WO2000032771A1 - Pth1r and pth3r receptors, methods and uses thereof - Google Patents

Pth1r and pth3r receptors, methods and uses thereof Download PDF

Info

Publication number
WO2000032771A1
WO2000032771A1 PCT/US1999/011883 US9911883W WO0032771A1 WO 2000032771 A1 WO2000032771 A1 WO 2000032771A1 US 9911883 W US9911883 W US 9911883W WO 0032771 A1 WO0032771 A1 WO 0032771A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
acid sequence
receptor
seq
pth3r
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1999/011883
Other languages
English (en)
French (fr)
Inventor
Harald Jüppner
David A. Rubin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Hospital Corp
Original Assignee
General Hospital Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by General Hospital Corp filed Critical General Hospital Corp
Priority to AU42172/99A priority Critical patent/AU4217299A/en
Publication of WO2000032771A1 publication Critical patent/WO2000032771A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/461Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/18Drugs for disorders of the endocrine system of the parathyroid hormones
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention is related to the fields of molecular biology, developmental biology, physiology, neurobiology and medicine.
  • the invention provides polynucleotides encoding the zebrafish PTHIR receptor and polynucleotides for a novel zebrafish PTH3R receptor, as well as vectors and cells containing said polynucleotides.
  • the invention further provides polypeptides for the PTHIR and PTH3R receptors.
  • the polynucleotides and polypeptides of the invention are useful for the identification of agonist and antagonists of PTHIR or PTH3R receptor function and as reagents in the treatment of diseases or disorders associated with PTHIR or PTH3R function.
  • PTH parathyroid hormone
  • PTHrP PTH-related peptide receptor
  • the PTHIR mediates the endocrine actions of PTH, the most important peptide regulator of calcium homeostasis in mammals, and the autocrine/paracrine actions of PTHrP, which is important for normal chondrocyte proliferation and differentiation (Karaplis; Lanske), and most likely for other, still incompletely defined functions including pancreas, skin, and breast development, as well as tooth eruption (Wysolmerski, Philbrick, Rupi and Stewart, Stewart, Braodus).
  • PTH2R PTH type-2 receptor
  • Usdin teleosts
  • Usdin an incompletely characterized hypothalamic peptide
  • Its biological importance remains uncertain, as does the importance of additional receptors for which there is growing biological and pharmacological evidence.
  • receptors with specificity for amino-terminal PTH and PTHrP have been described for keratinocytes, squamous carcinoma cell lines, and central nervous system cells (Orloff et al.
  • PTHrP-selective receptor in the mammalian supraoptic nucleus
  • the midregional portion of PTHrP stimulates an increase in intracellular free calcium in some cell lines and increases placental calcium transport (Kovacs et al. , 1996; Wu et al.,; Orloff et al. ,), and the carboxy -terminal portion of PTH binds to a distinct receptor on clonal cell lines (Inomata, 1995; Takasu 1998).
  • PTH parathyroid hormone
  • Formulations of PTH and compounds with PTH activity have been described (see US Patent Nos. 5,496,801; 5,814,603; 5,208041 ;), and methods to produce the same are also known (see US Patent Nos. 5,616,560 and 5,010,010).
  • analogs and inhibitors of PTH may be found in the prior art (see US Patent Nos. 4,423,037; 5,693616; 5,695,955 and 5,798,225).
  • the invention furthers the art by focusing on PTH receptors and providing reagents and methods that are distinct and separate from PTH. Summary of the Invention
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding a novel PTHIR receptor having the amino acid sequence shown in Figure 1 (SEQ ID NO: 2) or the amino acid sequence encoded by the cDNA clone deposited in a bacterial host as ATCC Deposit Number on .
  • the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of PTHIR polypeptides or peptides by recombinant techniques.
  • the invention further provides an isolated PTHIR polypeptide having an amino acid sequence encoded by a polynucleotide described herein.
  • the present invention also provides isolated nucleic acid molecules comprising a polynucleotide encoding a novel PTH3R receptor having the amino acid sequence shown in Figure 4 (SEQ ID NO:5) or the amino acid sequence encoded by the cDNA clone deposited in a bacterial host as ATCC Deposit
  • the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of PTH3R polypeptides or peptides by recombinant techniques.
  • the invention further provides an isolated PTH3R polypeptide having an amino acid sequence encoded by a polynucleotide described herein.
  • the present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a cellular response induced by the
  • PTHIR or PTH3R receptor which involves contacting cells which express the PTHIR or PTH3R receptor with the candidate compound, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made in absence of the candidate compound; whereby, an increased cellular response over the standard indicates that the compound is an agonist and a decreased cellular response over the standard indicates that the compound is an antagonist.
  • a screening assay for agonists and antagonists which involves determining the effect a candidate compound has on
  • the method involves contacting the PTH 1 R or PTH3R receptor with a PTH or PTHrP polypeptide and a candidate compound and determining whether PTH or PTHrP polypeptide binding to the PTHIR or PTH3R receptor is increased or decreased due to the presence of the candidate compound.
  • An additional aspect of the invention is related to a method for treating an individual in need of an increased level of PTH1 R or PTH3R activity in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an isolated PTHIR or PTH3R polypeptide of the invention or an agonist thereof.
  • a still further aspect of the invention is related to a method for treating an individual in need of a decreased level of PTHIR or PTH3R receptor activity in the body comprising, administering to such an individual a composition comprising a therapeutically effective amount of an PTHIR or PTH3R antagonist.
  • the invention further provides a diagnostic method useful during diagnosis or prognosis of diseases and disorders associated with PTHIR or PTH3R receptor expression or function.
  • FIG. 1 A) Schematic representation of exons M6/7 and M7 (A), and of the cDNA encoding the PTHIR or the PTH3R (B). Vertical boxes depict the predicted location of the membrane-spanning helices; recognition sites for restriction enzymes are shown by //. For and Rev arrows indicate the approximate location of primeta used for RT-PCR, S' RACE, and 3 ' RACE for zPTHlR and zPTH3R.
  • FIG. 1 A) The amino acid sequence of the PTHl R receptor; B) The amino acid sequence of the PTH3R receptor.
  • Figure 3 Alignment of the amino acid sequences of the zPTHl R, zPTH2R, and ZPTH3R.
  • the sequences were aligned using the GAP and pileup algorithms of the GCG package (Genetics Computer Group, Wisconsin). conserveed consensus sites for potential N-glycosylation arc identified by #; Gaps were introduced to maximize sequence homology.
  • the seventeen residues which are lacking in one splice variant of the characterized zPTH2R (Rubin et l, in press) are boxed; the residues which are predicted to comprise the signal peptide are outlined with a stippledbox; andthoseresidues which are likely tobePTH3R-specificareboxed.
  • Fig.4A-D COS-7 cells transiently expressing the zPTHlRor the zPTH3R were evaluated for competitive inhibition of radioligand binding (A,B) and agonist- stimulated cAMP production (C,D).
  • Binding studies (as described in Materials and Methods) used either ,25 I-[We w ⁇ Tyr M ]rPTH-(l-34)amide (Panel A) or ,2! I- rTyr 5 ⁇ ]hPTHrP-(l-36)amide (Panel B) as radioligand and varying amounts of unlabeled peptide. Data are expressed as % of maximal binding.
  • Cyclic AMP accumulation is expressed as % of maximal for the zPTHlR (C) or the zPTH3R (D); basal cAMP accumulation was 3-4 pmol/well for either receptor; maximal accumulation of 106.2 pmol well for the zPTHlR, and 285.4 pmol/well for the ZPTH3R.
  • Fig.6 Aphylogenetic analysis, as described in Materials andMethods, indicated that the single most parsimonious tree had a length of 1549 steps, and a consistency index excluding uninformative characters of 0.863.
  • the bootstrap confidence intervals are shown next to the branch points and indicate the percentage of trials which support a given branch in 100 branch-and-bound iterations.
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding a novel PTHIR polypeptide having the amino acid sequence shown in Figure 2A (SEQ ID NO.2), which was determined by sequencing a cloned cDNA.
  • the PTHl R protein of the present invention shares sequence homology with previously identified PTHIR and PTH2R sequences.
  • the nucleotide sequence shown in Figure 1 C (SEQ ID NO: 1) was obtained by sequencing a cDNA clone (zPTHlR), which was deposited on at the American Type Culture Collection, 10801 University Boulevard, Manassas,
  • the cDNA was inserted between the EcoRI and Sphl site of plasmid pcDNAl/Amp (Invitrogen).
  • the present invention also provides isolated nucleic acid molecules comprising a polynucleotide encoding a novel PTH3R polypeptide having the amino acid sequence shown in Figure 2B (SEQ ID NO:4), which was determined by sequencing a cloned cDNA.
  • the PTH3R protein of the present invention shares sequence homology with the PTH 1 R protein sequence of the invention and other PTH 1 R and PTH2R protein sequences previously .
  • the nucleotide sequence shown in Figure 1C (SEQ ID NO:3) was obtained by sequencing a cDNA clone(zPTH3R), which was deposited on at the American Type Culture
  • the cDNA was inserted between the BamHI and Notl site of plasmid pcDNAI/Amp (Invitrogen).
  • nucleotide sequences determined by sequencing a DNA molecule herein were determined by manual sequencing, and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by manual sequencing are typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule.
  • a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
  • a nucleic acid molecule of the present invention encoding a PTHIR or PTH3R polypeptide, respectively may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material.
  • the nucleic acid molecule described in Figure IC (SEQ ID NO:l) was discovered using oligonucleotide primers in a polymerase chain reaction (PCR) with total RNA isolated from adult zebrafish.
  • the determined nucleotide sequence of the PTHIR cDNA of Figure IC contains an open reading frame encoding a protein of about 536 amino acid residues, with a predicted leader sequence of about 24 amino acid residues, and a deduced molecular weight of about 61.4 kDa for the non- glycosylated form.
  • the amino acid sequence of the predicted mature PTHIR receptor is shown in Figure 2A from amino acid residue about 25 to residue about 536.
  • the PTHIR protein shown in Figure 2A (SEQ ID NO:2) is about 76 % identical to human PTHIR sequence and about 68 % identical to human PTH2R sequence.
  • nucleic acid molecule described in Figure ID (SEQ ID NO:3) was discovered in a zebrafish cDNA library (Clontech).
  • the determined nucleotide sequence of the Figure ID (SEQ ID NO:3) contains an open reading frame encoding a protein of about 523 amino acid residues, with a predicted leader sequence of about 21 amino acid residues, and a deduced molecular weight of about 59.2 kDa.
  • the PTH3R protein shown in Figure 2B (SEQ ID NO:4) is about 68% and 57% similar to human PTHl R and human PTH2R, respectively.
  • the present invention also provides the mature form(s) of the PTHIR and PTH3R receptors of the present invention.
  • proteins secreted by mammalian cells have a signal or secretory leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated.
  • Most mammalian cells and even insect cells cleave secreted proteins with the same specificity.
  • cleavage of a secreted protein is not entirely uniform, which results in two or more mature species on the protein.
  • the present invention provides a nucleotide sequence encoding the mature PTHIR polypeptides having the amino acid sequence encoded by the cDNA clone contained in the host identified as ATCC Deposit No. and as shown in
  • Figure 2A SEQ ID NO:2.
  • the present invention also provides a nucleotide sequence encoding the mature PTH3R polypeptides having the amino acid sequence encoded by the cDNA clone contained in the host identified as ATCC Deposit No. and as shown in Figure 2B (SEQ ID NO:4).
  • PTHIR protein having the amino acid sequence encoded by the cDNA clone contained in the host identified as ATCC Deposit is meant the mature form(s) of the PTH 1 R receptor produced by expression in a mammalian cell (e.g. , COS cells, as described below) of the complete open reading frame encoded by the zebrafish DNA sequence of the clone contained in the vector in the deposited host.
  • a mammalian cell e.g. , COS cells, as described below
  • the mature PTH3R protein having the amino acid sequence encoded by the cDNA clone contained in the host identified as ATCC Deposit is meant the mature form(s) of the PTH3R receptor produced by expression in a mammalian cell (e.g., COS cells, as described below) of the complete open reading frame encoded by the zebrafish DNA sequence of the clone contained in the vector in the deposited host.
  • a mammalian cell e.g., COS cells, as described below
  • Deposit No. may or may not differ from the predicted "mature'TTHlR protein shown in Figure 2 A (amino acids from about 25 to about 536) depending on the accuracy of the predicted cleavage.
  • the mature PTH3R receptor having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit
  • No. may or may not differ from the predicted "mature" PTH3R protein shown in Figure 2B (amino acids from about 22 to about 523) depending on the accuracy of the predicted cleavage site.
  • Methods for predicting whether a protein has a secretory leader as well as the cleavage point for that leader sequence are available. For instance, the methods of McGeoch (Virus Res. 5:271-286 (1985)) and von Heinje (Nucleic Acids Res. 74:4683-4690 (1986)) can be used.
  • the accuracy of predicting the cleavage points of known mammalian secretory proteins for each of these methods is in the range of 75-80%. von Heinje, supra.
  • the predicted amino acid sequence of the complete PTHIR and PTH3R polypeptides of the present invention were analyzed for structural properties by comparison to the rat PTHIR sequence.
  • This analysis provided predicted a cleavage site between amino acids 24 and 25 in Figure 2A (SEQ ID NO:2) and a cleavage site between amino acids 21 and 22 in Figure 2B (SEQ ID NO:4).
  • the leader sequence for the PTHIR receptor protein is predicted to consist of amino acid residues 1 -24 in Figure 2A (amino acids 1 to 24 in SEQ ID NO:2)
  • the predicted mature PTHIR protein consists of residues 25-536 (amino acids 25 to 536 in SEQ ID NO:2).
  • the leader sequence for the PTH3R receptor protein is predicted to consist of amino acid residues 1 -21 in Figure 2B (amino acids 1-21 in SEQ ID NO:4), while the predicted mature PTH3R protein consists of residues 22-523 (amino acids 22 to 523 in SEQ ID NO:4).
  • nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically.
  • the DNA may be double-stranded or single-stranded.
  • Single-stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
  • the PTHIR receptor polypeptide encoded by the deposited cDNA comprises about 536 amino acids, but may be anywhere in the range of 510-561 amino acids; and the leader sequence of this protein is about 24 amino acids, but may be anywhere in the range of about 10 to about 30 amino acids.
  • the PTH3R receptor polypeptide encoded by the deposited cDNA comprises about 523 amino acids, but may be anywhere in the range of 500-550 amino acids; and the leader sequence of this protein is about 24 amino acids, but may be anywhere in the range of about 15 to about 35 amino acids.
  • nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically.
  • the DNA may be double-stranded or single-stranded.
  • Single-stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
  • isolated nucleic acid molecule(s) is intended a nucleic acid molecule,
  • DNA or RNA which has been removed from its native environment.
  • recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention.
  • isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution.
  • Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention.
  • Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.
  • Isolated nucleic acid molecules of the present invention include DNA molecules comprising an open reading frame (ORF) shown in Figure IC (SEQ ID NO: 1) or Figure ID (SEQ ID NO: 3); DNA molecules comprising the coding sequence for the PTHIR receptor shown in Figure 2A (SEQ ID NO:2) or the PTH3R receptor shown Figure 2B (SEQ ID NO:4); and DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the PTHIR or the
  • the invention provides isolated nucleic acid molecules encoding the PTHIR polypeptide having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. on .
  • the invention provides isolated nucleic acid molecules encoding the PTH3R polypeptide having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. on .
  • these nucleic acid molecules will encode the mature polypeptides encoded by the above-described deposited cDNA clones.
  • nucleic acid molecules are provided encoding the PTHIR or the PTH3R polypeptide or the PTHIR or the PTH3R polypeptide lacking the N-terminal methionine.
  • the invention also provides an isolated nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO:l or the nucleotide sequence of the PTHIR cDNA contained in the above-described deposited clone, or a nucleic acid molecule having a sequence complementary to one of the above sequences.
  • isolated molecules, particularly DNA molecules are useful as probes for gene mapping, by in situ hybridization with chromosomes, and for detecting expression of the PTHIR gene in human tissue, for instance, by Northern blot analysis.
  • the invention also provides an isolated nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO:3 or the nucleotide sequence of the cDNA contained in the above-described deposited clone, or a nucleic acid molecule having a sequence complementary to one of the above sequences.
  • isolated molecules particularly DNA molecules, are useful as probes for gene mapping, by in situ hybridization with chromosomes, and for detecting expression of the gene in human tissue, for instance, by Northern blot analysis.
  • the present invention is further directed to fragments of the isolated nucleic acid molecules described herein.
  • a fragment of an isolated nucleic acid molecule having the nucleotide sequence of the deposited cDNAs or the nucleotide sequence shown in Figure IC (SEQ ID NOT) or Figure ID (SEQ ID NO:3) is intended fragments at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt. and even more preferably, at least about 40 nt in length which are useful as diagnostic probes and primers as discussed herein.
  • fragments of about 50-1550 nt in length, and more preferably at fragments least about 600 nt in length are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequence of the deposited cDNAs or as shown in Figure 1 C (SEQ ID NOT) or Figure ID (SEQ ID NO:3).
  • a fragment at least 20 nt in length for example, is intended fragments which include 20 or more contiguous bases from the nucleotide sequence of the deposited cDN As or the nucleotide sequence as shown in Figure IC (SEQ ID NOT) or Figure ID (SEQ ID NO:3).
  • Preferred nucleic acid fragments of the present invention include nucleic acid molecules encoding: a polypeptide comprising the PTHIR receptor extracellular domain (predicted to constitute amino acid residues from about 25 to about 147 in Figure 2A (or amino acid residues from about 25 to about 147 in SEQ ID NO:2)); a polypeptide comprising the PTHIR receptor transmembrane domain (predicted to constitute amino acid residues from about 148 to about 416 in Figure 2A (or amino acid residues from about 148 to about 416 in SEQ ID NO:2)); and a polypeptide comprising the PTHIR receptor extracellular domain with all or part of the transmembrane domain deleted.
  • amino acid residues constituting the PTHIR receptor extracellular and transmembrane domains have been predicted.
  • amino acid residues constituting these domains may vary slightly (e.g., by about 1 to about 15 amino acid residues) depending on the criteria used to define each domain.
  • Preferred nucleic acid fragments of the present invention also include nucleic acid molecules encoding: a polypeptide comprising the PTH3R receptor extracellular domain (predicted to constitute amino acid residues from about 22 to about 145 in Figure 2B (or amino acid residues from about 22 to about 145 in SEQ ID NO:4)); a polypeptide comprising the PTH3R receptor transmembrane domain (predicted to constitute amino acid residues from about 346 to about 402 in Figure 2B (or amino acid residues from about 146 to about 402 in SEQ ID NO:4)); and a polypeptide comprising the PTH3R receptor extracellular domain with all or part of the transmembrane domain deleted.
  • amino acid residues constituting the PTH3R receptor extracellular and transmembrane domains have been predicted by computer analysis.
  • the amino acid residues constituting these domains may vary slightly (e.g., by about 1 to about 15 amino acid residues) depending on the criteria used to define each domain.
  • Preferred nucleic acid fragments of the present invention also include nucleic acid molecules encoding epitope-bearing portions of the PTHIR or PTH3R receptor protein.
  • a nucleic acid sequence may be used to predict the polypeptide sequence encoded therein. Such information may then be used to predict antigenic determinants in the polypeptide that may be related to the corresponding polynucleotide regions encoding the antigenic determinants identified by the analysis. Methods for predicting the antigenic determinants of a polypeptide are well known in the art. Methods for determining other such epitope-bearing portions of the
  • PTHIR or the PTH3R protein are described in detail below.
  • the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA clones contained in ATCC Deposit Nos. or .
  • stringent hybridization conditions is intended overnight incubation at 42 °C in a solution comprising: 50% formamide, 5x SSC (150 mM NaCI, 15mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0. Ix SSC at about 65 °C.
  • a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30-70 nt of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.
  • a portion of a polynucleotide of "at least 20 nt in length,” for example, is intended 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (e.g., the deposited cDNAs or the nucleotide sequence as shown in Figure IC (SEQ ID NOT) or Figure ID (SEQ ID NO:3).
  • Figure 1 C (SEQ ID NO: 1 ) or the 3 ' terminal poly(A) tract of the PTH3R receptor cDNA shown in Figure ID (SEQ ID NO: 3)), or to a complementary stretch of T (or U) resides, would not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).
  • nucleic acid molecules of the present invention which encode a PTHIR or PTH3R polypeptide may include, but are not limited to those encoding the amino acid sequence of the mature polypeptides, by themselves; the coding sequence for the mature polypeptides and additional sequences, such as those encoding the amino acid leader or secretory sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
  • the sequence encoding the polypeptide may be fused to a marker sequence, such as a sequence encoding a peptide which facilitates purification of the fused polypeptide.
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc.), among others, many of which are commercially available. As described in Gentz et al, Proc. Natl. Acad. Sci. USA 56:821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein.
  • the "HA” tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein, which has been described by Wilson et al., Cell 37: 767 (1984).
  • other such fusion proteins include the PTHIR receptor fused to Fc at the - or C-terminus.
  • the present invention further relates to variants of the nucleic acid molecules of the present invention, which encode portions, analogs or derivatives of the PTHIR or PTH3R receptor. Variants may occur naturally, such as a natural allelic variant.
  • an "allelic variant” is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985). Non-naturally occurring variants may be produced using art-known mutagenesis techniques.
  • variants include those produced by nucleotide substitutions, deletions or additions, which may involve one or more nucleotides.
  • the variants may be altered in coding regions, non-coding regions, or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the PTHIR or PTH3R receptor or portions thereof. Also especially preferred in this regard are conservative substitutions.
  • nucleic acid molecules comprising a polynucleotide having a nucleotide sequence at least 95%, 96%, 97%, 98% or 99% identical to (a) a nucleotide sequence encoding the full-length PTH 1 R polypeptide having the complete amino acid sequence in SEQ ID NO:2, including the predicted leader sequence; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID NO:2, but lacking the N-terminal methionine; (c) a nucleotide sequence encoding the mature PTHIR receptor (full-length polypeptide with the leader removed) having the amino acid sequence at positions from about 25 to about 536 in SEQ ID NO:2; (d) a nucleotide sequence encoding the full-length PTH 1 R polypeptide having the complete amino acid sequence including the leader encoded by the cDNA clone contained in ATCC Deposit No.
  • nucleotide sequence encoding the mature PTHIR receptor having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97883;
  • PTHIR receptor extracellular domain with all or part of the transmembrane domain deleted ; and (i) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g) or (h).
  • polynucleotide having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence encoding a PTHl R or PTH3R polypeptide is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the PTHIR or PTH3R receptor.
  • a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • These mutations of the reference sequence may occur at the 5 ' or 3 ' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
  • nucleic acid molecule is at least 95%, 96%, 97%, 98% or 99% identical to, for instance, the nucleotide sequence shown in Figure IC or ID or to the nucleotides sequence of the deposited cDN A clones can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 5371 1. Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of homology between two sequences.
  • Bestfit program Wiconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 5371 1. Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of homology between two sequences.
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
  • the present application is directed to nucleic acid molecules at least 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in
  • Figure IC SEQ ID NOT or Figure ID (SEQ ID NO:3) or to the nucleic acid sequence of the deposited cDNAs, irrespective of whether they encode a polypeptide having PTHIR or PTH3R receptor activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having PTH 1 R or PTH3R receptor activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer.
  • PCR polymerase chain reaction
  • nucleic acid molecules of the present invention that do not encode a polypeptide having PTHl R or PTH3R receptor activity include, inter alia, (1) isolating the PTHIR or PTH3R receptor gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g.,
  • FISH Fluorescence In situ hybridization
  • nucleic acid molecules having sequences at least 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure IC (SEQ ID NOT) or Figure ID (SEQ ID NO:3) or to the nucleic acid sequence of the deposited cDNA which do, in fact, encode a polypeptide having PTHIR or PTH3R receptor activity.
  • a polypeptide having PTHIR or PTH3R receptor activity is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the PTHIR or PTH3R receptor of the invention, as measured in a particular biological assay.
  • PTHIR or PTH3R receptor activity can be measured using competition binding experiments of labeled PTH or PTHrP to cells expressing the candidate PTHIR or PTH3R polypeptide as described in Treanor et al, Nature 352:80-83 (1996) or Jing et al, Cell 85: 1 1 13-1124 (1996).
  • any cell line expressing the PTHIR or PTH3R receptor, or variants thereof, may be used to assay ligand binding and second messenger activation as described in Examples 3 and 4.
  • any cell line expressing the PTHIR or PTH3R receptor, or variants thereof may be used to assay ligand binding and second messenger activation as described in Examples 3 and 4.
  • the genetic code due to the degeneracy of the genetic code, one of ordinary skill in the art will immediately recognize that a large number of the nucleic acid molecules having a sequence at least 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited cDNAs or the nucleic acid sequence shown in
  • Figure IC SEQ ID NOT
  • Figure ID SEQ ID NO:3
  • Figure IC SEQ ID NOT
  • Figure ID SEQ ID NO:3
  • degenerate variants of these nucleotide sequences all encode the same polypeptide, this will be clear to the skilled artisan even without performing the above described comparison assay.
  • a reasonable number will also encode a polypeptide having PTH 1 R or PTH3R protein activity. This is because the skilled artisan is fully aware of amino acid substitutions that are either less likely or not likely to significantly effect protein function (e.g., replacing one aliphatic amino acid with a second aliphatic amino acid). For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie, J. U. et al, "Deciphering the
  • the present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors, and the production of PTHIR or PTH3R polypeptides or fragments thereof by recombinant techniques.
  • the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
  • a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
  • the DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
  • an appropriate promoter such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
  • Other suitable promoters will be known to the skilled artisan.
  • the expression constructs will further contain sites for transcription initiation, termination and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the mature transcripts expressed by the constructs will preferably include a translation initiating at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
  • the expression vectors will preferably include at least one selectable marker.
  • markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture and tetracycline or ampicillin resistance genes for culturing in E coli and other bacteria.
  • Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • vectors preferred for use in bacteria include pQ ⁇ 70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHl ⁇ a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540. pRIT5 available from Pharmacia.
  • eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
  • Other suitable vectors will be readily apparent to the skilled artisan.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al, Basic Methods In Molecular Biology (1986).
  • the polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals, but also additional heterologous functional regions. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification, or during subsequent handling and storage. Also, peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art.
  • a preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to solubilize proteins.
  • EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232262).
  • Fc portion proves to be a hindrance to use in therapy and diagnosis, for example when the fusion protein is to be used as antigen for immunizations.
  • human proteins such as, hIL5-receptor has been fused with Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. See, D. Bennett et al, Journal of Molecular Recognition, Vol. 8:52-58 (1995) and K. Johanson et al, The Journal of Biological Chemistry, Vol. 270, No.
  • the PTHIR or PTH3R receptor can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography ("HPLC") is employed for purification.
  • Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells.
  • polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
  • the invention further provides an isolated PTH 1 R or PTH3R polypeptide having the amino acid sequence encoded by the deposited cDNAs, or the amino acid sequence in Figure 2 A (SEQ ID NO:2) or Figure 2B (SEQ ID NO:4), or a peptide or polypeptide comprising a portion of the above polypeptides.
  • the invention further includes variations of the PTHIR or PTH3R receptor which show substantial PTHIR or PTH3R receptor activity or which include regions of PTHIR or PTH3R protein such as the protein portions discussed below.
  • Such mutants include deletions, insertions, inversions, repeats, and type substitutions.
  • amino acid residues may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as an IgG Fc fusion region peptide or leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.
  • a conserved or non-conserved amino acid residue preferably a conserved amino acid residue
  • substituted amino acid residue may or may not be one encoded by the genetic code
  • the PTHIR or PTH3R receptor of the present invention may include one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation.
  • changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein (see Table 1).
  • Amino acids in the PTH 1 R or PTH3R protein of the present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244:1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro proliferative activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al, J. Mol. Biol 224:899-904 (1992) and de Vos et al Science 255:306-312 (1992)).
  • polypeptides of the present invention are preferably provided in an isolated form.
  • isolated polypeptide is intended a polypeptide removed from its native environment.
  • a polypeptide produced and/or contained within a recombinant host cell is considered isolated for purposes of the present invention.
  • isolated polypeptide are polypeptides that have been purified, partially or substantially, from a recombinant host cell.
  • a recombinantly produced version of the antimicrobial peptide polypeptide can be substantially purified by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988).
  • polypeptides of the present invention are preferably provided in an isolated form, and preferably are substantially purified.
  • a recombinantly produced version of the PTHIR or PTH3R receptor can be substantially purified by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988).
  • polypeptides of the present invention also include the polypeptide encoded by the deposited PTHIR cDNA including the leader, the polypeptide encoded by the deposited the cDNA minus the leader (i.e., the mature protein), the polypeptide of Figure 2 A (SEQ ID NO: 2) including the leader, the polypeptide of Figure 2A (SEQ ID NO:2) minus the leader, the extracellular domain, the transmembrane domain, a polypeptide comprising amino acids about
  • polypeptides which are at least 95% identical, still more preferably at least 96%, 97%, 98% or 99% identical to the polypeptides described above, and also include portions of such polypeptides with at least 30 amino acids and more preferably at least 50 amino acids.
  • polypeptides of the present invention also include the polypeptide encoded by the deposited PTH3R cDNA including the leader, the polypeptide encoded by the deposited the cDNA minus the leader (i.e., the mature protein), the polypeptide of Figure 2 (SEQ ID NO:4) including the leader, the polypeptide of Figure 4 (SEQ ID NO:4) minus the leader, the extracellular domain, the transmembrane domain, a polypeptide comprising amino acids about 1 to about 523 in SEQ ID NO:4, and a polypeptide comprising amino acids about 2 to about 523 in SEQ ID NO:4, as well as polypeptides which are at least 95% identical, still more preferably at least 96%, 97%, 98% or 99% identical to the polypeptides described above, and also include portions of such polypeptides with at least 30 amino acids and more preferably at least 50 amino acids.
  • polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of a PTHIR or PTH3R polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the PTHl R or PTH3R receptor.
  • up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • any particular polypeptide is at least 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequence shown in Figure 2A (SEQ ID NO:2) or Figure 2B (SEQ ID NO:4) or to the amino acid sequence encoded by deposited cDNA clones can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711).
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
  • the polypeptide of the present invention could be used as a molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art.
  • polypeptides of the present invention can also be used to raise polyclonal and monoclonal antibodies, which are useful in assays for detecting PTHIR or PTH3R expression as described below or as agonists and antagonists capable of enhancing or inhibiting PTHIR or PTH3R receptor function.
  • polypeptides can be used in the yeast two-hybrid system to "capture" PTHIR or PTH3R receptor binding proteins which are also candidate agonist and antagonist according to the present invention.
  • the yeast two hybrid system is described in Fields and Song, Nature 340:245-246 (1989).
  • the invention provides a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide of the invention.
  • the epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide described herein.
  • An "immunogenic epitope” is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen.
  • a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope.”
  • the number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes. See, for instance, Geysen et al, Proc. Natl. Acad. Sci. USA 57:3998-
  • peptides or polypeptides bearing an antigenic epitope i.e., that contain a region of a protein molecule to which an antibody can bind
  • relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein. See, for instance, Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner, R.A. (1983) Antibodies that react with predetermined sites on proteins. Science 219:660-666.
  • Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl terminals.
  • Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention. See, for instance, Wilson etal, Cell
  • Antigenic epitope-bearing peptides and polypeptides of the invention preferably contain a sequence of at least seven, more preferably at least nine and most preferably between at least about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention.
  • Figure 2A SEQ ID NO:2
  • Figure 2B SEQ ID NO:4
  • the epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means.
  • Houghten provides a general method for the rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody interaction at the level of individual amino acids Houghten, R. A., Proc. Natl Acad. Sci. USA 52:5131-5135 (1985)).
  • SMPS Simultaneous Multiple Peptide Synthesis
  • PTHIR or PTH3R polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
  • IgG immunoglobulins
  • These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human
  • CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al, Nature 337:84- 86 (1988)).
  • Fusion proteins that have a disulfide-linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric PTHIR or PTH3R protein or protein fragment alone (Fountoulakis et al, J. Biochem 270:3958-3964 (1995)).
  • tissue in mammals with certain diseases and disorders express significantly decreased levels of the PTH 1 R or PTH3R receptor and mRNA encoding the PTHIR or PTH3R receptor when compared to a corresponding "standard" mammal, i.e., a mammal of the same species not having the disorder.
  • enhanced levels of the PTH 1 R or PTH3R receptor can be detected in certain body fluids (e.g., sera, plasma, urine, and spinal fluid) from mammals with cancer when compared to sera from mammals of the same species not having the disorder.
  • the invention provides a diagnostic method useful during diagnosis of diseases and disorders, for example, which involves assaying the expression level of the gene encoding the PTHIR or PTH3R receptor in mammalian cells or body fluid and comparing the gene expression level with a standard PTHIR or PTH3R receptor gene expression level, whereby an decrease in the gene expression level over the standard is indicative of certain disorders.
  • the present invention is useful as a prognostic indicator, whereby patients exhibiting decreased PTHIR or PTH3R gene expression will experience a worse clinical outcome relative to patients expressing the gene at a higher level.
  • saying the expression level of the gene encoding the PTHIR or PTH3R protein is intended qualitatively or quantitatively measuring or estimating the level of the PTHIR or PTH3R protein or the level of the mRNA encoding the PTHIR or PTH3R receptor in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the PTHl R or PTH3R protein level or mRNA level in a second biological sample).
  • the PTHl R or PTH3R protein level or mRNA level in the first biological sample is measured or estimated and compared to a standard PTHIR or PTH3R protein level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the cancer.
  • a standard PTHIR or PTH3R protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.
  • biological sample any biological sample obtained from an individual, cell line, tissue culture, or other source which contains PTHIR or
  • PTH3R protein or mRNA include mammalian body fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) which contain PTHIR or PTH3R protein, and ovarian, prostate, heart, placenta, pancreas liver, spleen, lung, breast, neural, and umbilical tissue.
  • the present invention is useful for detecting disorders in mammals. In particular the invention is useful during diagnosis of diseases and disorders in mammals involving PTHIR or PTH3R receptor expression or function. Mutations that affect PTHIR or PTH3R sequence and/or expression levels of PTHIR or PTH3R could be diagnostic for patients with diseases or disorders of a developmental, physiological or neurological nature.
  • Preferred mammals include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and humans. Particularly preferred are humans.
  • Total cellular RNA can be isolated from a biological sample using the single-step guanidinium-thiocyanate-phenol-chloroform method described in Chomczynski and Sacchi, ⁇ « ⁇ 7. Biochem. 762:156-159 (1987). Levels ofmRNA encoding the PTHIR or PTH3R receptor are then assayed using any appropriate method.
  • PTHIR or PTH3R protein levels in a biological sample can occur using antibody-based techniques.
  • PTH 1 R or PTH3R protein expression in tissues can be studied with classical immunohistological methods
  • Suitable labels are known in the art and include enzyme labels, such as glucose oxidase, and radioisotopes, such as iodine ( ,25 1, 12I I), carbon ( 14 C), sulfur ( 35 S), tritium ( 3 H), indium (“ 2 In), and technetium ( 99m Tc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
  • enzyme labels such as glucose oxidase
  • radioisotopes such as iodine ( ,25 1, 12I I), carbon ( 14 C), sulfur ( 35 S), tritium ( 3 H), indium (“ 2 In), and technetium ( 99m Tc)
  • fluorescent labels such as fluorescein and rhodamine, and biotin.
  • the present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a cellular response induced by the PTHIR or PTH3R receptor, which involves contacting cells which express the PTHIR or PTH3R receptor with the candidate compound, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made in absence of the candidate compound; whereby, an increased cellular response over the standard indicates that the compound is an agonist and a decreased cellular response over the standard indicates that the compound is an antagonist.
  • a screening assay for agonists and antagonists is provided which involves determining the effect a candidate compound has on PTH or PTHrP binding to the PTHIR or PTH3R receptor.
  • the method involves contacting the PTHIR or PTH3R receptor with a PTH or a PTHrP polypeptide and a candidate compound and determining whether PTH or PTHrP polypeptide binding to the PTHIR or PTH3R receptor is increased or decreased due to the presence of the candidate compound.
  • agonist is intended naturally occurring and synthetic compounds capable of enhancing or potentiating PTH 1 R or PTH3R receptor response (e.g. , signaling through the cAMP or inositol phosphate pathway).
  • antagonist is intended naturally occurring and synthetic compounds capable of inhibiting PTHIR or PTH3R receptor response (e.g., signaling through the cAMP or inositol phosphate pathway).
  • Whether any candidate "agonist” or “antagonist” of the present invention can enhance or inhibit PTHl R or PTH3R receptor activity can be determined using art-known competition binding assays, including those described in more detail below.
  • One such screening procedure involves the use of melanophores which are transfected to express a receptor of the present invention.
  • a screening technique is described in PCT WO 92/01810, published February 6, 1992.
  • Such an assay may be employed, for example, for screening for a compound which inhibits (or enhances) activation of the PTHIR or PTH3R receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both PTH or PTHrP as a ligand and the candidate antagonist (or agonist). Inhibition or enhancement of the signal generated by the ligand indicates that the compound is an antagonist or agonist of the ligand/receptor signaling pathway.
  • screening techniques include the use of cells which express the receptor (for example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science 246:181-296 (October 1989).
  • compounds may be contacted with a cell which expresses the PTHIR or PTH3R receptor polypeptide of the present invention and a second messenger response, e.g., signal transduction or pH changes, may be measured to determine whether the potential compound activates or inhibits the receptor.
  • Another such screening technique involves introducing RNA encoding the PTHIR or PTH3R receptor into Xenopus oocytes to transiently express the receptor. The receptor oocytes may then be contacted with the receptor ligand and a compound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of screening for compounds which are thought to inhibit activation of the receptor.
  • Another screening technique involves expressing in cells a construct wherein the receptor is linked to a phospholipase C or D.
  • Such cells include endothelial cells, smooth muscle cells, embryonic kidney cells, etc.
  • the screening may be accomplished as hereinabove described by detecting activation of the PTHIR or PTH3R receptor or inhibition of activation of the PTHIR or PTH3R receptor from the phospholipase signal.
  • Another method involves screening for compounds which inhibit activation of the receptor polypeptide of the present invention antagonists by determining inhibition of binding of labeled ligand to cells which have the receptor on the surface thereof.
  • Such a method involves transfecting a eukaryotic cell with DNA encoding the PTHIR or PTH3R receptor such that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a known ligand.
  • the ligand can be labeled, e.g.. by radioactivity.
  • the amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the compound binds to the receptor as determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited.
  • a screening method for determining whether a candidate agonist or antagonist is capable of enhancing or inhibiting a cellular response to PTH or PTHrP.
  • the method involves contacting cells which express the PTHIR or PTH3R polypeptide with a candidate compound and the PTH or PTHrP ligand, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made with the ligand in absence of the candidate compound, whereby an increased cellular response over the standard indicates that the candidate compound is an agonist of the ligand/receptor signaling pathway and a decreased cellular response compared to the standard indicates that the candidate compound is an antagonist of the ligand/receptor signaling pathway.
  • saying a cellular response is intended qualitatively or quantitatively measuring a cellular response to a candidate compound and/or PTH or PTHrP (e.g., determining or estimating an increase or decrease in cell proliferation or tritiated thymidine labeling).
  • a cell expressing the PTHIR or PTH3R polypeptide can be contacted with either an endogenous or exogenously administered PTH or PTHrP.
  • Agonist according to the present invention include naturally occurring and synthetic compounds such as, for example, PTH or PTHrP peptide fragments, or other known compounds that behave as PTH or PTHrP agonist.
  • Preferred agonist include chemotherapeutic drugs such as, for example, cisplatin, doxorubicin, bleomycin, cytosine arabinoside, nitrogen mustard, methotrexate and vincristine. Others include ethanol and ⁇ -amyloid peptide. (Science 267:1457-1458 (1995)).
  • Further preferred agonist include polyclonal and monoclonal antibodies raised against the PTHIR or PTH3R polypeptide, or a fragment thereof.
  • Antagonist according to the present invention include naturally occurring and synthetic compounds such as, for example, the CD40 ligand, neutral amino acids, zinc, estrogen, androgens, viral genes (such as Adenovirus E/7 , Baculovirus p35 and IAP, Cowpox virus crmA, ⁇ pstein-Barr virus BHRF1, IMP-1, African swine fever virus LMW5-HI, and Herpesvirus yl 34.5), calpain inhibitors, cysteine protease inhibitors, and tumor promoters (such as PMA, Phenobarbital, and ⁇ -Hexachlorocyclohexane).
  • viral genes such as Adenovirus E/7 , Baculovirus p35 and IAP, Cowpox virus crmA, ⁇ pstein-Barr virus BHRF1, IMP-1, African swine fever virus LMW5-HI, and Herpesvirus yl 34.5
  • calpain inhibitors such as PMA, Phenobarbit
  • Antisense molecules can be used to control gene expression through antisense DNA or RNA or through triple-helix formation. Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance Lee et al, Nucleic Acids Research 10-1573 (1979); Cooney et al, Science 247:456 (1988); and Dervan et al, Science 257:1360 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the receptor.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide.
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the receptor.
  • Further antagonist according to the present invention include soluble forms of PTHIR or PTH3R fragments that include the ligand binding domain from the extracellular region of the full length receptor.
  • Such soluble forms of the receptor which may be naturally occurring or synthetic, antagonize PTHIR or PTH3R mediated signaling by competing with the cell surface PTHIR or PTH3R for binding to PTH or PTHrP.
  • These are preferably expressed as dimers or trimers, since these have been shown to be superior to monomeric forms of soluble receptor as antagonists, e.g., IgGFc-PTHIR or IgGFc-PTH3R receptor family fusions.
  • the invention further provides a method of treating an individual in need of an increased level of PTHIR or PTH3R receptor activity comprising administering to such an individual a pharmaceutical composition comprising an effective amount of an isolated PTHl R or PTH3R polypeptide of the invention, effective to increase the
  • PTHIR or PTH3R receptor activity level in such an individual are PTHIR or PTH3R receptor activity level in such an individual.
  • the invention also relates to a method of treating an individual in need of an increased level of PTHIR or PTH3R receptor activity comprising administering to such an individual a pharmaceutical composition comprising an effective amount of an agonist for PTHIR or PTH3R.
  • the invention further relates to a method of treating an individual in need of a decreased level of PTHIR or PTH3R receptor activity comprising administering to such an individual a pharmaceutical composition comprising an effective amount of an antagonist for PTHIR or PTH3R.
  • PTHIR or PTH3R polypeptide or its agonists or antagonists administered parenterally per dose will be in the range of about 1 ⁇ g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone. If given continuously, the PTHIR or PTH3R polypeptide is typically administered at a dose rate of about 1 ⁇ g/kg/hour to about 50 ⁇ g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed.
  • compositions containing the PTHIR or PTH3R polypeptide(s)of the invention or its agonists or antagonsits may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray.
  • pharmaceutically acceptable carrier is meant a non- toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • the nucleic acid molecules of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • the cDNA herein disclosed is used to clone genomic DNA of a PTHIR or PTH3R receptor gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially.
  • the genomic DNA then is used for in situ chromosome mapping using well known techniques for this purpose.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3 ' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes.
  • Fluorescence in situ hybridization of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with probes from the cDNA as short as 50 or 60 bp.
  • Verma et al Human Chromosomes: A Manual Of Basic Techniques, Pergamon Press, New York (1988).
  • the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V.
  • the primers for the first PCR reaction were the following: For M6a (5'TTYGGIGTSCAYTAYATHGTVTT; (SEQ ID NO:5) 576-fold degenerate), or For M6b (5'GTSYTBRTGCCICTHYTYGG; (SEQ ID NO:6) 1 152-fold degenerate), and Rev M7 (CTCDCCATTRCAGWARCAGTADAT; (SEQ ID NO:7) 72-fold degenerate) (Fig. 1). PCR was performed using 1 mg of zebrafish
  • Example 2 Isolation of partial cDNA clones encoding zPTHlR and zPTH3R
  • RNA from adult zebrafish was isolated as previously described (Rubin et al. , in press) and used as a template for RT-PCR (Gibco).
  • RT-PCR RT-PCR
  • For and Rev primers for RT-PCR were based on either zPTHlR or zPTH3R genomic DNA sequences corresponding to the mammalian exons M6/7 and M7, ZPTH1 R(TM6/7)/GEM-T and zPTH3R(TM6/7)/GEM-T. respectively (Fig. 1).
  • RT Reverse transcription
  • nPCR was performed using 2 ⁇ l of a 1 : 100 dilution from the initial zPTHl R or zPTH3R RT-PCR product, and either zPTHl PJRev 6(2) (5'AGAAACTTCTGTGTAAGGCATCGC) (SEQ ID NO: 12) or zPTH3R/Rev 6(2) (5 'AAGAGCCATGAAC AGCATGTAATG) (SEQ ID NO: 13), and the For 313 primer using the previous PCR profile except for 35 cycles.
  • zPTHlR and zPTH3R PCR products were identified on a 1.5% agarose gel with ethidium bromide, cDNA species of approximately 450 bp were cloned, as described above, into pGEM-T to yield zPTHlR(TM3/6)/pGEMT and zPTH3R(TM3/6)/pGEMT, respectively.
  • Example 3 Isolation of full-length cDNAs encoding the zPTHlR
  • RT-PCR using For313 and primers specific for zPTHlR(TM6/7) produced a 450 bp cDN A, zPTH 1 R(TM3/6), corresponding to TM3 through TM6 of the mammalian PTHIR. Subsequently, 5' and 3' RACE reactions were performed to generate overlapping sequences, and a full-length zPTHlR clone was constructed using a unique Mfel endonuclease restriction site (Fig. 1).
  • the first nPCR was performed using 5 ⁇ l of a 1 : 100 dilution from the previous PCR, Rev TM5 primer (5 ⁇ TATTGTTGTCTGGTGTCACATCT) (SEQ ID NO: 15), (KlenTaq, 5.0 units) (Clontech, CA), and the following PCR profile [initial denaturation at 95° for 3 min, [(denature at 94° for 1 min, anneal at 62° for 1 min, and polymerize at 72° for 2 min) for 35 cycles ⁇ with a final extension of 10 min at 72°].
  • a second nPCR was performed using 5 ⁇ l of a 1 : 100 dilution from the first nPCR, Rev 4x primer (5'CGCATTTGTTTCTCGAAGTTTTGTTGC) (SEQ ID NO: 16), Gibco Taq (5.0 units) and the same PCR profile as the first nPCR.
  • the second nPCR products were purified as described above and ligated into pGEM-T EASY (Promega) to yield zPTHlR(5')/pGEMTeasy, for transformation of TOP 10 E. coli cells (Invitrogen).
  • RT was performed as before but with an oligo-dT anchor primer (Gibco).
  • PCR was performed using the For TM3 primer (5'ATCTTCATGACCTTCTTCTCAGAC) (SEQ ID NO: 17), Gibco Taq (2.5 units) and the following profile [initial denaturation at 95 ° for 3 min, [(denature at 94° for 1 min, anneal at 64° for 1 min, and polymerize at 72° for 3 min) for 35 cycles ⁇ with a final extension of 10 min at 72 °].
  • nPCR was performed using the previous PCR profile with 5 ⁇ l of a 1 : 100 dilution from the previous PCR, and For 4(1) (5'AGGAAGTACCTCTGGGGCTTCA) (SEQ ID NO: 18).
  • the 3' RACE nPCR products were purified and cloned to yield zPTHlR(3 ')/pGEMTeasy.
  • Mi diprep DNA of zPTH 1 R( 5 ' )/pGEMTeasy and zPTHlR(3')/pGEMTeasy were digested with Mfe I and Nde I (New England Biolabs, Beverly, MA), and a 1.0 Kb fragment from zPTH 1 R(3 ') was ligated into an approximately 4.5 Kb fragment from zPTHlR(5')/pGEMTeasy to yield the full length zPTH l R clone, zPTH l R(FL)/pGEMTeasy.
  • the zPTHlR(FL)/pGEMTeasy plasmid DNA was digested with EcoRI and Sad, and cloned into the corresponding sites in pGEM-3 (Promega) to yield zPTHlR(FL)/pGEM3. Subsequently, an EcoRI/Sphl fragment, from the insert of zPTHlR(FL)/pGEM3 which comprises the entire coding region, of the zPTHlR was cloned into the corresponding sites of pcDNAI/Amp (Invitrogen) to yield zPTHlR(FL)/pcDNAI/Amp (zPTHlR).
  • the 5 ' RACE reactions generated two PCR products which contained an identical Kozak sequence and coding region (including the putative signal sequence) but varied in the length of the 5' UT; 5'RACE#29 was 149 bp and
  • 5'RACE#25 was 391 bp. Both clones, zPTHlR#25 and zPTHlR#29, were characterized by radioligand assay, total IP generation, and cAMP accumulation.
  • zPTH3R(TM6/7) contained, at the 5 ' and 3 ' end, nucleotide sequences which were similar to but distinct from zPTHlR and zPTH2R, and contained approximately 700 bp, rather than 84 bp, of intronic sequence. This information indicated that portions of a novel gene had been isolated, subsequently refered to as zPTH3R.
  • RT-PCR using For313 and primers specific for zPTH3R(TM6/7) produced a 450 bp cDNA clone, zPTH3R(TM3/6), which encodes TM3 through TM6 of the zPTH3R.
  • a zebrafish 1 gtl l cDNA library (Clontech) was screened by plaque hybridization using a 450 bp 32 P-radiolabeled cDNA probe which was generated by PCR from zPTH3R(TM3/6)/pGEMT. Filters containing 1.5 x 10 6 pfu were hybridized (42° for 18 hrs) in 50% formamide (Rubin et al, 1996), and washes were performed for 30 min each at RT, 50°, and at 55°, respectively, with lx SSC/0.1% SDS. Autoradiography was performed for 5 days at -70° with a DuPont Cronex intensifying screen and Kodak XAR film. A single phage was plaque-purified and subcloned into the EcoRI site of pcDNAI/Amp using the ⁇ TRAP phage kit (Clontech) to yield zeb3-37pcDNAI/Amp.
  • cDN A products were ligated to pGEMT-EAS Y (yielding zeb3-5 VpGEMT), minipreped, and their sequences analysed for homology to the known PTH receptors using GCG.
  • Inserts which were determined to contain a nucleotide sequence with homology to the signal sequence of the mammalian PTHIRs were ligated into zeb3- 37pcDNAI/Amp using sites for BamHI, ApaLI, and Notl to yield zPTH3R(FL)/pcDNAI/Amp (zPTH3R). From 1.5 x 10 6 screened PFUs, a single phage clone was identified and the 2.5 Kb insert was subcloned to yield zeb3-37pcDNAI/Amp.
  • E3 and El which encode portions of the amino-terminal extracellular domain of the PTHIRs.
  • These clones also contained a Kozak sequence and a nucleotide sequence with homology to the signal peptide sequence found in the mammalian PTHIRs (Schipani, Kong).
  • zPTHlR and zPTH3R contain the same eight extracellular cysteines as all known mammalian and non- mammalian members of this family of G protein-coupled receptors as well as several other "signature residues" (G protein coupled receptor database: Http://www.gcrdb.uthacsa.edu).
  • G protein coupled receptor database Http://www.gcrdb.uthacsa.edu.
  • N-X-S or N-X-T consensus sequences
  • Example 5 Functional characterization ofzPTHIR and zPTH3R in COS-7 cells
  • Plasmid DNAs encoding the two full length zPTHIRs (#25 and #29) and the zPTH3R were transiently expressed in COS-7 cells.
  • COS-7 African green monkey kidney cells (approximately 200,000 cells/well in a 24-well plate) were cultured and transfected with plasmid DNA (200 ng/well) as described (Rubin et al, 1998). After transfection, cells were cultured for 72 hrs at 37° with daily exchanges of medium, followed by an additional 24 hrs at 33 ° (Gardella et al, 1997) until they were functionally evaluated after 96 hrs.
  • Radioligand studies with COS-7 cells expressing either zPTHlR or zPTH3R were performed as described using either , 25 I-labeled [Nle 8 - 21 ,Tyr 34 ]rPTH-(l-34)amide (rPTH) (SEQ ID NO:22) or 125 I-labeled [Tyr 36 ]hPTHrP-(l-36)amide (PTHrP) (SEQ ID NO:23), and increasing concentrations of either [Tyr 4 ]hPTH(l-34)amide (PTH) (SEQ ID NO:24), or [Tyr 6 ]hPTHrP(l-36)amide (PTHrP) (SEQ ID NO:X) (Bergwitz).
  • Peptides were synthesized by the MGH polymer core facility as described (Gardella et al. , 1995 and 1996). Specific binding was calculated by subtracting radioligand binding in the presence of excess unlabeled peptide from the total binding. All points represent mean ⁇ S.E.M. of two to three replicates from two or more independent experiments (Tallarida and Jacob, 1979). IC 50 values (dose of a competing ligand which resulted in 50% inhibition of radioligand binding) were calculated as previously described (Gardella et al, 1996).
  • COS-7 cells In order to determine total inositol phosphate turnover for COS-7 cells expressing zPTHlR, zPTH3R, and hPTHlR, cells were grown in 6- well plates with COS-7 cells (approximately 200,00 cells/well transfected with either 1 ⁇ g/well of zPTHlR, zPTH3R, or hPTHlR (stina)). Cells were cultured for 3 days in DMEM/7% fetal bovine serum (FBS) at 37°C with daily exchanges of medium.
  • FBS fetal bovine serum
  • the cells were then preloaded with 3 ⁇ Ci/ml myo-[ 3 H] inositol (New England Nuclear, Boston, MA) in inositol-free DMEM (Gibco)/7% FBS (33°C for 18 hr). The following day, plates were rinsed and then incubated with 10 "6 M of either PTH, PTHrP in DMEM/0.1% BSA, or with DMEM/0.1% BSA alone (40 min at 37°C), in the presence of 30 mM LiCl.
  • IPs inositol phosphate
  • zPTH3R showed a higher specific binding for radiolabeled PTHrP than rPTH. Furthermore, the zPTH3R showed a higher apparent Kd for PTHrP than PTH (approximately 3nM versus approximately lOOnM, respectively). These results indicate that zPTH3R preferentially interacts with PTHrP. Similar to these binding data, COS-7 cells expressing the zPTHlR showed very similar EC 50s for cAMP accumulation in response to either PTH or PTHrP which is similar to the findings with mammalian PTHIRs (EC 50 : 0.8 ⁇ 0.03 nM for PTH and 0.3 ⁇ 0.04 nM for PTHrP, Table 2).
  • the zPTH3R showed a higher maximal cAMP accumulation (285.4 nM for PTH and 227.4 for PTHrP nM), but in contrast to the zPTHl R, zPTH3R showed a reduced efficacy for PTH
  • COS-7 cells expressing the zPTHlR showed an equivalent increase of IP accumulation (2-fold) when stimulated with either PTH or PTHrP. In contrast, despite higher expression levels, no IP accumulation was detectable when challenged with either ligand (Fig. 5). The lack of signaling through this second messenger may be related to significant structural alterations in the second intracellular loop of zPTH3R (Fig. 4). Previous studies with the rat PTHl R have shown that this portion of the receptor is important for IP signaling, since replacement of some residues in this "EKKY" cassette either impaired or abolished phospholipase C activation (Akiko).
  • the zPTHlR contains a conserved DRKY sequence instead of the mammalian EKKY, the corresponding AA residues of the zPTH3R are DKNC (Fig. 3). The two most important residues are therefore altered in the novel receptor which could explain the signaling selectivity of the zPTH3R.
  • the zPTH3R is therefore a naturally occurring PTH/PTHrP receptor which appears to be incapable of signaling through IP.
  • zPTHlR and zPTH3R are encoded by distinct genes.
  • three infrequently cutting restriction endonucleases were utilized to digest zebrafish genomic DNA to completion (Fig. 6). Approximately 16 ⁇ g of zebrafish genomic DNA was digested to completion with either BamHI, EcoRI, or Hindlll, split into two equal aliquots for electrophoresis through a 0.8% agarose gel containing ethidium bromide, and transferred onto a nitrocellulose membrane (MSI, Westborough, MA).
  • TM6 of either receptor showed multiple hybridizing DNA species, indicating that these probes cross hybridized with each others gene or with closely related genes (data not shown).
  • hybridizations were performed with radiolabeled probes comprising only the tail region of each receptor, zPTHlR tail or zPTH3R/tail, which showed the highest rates of sequence variation between PTH receptor subtypes.
  • zPTHlR tail or zPTH3R/tail which showed the highest rates of sequence variation between PTH receptor subtypes.
  • GCG was used for comparing the tail regions of zPTHlR, zPTH2R, zPTH3R, hPTHlR, and hPTH2R. A further analysis was performed within
  • the single most parsimonious Bootstrap consensus tree revealed two statistically significant PTH/PTHrP receptor clades; the PTH1R/PTH3R clade and the PTH2R clade (Fig.7). Furthermore, within the PTH 1 R/PTH3R clade, the PTHIR groups significantly different from PTH3R and, at least for the PTHIR, the terminal branches contained within are congruent with morphologically based phylogenies (Pough, 1989). Whereas the overall amino acid conservation between zPTHlR and zPTH3R is relatively high, particularly within the transmembrane region, multivariate analysis led to the identification of amino acid residues that may be specific for PTH3Rs (Fig. 3). Although additional PTH3R sequences from other species are required to confirm the receptor specificity of these residues, the limited number of amino acid changes may already allow mutational studies to explore their functional importance, particularly with regard to phospholipase C activation.
  • Residues comprising the tail region of the zPTHl R and zPTH3R were compared to corresponding regions of the zPTH2R, and the human PTHIR or PTH2R. %similarity/%identity are indicated.
  • PTHrP Parathyroid hormone-related peptide
  • the 69-84 amino acid region of the parathyroid hormone molecule is essential for the interaction of the hormone with the binding sites with carboxyl-terminal specificity. Endocrinology 137, 5537-5543.
  • Identical complementary deoxyribonucleic acids encode a human renal and bone parathyroid hormone (PTHVPTH-related peptide receptor. Endocrinology 132, 2157-2165.
  • PTH/PTHrP receptor splice variant that lacks the signal peptide. Endocrinology 138, 1742-1749.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Endocrinology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US1999/011883 1998-11-30 1999-05-28 Pth1r and pth3r receptors, methods and uses thereof Ceased WO2000032771A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU42172/99A AU4217299A (en) 1998-11-30 1999-05-28 Pth1r and pth3r receptors, methods and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US11046798P 1998-11-30 1998-11-30
US60/110,467 1998-11-30

Publications (1)

Publication Number Publication Date
WO2000032771A1 true WO2000032771A1 (en) 2000-06-08

Family

ID=22333168

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US1999/011883 Ceased WO2000032771A1 (en) 1998-11-30 1999-05-28 Pth1r and pth3r receptors, methods and uses thereof
PCT/US1999/028207 Ceased WO2000032775A1 (en) 1998-11-30 1999-11-30 Pth1r and pth3r receptors

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US1999/028207 Ceased WO2000032775A1 (en) 1998-11-30 1999-11-30 Pth1r and pth3r receptors

Country Status (5)

Country Link
US (3) US6541220B1 (enExample)
EP (1) EP1135489A1 (enExample)
JP (1) JP2002531091A (enExample)
AU (2) AU4217299A (enExample)
WO (2) WO2000032771A1 (enExample)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7572765B2 (en) 2001-07-23 2009-08-11 The General Hospital Corporation Conformationally constrained parathyroid hormone (PTH) analogs
US9057727B2 (en) 2007-08-01 2015-06-16 The General Hospital Corporation Screening methods using G-protein coupled receptors and related compositions
US9492508B2 (en) 2010-05-13 2016-11-15 The General Hospital Corporation Parathyroid hormone analogs and uses thereof

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000023594A1 (en) * 1998-10-22 2000-04-27 The General Hospital Corporation BIOACTIVE PEPTIDES AND PEPTIDE DERIVATIVES OF PARATHYROID HORMONE (PTH) AND PARATHYROID HORMONE-RELATED PEPTIDE (PTHrP)
US6417333B1 (en) * 1998-11-25 2002-07-09 The General Hospital Corporation Modified human parathyroid hormone
US6537965B1 (en) * 1998-11-25 2003-03-25 The General Hospital Corporation Amino-terminal modified parathyroid hormone (PTH) analogs
WO2000032771A1 (en) * 1998-11-30 2000-06-08 The General Hospital Corporation Pth1r and pth3r receptors, methods and uses thereof
US7057012B1 (en) * 1998-12-31 2006-06-06 The General Hospital Corporation PTH functional domain conjugate peptides, derivatives thereof and novel tethered ligand-receptor molecules
ATE308609T1 (de) 1998-12-31 2005-11-15 Gen Hospital Corp Pth rezeptor und testverfahren unter verwendung desselben
EP1147133B1 (en) * 1998-12-31 2008-08-06 The General Hospital Corporation Peptides consisting of two PTH functional domains fused by a linker molecule, and derivatives thereof
WO2001023521A2 (en) * 1999-09-29 2001-04-05 The General Hospital Corporation Polypeptide derivatives of parathyroid hormone (pth)
US6756480B2 (en) * 2000-04-27 2004-06-29 Amgen Inc. Modulators of receptors for parathyroid hormone and parathyroid hormone-related protein
KR100491737B1 (ko) * 2001-07-20 2005-05-27 주식회사 한국아이템개발 공기 정화 기능의 모기 퇴치기
AU2002951372A0 (en) * 2002-09-13 2002-09-26 St Vincent's Institute Of Medical Research Parathyroid hormone-like polypeptides
WO2004093902A1 (en) * 2003-03-19 2004-11-04 The General Hospital Corporation CONFORMATIONALLY CONSTRAINED PARATHYROID HORMONES WITH α-HELIX STABILIZERS
EP1653985A4 (en) * 2003-07-17 2009-08-05 Gen Hospital Corp FORCED PARATHORMON (PTH) ANALOGUE
US20060068426A1 (en) * 2004-08-20 2006-03-30 Tam James P Cyclic peptides and antibodies thereof
JP2009545320A (ja) * 2006-08-04 2009-12-24 ザ ジェネラル ホスピタル コーポレイション 副甲状腺ホルモン(pth)のポリペプチド誘導体
EP1961765A1 (en) * 2006-12-08 2008-08-27 Zealand Pharma A/S Truncated PTH peptides with a cyclic conformation
US20110256557A1 (en) * 2008-10-31 2011-10-20 Discoverybiomed, Inc. Identifying parathyroid hormone agonists and antagonists
WO2018026748A1 (en) * 2016-08-01 2018-02-08 Xoma (Us) Llc Parathyroid hormone receptor 1 (pth1r) antibodies and uses thereof
JP2021516222A (ja) 2018-03-16 2021-07-01 ザ ジェネラル ホスピタル コーポレイション 副甲状腺ホルモンポリペプチドコンジュゲートおよびその使用方法
WO2022235929A1 (en) * 2021-05-05 2022-11-10 Radius Pharmaceuticals, Inc. Animal model having homologous recombination of mouse pth1 receptor
CN114874325B (zh) * 2022-06-01 2023-02-14 南京医科大学 抗人pth1r胞外区阻断型单域抗体及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992017602A1 (en) * 1991-04-05 1992-10-15 The General Hospital Corporation Office Of Technology Affairs Parathyroid hormone receptor and dna encoding same

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4423037A (en) 1982-05-13 1983-12-27 The General Hospital Corporation Inhibitors of peptide hormone action
US5010010A (en) 1986-10-22 1991-04-23 Selmer-Sande, A.S. Production of human parathyroid hormone from microorganisms
US5462856A (en) 1990-07-19 1995-10-31 Bunsen Rush Laboratories, Inc. Methods for identifying chemicals that act as agonists or antagonists for receptors and other proteins involved in signal transduction via pathways that utilize G-proteins
US5208041A (en) 1991-05-23 1993-05-04 Allelix Biopharmaceuticals Inc. Essentially pure human parathyroid hormone
AU3322593A (en) 1991-12-17 1993-07-19 Procter & Gamble Pharmaceuticals, Inc. Methods for the treatment of osteoporosis using bisphosphonates and parathyroid hormone
US5814603A (en) 1992-06-12 1998-09-29 Affymax Technologies N.V. Compounds with PTH activity
US5589452A (en) 1992-07-14 1996-12-31 Syntex (U.S.A.) Inc. Analogs of parathyroid hormone and parathyroid hormone related peptide: synthesis and use for the treatment of osteoporosis
US5496801A (en) 1993-12-23 1996-03-05 Allelix Biopharmaceuticals Inc. Parathyroid hormone formulation
WO2000023594A1 (en) * 1998-10-22 2000-04-27 The General Hospital Corporation BIOACTIVE PEPTIDES AND PEPTIDE DERIVATIVES OF PARATHYROID HORMONE (PTH) AND PARATHYROID HORMONE-RELATED PEPTIDE (PTHrP)
US6537965B1 (en) * 1998-11-25 2003-03-25 The General Hospital Corporation Amino-terminal modified parathyroid hormone (PTH) analogs
US6417333B1 (en) * 1998-11-25 2002-07-09 The General Hospital Corporation Modified human parathyroid hormone
WO2000032771A1 (en) * 1998-11-30 2000-06-08 The General Hospital Corporation Pth1r and pth3r receptors, methods and uses thereof
ES2316354T3 (es) 1999-09-29 2009-04-16 The General Hospital Corporation Derivados polipeptidos de la hormona paratiroidea (pth).

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992017602A1 (en) * 1991-04-05 1992-10-15 The General Hospital Corporation Office Of Technology Affairs Parathyroid hormone receptor and dna encoding same

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
JÜPPNER H ET AL.: "A G protein-linked receptor for parathyroid hormone and parathyroid hormone-related peptide", SCIENCE, vol. 254, 15 November 1991 (1991-11-15), pages 1024 - 1026, XP002115899 *
MCCUAIG K.A. ET AL.: "Molecular cloning of the gene encoding the mouse parathyroid hormone/parathyroid hormone-related peptide receptor", PROC. NATL. ACAD. SCI. USA, vol. 91, May 1994 (1994-05-01), pages 5051 - 5055, XP002115901 *
RUBIN D.A. & JÜPPNER J.: "Parathyroid hormone (PTH)/PTH-related (PTHRP) receptor cloning and in situ hybridizaion in the zebrafish, Danio rerio", AMERICAN ZOOLOGIST, vol. 37, no. 5, 1997, pages 181A, XP002115900 *
RUBIN D.A. ET AL.: "Molecular cloning and expression of receptors for parathyroid hormone (PTH) and PTH-related (PTHrP) protein in zebrafish", AMERICAN ZOOLOGIST, vol. 36, no. 5, 1996, pages 97A, XP002115903 *
TURNER P.R. ET AL.: "Transmembrane residues togehter with the amino terminus limit the response of the parathyroid hormone (PTH) 2 receptor to PTH-related peptides", J. BIOL. CHEM., vol. 273, no. 7, 13 February 1998 (1998-02-13), pages 3830 - 3837, XP002115902 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7572765B2 (en) 2001-07-23 2009-08-11 The General Hospital Corporation Conformationally constrained parathyroid hormone (PTH) analogs
US9057727B2 (en) 2007-08-01 2015-06-16 The General Hospital Corporation Screening methods using G-protein coupled receptors and related compositions
US9492508B2 (en) 2010-05-13 2016-11-15 The General Hospital Corporation Parathyroid hormone analogs and uses thereof

Also Published As

Publication number Publication date
WO2000032775A9 (en) 2001-03-29
US20030162256A1 (en) 2003-08-28
AU4217299A (en) 2000-06-19
WO2000032775A1 (en) 2000-06-08
EP1135489A1 (en) 2001-09-26
US7078487B2 (en) 2006-07-18
US20060228353A1 (en) 2006-10-12
JP2002531091A (ja) 2002-09-24
US6541220B1 (en) 2003-04-01
AU1926000A (en) 2000-06-19

Similar Documents

Publication Publication Date Title
US7078487B2 (en) PTH1R receptors
JP2002531091A5 (enExample)
EP1007563A1 (en) Hm74a receptor
CA2231748A1 (en) Novel g-protein coupled receptor (hfgan72x)
EP1104440A1 (en) A g-protein coupled 7tm receptor (axor-1)
WO1999060019A1 (en) HUMAN EDG3sb GENE
EP1062238A1 (en) Ecr673: a 7-transmembrane g-protein coupled receptor
WO1999042484A1 (en) Fishboy, a g-protein coupled receptor
WO1999055733A1 (en) Cloning of a novel 7tm receptor axor-2
WO2000028083A1 (en) Mouse 7-transmembrane receptor gpr43
JPH10243788A (ja) 新規ヒト7−トランスメンブランレセプターをコードするcDNAクローンHNFJD15
EP1071708A1 (en) Edg family gene, human h218
EP1098904A1 (en) Axor10, a g-protein coupled receptor
US20020052330A1 (en) Molecular cloning of a chemokine receptor (SBELEVTM)
WO1999049040A1 (en) HUMAN G-PROTEIN COUPLED RECEPTOR GPR6sb
EP1104483A1 (en) Molecular cloning of a 7tm receptor (gpr31a)
EP1129101A1 (en) A novel g-protein coupled 7tm receptor (axor15)
WO1999064021A1 (en) hCEPR RECEPTOR
WO1999042603A1 (en) GABAB-R2a, A 7TM RECEPTOR
EP1155031A2 (en) Axor14, a g-protein coupled receptor
WO1999053054A1 (en) Axor4 g-protein-coupled receptor
EP1068235A1 (en) G-protein coupled receptors
WO2000012106A1 (en) Gabab1aa receptor
WO1999045030A1 (en) Human g-protein coupled receptor (gpr25)
WO2000028818A1 (en) 7-transmembrane receptor mouse kiaa0001

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase