Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
  • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
  • C12N9/503—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from viruses
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
  • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
  • C12N9/503—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from viruses
  • C12N9/506—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from viruses derived from RNA viruses
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
  • C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase

Definitions

• This invention relates to a prokaryotic cell system and cell based assays for: identification of protease inhibitors and protease modulators; ii) determination of the amino acid sequence of a cleavage site for a known protease; iii) identification and cloning of a protease whose cleavage site is known; and iv) rapid identification of a form of a protease that exhibits increased protease activity relative to a control protease.
• Proteases are enzymes that cleave peptide bonds, and hence by definition, alter proteins. These enzymes are broadly classified into four groups: a) serine proteases, b) cysteine proteases, c) aspartate proteases and d) metalloproteases (Nduwimana et al., Ann. Biol. Clin. 53::251-264 (1995). This classification is primarily based on the mechanism of action. Many of these proteases which cleave peptide bonds at specific sites have been implicated in a variety of human diseases (Melnick, J. L., in Virology 1985,, B. N. Fields, Ed. Raven Press, New York, pp.
• proteases have also been shown to play a very important role in the physiology of several pathogenic microorganisms and the maturation of viruses (Toyoda et al., Cell (1986) 45:761., Hanecak et al., Cell (1984) 37:1063; Kohl, N. E., et. al., Proc. Nat. Acad. Sci. (USA) (1988) 85:4686-4690) ) Hence, proteases are also implicated in the establishment of infectious diseases. In all of these cases, it is believed that a specific inhibitor or a modulator of a specific protease may serve as a therapeutic agent that can be used to either prevent a disease or help control and mitigate the adverse effects of a disease.
• heterologous gene expression systems utilizing the bacteria Escherichia coli (E. col ⁇ ), or the yeast Picchia pastoris or the insect virus Bacculovirus have been widely used.
• E. col ⁇ the bacteria Escherichia coli
• yeast Picchia pastoris the insect virus Bacculovirus
• the heterologous protein is found to be sequestered in insoluble aggregates called inclusion bodies or is found in some other precipitated or aggregated inactive form.
• a slight change in the amino acid sequence of the protein results in the production of a soluble and hence active protein. The change is subtle enough so that the integral structure or the activity of the protein remains unaffected.
• identification of these subtle solubilizing changes is often very cumbersome and labor intensive.
• a rapid method has long been sought to screen a library of mutant proteases and identify the ones that are expressed in a more soluble and hence active form.
• the present invention relates to a prokaryotic cell system for monitoring protease activity that can be used to i) identify protease inhibitors and protease modulators, ii) determine the sequence of a protease cleavage site for a known protease, iii) identify and clone the gene for a protease whose cleavage site is known, and iv) rapidly identify a form of a protease that exhibits protease activity when the wild type protease exhibited little or no activity in a prokaryotic system.
• One aspect of the invention is a prokaryotic cell system for monitoring protease activity
• a prokaryotic cell comprising: a) a gene coding for a protease ; b) a modified DNA-binding repressor gene wherein said modification is one or more cognate cleavage sites of the protease engineered into one or more exposed and permissive loops of the repressor polypeptide encoded by said repressor gene; and c) a reporter cartridge wherein the expression of the reporter gene in said reporter cartridge is regulated by a promoter whose transcription can be negatively regulated by the wild type or the modified DNA-binding repressor protein.
• the activity of a protease can be determined by monitoring the level of expression of the reporter gene; i.e., the reporter gene activity.
• the modified or the wild-type repressor negatively regulates the expression of the reporter gene. If the protease is expressed in the same cell and is active, it cleaves the modified repressor at its cognate cleavage site, which has been engineered into the repressor. The cleaved repressor is not able to bind to its cognate DNA sequence and hence does not regulate the expression of the reporter gene.
• the activity of the protease we can monitor the activity of the protease.
• Another aspect of the invention is an assay for identifying protease inhibitors and protease modulators.
• This can be achieved by using the above mentioned prokaryotic cell system capable of expressing a protease, a modified DNA-binding repressor containing the cognate cleavage site, and the appropriate reporter cartridge.
• the cell can be grown in the presence of a potential inhibitor or potential modulator.
• transcription of the reporter gene can be quantified.
• the level of expression can be used to correlate to the efficacy of the potential protease inhibitor or potential protease modulator.
• Another aspect of the invention is an assay to determine a cleavage site of a known protease whose cleavage site is not known.
• a random library of modified repressors can be constructed. The modification is achieved by engineering a random DNA sequence in the region coding for a permissive and exposed loop of the repressor. The DNA sequence could code for extra amino acids in the exposed and permissive loop. During the design of the library, care should be taken to maintain the reading frame of the repressor polypeptide.
• the library of plasmids coding for the modified repressors is constructed, it is transformed into an appropriate host strain, which has the reporter cartridge, as well as a plasmid that expresses the specific protease.
• Cells that have the plasmid coding for the modified repressor with the appropriate cleavage site engineered will have a higher level of expression of the reporter gene. These cells can be identified and isolated. The plasmids from those cells can be isolated, sequenced and the cleavage site determined.
• Another aspect of the invention is an assay to identify and clone the gene coding for a protease site whose cleavage site is known.
• a genomic DNA or cDNA library can be constructed using the organism from which the gene coding for the protease has to be identified.
• the library is transformed into an appropriate host strain, which has the reporter cartridge, as well as a plasmid that codes for a modified repressor which has the cleavage site engineered into an exposed and permissive loop.
• cells that have the plasmid which codes for the cognate protease activity will have a higher level of expression of the reporter gene.
• the plasmid from these cells can be isolated and characterized to reveal the gene that codes for a protease.
• Another aspect of the invention is an assay to rapidly identify a form of a protease, such as a mutant or a naturally-occurring protease variant, that exhibits increased protease activity relative to a control protease.
• a mutant protease may be useful when the wild type has been found to exhibit little or no activity in a prokaryotic system. This can be achieved, for instance, in the following way.
• a randomly mutagenised library of the protease can be generated. The library is transformed into an appropriate host strain, which has the reporter cartridge as well as a plasmid that codes for a modified repressor which has the cleavage site engineered into an exposed and permissive loop.
• Another aspect of the invention is a method of inhibiting or modulating a protease by contacting said protease with a protease inhibitor or protease modulator first identified to be a protease inhibitor or protease modulator by a method of the invention.
• Another aspect of the invention is a method of cleaving a peptide bond comprising contacting said peptide bond with an effective amount of a protease encoded by the nucleotide sequence first identified to encode a protease by a method of the invention.
• Another aspect of the invention is a method of cleaving a peptide bond comprising contacting said peptide bond with an effective amount of a protease first identified to exhibit increased protease activity relative to a control protease by a method of the invention.
• Figure 1 is a schematic representation of the screening organism used in Example 1.
• Figure 2 is a schematic representation of the modification of the tetracycline repressor coding region. It illustrates the insertion of the hCMV protease cleavage site in between helix 4 and helix 5. It also illustrates the insertion of the hCMV protease cleavage site in between helix 8 and 9 of the tetracycline repressor.
• the hCMV protease cleavage sequence is boxed. The additional amino acids have been inserted to accommodate the engineering of the Notl and Ascl restriction enzyme sites.
• Figure 3 is a schematic representation of the reporter cartridge used in the examples described. It illustrates the relative position of the tetracycline repressor binding site (Tet-RE) in comparison with the cannonical -35, -10 and the +1 regions of a typical E. coli promoter. It also shows the relative positioning of the bacterial ribosomal binding site (rbs) and the reporter gene. Relative positions of convenient and useful restriction enzyme sites are also shown.
• Tet-RE tetracycline repressor binding site
• rbs bacterial ribosomal binding site
• Figure 4 shows an electronically scanned image of plates used to demonstrate the proof of principle of the assay.
• the dark (orange) area represents growth.
• the light (yellow) area represents area of no growth.
• E. coli cells containing both the reporter and the test expression plasmids were seeded in LB agar containing the appropriate antibiotics.
• IsoPropyl Thio-galactopyranoside (IPTG) was either included or not included in the medium.
• IPTG IsoPropyl Thio-galactopyranoside
• Six microliters of either chloramphenicol (Cm) (60 ug/ml) or rifampicin (Rif) (30 ug/ml) was added to the plates as indicated. The plates were incubated and then the effect of chloramphenicol on the growth was observed.
• Rifampicin was included as a control.
• FIG. 5 is a schematic representation of the expression plasmid used in the examples. The detailed construction of the plasmid is as described in the text below. The relative positions of the origin of replication (ori), The T7 promoter (T7), the hCMV protease gene (CMV protease), the b-lactamase gene (ampR), the tetracycline repressor (Tet-R*) and the gene coding for the lac operon repressor (lad) gene is as shown.
• Figure 6 is the DNA sequence of the forward and the reverse oligo used to generate the random library of cleavage sites. The relative positions of the relevant restriction enzyme sites are as shown.
• a adenine
• c cytosine
• t thymidine
• g guanine
• b either g, t or c
• v either g, a or c
• n any of the four nucleo tides.
• Figure 7 is a table showing the effect of chloramphenicol on the growth of the E. coli test strain in the presence and absence of IPTG. The numbers represent the zone of growth inhibition as measured in mm.
• Figure 8 is a diagram of the bacterial selection scheme for obtaining soluble HCV protease mutants. See Example 4 for a detailed description of the system. (Center) expression plasmid (expressing HCV NS4a-NS3 fusion protease and modified Tet repressor) and chromosomally encoded Tet promoter-CAT
• FIG. 9 is SDS-PAGE analysis of expression of various HCV NS4a-NS3 fusion protein constructs. Plasmid containing cells were grown to OD 600 -0.7 and 10 ml cultures were induced with 0.25 mM IPTG for 20 hours at 20 degrees C.
• Cells were harvested by centrifugation (1500 rfc) in a tabletop microfuge and cell pellets were resuspended in 1ml of 25mM Na-phosphate buffer,pH 7.5; 0.5M NaCl, 2mM DTT, 10:M ZnCl, 1 OmM MgCl, 10:g/ml DNAse and sonicated twice for 1 min at power 5 in pulse mode. The homogenates were spun down in tabletop microfuge at
• prokaryotic host cell includes, but is not limited to, such genera and species as:
• Rhizobium and the like.
• protease refers to a polypeptide that can cleave an amide linkage in a polypeptide.
• the gene coding for a protease refers to a DNA sequence that codes for the entire protease polypeptide or a segment of the protease that can cleave an amide linkage in a polypeptide chain.
• repressor refers to a polypeptide or a segment of the polypeptide that can bind to a specific DNA sequence.
• the binding of the repressor protein to its cognate DNA sequence represses the transcription from a specific promoter. This promoter is deemed to be negatively regulated by the repressor protein.
• modification of the repressor refers to engineering the DNA sequence coding for the repressor in such a manner that it includes additional amino acid residues that could code for a specific protease cleavage site.
• exposed and permissive region of the repressor means the following.
• Permissive refers to engineering of the above mentioned additional amino acids in the repressor coding region in such a manner that just the insertion of the extra amino acids does not prevent the binding of the repressor to its cognate DNA sequence. Exposed refers to the fact that the insertion has to be in a region that is accessible to be cleaved by the protease and that the DNA binding property is destroyed upon cleavage.
• reporter gene refers to a DNA sequence that codes for a protein or a segment of a protein whose activity can be monitored easily. These include, but are not limited to, reporter genes viz. chloramphenicol acetyl transferase, b-galactosidase, alkaline phosphatase, green fluorescent protein, other genes that confer antibiotic resistance or toxic genes that can act as suicide genes.
• reporter cartridge refers to a unit consisting of: a promoter whose transcription activity is negatively regulated by the repressor protein; a reporter gene; and the required transcription and translational signals.
• the reporter cartridge can be maintained inside a cell as part of a plasmid or bacteriophage or independently replicating episome, or can be part of the host cell chromosome.
• To transfer the reporter cartridge onto the host cell chromosome one of several alternative procedures can be used: i) the use of a plasmid containing a temperature sensitive origin of replication can be utilized; ii) homologous recombination at the attP site of the E. coli chromosome; or iii) transformation using linear DNA can also be utilized.
• the source of the protease and the repressor gene can be a previously identified and cloned copy or can be obtained using genomic or cDNA libraries.
• the protease gene and/or the modified repressor gene can be maintained in the host cell either as part of a plasmid or bacteriophage or autonomously replicating episome, or can be part of the host cell chromosome.
• the transcription of the protease gene can be regulated by an inducible promoter viz. the isopropyl thio-galacto pyranoside (IPTG) regulated lac promoter, or the thermally regulated phage promoter or any other regulated promoter. It is preferred, however not necessary, that the transcription of the repressor gene is constitutively active.
• the DNA sequence coding for the protease cleavage site can be either obtained using chemical synthesis or PCR or can be cloned out of a protease substrate using standard recombinant DNA methods.
• the DNA sequence coding for the protease cleavage site can be engineered into the coding frame of the DNA sequence of the repressor using restriction enzyme digestion followed by ligation. If required, appropriate restriction enzyme sites can be engineered in the DNA sequence of the repressor as well as flanking the DNA sequence coding for the protease cleavage site using site directed mutagenesis or similar procedures.
• DNA sequence coding for amino acids that may help the cleavage site become more accessible to the protease can also be added on either side of the DNA sequence coding for the protease cleavage site. It is important that the DNA sequence coding for the protease cleavage site be engineered in a region of the repressor molecule that does not destroy its DNA binding activity to its cognate DNA sequence yet is accessible to the protease.
• the transcription activity of the promoter in the reporter cartridge may be measured using standard procedures.
• biologically active proteins such as gene products conferring antibiotic resistance can be measured as a growth/no growth phenotype in the presence of the appropriate concentration of the antibiotic.
• Biologically active enzymes such as b-galactosidase or an anabolic enzyme can also be monitored under appropriate conditions.
• Enzyme activity such as alkaline phosphatase activity can be monitored by incorporating the appropriate substrate in the growth medium.
• cloning and expression vectors used in this invention can contain one or more marker activities that can be used to select for desired transformants, such as antibiotic resistance. It is also understood that sequence(s) of DNA may be inserted in a cloning vehicle or a specific gene to assist in the transcription and translation of the desired gene and/or maintain the appropriate reading frame.
• Conditions for inhibiting or modulating a protease by contacting the protease with an effective amount of a protease inhibitor or protease modulator can be determined by one of skill in the art using standard techniques as found in, for example, Kezdy, F.S. and Kaiser, E.T., Methods in Enzymology, (1970) 19, 3-20.
• Conditions for monitoring cleavage of a peptide bond by contacting the peptide bond with an effective amount of a protease can be determined by one of skill in the art using standard techniques as found in, for example, Knight, C.G., Methods in Enzymology, (1995) 248 18-34.
• FIG. 1 A schematic representation of the screening organism is as shown in Figure 1.
• the repressor used in this example was the tetracycline repressor. It belongs to a class of repressor molecules that occur in some prokaryotes in nature as a homo-dimer with an alpha helix-turn alpha helix motif and binds to a palindromic DNA sequence: 5'— C-X-C-T-A-T-C-A-X-T-G-A-T-A-G-X-G-3"
• the wild type tetracycline repressor (type B) is 207 amino acids long and binds to DNA as a dimer.
• Each monomer consists of 10 alpha helical coils. The intervening region between these 10 alpha helical coils exists as partially folded beta- sheets.
• the dimer is clearly divided into the protein core and two DNA-binding domains that are formed for each monomer, by the three-helix bundles, Al, A2 and A3. Each DNA binding domain is connected to the core by the alpha helix 4.
• the core helices five to ten are responsible for the dimer formation (Braumeister R., et al.,
• cleavage site To make the cleavage site more accessible to the protease, two alanine residues were inserted in front of the sequence and a proline is inserted at the end of the sequence.
• a second cleavage site is inserted between helix #8 and helix #9.
• the above mentioned cleavage sequence is inserted between lysine (residue # 155) and proline (residue #161).
• two alanine residues were incorporated in front of the sequence to make it more accessible to the protease.
• the modified tetracycline repressor gene is maintained on a colEl plasmid and is transcribed from a constitutive promoter.
• the gene coding for the hCMV protease is maintained on the same plasmid as the tetracycline repressor gene and its transcription is regulated from an inducible T7 promoter.
• the reporter module used is the chloramphenicol acetyl transferase (CAT) gene whose transcription is regulated by a modified tetracycline repressor.
• a schematic representation of the modified tetracycline promoter is as shown in the Figure 2.
• the promoter includes a canonical -35 region of the E. coli promoter followed by a tetracycline repressor binding sequence followed by a canonical -10 region of the E. coli promoter, the +1 transcription initiation site and then followed by another tetracycline repressor binding site.
• the exact DNA sequence of the modified tetracycline promoter/operator is as shown in Figure 3.
• the chloramphenicol acetyl transferase gene was obtained as a cartridge from Pharmacia-Biotech.
• the gene coding for the wild type tetracycline repressor including its own constitutive transcriptional promoter and ribosomal binding site was obtained from the commercially available plasmid pASK75.
• the gene was cloned into the plasmid vector, pUC18, using standard molecular biology techniques. Using site specific mutagenesis, Notl restriction enzyme cleavage sites were introduced into the DNA sequence of the tetracycline repressor right after the triplet coding for the amino acid residue #69 (after helix #4) and the triplet coding for the amino acid residue #155 (after helix #8) of the repressor.
• the hCMV protease cleavage site was inserted using cassette mutagenesis. This was achieved by synthesizing two oligos, complementary to each other, comprising the DNA sequence coding for hCMV protease cleavage site and flanked by a Notl and an Ascl site.
• the DNA sequence of the two oligo's are as given below: Oligo l : 5'— CCGGCGCGGCCGCGCCGCCGGGGGTCGTCAATGCCTCCTGCAGGCTCGCG ACCCCGCCGGGCGCGCCGGGGCCC—3' Oligo2: 5'—
• the two oligo's were mixed in an equi-molar ratio, annealed, and cut with the restriction enzymes Notl and Ascl. Using standard molecular biology techniques, they were then inserted into the Notl and Ascl sites engineered into the DNA sequence coding for the tetracycline repressor. During the design of the oligo's and all of the DNA manipulations, care was taken to maintain the reading frame of the tetracycline repressor. Again, upon transcription and translation, a full-length tetracycline repressor was synthesized containing the hCMV protease cleavage site. The insertion of the hCMV protease cleavage site had no adverse effect on the ability of the modified tetracycline repressor to regulate transcription of a reporter gene from a tetracycline repressor.
• the gene coding for the hCMV protease was cloned first into a plasmid vector pET15.
• the sub-cloning was designed in such a manner that the expression of the hCMV protease gene was under the regulation of the T7 promoter.
• the entire cassette containing the T7 promoter, the ribosomal binding site and the gene coding for the hCMV protease was cloned into the above mentioned modified pUC18 plasmid vector containing the modified tetracycline repressor gene.
• FIG. 5 A schematic representation of the expression plasmid containing the hCMV protease gene and the modified tetracycline repressor containing the hCMV protease cleavage site is as shown in the Figure 5.
• control expression plasmid was also constructed.
• the control expression plasmid was identical to the plasmid described above except the hCMV protease cleavage site was not inserted into the tetracycline repressor.
• Plasmid vector pMAK705 which contains a pSClOl temperature sensitive origin of replication and a gene conferring kanamycin resistance, was modified to contain a tetracycline promoter/operator system. This was achieved by inserting the DNA sequence containing i) a canonical E. coli promoter, ii) a tetracycline repressor binding site in between the -35 and the -10 region of the canonical promoter, iii) a tetracycline repressor binding site right after the +1 transcription start site and a Hindlll restriction cleavage site. The insertion of the above module was done using cassette mutagenesis and standard molecular biology techniques. The DNA sequence of the module is as shown below: 5'—
• the CAT cartridge containing the chloramphenicol acetyl-transferase gene and its own ribosomal binding site but not containing a transcriptional promoter was obtained as a cassette from Pharmacia Biotech Company.
• the cassette has Hindlll site at either end for cloning purposes.
• the CAT cartridge was inserted into the Hindlll site of the above mentioned modified plasmid vector pMAK705.
• E. coli strain BL21(D ⁇ 3) was obtained from Novagen Inc. This particular strain whose genotype is listed below has the ability to express genes under the regulation of the T7 promoter. The strain was transformed with the reporter plasmid and kanamycin resistant cells were isolated. Cells containing the reporter plasmid were then transformed either with the test or the control expression plasmid using ampicillin and kanamycin resistance as the selection for transformed cells.
• Genotype of BL21(DE3) F-ompT[lon]hsdSB(rB-mB-) with DE3, a lambda prophage carrying the T7RNA polymerase gene.
• Example 2 The system can be used to determine the cleavage site of a protease that has already been cloned and successfully expressed in a bacterial system in an active form.
• E. coli can be used as the organism to perform the assay.
• the tetracycline repressor can be used as the DNA-binding repressor molecule and the CAT reporter cartridge described above can be used as the reporter gene.
• Example 2 As compared to that described in Example 1, instead of inserting the CMV protease cleavage site in between the amino acid proline (residue #69) and glycine (residue #72) of the tetracycline repressor, a random library of cleavage sites can be inserted.
• the expression plasmid is constructed in a similar fashion as described above in Example 1.
• the protease for which its specific cleavage site needs to be determined can be cloned into the place of the CMV protease in the above mentioned expression plasmid using the Ncol and Hindlll or any other appropriate restriction enzyme cleavage site.
• the random library of cleavage sites can be constructed using standard molecular biological techniques. Briefly, random DNA oligo's are synthesized using the design as described in Figure 6. The essential feature of the design of the random oligo's is that there is enough homology on either side of the random nucleotides to allow annealing with the formation of a "bubble" in between.
• the reverse and forward DNA oligo's need to be mixed in equi-molar concentration, annealed and cut with the restriction enzymes Pstl and Hindlll. The oligo's can then be ligated into the Pstl and Hindlll sites of an E. coli vector viz. pUC19.
• the ligation mixture can then be used to transform a mutS strain of E. coli.
• the mutS mutation does not repair the mis-match generated during the annealing of the two different oligos.
• the transformed culture should be allowed to recover for about an hour at 30°C after transformation and then should be grown on selection media using the appropriate antibiotic.
• pUC19 one can use 100 ug/ml of ampicillin in Luria Broth.
• the cells should be grown in 500 ml of liquid media until stationery phase.
• the plasmid is then isolated from the culture. A large aliquot of the plasmid can then be cut with the restriction enzymes, Notl and Ascl. The small fragment of DNA should be isolated.
• This isolated piece of DNA can then be ligated into the Notl and Ascl sites of the expression plasmid described in above.
• a random library of cleavage sites that have been inserted into an exposed and permissive loop of the tetracycline repressor has been generated.
• Example 1 the same reporter cartridge as used in Example 1 can be used for this particular assay.
• the reporter plasmid can be constructed as described in Example 1.
• E. coli strain BL21(DE3) Novagen Inc.
• a similar strain which can allow expression from a T7 promoter can be used.
• the strain needs to be transformed with the reporter plasmid.
• the transformed cells can be selected using kanamycin resistance as the selection marker.
• Cells containing the reporter plasmid can then be transformed with the library of expression plasmid generated as described above.
• Resistance to ampicillin and kanamycin can be used to select for transformed cells.
• the cells After the cells are transformed with both the plasmids, the library of expression plasmid and the reporter plasmid, the cells need to be grown for several generations (stationery phase) in 100 ml liquid Luria Broth under antibiotic selection pressure.
• Genotype of BL21(DE3) F-ompT[lon]hsdSB(rB-mB-) with DE3, a lambda prophage carrying the T7RNA polymerase gene.
• the expression plasmid from each of the chloramphenicol resistant colony should be isolated individually.
• the DNA sequence of the modified tetracycline repressor should be determined and the amino acid sequence of the cleavage site should then be deduced from the DNA sequence.
• Example 3 The systems can be used to clone a protease whose specific cleavage site is known.
• E. coli can be used as the organism to perform the assay.
• the tetracycline repressor can be used as the DNA-binding repressor molecule and the CAT reporter cartridge described above can be used as the reporter gene.
• the specific cleavage site should be inserted.
• a plasmid based expression library using the genomic DNA or cDNA obtained from the organism from which the protease needs to be cloned is constructed using standard molecular biological techniques.
• the gene coding for the tetracycline repressor is modified to contain the appropriate specific cleavage site as described in Example 1.
• the gene coding for the modified tetracycline repressor containing its own promoter and ribosomal binding site is sub-cloned into the above mentioned plasmid based expression library.
• tetracycline repressor contains the appropriate cleavage site as opposed to the hCMV protease cleavage site, and, a genomic or cDNA library is substituted instead of the hCMV protease gene.
• Example 1 the same reporter cartridge as used in Example 1 can be used for this particular assay.
• the reporter plasmid can be constructed as described in Example 1.
• An E. coli strain which is compatible with the plasmid based expression library described above can be used.
• the strain needs to be transformed with the reporter plasmid.
• the transformed cells can be selected using kanamycin resistance as the selection marker.
• Cells containing the reporter plasmid can then be transformed with the library of expression plasmid generated as described above. Resistance to the appropriate antibiotics can be used to select for transformed cells.
• the libraries of expression plasmid and the reporter plasmid the cells need to be grown for several generations (stationery phase) in 100 ml liquid Luria Broth under antibiotic selection pressure. The cells then need to be stored in a frozen state in 2 -ml aliquots.
• proteolytic activity produced from the fragment of the genomic or cDNA insert should then be further confirmed using a secondary assay viz. as cleavage of a synthetic substrate (radiolabeled, fluorogenic or ⁇ LISA) using appropriate detection methods.
• a secondary assay viz. as cleavage of a synthetic substrate (radiolabeled, fluorogenic or ⁇ LISA) using appropriate detection methods.
• the cloned protease fragment can be used to clone the entire gene using standard hybridization techniques.
• Example 4 Wild type hepatitis C virus (HCV) NS3 protease is insoluble when expressed in E. coli and thus has limited use for research purposes.
• HCV NS4a protein stimulates HCV NS3 protease activity through the formation of a heteromeric complex with HCV NS3.
• a library of mutant HCV NS4a-NS3 fusion proteases was made to find mutants that expressed a soluble and active protease.
• the expressed wild type HCV protease is inherently active; however, the activity is masked by the insoluble character of the expressed protease, resulting in a chloramphenicol sensitive (Cm s ) phenotype. If among the pool of mutants a more soluble active mutant protease is expressed, the inherent activity of the protease is unmasked by the soluble nature of the mutant enzyme and the cells harboring this mutant protease become chloramphenicol resistant (Cm R ).
• the present invention was used to screen a library of mutant HCV NS4a-NS3 fusion proteases for mutants that expressed a soluble and active protease.
• the bacterial selection system is diagramed in Figure 8.
• the system differs from that described with CMV in Example 1 in that the plasmid containing the Tet repressor has a HCV cleavage site within the Tet repressor (rather than a CMV cleavage site) and contains an HCV protease (rather than a CMV protease), and in that the CAT gene is on the chromosome (rather than on a second plasmid).
• HCV HCV cleavage site within the Tet repressor
• HCV protease rather than a CMV protease
• the CAT gene is on the chromosome (rather than on a second plasmid).
• One of ordinary skill in the art could make the system using HCV from the system using CMV
• the system features a plasmid encoding a mutagenized HCV NS4a-NS3 protease gene as well as a gene encoding a modified Tet repressor.
• the modification of the Tet repressor is the introduction of a HCV NS3 protease cleavage site within a solvent-exposed loop of the Tet repressor protein.
• the strain carrying this plasmid also has a chromosomally-encoded chloramphenicol acetylase transferase gene (CAT - conferring chloramphenicol resistance) under the control of the Tet promoter.
• the strain After induction of the mutant HCV NS4a-NS3 fusion protease by IPTG (under lac-T7 control), the strain becomes either chloramphenicol resistant (Cm R ) if the protease activity is present (because cleavage of the modified Tet repressor allows expression of CAT), or remains chloramphenicol sensitive (Cm s ) if fusion protease activity is not present (because there is no cleavage of the modified Tet repressor and therefore there is repression of CAT).
• Cm R chloramphenicol resistant
• Cm s chloramphenicol sensitive s
• HCV NS4a-NS3 fusion protease having wild type HCV NS4a and NS3 sequence
• the library of mutant HCV NS4a-NS3 fusion proteases was transformed into the E.coli selection strain.
• Many plasmids encoding mutant HCV NS4a-NS3 fusion proteases conferred upon induced transformed E.coli cells an enhanced ability to grow on plates with low levels of chloramphenicol (1-3 ⁇ g/ml chloramphenicol).
• Figure 9 Six of the transformants exhibited more soluble proteases than the others, and plasmid DNA was prepared and sequenced.
• Figure 9 (lanes 4 and 5) show one such mutant HCV NS4a-NS3 fusion protease in the soluble fraction, while a unmutagenized fusion protease was insoluble
• This example describes using the present invention to screen protease mutants for solubility which leads to unmasked activity.
• the present invention could similarly be used to screen various wild type isolates for activity.
• the activity could be due to solubility of a naturally-occurring variant form of the protease or could be due to inherent activity of the naturally-occurring variant.

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Wood Science & Technology (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Genetics & Genomics (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Molecular Biology (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Virology (AREA)
• Biotechnology (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Biomedical Technology (AREA)
• Medicinal Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Physics & Mathematics (AREA)
• Analytical Chemistry (AREA)
• Biophysics (AREA)
• Immunology (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (4)

Applications Claiming Priority (2)

Publications (1)

Family

ID=22360285

Family Applications (1)

Country Status (5)

Cited By (3)

Families Citing this family (2)

Citations (1)

• 2000
  • 2000-01-06 JP JP2000592438A patent/JP2002534095A/ja active Pending
  • 2000-01-06 CA CA002360022A patent/CA2360022A1/en not_active Abandoned
  • 2000-01-06 EP EP00908220A patent/EP1141382A4/en not_active Withdrawn
  • 2000-01-06 WO PCT/US2000/000308 patent/WO2000040745A1/en active Search and Examination
  • 2000-01-06 AU AU29607/00A patent/AU764132B2/en not_active Ceased

Patent Citations (1)

Non-Patent Citations (2)

Also Published As

Similar Documents

Legal Events