invention, MA having an arbitrary nucleotide sequence based on the degeneracy of the genetic code is included. As described above, the DNA of the present invention can be obtained by a hybridization method using a DNA sequence encoding the C-PLACE1003238 protein (SEQ ID NO: 1) or a part thereof as a probe, or a primer synthesized based on these DNA sequences. It can be isolated by a conventional method such as a PCR method using the above method.

 The present invention also provides a vector into which the DNA of the present invention has been inserted. The vector of the present invention is not particularly limited as long as it stably retains the inserted DNA. For example, if Escherichia coli is used as a host, the pBluescript vector (Stratagene) may be used as a cloning vector. And the like are preferred. When a vector is used for the purpose of producing the protein of the present invention, an expression vector is particularly useful. The expression vector is not particularly limited as long as it is a vector that expresses the protein in a test tube, in E. coli, in a cultured cell, or in an individual organism. For example, a pBEST vector (Promega Escherichia coli, pET vector (Invitrogen), cultured cells!) ME18S-FL3 vector (GenBank Accession No. AB009864), pCEP 4 vector (Invitrogen), or a living organism For example, the pME18S vector (Mol Cell Biol. 8: 466-472 (1988)) is preferable. Insertion of the DNA of the present invention into a polynucleotide can be carried out by a conventional method, for example, by a ligase reaction using a restriction enzyme site (Current protocols in Molecular Biology edit.Ausubel et al. 1987) Publish. John Wiley & Sons. Section 11.4-11.11).

The present invention also provides a transformant carrying the DNA of the present invention or the vector of the present invention. The host cell into which the vector of the present invention is introduced is not particularly limited, and various host cells may be used depending on the purpose. The production system for protein production is in vit There are ro and in vivo production systems. Examples of eukaryotic cells for highly expressing a protein include COS cells, CH0 cells, and 293 cells. Transduction of vectors into host cells can be performed, for example, by calcium phosphate precipitation, electropulse perforation (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons. Section 9.1-9.9), ribofect It can be performed by a known method such as the Yumin method (GIBC0-BRL) or the microinjection method.

The present invention also provides nucleotides having a chain length of at least 15 nucleotides, which are complementary to DNA encoding the protein of the present invention (MA consisting of the nucleotide sequence of SEQ ID NO: 1 or a complementary strand thereof). Here, the “complementary strand” refers to one strand of the double-stranded nucleic acid consisting of A: T (U in the case of RNA) and G: C base pairs with respect to the other strand. The term "complementary" is not limited to a case where the sequence is completely complementary to at least 15 contiguous nucleotide regions, but is at least 70%, preferably at least 80%, more preferably 90%, and still more preferably 95%. It suffices that the homologous sequence has a homology of at least%. The algorithm for determining homology may use the algorithm described in this specification. Such nucleotides can be used as a probe for detecting and isolating the DNA of the present invention, and as a primer for amplifying the DNA of the present invention. When used as a primer, it usually has a chain length of 15 bp to 100 bp, preferably 15 bp to 35 bp. When used as a probe, a nucleotide having a chain length of at least 15 bp containing at least a part or the entire sequence of the DNA of the present invention is used. Such nucleotides preferably specifically hybridize to DNA encoding the protein of the present invention. The term "specifically hybridizes" means that it hybridizes with a DNA encoding the protein of the present invention (SEQ ID NO: 1) under ordinary hybridization conditions, preferably under stringent conditions, and other conditions. Means that it does not hybridize with DNA encoding the protein. These nucleotides can be used for testing and diagnosing abnormalities of the protein of the present invention. For example, a probe using these nucleotides as a probe or primer Abnormal expression of the DNA encoding the protein of the present invention can be examined by hybridization or RT-PCR. In addition, the DNA encoding the protein of the present invention and its expression control region are amplified by polymerase chain reaction (PCR) using these nucleotides as primers, and DNLP is analyzed by methods such as RFLP analysis, SSCP, and sequencing. Inspection and diagnosis of A sequence abnormalities.

 In addition, these nucleotides include antisense DNA for suppressing the expression of the protein of the present invention. The antisense DNA has a chain length of at least 15 bp or more, preferably 100 bp, more preferably 500 bp or more, and usually has a chain length of 3000 bp or less, preferably 2000 bp or less in order to cause an antisense effect. Such antisense DNA may be applied to gene therapy of diseases caused by abnormalities (functional abnormality or abnormal expression) of the protein of the present invention. The antisense DNA is, for example, based on the sequence information of the DNA encoding the protein of the present invention (for example, SEQ ID NO: 1), based on the phosphorothioate method (Stein, 1988 Physicochemical properties of phosphorothioate oligodeoxynucleotides. Nucleic Acids Res. 16, 3209-21 (1988)).

 When used for gene therapy, the nucleotides of the present invention can be used, for example, by utilizing viral vectors such as retrovirus vectors, adenovirus vectors, adeno-associated virus vectors, and non-viral vectors such as ribosomes, and the like. It may be possible to administer to patients by the in vivo method or the in vivo method.

 The present invention also provides an antibody that binds to the protein of the present invention. The form of the antibody of the present invention is not particularly limited, and includes a polyclonal antibody, a monoclonal antibody, and a part thereof having antigen-binding properties. It also includes all classes of antibodies. Furthermore, the antibodies of the present invention also include special antibodies such as humanized antibodies.

In the case of a polyclonal antibody, the antibody of the present invention can be obtained by synthesizing an oligonucleotide corresponding to the amino acid sequence of the protein of the present invention according to a conventional method, and immunizing a rabbit ( Current protocols in Molecular Biology edit.Ausub el et al. (1987) Publish. John Wiley & Sons. Section 11.12-11.13). In the case of a monoclonal antibody, a mouse is immunized with a protein expressed and purified in Escherichia coli according to a conventional method, and a hybridoma cell obtained by fusing the spleen cell and myeloma cell thereof is prepared. It can be obtained from dorma cells (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons. Section 11.4-11.11).

 Antibodies that bind to the protein of the present invention may be used, for example, for the examination and diagnosis of abnormal expression or structural abnormality of the protein of the present invention, in addition to purification of the protein of the present invention. Specifically, for example, proteins are extracted from tissues, blood, cells, or the like, and the presence or absence of abnormalities in expression or structure is detected through detection of the proteins of the present invention by Western blotting, immunoprecipitation, or ELISA. Inspection · Can be diagnosed.

 It is also conceivable to use an antibody that binds to the protein of the present invention for the purpose of treating a disease associated with the protein of the present invention. The antibody of the present invention can act as an agonist of the protein of the present invention. When the antibody is used for the purpose of treating a patient, a human antibody or a humanized antibody is preferred because of its low immunogenicity. Human antibodies include mice in which the immune system has been replaced by humans (for example, functional transplant of megabase human immunoglobulin loci recapitulates human antibody responses in mice, Mendez, MJ et al. (1997) Nat. Genet. 15: 146 -156 ”). In addition, a humanized antibody can be prepared by genetic recombination using the hypervariable region of a monoclonal antibody (Methods in Enzymology 203, 99-121 (1991)).

 The present invention also provides a method for screening for a ligand that binds to the protein of the present invention, using the protein of the present invention. This screening method includes (a) a step of bringing a test sample into contact with a protein of the present invention or a partial peptide thereof, and (b) a step of selecting a compound that binds to the protein or a partial peptide thereof.

The test sample is not particularly limited. For example, various G protein-coupled receptor Gand activity was prepared by applying known compounds or peptides (for example, those registered in a chemical file) or phage display method (J. Mol. Biol. (1991) 222, 301-310). Random 'peptides can be used. In addition, culture supernatants of microorganisms, natural components derived from plants and marine organisms, etc. are also subject to screening. Other biological tissue extracts, including brain, cell extracts

Examples include, but are not limited to, expression products of a gene library. The protein of the present invention used for screening is, for example, a form expressed on the cell surface.

Alternatively, the cells may be in the form of a cell membrane fraction or in the form of being bound to an affinity column.

 Specific screening techniques include, for example, a method of contacting a test sample with an affinity column for the protein of the present invention to purify a compound that binds to the protein of the present invention, and a number of known methods such as a West Western plotting method. Methods are available. When these methods are used, the test sample is appropriately labeled, and the binding to the protein of the present invention can be detected using the label. In addition to these methods, a cell membrane expressing the protein of the present invention is prepared and immobilized on a chip, and dissociation of the trimeric GTP-binding protein upon ligand binding is confirmed by surface plasmon resonance (surface plasmon resonance). It is also possible to use a method of detecting with resonance; (Nature Biotechnology (99) 17: 1105).

Further, the binding activity between the test sample and the protein of the present invention can be detected by using, as an index, a change in cells caused by binding of the test sample to the protein of the present invention expressed on the cell surface. Such changes include, but are not limited to, changes in intracellular Ca ²⁺ levels and changes in cAMP levels. Specifically, agonist activity for G protein-coupled receptors can be measured by the GTP-S binding method. As one example of this method, a cell membrane expressing a G protein-coupled receptor was labeled with ³⁵ S in a solution of 20 mM HEPES (pH 7.4), 100 mM NaCl, 10 mM MgCl ₂ , and 50 〃M GDP. Mixed with 400 pM GTPa S and incubated in the presence and absence of the test sample. After filtration, filtration can be used to compare the radioactivity of the bound GTPyS.

In addition, G protein-coupled receptors share a system that transduces signals into cells via activation of trimeric GTP-binding proteins. Trimeric GTP-binding proteins are classified into three types, Gq-type that increases Ca2 ⁺ , Gs-type that increases cAMP, and Gi-type that suppresses cAMP, depending on the type of intracellular signaling system that is activated. . Applying this fact, Gq protein subunit is chimerized with other G protein subunits, and a positive signal at the time of ligand screening is consequently increased to Ca2 ⁺ , which is a Gq intracellular transduction pathway. Is possible. Elevated Ca ²⁺ levels can be detected using as indicators the changes in the repo overnight gene system having TRE (TP A responsive element) upstream, a staining indicator such as Fluor-3, and the fluorescent protein aequorin. Similarly, Gs protein subunits are chimerized with other G protein subunits, and a positive signal results in an increase in cAMP, a Gs intracellular transduction pathway, and a reporter having a CRE (cAMP-responsive element) upstream. Changes in the overnight gene system can be used as an index (Trends Pharmacol. Sci. (99) 20: 118).

There are no particular restrictions on the host cells that express the protein of the present invention in this screening system, and various host cells may be used depending on the purpose.Examples include COS cells, CH0 cells, HEK293 cells, and the like. . Examples of vectors for expressing the protein of the present invention in vertebrate cells include a promoter located upstream of a gene encoding the protein of the present invention, a splice site, a polyadenylation site, and a transcription termination sequence of RNA. And those having a replication origin and the like can be suitably used. For example, pSV2dhfr (Mol. Cell. Biol. (1981) 1,854-864) having an early promoter of SV40, pEF-BOS (Nucleic Acids Res. (1990) 18, 5322), pC drawing (Nature (1987) 329, 840-842) and pCEP4 (Invitrogentt) are useful vectors for expressing G protein-coupled receptors. Insertion of the DNA of the present invention into a vector can be performed by a ligase reaction using a restriction enzyme site according to a conventional method (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons. Section IV.4-- 11.11). In addition, the introduction of the vector into a host cell can be performed, for example, by the calcium phosphate precipitation method or the electric pulse perforation method (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons. Section 9.1) -9.9), Lvov method (GIBC0-BRL), FuGENE6 reagent (Boehringer-Mannheim), microinjection, and other known methods.

 If the ligand is isolated by the above-described method for screening a ligand that binds to the protein of the present invention, a compound that inhibits the interaction between the protein and the ligand of the present invention can be screened. Therefore, the present invention also provides a method for screening a compound having an activity of inhibiting the binding of the protein of the present invention to its ligand. This screening method comprises the steps of: (a) contacting a ligand of the protein or its partial peptide in the presence of a test sample with a ligand, and detecting the binding activity between the protein or its partial peptide and the ligand; b) selecting a compound that reduces the binding activity detected in step (a) as compared to the binding activity in the absence of the test sample.

 The test sample is not particularly limited. For example, a compound group obtained by combinatorial 'chemistry—technology (Tetrahedron (1995) 51, 8135-8137), or a phage' display method (J. Mol. Biol. (1991) 222, 30-310) can be used. In addition, culture supernatants of microorganisms and natural components derived from plants and marine organisms are also targets for screening. Other examples include, but are not limited to, brain and other biological tissue extracts, cell extracts, expression products of gene libraries, synthetic low molecular weight compounds, synthetic peptides, natural compounds, and the like.

 The protein of the present invention used for screening is, for example, a form expressed on the cell surface.

Morphology of the cells as a cell membrane fraction or bound to an affinity column It may be in a form.

 As a specific screening method, for example, a method in which a ligand is labeled with a radioisotope or the like, and the ligand is contacted with the protein of the present invention in the presence of a test sample, and then compared with the case where detection is performed in the absence of a test sample Then, a method of detecting a compound that reduces the binding activity between the protein and the ligand of the present invention based on the label attached to the ligand can be used. In addition, similarly to the case of the screening of the ligand binding to the protein of the present invention, the screening can be performed using the intracellular change as an index. That is, a compound expressing the protein of the present invention is brought into contact with a ligand in the presence of a test sample, and a compound that reduces the change in the cell is selected as compared to the case where the ligand is detected in the absence of the test sample. By doing so, it is possible to screen for a compound that inhibits the binding between the protein of the present invention and a ligand. Cells expressing the protein of the present invention can be prepared in the same manner as in the above-described screening for a ligand that binds to the protein of the present invention. The compound isolated by this screening is a candidate for the agonist of the protein of the present invention.

 The present invention also provides a method for screening a compound that inhibits or promotes the activity of the protein of the present invention. This screening method comprises the steps of (a) contacting a cell expressing the protein of the present invention with a ligand of the protein in the presence of a test sample, and (b) a change in cells caused by binding of the ligand to the protein of the present invention. And (c) selecting a compound that suppresses or enhances the change in the cells detected in step (b) as compared to the change in the cells in the absence of the test sample.

As the test sample, the compound group obtained by the combinatorial chemistry technique, the phage display method, etc. may be used in the same manner as the above-mentioned compound screening method of the present invention for inhibiting the binding of the protein to the ligand. Random peptides produced by application, culture supernatants of microorganisms, natural components derived from plants and marine organisms, biological tissue extracts, cell extracts, gene library expression products, synthetic low molecular weight compounds , Go Synthetic peptides, natural compounds and the like can be used. In addition, a compound isolated by screening a compound that inhibits the binding between the protein of the present invention and a ligand can be used as a test sample. Cells expressing the protein of the present invention can be prepared in the same manner as in the above-described screening for a ligand that binds to the protein of the present invention. Changes in the cells after contact with the test sample can be detected using changes in intracellular Ca ²⁺ levels and cAMP levels as indices, as in the above-described screening method. In addition, when detecting intracellular signal transduction, it is also possible to detect using a measurement system such as a repo overnight system using luciferase or the like as a reporter gene.

 As a result of this detection, if the change in cells when the test sample is contacted is suppressed compared to the change in cells when the ligand is contacted in the absence of the test sample, The sample is determined to be a compound that inhibits the activity of the protein of the present invention. Conversely, if the test sample enhances the change in the cells, the compound is determined to be a compound that promotes the activity of the protein of the present invention. In addition, “promoting or inhibiting the activity of the protein of the present invention” as used herein refers to whether the action of the protein of the present invention is a direct action or an indirect action on the protein of the present invention. It means that the activity of the protein of the invention is promoted or inhibited. Therefore, compounds isolated by this screening include compounds that act on the protein or ligand of the present invention to inhibit or promote their binding to thereby inhibit or promote the activity of the protein of the present invention, Also included are compounds that do not inhibit or promote binding itself, but which, as a result, inhibit or promote the activity of the proteins of the invention. Such compounds include, for example, compounds that do not inhibit the binding of the protein of the present invention to the ligand, but inhibit or promote a signal transduction pathway in cells.

When a compound isolated by the screening method of the present invention is used as a pharmaceutical, the isolated compound itself is administered directly to a patient or administered as a pharmaceutical composition formulated by a known pharmaceutical method. It is also possible to do. For example, medicine P

19

 It is conceivable to formulate and administer a suitable combination with a physiologically acceptable carrier or vehicle, specifically, sterile water, physiological saline, vegetable oil, emulsifier, suspending agent and the like. Administration to a patient can be generally performed by a method known to those skilled in the art, such as oral administration, nasal administration, intraarterial injection, intravenous injection, and subcutaneous injection. The dose varies depending on the weight and age of the patient, the administration method, and the like, but those skilled in the art can appropriately select an appropriate dose. If the compound can be encoded by MA, the DNA may be incorporated into a gene therapy vector to perform gene therapy. BRIEF DESCRIPTION OF THE FIGURES

 FIG. 1 is a view showing alignment between C-PLACE1003238 and a previously reported G protein-coupled receptor. TMn in the figure indicates the n-th transmembrane site.

 FIG. 2 is a continuation of FIG.

 FIG. 3 is a continuation of FIG. BEST MODE FOR CARRYING OUT THE INVENTION

 Next, the present invention will be described more specifically with reference to examples, but the present invention is not limited to the following examples. Unless otherwise specified, it can be carried out according to a known method (Maniat is, T. at al. 982): "Molecular Cloning-A Laboratory Manual" Cold Spring Harbor Laboratory, NY.

 [Example 1] Preparation of cDNA library from human placental tissue by oligocap method

MRNA was extracted from human placental tissues by the method described in Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1989). Further, oligo (d) was prepared according to the method described in Molecular Cloning, A Laboratory Manual, Second Edition, Co Id Spring Harbor Laboratory Press (1989). P

20

 T) Poly (A) + UNA was purified using a cellulose column (Collaborative labs). From the poly (A) + RNA, a cDNA library was prepared by an oligocap method [M. Maruyama and S. Sugano, Gene, 138: 171-174 (1994)]. Using an oligocaprin ligand (synthetic RNA) consisting of the sequence represented by SEQ ID NO: 3 and an oligo (dT) adapter consisting of the sequence represented by SEQ ID NO: 4, the literature [Suzuki 'Sugano, Protein Nucleic acid] Enzyme, 41: 197-201 (1996), Y. Suzuki et al., Gene, 200: 149-156 (1997)], BAP (Bacterial Alkaline Phosphatase) treatment, TAP (T obacco Acid Pyrophosphatase treatment, RNA ligation, synthesis of first-strand cDNA, and RNA removal were performed. Then, using a 5 ′ terminal side PCR primer represented by SEQ ID NO: 5 and a 3, terminal side PCR primer represented by SEQ ID NO: 6, it was converted into double-stranded cDNA by PCR (polymerase chain reaction). The obtained DNA fragment was cut with Sfil. Next, the vector was cut with Dral II and the vector PME18SFL3 (GenBank AB009864) was cloned by determining the direction of the cDNA to prepare a cDNA library. The cloned site of PME18SFL3 is an asymmetric Drall site, and a complementary Sfil site is added to the end of the cDNA fragment. It is inserted unidirectionally downstream of the promotion.

 [Example 2] Analysis of cDNA clone derived from cDNA library prepared from human placental tissue

 (1) Isolation of cDNA clone

 A part of the cDNA library prepared in Example 1 was introduced into Escherichia coli DH10B by electroporation using Gene Pulser (Biorad). Transformants were selected by culturing on LB agar medium containing 50 g / mL of ampicillin. These transformants were cultured overnight in an LB medium containing 50 g / mL of ampicillin, and the plasmid was extracted using a plasmid automatic extractor PI100 (manufactured by Kurabo Industries, Ltd.).

 (2) Analysis of the nucleotide sequence of the isolated cDNA clone

The plasmid DNA of clones obtained from these transformants was subjected to DNA sequencing. Using a sequencing reagent (BigDye Terminator Cycle Sequencing FS Ready Reaction Kit, manufactured by PE Biosystems), perform the sequencing reaction according to the manual, and then use a DNA sequencer (ABI PRISM 377, manufactured by PE Biosystems) to determine the 5 and 5 Or 3, the base sequence from the end was analyzed.

 For determination of the base sequence from the 5 'end, ME761FW represented by SEQ ID NO: 7 is used. For determination of the base sequence from the 3' end, ME1250RV represented by SEQ ID NO: 8 is used for the sequencing primer. Used as

 (3) Classification of 5 'and 3' end sequences of cDNA clones

 The 5′-end sequence and the 3′-end sequence of the cDNA clone determined in (2) were separately classi? Ed. That is, the single-pass sequence data from the 5 'end and 3' end determined for the cDNA clones were subjected to BLAST analysis between each sequence, and clones considered to be derived from the same gene were grouped. Was. If the consensus sequence with a homology of 95% or more is 300 base pairs or more at the 5 'end sequence, and the consensus sequence with a homology of 90% or more is 200 base pairs or more at the 3' end sequence, the same group is considered. The 'terminal sequence group' was further subjected to grouping (clustering) so that the 5 'terminal sequence and 3' terminal sequence of the same clone belonged to the same group (cluster).

 (4) Characterization of cDNA clone sequence

 5 ′ terminal sequence data of the clone sequence was characterized based on the following method.

 (1) By homology search using GenBank with BlastN, confirm that the sequence is the same as the human {other mRNA sequence (including the licensed sequence)} / human EST sequence.

(2) Human sequence ヒ ト Confirm that the 5 'end is longer than the human EST sequence.

(3) 5'-end sequence by ATGpr program [A. Salajnov, T. Nishikawa, MB S in dells. Assessing protein coding region integrity in cDNA sequencing projects. Bioinformatics 14: 384-390 (1998)] Determine ATGprl, ATGpr2 values from all start codons in. (4) Determine the number of identical human EST sequences by homology search using BlastN for GenBank.

 In addition, the characterization of the 3′-end sequence of the clone sequence was performed for (1) and (4) above.

 Based on the data of the clone sequences thus characterized, a new and likely full-length cDNA clone was selected.

 (5) Human mRNA sequence--identity to human EST sequence Comparison of 5'-end length Comparison of the 5'-end and 3'-end sequences of the clonal sequence to mRNA sequences of humans and other organisms When the length of the comparison sequence portion with each sequence was at least 200 bases and at least 94 matches, the sequences were regarded as identical. The identity to the human EST sequence was considered to be identical if the length of the comparison sequence portion with the 5 'terminal sequence was 200 bases or more and 90% or more matches.

 When comparing the length of the 5 'end with the human mRNA sequence as a comparison sequence, when the length of the 5' end sequence is longer than the human mRNA sequence, or when the 5 'end sequence contains a translation initiation codon, did. When the comparison target sequence is EST, if the 5 'end is longer and longer than the human EST sequence in the database, or if the clone with a shorter 5' end has a difference of 50 bases or less. In some cases, the entire length is referred to as the full length, and in cases where the length is shorter, the non-full length is used.

(6) Prediction of full length by ATGpr

 ATGpr [A. Salamov, T. Nishika a, Μ. Β. Swindells. Asse ssing protein coding region integrity in cDNA sequencing projects.Bioin formatics 14: 384-390 (1998)] Was. The ATGprl value is a value that predicts the possibility of the full length from the calculated value. The higher the ATGprl value, the higher the possibility of the full length. The maximum ATGprl value and maximum ATGpr2 value indicate the maximum ATGprl value and ATGpr2 value predicted from all start codons contained in the 5 'end sequence of the clone sequence, and these values were used for characterization. .

 (7) Prediction of novelty from the number of identical EST sequences by homology search

5 'terminal sequence For each 3' terminal sequence, determined from homology search using GenBank Was. For the human EST sequence, the sequence was determined to be identical when the length of the comparison sequence portion with the 5 'terminal sequence was 90% or more over 200 bases or more. The number of EST sequences was used directly for characterization and used as an index of novelty. Clones having 5′-terminal sequences and 3′-terminal sequences that are not identical to not only mRNA sequences but also EST sequences are genes encoding novel sequences. Similarly, clones with a small number of 5'-terminal sequences or 3'-terminal sequences with a small number of identical EST sequences were also determined to be cDNA clones encoding the novel sequences.

(8) Characterization of class Yuichi

 5'-end sequence The class of 3'-end sequences was characterized based on the following viewpoints.

 (1) By homology search using BlastN for GenBank, mRNA sequences of humans and other organisms (including licensed sequences) か Are they identical to human EST sequences?

 All 5 'terminal sequences included in class 1 If at least one of the 3' terminal sequences is identical to the mRNA sequence, that class is identical to the class 1 that is identical to the mRNA sequence. did.

 (2) Is the 5 'end longer than the human mRNA sequence ゃ human EST sequence?

 If all the 5 'terminal sequences included in the class 1 are non-full length with respect to the mRNA sequence ゃ human EST sequence, the class 1 is non-full length with respect to the mMA sequence or human EST sequence. And

 (3) ATGprH direct and ATGpr2 values derived from all start codons in the 5 'terminal sequence by the ATGpr program for predicting full length.

The ATGpr program [A. Salamov, T. Nishikawa, MB Swindells. Assessing protein coding region integrity in cDNA sequencing projects. Bioinformatics 14: 384-390 (1998)] Regarding the ATGprl value derived from the start codon, the maximum value of the ATGprl value for all the 5 'terminal sequences contained in the class evening was defined as the ATGprl value in the class evening. ATGpr2 values were similar (4) The number of human EST sequences determined to be identical by homology search using BlastN in GenBank.

The maximum value of the number of EST sequences was calculated for each of the 5 ⁵ terminal sequences and 3 'terminal sequences included in the class, and the number of identical EST sequences of the 5' terminal sequence and the number of identical EST sequences of the 3 'terminal sequence in the cluster were calculated. did.

 (9) Selection method of class evening from characterization

 From the data obtained by the characterization, first, clusters identical to the mRNA sequences of humans and other organisms (including the licensed sequences) and non-full-length clusters were excluded. From those clusters, those that met one of the following conditions were selected.

 (a) Classes in which the number of identical EST sequences in the 5'-end sequence in class is less than 20, and ATGprl value in class is more than 0.3.

 (b) Even if the ATGprl value in class I is less than 0.3, the number of identical EST sequences at the end sequence is 5 or less in class I, and the 3 'terminal sequence in class I is less than 5. Clusters with less than 5 identical EST sequences and multiple clones within the class.

 (c) Even if the ATGprl value in the class is less than 0.3, the number of identical ESTs in the cluster 5 and the terminal sequence is 0, and the same EST in the 3 'terminal sequence is the same in the class. Class Yuichi with 1 or more arrays.

 (d) Even if the class has an ATGprl value of 0.3 or less in the class, the number of identical EST sequences in the 5 'end sequence in the class is 1 or more and 5 or less, and the 3' end sequence in the class is Class Yuichi with 0 identical EST sequences.

 In the class selected in (a), at least one clone contains a clone with high novelty and full length. In the class selected in (b), (c), and (d), the full-length rate is low, but the full-length class still contains new clones.

(10) How to select clones from class If the clone contained only one clone in the same class, the clone was selected. When a plurality of clones were included in the same cluster and there were a plurality of clones having an ATGprl value of more than 0.3, a clone having a larger ATGprl value was selected. When multiple clones were included in the same cluster, and there were multiple clones with an ATGprl value of 0.3 or less, if the ATGpr2 value was greater than 0.3, the clone with the larger ATGpr2 value was selected. In addition, when multiple clones are included in the same class, if the ATGprl value and ATGpr2 value are both 0.3 or less, and if there is a clone with the maximum ATGprl value and ATGpr2 value both in the class, A clone was selected. If multiple clones are included in the same cluster and selection cannot be performed based on the ATGpr value as described above, assembling using the 5 'terminal sequence and the 3' terminal sequence and the human EST sequence will improve 5. A long clone was selected on the terminal side. Sequencher (Gene Codes) was used for assembling, and if it could not be determined by assembling a part, all the target clones were judged to be full length.

 (11) Analysis of full-length sequence of cDNA clone

 The nucleotide sequence of the full-length cDNA was determined for the cDNA clones selected from (1) to (10) and derived from human placental tissue, which were determined to be highly likely to be novel. Primer walking is performed mainly by primer walking according to the Diodexoxy-Mine-All-In-One method using a custom synthesized DNA primer (sequencing is performed according to the manual using a DNA sequencing reagent manufactured by PE Biosystems using a custom synthesized DNA primer). After the reaction, the DNA base sequence was analyzed using the company's sequencer). The full-length nucleotide sequence was finally determined by completely overlapping the partial nucleotide sequence determined by the above method. Next, a deduced amino acid sequence was determined from the determined nucleotide sequence of the full-length cDNA.

The nucleotide sequence of cDNA clone C-PLACE1003238 as an example of a cDNA clone derived from human placental tissue, which was selected as described in (1) to (10) and determined to be highly likely to be full-length, Is shown in SEQ ID NO: 1. C deduced from the base sequence The amino acid sequence of the gene product encoded by DNA clone C-PLACE1003238 is shown in SEQ ID NO: 2.

 [Example 2] Evaluation of the total length of the 5'-end of cDNA using ATGpr and ESTiMateFL

 ATGpr is a program developed by AA Salamov, T. Nishikaa, and MB Swindells of the Helix Institute to predict whether a translation initiation codon exists based on the characteristics of the sequence around the ATG codon [AA Salamov , T. Nishikawa, MB Swindells, Bioinformatics, 14: 384-390 (1998); http: //www.hri.co.jp/atgpr/]. The results were expressed as the expected value of the ATG being the true start codon (hereinafter sometimes referred to as ATGprl) (0.05-0.94). When this program was applied to the 5'-end sequence of a cDNA clone from a library prepared by an oligocap method with a total length of 65% and a clone was selected with an ATGpr 1 value of 0.6 or more, the full-length clone (0RF N- Both the sensitivity and the specificity of the evaluation (clone to the end) increased to 82-83. The maximum ATGprl value of C-PLACE1003238 was 0.22.

 [Example 3] Gene expression analysis by hybridization using high-density DNA filter

DNA for nylon membrane spots was prepared as follows. That is, E. coli is cultured in each well of a 96-well plate (37 ° C, 16 hours in LB medium), a part of the culture is suspended in sterilized water dispensed into 96-well plates, and the suspension is incubated at 100 ° C. After treatment with C for 10 minutes, it was used as a sample for the PCR reaction. PCR was performed using a TaKaRa PCR Amplification Kit (manufactured by Takarasha) with a reaction solution of 20 μL per reaction according to the protocol. In order to amplify the plasmid cDNA, the primer was paired with the sequencing primer ME761FW (5 'tacggaagtgttacttctgc3' / SEQ ID NO: 7) and ME1250 RV (5, tgtgggaggttttttctcta3, / SEQ ID NO: 8). One or a pair of M13M4 (5 ′ gttt tcccagtcacgac3 ′ / SEQ ID NO: 9) and M13RV (5 ′ caggaaacagctatgac3 ′ / SEQ ID NO: 10) was used. The PCR reaction was performed at 95 ° C for 5 minutes with GeneAmp System9600 (manufactured by PE Biosystems), followed by 10 cycles at 95 ° C for 10 seconds and 68 ° C for 1 minute. Twenty cycles were performed at 98 ° C for 20 seconds, 60 ° C for 3 minutes, and performed at 72 ° C for 10 minutes. After the PCR reaction, 2 jl of the reaction solution was subjected to 1% agarose gel electrophoresis, and the DNA was stained with a bromide reagent to confirm the amplified cDNA. For those that could not be amplified, a plasmid containing the cDNA insert was prepared by the alkali extraction method (J Sambrook, EF Fritsh, T Maniatis, oleolecular Cloning, A laboratory manual / 2nd edition, Cold Spring Harbor Laboratory Press, 1989). did.

 Preparation of the DNA array was performed as follows. DNA was dispensed into each well of a 384-well plate. DNA spotting on the nylon membrane (manufactured by Behringer) was performed using a 384-bin tool of Biomek 2000 Laboratory Automation System (manufactured by Beckman Cole Yuichi). That is, a 384-well plate containing DNA was set. 384 independent pins of a pin tool were simultaneously immersed in the DNA solution, and the DNA was sprinkled on the needles. By gently pressing the needle against the nylon membrane, the DNA attached to the needle was spotted on the nylon membrane. Denaturation of the spotted DNA and immobilization on the nylon membrane were performed according to a conventional method (J Sambrook, EF Fritsh, T Maniatis, Molecular Cloning, A laboratory manual / 2nd edition, Cold Spring Harbor Laboratory Press, 1989).

As a hybridization probe, a 1st strand cDNA labeled with a radioisotope was used. The synthesis of 1st strand cDNA was performed using Thermoscript ^(TM ) RT-PCR System (GIBC0). That is, the 1. 5 jug of each tissue derived m RNA of human Bok (Clontech Co.), using a 1 L 50 μ Ol igo (dT ) 20, supplied with the addition of 50 〃Ci [ct ³³ P] dATP 1st strand cDNA was synthesized according to the protocol described in The probe was purified using a ProbeQuant ( ^TM ) G-50 micro column (manufactured by Amersham Pharmacia Biotech) according to the attached protocol. Next, add 2 units E. coli RNase H, incubate at room temperature for 10 minutes, add 100 μg human COT-1 DNA (manufactured by GIBC0), and incubate at 97 ° C for 10 minutes. After one hour, the mixture was allowed to stand on ice to serve as a probe for hybridization. Hybridization of the radioisotope-labeled probe to the DNA array was carried out according to a conventional method (J Sambrook, EF Fritsh, T Maniatis, Molecular Cloning, A laboratory manual / 2nd edition, Cold Spring Harbor Laboratory Press, 1989). Washing is performed by washing the nylon membrane three times in a washing solution 1 (2X SSC, 1% SDS) at room temperature (about 26 ° C) for 20 minutes, and then in a washing solution 2 (0.1X SSC, 1% SDS). At 65. C was washed three times for 20 minutes. The autoradiogram was obtained using an image plate of BAS2000 (manufactured by Fuji Photo Film Co., Ltd.). That is, the hybridized nylon film was wrapped in Saran wrap, brought into close contact with the photosensitive surface of the image plate, placed in a radioisotope-sensitive cassette, and allowed to stand in a dark place for 4 hours. The radioisotope activity recorded on the image plate was analyzed using BAS2000, and converted and recorded as an autoradiogram image file electronically. Analysis of the signal intensity of each DNA spot was performed using Visage High Density Grid Analysis Systems (manufactured by Genomic Solutions), and the signal intensity was converted into numerical data. The data was obtained by Duplicate, and the reproducibility was determined by hybridizing two DNA filters with one probe and comparing the signal intensity of the corresponding spots in both filters. 95% of all spots have a signal value within 2 times that of the corresponding spot, and the correlation coefficient is -0.97. The reproducibility of the night is enough.

The detection sensitivity of gene expression analysis was determined by preparing a probe complementary to the DNA spotted on the membrane and examining the increase in probe signal intensity in the hybridization depending on the probe concentration. Estimated. PLACE1008092 (identical to GenBank Accession No. AF107253) was used as DNA. A DNA array of PLACE1008092 was prepared by the method described above. As a probe, mRNA of PLACE1008092 was synthesized in vitro, and this RNA was used as type III to synthesize and use a 1st strand cDNA labeled with a radioisotope in the same manner as in the probe preparation method described above. To synthesize PLACE100 8092 mRNA in vitro, use the pBluescript SK (-) A recombinant plasmid was constructed such that the 5 'end of PLACE1008092 was joined to the side. That is, PLACE1008092 integrated into the restriction site of Dralll of PME18SFL3 was cut with the restriction enzyme Xhol to cut out PLACE1008092. Next, pBluescript SK (-) cut with Xhol and PLACE 1008092 cut out were ligated using DNA ligation kit ver.2 (Takarasha). In vitro synthesis of PLAC E1008092 mRNA recombined with pBluescript SK (-) was performed using an Ampliscribe ( ^TM ) T7 high yield transcription kit (Epicentre technologies). Analysis of the signal values of the hybridization and each DNA spot was performed in the same manner as described above. Probe concentration is less than lxl0 ⁷ / g / mL, since the signal increases in proportion to the probe concentration is no comparison of signal in this concentration range is considered difficult, the signal intensity 40 following Supodzu metropolitan uniformly A low level signal was used. Lxl0 ⁷ there is an increase in probe concentration dependent signal value in the range of to 0.1 zg / mL, the expression level ratio per sample as the detection sensitivity is 1: Detection sensitivity of 100, 000 of the mRNA. As a result of this analysis, expression of PLA CE1003238 was low in all of these tissues.

 [Example 4] Analysis of nerve cell differentiation-related genes

 Genes related to the differentiation of nerve cells are useful genes for treating neurological diseases. Genes whose expression is changed by inducing differentiation of cells of the nervous system are considered to be related to neurological diseases.

 We searched for genes whose expression was altered by inducing differentiation (stimulation of retinoic acid (RA)) of cultured cells of the nervous system NT2.

The handling of NT2 cells basically followed the attached INSTRACTI0N MANUAL. Undifferentiated NT2 cells are OPT I-MEM I (GIBC0 BRL, Catalog No. 31985), 10¾ (v / v) fetal bovine serum (GIBC0 BRL), l% (v / v) penicillin-streptomycin (NTB cells) subcultured in a medium (GIBCO BRL). NT2 cells cultured in the presence of retinoic acid refer to undifferentiated NT2 cells as D-MEM (GIBC0 BRL, Catalog No. 11965), so-called v / v) fetal bovine serum, 1% (ν / ν) peni ci 11 in-streptomyc in _s IOJUK Retinoic The cells were transferred to a retinoic acid-supplemented medium containing acid (GIBC0 BRL) and passaged for 5 weeks. NT2 cells cultured in the presence of HA and further cultured with an inhibitor are retinoic acid-added NT2 cells that have passed 05 weeks, a medium containing a cell division inhibitor D-MEM (GIBC0 BRL Catalog ¾ο.11965), 10¾ (v / v) fetal bovine serun l¾ (v / v) penicilli n-streptomyciiu 10 M Retinoic acids 10〃M FudR (5-Fluoro-2, -deoxyuridin e: GIBCO BRL ), 10 / M Urd (Uridine: GIBCO BRL), 1 、 MaraC (Cytosine 5-D-Arabinofuranoside: GIBCO BRL) Two weeks after transfer to cells. After the cells were collected by trypsin treatment, total MA was extracted using a SNAP ^(TM ) to total RNA isolation kit (Invitrogen). Probe labeling for hybridization was performed in the same manner as described above using 10 zg of the total RNA.

 Data were acquired at n = 3, and the signals of cells with and without differentiation induction stimulus were compared. For comparison, statistical processing of a two-sample t-test was performed, and clones having a significant difference in the distribution of signal values were selected at p and 0.05. This analysis can detect differences statistically even in clones with low signal values. Therefore, a clone with a signal value of 40 or less was also evaluated.

 The expression of each cDNA was measured in undifferentiated NT2 cells, NT2 cells cultured in the presence of RA, or NT2 cells cultured in the presence of RA and further cultured with an inhibitor.

The average (M ₁₃ M ₂ ) and the sample variance ( _Sl ² , s ₂ ² ) of the signal value were determined for each gene of the cell, and the composite sample variance s ² was determined from the sample variance of the two cells to be compared. _{t = (Mj - M 2)} / s / (l / 3 + l / 3) was determined ^1/2. Compared to the t-values of 0.05 and 0.01, which are the probability P of the significance level in the t-distribution table with 4 degrees of freedom, when the value is large, the difference in gene expression between both cells is P-0.05 or P-0.01, respectively. It was determined that there was. PLACE1003238 increased expression with RA / inhibitor. This clone is a clone relating to a neurological disease.

 [Example 5] Analysis of UV damage-related genes

Ultraviolet rays are known to have considerable effects on health. In recent years the ozon layer The increased exposure to UV damage associated with destruction has been recognized as a risk factor for skin cancer (United States Environmental Protection Age ncy: Ozone Depletion Home Page, http://www.epa.gov / ozone /) ₀ Genes whose expression changes when ultraviolet light acts on skin epidermal cells are considered to be related to skin ultraviolet damage.

Cultures of primary cultured skin-derived fibroblasts irradiated with ultraviolet light were searched for genes whose expression was altered. Primary cultured skin-derived fibroblasts (manufactured by Cell Applications) were confluently cultured in a culture dish and irradiated with 254 nm ultraviolet light at 10,000 10, J / cm ² .

Extraction of mRNA from cells was performed using FastTrack ™ 2.0 mRNA isolation kit (Invitrogen) for unirradiated cells and cells cultured for 4 or 24 hours after irradiation. Hybridization probe labeling was performed in the same manner as described above using 1.5 g of this mRNA. Data were obtained at n = 3, and the signal values of cells with and without UV stimulation were compared. For comparison, statistical processing of a two-sample t-test was performed, and clones having a significant difference in signal value distribution were selected at p <0.05. This analysis can detect differences statistically even in clones with low signal values. Therefore, clones with signal values of 40 or less were also evaluated.

 The expression of each cDNA in skin-derived fibroblasts not irradiated with ultraviolet light and in skin-derived fibroblasts irradiated with ultraviolet light was measured.

The mean (MM ₂ ) and the sample variance ( _Sl ² , s ₂ ² ) of the signal values for each gene in each cell were determined, and the composite sample variance s ² was determined from the sample variances of the two cells to be compared. t = (,-M ₂ ) / s / (l / 3 + l / 3) ^1/2 was determined. Compared to the t-values of 0.05 and 0.01, which are the probability P of the significance level in the t-distribution table with 4 degrees of freedom, when the value is large, the difference in gene expression between both cells is P-0.05 or P-0.01, respectively. It was determined that there was. As a result of this analysis, the expression of PLACE10 03238 was reduced by ultraviolet irradiation after 4 hours or 24 hours.

[Example 6] Signal sequence, transmembrane region and function for deduced amino acid sequence Search Domain

 For the deduced amino acid sequence of PLACE1003238, the presence or absence of an amino-terminal signal sequence and the presence or absence of a transmembrane region were predicted, and protein functional domains (motifs) were searched. PSORT [K. Nakai & M. Kanehisa, Genomics, 14: 897-911 (1992)] for the amino-terminal signal sequence, and SOSUI [T. Hiroka a et. Al. Bioinformatics, 14: 378-379 (1998)] (sold by Mitsui Information & Development Co., Ltd.). Pfam (http: //www.sanger.accu/Software/Pfam/index, shtml) was used to search for functional domains. By PSORT and SOSUI, the amino acid sequence whose amino-terminal signal sequence and transmembrane region were predicted was predicted to be secreted and membrane proteins. In the search of functional domains by Pfam, the amino acid sequence hit in a certain functional domain is based on the hit data, for example, PROSITE (http: 〃www.expasy.ch / cgi-bin / prosite-list.pl). The function of the protein can be predicted by referring to one of the functional categories in ()). It is also possible to search for functional domains in PR0SITE.

 In PLACE1003238, a transmembrane region was detected in the deduced amino acid sequence by SOSUI. In addition, Pfajii detected seven transmembrane receptor attitudes in the deduced amino acid sequence of PLACE1003238.

 [Example 7] Classification of functional categories by full-length sequence

 PLACE1003238 is encoded in the clone based on the results of a homology search performed on the GenBank, Swiss-Prot, and UniGene databases, and the results of a domain search for the amino acid sequence deduced from the full-length nucleotide sequence. Protein function prediction and category classification were performed. PLACE1003238 was classified as a secretory 'membrane protein and a glycoprotein-related protein.

 [Example 8]

The nucleotide sequence of the cDNA clone of the present invention (C-PLACE1003238) shown in the above Examples was determined by the Sanger method, and confirmed again. Test method

 (1) Reagent

 Reagent kit for plasmid extraction: QIAprep® Spin Miniprep Kit (QIAGEN) Reagent kit for nucleotide sequence analysis: ABI PRISM® BigDye Terminator Cycle Sequence Kit (PE Biosysterns)

 Oligonucleotide primer for nucleotide sequence analysis: CP-38 from CP38-1 to CP38-6

Primer for ACE1003238. T7 and M13 Reverse are oligonucleotide primers for analyzing common nucleotide sequences on a vector. The salt sequence of each primer is shown below.

CP38-1: GTGTTTCCTGACACGCATCT / SEQ ID NO: 1 1

 CP38-2: CTCTGCAGATACACTTCAGT / SEQ ID NO: 1 2

 CP38-3: CATMGTCAGTCAAGCCGAA / SEQ ID NO: 13

 CP38-4: TCTGCACMGTGATATGGTA / SEQ ID NO: 14

 CP38-5: CAAATGGCTTGACCACCTTC / SEQ ID NO: 15

 CP38-6: AGGGTGGTGTTCTTTCCTGG / SEQ ID NO: 16

 T7: TAATACGACTCACTATAGGG / SEQ ID NO: 17

 M13 Reverse: CAGGAAACAGCTATGAC / SEQ ID NO: 18

(2) Transformation of E. coli with recombinant plasmid

 1) The C-PLACE1003238 clone was cloned by the method described in Example 1. This recombinant plasmid was introduced into E. coli DH5 strain by the method described below.

 2) Dispense 20 µL of DH5 strain competent cells (Competent high E. coli DH5 strain: Toyobo) into a 1.5 mL eppendorf tube, and add a very small amount (about OA jL) of the plasmid solution. And placed on ice for about 30 minutes.

3) The tube was immersed in a water bath and heated at 42 ° C for 45 seconds. 4) The tube was placed on ice for about 2 minutes.

 5) 20 L and 200 L of the E. coli solution were dropped on agar plates containing ampicillin (final concentration: 100 g / mL), respectively, and spread with a conical rod. This agar medium plate was cultured overnight at 37 ° C. to obtain an ambicilin-resistant transformant.

 (3) Plasmid extraction

 1) An isolated colony on an agar medium plate was collected from the transformant, inoculated on a Terrific Broth medium, and cultured at 37 ° C overnight.

 2) The culture was transferred to a 2 mL eppendorf tube and centrifuged to collect the cells. The pellet was resuspended by adding 250 / L P1 buffer (attached to the kit: containing RNase A).

 3) Add P2 buffer solution (attached to the kit) to lyse the cells.

N3 buffer (attached to the kit) was added for neutralization.

 4) After centrifuging the tube at 12,000 rpm for 10 minutes, the supernatant was put on a spin column (attached to the kit) and centrifuged at 12,000 rpm for 1 minute.

 5) After washing the column with 750 / L of PE buffer (containing ethanol: attached to the kit), add plasmid MA to 100 / L of TE buffer (10 ol / L Tris-HCl, 1 tmol / L). L EDTA, pH 8.0).

 6) A portion of the plasmid DNA solution was diluted 20-fold with TE buffer (30 L / 570 / L), and the absorbance at 260 brains was measured to calculate the DNA concentration.

 (4) Analysis of nucleotide sequence

 1) Approximately 500 n of plasmid DNA is mixed with 8 µL of Bremix (attached to the kit), 3.2 pmol of a base sequence determination primer, and purified water in a Polymerase-Chain Reaction (PCR) tube, and the total amount is mixed. 20 L and PCR was performed. The PCR conditions were as follows: 96 ° C for 3 minutes → 96 ° C for 10 seconds, 50 ° C for 5 seconds, 60 ° C for 4 minutes, 25 cycles of cooling to 4 ° C.

2) Overlay the PCR product on a 96-well column set in a 0.2 mL PCR tube, and add 2,000 After spinning for 5 minutes to remove unreacted dNTPs, they were dried under negative pressure. The 96-well ram uses a 96-well fill plate (multi-screen-HV plate: Millipore) with a fixed amount of column particles (Sephadex G-50 Medium: Amersham / Pharmacia / Neotech) and a column loader (multi-screen 45〃L). A column loader was collected by fractionation using a millipore), packed with purified water (300 / L), swollen for about 2 hours, and then centrifuged at 2,000 rpm for 5 minutes.

 3) After adding 20 µL of Template suppression reagent (PE Biosystems) to each PCR tube to dissolve the dried PCR product, the mixture was heated at 96 ° C for about 2 minutes and rapidly cooled on ice.

 4) After setting each tube on the base sequence analyzer, the base sequence was analyzed. The operation method of this device followed the usage manual prepared by the manufacturing company.

 As a result of the nucleotide sequence analysis, the nucleotide sequence of C-PLACE1003238 was consistent with the result of the above-mentioned Example.

 This sequence has 1077 bases of 0RF (from 362 to 1435 of SEQ ID NO: 1). The amino acid sequence deduced from 0RF (358 amino acids, SEQ ID NO: 2) had a hydrophobic region thought to be seven transmembrane domains characteristic of a G protein-coupled receptor. See FIGS. 1-3. This suggested that this gene encodes a G protein-coupled receptor.

 [Example 9]

The amino acid sequence deduced from the nucleotide sequence of C-PLACE1003238 was searched against GenBank using BLAST2.05 (Nucleic Acids Res., 25, p3389-3402, 1997). The results are shown in Figs. Table 1 shows the results with typical known G protein-coupled receptors. table 1

Since the amino acid sequence deduced from C-PLACE1003238 is not very high in homology to known G protein-coupled receptors, the protein encoded by this gene is a novel G protein-coupled receptor. Was suggested.

 [Example 10]

 The expression site of C-PLACE1003238, a novel G protein-coupled receptor gene of the present invention, in normal human tissues was examined.

 Test method

 (1) Reagent

 Polymerase chain reaction (PCR) primer for C-PLACE1003238 expression analysis: A sense primer and an antisense primer were designed and manufactured using gene analysis software Vector NTI ver.5.2 (Informax). The nucleotide sequences of the primers are shown below. This primer produces a 113 base pair PCR product. MA: AGTCACCTATGTGMCAGCT / SEQ ID NO: 19

Primer: ACTGACTTATGAATTGCCTG / SEQ ID NO: 20 Human RAPID-SCAN ™ GENE EXPRESSION PANEL: cDNA prepared from 24 types of human tissue niRNA at a 4-step concentration in a 96-well plate (OriGene Technologies Inc. ) Was used. DNA polymerase uses TaKaRa LA Taq ™ (Takara Shuzo) did

 (2) PCR reaction

 1) The RAPID-SCA plate was moved from 4 ° C to room temperature and left still.

 2) A reaction solution having the following composition was prepared in a 15 mL Falcon tube, and kept in ice.

10 LA Taq PCR buffer * 300 zL

25mM MgCl ₂ 300 iL

 dNTP (2 mM each) * 300> L

 Sensev. Lima (10 pmol / / L) 120 ^

 Antisense. Lima (10 pmol / / L) 120 JLLL

 Purified water 1848 / L

3000 zL

 * Using the reagent attached to the enzyme <

3) The prepared reaction solution was dispensed per 1-well of the RAPID-SCAN plate, and a few drops of mineral oil were overlaid.

 4) The plate was covered with a plastic cover sheet and left on ice for 15 minutes.

5) The plate was set on a thermal cycler (PCR Thermal Cycler MP: Takara Shuzo) and reacted with the following operation program. That is, one cycle of 95 ° C for 2 minutes → 35 cycles of 95 ° C for 30 seconds, 55 ° C for 30 seconds, 35 cycles of 72 ° C for 1 minute, and one cycle of 72 ° C for 5 minutes. (3) Agarose gel electrophoresis

 1) 6 L of the PCR product was mixed with 1 L of 6x electrophoresis dye solution, and applied to a 3% agarose gel (Nusieve 3: 1 agarose, FMC BioProducts) set in an electrophoresis apparatus Mupid (Cosmo Bio).

 2) Electrophoresed at a constant voltage of 100 V for 40 minutes. The electrophoresis buffer used was a tris-borate buffer.

 3) Electrophoresis images of PCR products were taken under UV irradiation.

Using 1 ng of the cDNA for type III, the PCR product was subjected to electrophoresis, and the expression distribution of C-PLACE100 3238 of the present invention in normal human tissues was confirmed. As a result, the expression of the gene corresponding to C-PLACE1003238 clone was in the following order (Table 2). Table 2

 E Example 11]

 In order to estimate the involvement of the novel human cDNA clone C-PLACE1003238 in the pathological condition, the expression level in human cancer tissues and Alzheimer's disease brain tissues was compared with that in normal tissues.

 Test method

 (1) Reagent

Primer for Polymerase chain reaction (PCR): For expression analysis of C-PLACE1003238 Both the sense primer and the antisense primer used in the previous example were designed. In addition, human glyceraldehyde 3-phosphate dehydrogenase (G3PDH) was used as an endogenous control. The primer sequences used for the expression analysis are shown below. Sense primer: ACCACAGTCCATGCCATCAC / SEQ ID NO: 21 Antisense primer: TCCACCACCCTGTTGCTGTAZ SEQ ID NO: 22 This primer set generates a 452 base pair PCR product.

 CDNA from patient tissues: For cDNAs from prostate, colon, stomach, ligament, testis, and brain tumor, cDNAs from the corresponding tissues from normal humans and cancer patients were purchased from BioChains Institute and used. Regarding cDNA derived from Alzheimer's disease patients, cDNAs derived from the frontal lobe and hippocampus of Alzheimer's disease patients and normal adults were purchased from BioChain Institute and used.

 The DNA polymerase used was TaKaRa LA Taq ™ (Takara Shuzo).

 (2) PCR reaction

 1) A reaction mixture of the following composition was prepared in a 1.5 mL eppendorf tube and kept on ice.

10 XLA Taq PCR buffer * 50 〃L

25mM MgCl ₂ 50 / L

 dNTP (2 mM each) * 50 // L

 Sensev. Lima-(10 pmol / ^ L) 20 iL

Antisense. Lymer (10 pmol / AiL) 20 μ. Purified water 288〃L

Total volume 480 / L

 * The reagent attached to the enzyme was used.

2) After dispensing 24〃L into 200L of 8-tube tubes for PCR, add each of DNA-type DNA; add l 各 々 L, close the cap, set in a thermal cycler (PCR Thermal Cycler MP: Takara Shuzo), The reaction was performed by the following operation program. That is, 95 ° C for 2 minutes, 1 cycle 95 ° C for 15 seconds, 55 ° C for 30 seconds, 72 ° C for 1 minute, 25 cycles (G3PDH) or 40 cycles (C-PLACE1003238) → 72 ° C, 5 minutes for 1 cycle .

 (3) Agarose gel electrophoresis

 1) 1% or 3% agarose gel (Nusieve 3: 1 agarose, FMC BioProducts) prepared by mixing 6 μL of PCR product with 1 μL of 6 × electrophoresis dye solution and setting in a electrophoresis apparatus Mupid (Cosmo Bio) (G3PDH and C-PLACE1003238, respectively).

 2) Electrophoresis was performed at a constant voltage of 100 V for 40 minutes.

 3) Electrophoresis images of PCR products were taken under UV irradiation. The concentration of each sample was made uniform using the amount of cDNA of G3PDH as an internal standard as an index. After PCR amplification of G3PDH and electrophoresis, the amount of DNA was determined by visual inspection, and the concentration difference was reduced by diluting the higher concentration. By repeating this, the amount of G3PDH cDNA was adjusted to a level where there was almost no difference in electrophoresis.

Next, in order to examine the change in expression of the C-PLACE1003238 gene in the pathological condition, a PCR reaction of C-PLACE1003238 was performed using the standardized type III cDNA described above. Table 3 shows the results. Table 3

Comparison of the expression of C-PLACE1003238 in tumor tissue with that in normal subjects showed that the expression was almost nonexistent in colon and knee in normal subjects, but was strongly expressed in colon and Teng cancer. Do you get it. Similarly, when the expression level of the C-PLACE1003238 gene in the brain (frontal lobe and hippocampus) of Alzheimer's disease patients was compared with that in normal adults, the expression was found in the frontal lobe and hippocampus in normal subjects, but in the Alzheimer's disease patients It was found that expression decreased in the frontal lobe and increased in the hippocampus.

 It has been suggested that the C-PLACE1003238 of the present invention may be applicable to the diagnosis of cancer (colon cancer, Tengler cancer, testis cancer), the diagnosis of Alzheimer's disease, and the screening of preventive and therapeutic drugs. .

 [Example 12]

 A vector carrying the cDNA of the present invention was constructed. From the base several nucleotides upstream of the translation initiation codon ATG of C-PLACE1003238 to the downstream containing the stop codon was amplified by PCR and subcloned into the expression vector pCEP4. Industrial applicability

According to the present invention, a novel G protein-coupled receptor (C-PLACE1003238), a gene encoding the protein, a vector containing the gene, a host cell containing the vector And a method for producing the protein. Furthermore, a method for screening a compound that modifies the activity of the protein was provided. That is, the gene or a protein that is a translation product thereof can be used for screening for ligands or for screening agonists or angelic gonists useful as pharmaceuticals. The protein of the present invention, its gene, or a compound that modulates the activity of the protein is expected to be used for the development of a new preventive or therapeutic agent for a disease associated with the G protein-coupled receptor protein of the present invention.

Claims

The scope of the claims

1. The DNA according to any one of the following (a) to (d), which encodes a guanosine triphosphate binding protein-coupled receptor.

 (a) DNA encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2.

 (b) DNA containing the coding region of the nucleotide sequence of SEQ ID NO: 1.

 (c) a DNA encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2 in which one or more amino acids have been substituted, deleted, added and / or inserted.

 (d) DNA that hybridizes under stringent conditions to DNA consisting of the nucleotide sequence of SEQ ID NO: 1.

 2. A DNA encoding a partial peptide of a protein consisting of the amino acid sequence of SEQ ID NO: 2.

 3. A vector containing the MA according to claim 1 or 2.

 4. A transformant carrying the DNA according to claim 1 or 2 or the vector according to claim 3.

 5. A protein or peptide encoded by the DNA of claim 1 or 2.

6. The method for producing a protein or peptide according to claim 5, comprising a step of expressing a protein or peptide using the transformant according to claim 4, and a step of recovering the expressed protein or peptide. .

 7. A method for screening a ligand that binds to the protein according to claim 5,

 (a) contacting a test sample with the protein or peptide according to claim 5,

(b) selecting a compound that binds to the protein or peptide.

8. A method for screening a compound having an activity of inhibiting the binding of the protein according to claim 5 to a ligand thereof, (a) a step of contacting a ligand with the protein or the partial peptide thereof according to claim 5 in the presence of a test sample, and detecting a binding activity between the protein or the partial peptide and a ligand;

 (b) selecting a compound that reduces the binding activity detected in step (a) as compared to the binding activity in the absence of the test sample.

 9. A method for screening a compound that inhibits or promotes the activity of the protein according to claim 5, wherein

 (a) contacting a ligand of the protein with a cell that expresses the protein in the presence of a test sample;

 (b) detecting a change in a cell due to binding of the ligand to the protein,

(c) selecting a compound that suppresses or enhances the change in the cell detected in step (b) as compared to the change in the cell in the absence of the test sample.

10. An antibody that binds to the protein of claim 5.

 11 1 A compound isolated by screening according to any one of claims 7 to 9

 12. A pharmaceutical composition comprising the compound according to claim 11 as an active ingredient.

 13 Nucleotide having a chain length of at least 15 nucleotides, which is complementary to DNA consisting of the nucleotide sequence of SEQ ID NO: 1 or a complementary strand thereof.