WO2000032761A1 - Facteur 1 de reponse ethylenique (erf1) dans des vegetaux - Google Patents

Facteur 1 de reponse ethylenique (erf1) dans des vegetaux Download PDF

Info

Publication number
WO2000032761A1
WO2000032761A1 PCT/US1999/028104 US9928104W WO0032761A1 WO 2000032761 A1 WO2000032761 A1 WO 2000032761A1 US 9928104 W US9928104 W US 9928104W WO 0032761 A1 WO0032761 A1 WO 0032761A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
ethylene
erfl
nucleic acid
response
Prior art date
Application number
PCT/US1999/028104
Other languages
English (en)
Other versions
WO2000032761A8 (fr
Inventor
Joseph R. Ecker
Roberto J. Solano
Original Assignee
The Trustees Of The University Of Pennsylvania
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Trustees Of The University Of Pennsylvania filed Critical The Trustees Of The University Of Pennsylvania
Priority to EP99967157A priority Critical patent/EP1141270A4/fr
Priority to AU23495/00A priority patent/AU2349500A/en
Priority to JP2000585392A priority patent/JP2002541763A/ja
Priority to BR9915704-7A priority patent/BR9915704A/pt
Priority to CA002352468A priority patent/CA2352468A1/fr
Priority to IL14333899A priority patent/IL143338A0/xx
Publication of WO2000032761A1 publication Critical patent/WO2000032761A1/fr
Publication of WO2000032761A8 publication Critical patent/WO2000032761A8/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8237—Externally regulated expression systems
    • C12N15/8238—Externally regulated expression systems chemically inducible, e.g. tetracycline
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8249—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving ethylene biosynthesis, senescence or fruit development, e.g. modified tomato ripening, cut flower shelf-life
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/8266—Abscission; Dehiscence; Senescence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance

Definitions

  • the invention relates to the Ethylene-Response-Factorl (ERFl) and its function in the ethylene gas signaling pathway in plants.
  • EMFl Ethylene-Response-Factorl
  • the existence of a hierarchy of enzymes in the biosynthetic and signaling pathways provides a means to finely regulate the complex plant response to ethylene as a growth or maturation regulator and/or stress or injury signal.
  • ethylene C 2 H 4
  • This gaseous molecule is well known for its participation in physiological processes as diverse as fruit ripening, senescence, abscission, germination, cell elongation, sex determination, pathogen defense response, wounding, nodulation and determination of cell fate (Abeles et al. (1992) in Ethylene in Plant Biology, Academic Press, Inc., New York; Tanimoto et al, Plant J.
  • abscission zone a particular layer of cells in a zone located between the base of the leaf stalk and the stem (the abscission zone) responds to a complex combination of ethylene and other endogenous plant growth regulators by a process that is, to date, not fully understood.
  • the effect of abscission is the controlled loss of part of the plant, typically localized; the result of which is visible as a dead leaf or flower, or as softening or "ripening" of fruit, ultimately leaving the plant wounded at the point of separation.
  • the synthetic pathway of ethylene has been well characterized (Kende, Plant Physiol, Pi: 1-4 (1989)).
  • the conversion of ACC to ethylene is catalyzed by ethylene forming enzyme (Spanu et al, EMBO J 10:2007 (1991)).
  • SAM S-adenosyl-1 methionine
  • ACC 1 aminocyclopropane-1-carboxylic acid
  • ethylene is produced from ACC by an ACC oxidase.
  • the pathway therefore, utilizes multiple ACC synthases and ACC oxidases, creating a cascade or hierarchy of enzymes in the biosynthetic pathway and providing a means for regulating the complex plant response.
  • ETR1, ETR2 and EIN4 genes act upstream of CTR1
  • EIN2, EIN3, EIN5/AIN1, EIN6 and E1N7 genes act downstream of CTRL
  • the other class of mutants display constitutive ethylene response phenotypes in the absence of exogenously applied hormones.
  • this class was further divided into those mutants that display a "constitutive" triple response phenotype as a result of either ethylene overproduction (etol, eto2 and eto3) (Guzman and Ecker, 1990; Kieber et al, Cell 72:427-441 (1993)), or constitutive activation of the pathway (ctrl; constitutive triple response) (Kieber et al, 1993).
  • CTR1 has been identified as a negative regulator of the ethylene response pathway.
  • the CTR1 gene encodes a protein with similarity to the Raf-family of protein kinases, implicating a MAP-kinase cascade in the ethylene response pathway (Kieber et al, 1993)).
  • Coupling of a "bacterial"-type receptor and "Raf -like protein kinases in the osmo-sensing pathway in yeast is provided by phospho-relay proteins (Posas et al, Cell 86: 865-875 (1996)). While several proteins with both structural and functional similarity to response regulators have been identified in Arabidopsis (Imamura et al, Proc. Natl Acad. Sci. USA 95:2691-2696 (1998)), the ethylene receptors ETR1 and ERS1 (Chang, Trends Biochem. Sci.
  • EIL EIN3-LIKE
  • ethylene-responsive genes The most extensively studied of the various classes of ethylene-responsive genes, are the secondary response genes, whose expression is activated by ethylene in response to attack by pathogens. These include basic-chitinases, ⁇ -l,3-glucanases, defensins and other pathogenesis-related (PR) proteins (Boiler et al, Planta 157:22-31 (1983); Felix et al, Planta 167:206-211(1986); Broglie et al, Plant Cell 1 :599-607 (1989); Ohme- Takagi et al, Plant Mol Biol 15:941-946 (1990); Samac et al, Plant Physiol.
  • PR pathogenesis-related
  • Efhylene-Responsive-Element-Binding-Proteins (Ohme-Takagi et ⁇ l, 1995). These novel DNA-binding proteins interact in vitro with the GCC box through a domain homologous to that previously observed in the floral homeotic protein APETALA2 (Ecker, 1995; Weigel, Plant Cell 7:388-389 (1995)).
  • Arabidopsis over thirty genes belonging to this family have been identified by several groups (Wilson et al, Plant Cell 8:659-671 (1996); Buttner et al, Proc. Natl Acad. Sci. USA 94:5961-5966 (1997); Okamuro et al, Proc. Nail Acad. Sci. USA 94:7076-7081 (1997)) and as result of the Arabidopsis Genome Initiative (Bevan et al, Plant Cell 9:476-478 (1997), Ecker, Nature 391 :438-439 (1998)).
  • the present invention enhances the development of methods for improving the tolerance of plants to stress, injury or pathogens, as well as for developing easier and more efficient methods for identifying stress- or injury- or pathogen-tolerant plants.
  • plant food products such as fruits and vegetables, flowers and flowering ornamentals, and other non-food plant products, such as commercially valuable crops, e.g. , cotton or flax, or ornamental green plants, thereby providing more and better products for market in both developed and underdeveloped countries.
  • the present invention relates to the cloning and characterization of Ethylene Response Factor 1 (ERFl), an early responsive gene, encoding a GCC-box binding protein.
  • ERFl Ethylene Response Factor 1
  • EIN3 expression is both necessary and sufficient for ERFl transcription.
  • constitutive expression of ERFl results in the modulation of a variety of ethylene response genes and phenotypes.
  • EIN3 and EILs are demonstrated to be novel, sequence-specific DNA-binding proteins that bind a primary response element in the promoter of ERFl. Consistent with the findings in the biochemical studies, genetic analysis revealed that ERFl acts downstream of EIN3 and all previously identified members of the ethylene gas signaling pathway.
  • the present invention provides an isolated nucleic acid encoding a plant ethylene response factor, which is activated by EIN3 or an EIN3-like (EIL) peptide in the plant ethylene signaling pathway, wherein the activated factor binds to a target GCC-box in a secondary ethylene response gene. It also provides an isolated nucleic acid comprising ERFl, as well mutants, derivatives, homologues or fragments of ERFl, encoding an expression product having ERFl -activity. It further provides the nucleic acid comprising SEQ ID NO:l . In addition, the invention provides a purified polypeptide encoded by the above- identified nucleic acids.
  • polypeptide comprising ERFl, as well as homologues, analogs, derivatives or fragments thereof, having GCC-box binding activity in a target secondary response gene. It further provides the polypeptide comprising SEQ ID NO:2, as well as the polypeptide, wherein ERFl GCC-box binding activity is E1N3- or EiZ-dependent.
  • the invention also provides a recombinant cell comprising the above-identified isolated nucleic acids.
  • the invention further provides a vector comprising the above-identified isolated nucleic acids.
  • the invention further provides an antibody specific for a plant ⁇ RF1 polypeptide, and homologues, analogs, derivatives or fragments thereof, having GCC-box binding activity in a target secondary response gene. It also provides an isolated nucleic acid sequence comprising a sequence complementary to all or part of the ERFl nucleic acid sequence, and to mutants, derivatives, homologues or fragments thereof encoding a GCC-box binding expression product in a target secondary response gene. Thus, the invention also provides the nucleic acid having antisense activity at a level sufficient to regulate, control, or modulate the secondary ethylene response activity of a plant, plant cell, organ, flower or tissue comprising same.
  • the present invention provides a plant, plant cell, organ, flower, tissue, seed, or progeny comprising any of the above identified nucleic acids, including ERFl, wherein the plant cells, organs, flowers, tissues, seeds or progeny include those of a transgenic plant. Moreover, the invention is intended to include transgenic plants, plant cells, organs, flowers, tissues, seeds or progeny comprising the aforementioned recombinant nucleic acids or polypeptides.
  • the invention provides an isolated nucleic acid, further comprising a plant ERFl promoter sequence, or a fragment thereof having ERFl promoter activity; as well as a transgenic plant, the cells, organs, flowers, tissues, seed, or progeny of which contain a transgene comprising the ERFl promoter sequence.
  • the invention further provides an isolated ERFl nucleic acid, which further comprises a reporter gene operably fused thereto, or a fragment thereof having reporter activity.
  • the invention also provides a method for manipulating in a plant the ERFl nucleic acid to permit the regulation, control or modulation of the ethylene response in said plant. It further provides such a method, whereby the regulation, control or modulation results in the initiation or enhancement of germination, cell elongation, sex determination, flower or leaf senescence, flower maturation, fruit ripening, insect, herbicide or pathogen resistance, abscission, or response to stress, injury or pathogens in the plant.
  • the disclosed regulation, control or modulation method provides for the inhibition or prevention of germination, cell elongation, sex determination, flower or leaf senescence, flower maturation, fruit ripening, insect, herbicide or pathogen resistance, abscission, or response to stress, injury or pathogens in the plant.
  • the disclosed regulation, control or modulation method provides for the activation or enhancement of germination, cell elongation, sex determination, flower or leaf senescence, flower maturation, fruit ripening, insect, herbicide or pathogen resistance, abscission, or response to stress, injury or pathogens in the plant.
  • the invention also provides a method of identifying a compound capable of affecting the ethylene response in the ethylene signaling system in a plant comprising: providing a cell comprising an isolated nucleic acid encoding a plant ERFl sequence, having a reporter sequence operably linked thereto; adding to the cell a compound being tested; and measuring the level of reporter gene activity in the cell, wherein a higher or lower level of reporter gene activity in the cell compared with the level of reporter gene activity in a second cell to which the compound being tested was not added is an indicator that the compound being tested is capable of affecting the expression of a plant ERFl gene.
  • the invention provides a method for generating a modified plant with enhanced ethylene response activity as compared to that of comparable wild type plant comprising introducing into the cells of the modified plant an isolated nucleic acid encoding ERFl, wherein said ERFl nucleic acid binds to the GCC-box, thereby activating target secondary ethylene response genes of the modified plant.
  • a method for generating a modified plant with enhanced ethylene response activity as compared to that of comparable wild type plant comprising introducing into EIN3- or EIL-defective or deficient cells of the modified plant an isolated nucleic acid encoding EIN3 or EIL, wherein said E/N5 or EIL nucleic acid activates the ⁇ RF1 gene, thereby permitting activation of target secondary ethylene response genes of the modified plant.
  • the invention further provides a method for generating a plant with diminished or inhibited ethylene response activity as compared to that of a comparable wild type plant comprising binding or inhibiting the ⁇ RF1 molecules within the cells of the modified plant by introducing into said cells an isolated nucleic acid encoding a complementary nucleic acid to all or a portion of erf 1, wherein said erfl nucleic acid would otherwise bind to the GCC-box, thereby activating target secondary ethylene response genes of the modified plant.
  • a method for generating a plant with diminished or inhibited ethylene response activity as compared to that of a comparable wild type plant comprising binding or inhibiting the ERFl molecules within the cells of a modified plant by introducing into said cells an antibody to all or a portion of ERFl, wherein said ERFl polypeptide would otherwise bind to the GCC-box, thereby activating target secondary ethylene response genes of the modified plant.
  • a method for generating a plant with diminished or inhibited ethylene response activity as compared to that of a comparable wild type plant comprising binding or inhibiting the EIN3 or EIL molecules within the cells of a modified plant by introducing into said cells an antibody to all or a portion of ELN3 or EIL, wherein said EIN3 or EIL polypeptide would otherwise activate the expression of ERFl, thereby permitting activation of target secondary ethylene response genes of the modified plant.
  • the invention also provides a method for manipulating the expression of ERFl in a plant cell comprising: operably fusing the nucleic acid ERFl or an operable portion thereof to a plant promoter sequence in the plant cell to form a chimeric DNA, and generating a transgenic plant, the cells of which comprise said chimeric DNA, whereupon by controlling activation of the plant promoter, one can manipulate expression of ERFl
  • Figure 1 shows nuclear events in the ethylene gas signaling pathway. Shown is a model of the transcriptional regulatory cascade that mediates ethylene responses.
  • Figure 2 sets forth the results of cloning and ethylene inducibility of ERFl.
  • Figure 2A depicts the Northern blot analysis of ERFl mRNA expression induced in the presence of ethylene gas and its comparison with the induced expression of PDF 1.2.
  • Figure 2B depicts the Northern blot analysis of the expression of ERFl mRNA in EIN3- overexpressing plants.
  • Figure 2C depicts the Northern blot analysis of the cycloheximide induction of ERFl expression. Numbers above the lanes indicate ⁇ M concentrations of cycloheximide (ex).
  • FIG. 3 sets forth the data showing that EIN3 is a sequence specific DNA- binding protein.
  • Figure 3A shows the electrophoretic mobility shift assay (EMSA) of EIN3 protein, translated in vitro, binding to the -1238 to -950 fragment of the ERFl promoter. A control protein (control) or mock translated reticulocyte lysate (RL) was used in the indicated lanes.
  • Figure 3B shows the EMSA of ELN3-3 mutant protein, ELN3 and several deletion derivatives bound to fragments -1238 to -1204 (1) and -1213 to - 1178 (2) of the ERFl promoter.
  • Figure 3C shows the competition of the interaction of EIN3 with its target site, the EIN3 Binding Site (EBS) by addition of anti-ELN3 antibodies (Ab-EIN3).
  • PI stands for pre-immune serum.
  • Figure 4 sets forth data to characterize the EBS.
  • Figure 4 A depicts scan mutagenesis of the EBS. Wild-type EBS is shown with the palindromic repeats indicated by arrows. Base changes in the mutants tested are indicated. Dots indicate similar bases as in the wild-type EBS (Wt EBS).
  • Figure 4B depicts the sequence alignment of the EBS and a fragment of the promoters of E4 and GST1 genes (including the ERE).
  • Figure 5 sets forth data to characterize the EBS.
  • Figure 5 A shows the competition of the EIN3-EBS complex formation by addition of an excess of unlabelled EBS or two mutant versions, EBSml and EBSm2. No competitor was added in the lanes marked as 0. Black triangles represent increasing amounts of competitor (20, 60 and 200 nanograms).
  • Figure 5B shows a summary of ELN3 structural features and mutants used in EMSA experiments.
  • Figure 6 shows ELN3 homo-dimerization.
  • Figure 6A depicts EMSA of full size ELN3 and deletion derivatives binding to the EBS.
  • Figure 6B shows E ⁇ N3-ELN3 interactions assayed by the yeast "two-hybrid" system.
  • Yeast cells transformed with the indicated constructs as shown in the top-left plate were grown on synthetic complete (SC) medium containing histidine (+HIS) or in SC medium without histidine (-HIS) and with 50 mM 3-aminotriazole (3-AT, Sigma) to repress basal activity of the his3 reporter gene, ⁇ -gal activity of the colonies grown in -HIS (lacZ) was determined by the filter-lift assay.
  • FIG. 6C depicts binding of EIL proteins to the ELN3 target site in the ERFl promoter.
  • EMSA was performed using in vitro translated EIN3, EIL1, EIL2 and EIL3 proteins and the wild- type EBS (W) or mutant (M) version, wherein the mutant exhibits a mutation at position 17 from G to C, as shown in Figure 4.
  • Figure 7 shows data in support of ERFl as a GCC box DNA binding protein.
  • Electrophoretic mobility shift assays were performed using in vitro translated ERFl protein and promoter fragments from the Arabidopsis basic-chitinase (b-CHI) and bean chitinase5B (CH5B) genes. DNA fragments containing the GCC box or mutated versions (b-CHIm and CH5Bm) of these same elements were incubated with control, mock-translated rabbit reticulocyte lysate or those containing ELN3 protein.
  • b-CHI Arabidopsis basic-chitinase
  • CH5B bean chitinase5B
  • Figure 8 depicts constitutive activation of ethylene response phenotypes in iJS.-.'ERFi-expressing seedlings.
  • Transgenic seedlings overexpressing ERFl in wild type (Col-0) and ein3 mutant backgrounds were grown in continuous flow-through chambers with hydrocarbon-free air in agar with or without 10 ⁇ M ACC. Untransformed wild-type and ein3 mutant plants are also shown for comparison.
  • Figure 9 shows that ⁇ RF 1 acts downstream of ⁇ IN2 and ELN3 in the ethylene signaling pathway.
  • Transgenic plants overexpressing ERFl in wild type (Col-0), ein2, einS-1 and ein3-3 mutant backgrounds were grown in continuous flow-through chambers with hydrocarbon-free air for 5 weeks. Untransformed wild-type, ctrl-l and E1N3- overexpressing plants are shown for comparison.
  • Figure 10 shows transcriptional activation of ethyl ene-responsive genes by ERFl.
  • Figure 10A depicts Northern blot analysis (total RNA) of the expression of ethylene- induced genes in transgenic lines overexpressing ERFl in Wt (Col-0) and ethylene insensitive mutant backgrounds. Five independent transgenic lines in Col-0 and 2 independent lines in each of the mutants are shown. The same blot was probed with ethylene-induced genes PDF 1.2 and basic-chitinase, ERFl and a loading control probe (rDNA).
  • Figure 10B shows constitutive activation of the ethylene-induced CH5B-GUS reporter gene in ERFl -overexpressing transgenic plants.
  • Cascades of enzymes are a common theme in gene regulation, present in virtually all organisms from bacteria to humans, and involved in the regulation of processes as diverse as nitrogen fixation, embryogenesis, cell differentiation, response to pathogens, injury or extracellular signals, or circadian rhythmicity.
  • the existence of a hierarchy or cascade of transcription factors and enzymes in the signaling pathway for ethylene therefore, provides a means for regulating the complex plant response to this gaseous plant growth regulator/stress signal.
  • the present invention provides the cloning and characterization of Ethylene- Response-F actor 1 (ERFl), an early ethylene responsive gene, which encodes a GCC-box binding protein.
  • ERFl Ethylene- Response-F actor 1
  • EIN3 expression is both necessary and sufficient for ERFl transcription.
  • the constitutive expression of ERFl results in activation of a variety of ethylene response genes and phenotypes.
  • ELN3 and EILs are demonstrated to be novel sequence-specific DNA-binding proteins that bind a primary ethylene response element in the promoter of ERFl. Consistent with the biochemical studies, genetic analysis revealed that ERFl acts downstream of E1N3 and all previously identified components in the ethylene gas signaling pathway.
  • EIN3 or EIL
  • ERFl DNA binding proteins adds a new level of complexity in the regulatory hierarchy of the ethylene-signaling pathway.
  • binding of ethylene (C 2 H 4 ) to membrane receptors activates EIN3, and apparently EIL1 and EIL2, through a signaling cascade described elsewhere (Chao et al, 1997).
  • EIN3 directs the expression of ERFl and other primary target genes by directly binding, as a dimer, to the primary ethylene response element (PERE) present in their promoters.
  • PROE primary ethylene response element
  • ERFl is sufficient and necessary for ERFl expression, other factors, e.g., EIL activity, may be required for full ethylene-dependent ERFl induction. Consistent with this observation, HOOKLESS1, which contains a GCC element in its promoter, is not induced in ERFl transgenic plants, indicating that ERFl is responsible for the activation of a subset of the ethylene-responsive GCC-box-containing target genes.
  • GCC-box-containing secondary response genes of the ethylene signaling pathway which are activated or modulated by the ERFl of the present invention are referred to herein simply as the "target genes” or “target secondary ethylene response genes” or genes having "the described GCC-box binding capability.”
  • target genes or “target secondary ethylene response genes” or genes having "the described GCC-box binding capability.”
  • ERFl activates the transcription of downstream target secondary ethylene response genes.
  • ERFl binds to the GCC box (secondary ethylene response element, SERE), thereby activating the expression of certain secondary ethylene response genes, such as basic-chitinases and defensins (PDF1.2).
  • SERE secondary ethylene response element
  • PDF1.2 basic-chitinases and defensins
  • the secondary ethylene response genes are also referred to herein as ethylene-inducible target genes or effector genes in the ethylene signaling pathway.
  • the EREBP family of DNA-binding proteins have been identified based on their ability to bind to the GCC-box, and element that has been identified as being necessary for ethylene inducibility in response to pathogen attack as reviewed by Deikman, Physiol. Plantarum 100:561-566 (1997).
  • interactions between EREBPs and bZIP transcription factors, as well as synergistic effects of their DNA target sites, the GCC box and G box, have been previously described (Hart et al, 1993; Sessa et al, 1995; Buttner et al, 1997).
  • ERFl although a member of the ethylene response cascade, is neither anticipated nor suggested by known members of the EREBP family.
  • one member of the Arabidopsis AP2/EREBP family, AtEBP is reportedly regulated by ethylene (Buttner et al, 1997), and like ERFl, AtEBP is constitutively expressed in ctrl mutants.
  • AtEBP does not appear to be a direct target of ELN3 since its expression in response to ethylene is cycloheximide-dependent, suggesting a regulatory cascade exists among members of the EREBP family in which AtEBP acts downstream of ERFl.
  • Ethylene is an olefin, therefore its receptors are presumed to require coordination of a transition metal for hormone binding activity.
  • ethylene binding to its receptor inactivates the activity of ethylene receptors (presumably causing a reduction in the histidine kinase activity), and consequently causing induction of the ethylene response through activation (de-repression) of the signaling pathway.
  • a screen was initiated for Arabidopsis thaliana mutants that exhibited an ethylene-like triple response phenotype in response to a potent hormone antagonist.
  • the "triple response" in Arabidopsis consists of three distinct morphological changes in dark-grown seedlings upon exposure to ethylene: 1) inhibition of hypocotyl and root elongation, 2) radial swelling of the stem and 3) exaggeration of the apical hook.
  • a class of constitutive mutants, ctr display a constitutive triple response in the presence of ethylene biosynthetic inhibitors, and is affected at, or downstream of the receptor. Screening includes screening for root or stem elongation and screening for increased ethylene production.
  • plant as used herein, is meant any plant and any part of such plant, be it wild type, treated, genetically manipulated or recombinant, including transgenic plants.
  • the term broadly refers to any and all parts of the plant, including plant cell, tissue, flower, leaf, stem, root, organ, and the like, and also including seeds, progeny and the like, whether such part is specifically named or not.
  • Modified plants are plants in which the wild-type gene or protein character has been altered. Phenotypic alterations may enhance or inhibit a typical wild-type response in or by the plant cells; or there may be no phenotypic effect whatsoever. As one skilled in the art will recognize, absolute levels of endogenous ethylene production by a plant or plant cell will change with growth conditions.
  • ethylene sensitive plants including wild type plants or plants in which the signaling cascade is complete
  • secondary ethylene responses are activated by ERFl .
  • Such plants or plant cells typically demonstrate a shut-down or diminution of endogenous gas production in the presence of high concentrations of exogenous ethylene.
  • an "ethylene insensitive” plant or plant cell typically continues to produce endogenous ethylene, despite administration of inhibitory amounts of exogenous ethylene.
  • An ethylene insensitive plant will produce more ethylene or produce it at a rate greater than that of a wild type plant upon administration of an inhibitory amount of exogenous ethylene.
  • ethylene insensitivity includes either a total or partial inability to display the triple response in the presence of increased levels of exogenous ethylene, such as would be expected if the ethylene signaling pathway in were interrupted in the plant or plant cell.
  • the impaired receptor function resulting from blocking or inhibiting the expression of the E1N3 (or EIL) or ERFl genes will be displayed as constitutive production of endogenous ethylene, despite the presence of an abundance of exogenous ethylene.
  • nucleic acid sequences include, but are not limited to DNA, including and not limited to cDNA and genomic DNA; RNA, including and not limited to mRNA and tRNA, and may include chiral or mixed molecules.
  • Preferred nucleic acid sequences include, for example, the sequence set forth in
  • SEQ ID No: 1 as well as modifications of the nucleic acid sequence, including alterations, insertions, deletions, mutations, homologues and fragments thereof encoding the active region of ERFl or an ERFl -type regulatory protein in the ethylene response pathway capable of ERFl -GCC-box binding activity resulting in modulation of the expression of a target secondary ethylene response gene.
  • Modulation of expression by ERFl preferably means activation of expression, although in the present invention it is also meant to include enhanced expression of the target genes. Depending on conditions, however, it is also meant to include inhibition or prevention of expression of the target genes.
  • a "fragment" of a nucleic acid is included within the present invention if it encodes substantially the same expression product as the isolated nucleic acid, or if it encodes a peptide having the described GCC-box binding capability.
  • the invention should also be construed to include peptides, polypeptides or proteins comprising ERFl, or any mutant, derivative, variant, analogs, homologue or fragment thereof, having the described GCC-box binding capability in the ethylene signaling pathway.
  • protein protein
  • peptide polypeptide
  • protein sequences are used interchangeably within the scope of the present invention, and include, but are not limited to the sequence set forth in SEQUENCE ID NO: 2, the putative amino acid sequences corresponding to nucleic acid SEQUENCE ID NO: 1, as well as those sequences representing mutations, derivatives, analogs or homologues or fragments thereof having the described GCC-box binding capability in the ethylene response pathway.
  • the invention also provides for analogs or homologues of proteins, peptides or polypeptides encoded by the gene of interest, preferably ERFl.
  • Analogs can differ from naturally occurring proteins or peptides by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both, "homologues" are chromosomal DNA carrying the same genetic loci; when carried on a diploid cell there is a copy of the homologue from each parent. For example, conservative amino acid changes may be made, which although they alter the primary sequence of the peptide, do not normally alter its function.
  • Conservative amino acid substitutions of this type are known in the art, e.g., changes within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; or phenylalanine and tyrosine.
  • Modifications include in vivo or in vitro chemical derivatization of the peptide, e.g., acetylation or carbonation. Also included are modifications of glycosylation, e.g., modifications made to the glycosylation pattern of a polypeptide during its synthesis and processing, or further processing steps. Also included are sequences in which amino acid residues are phosphorylated, e.g., phosphotyrosine, phosphoserine or phosphothreonine.
  • polypeptides which have been modified using ordinary molecular biology techniques to improve their resistance to proteolytic degradation or to optimize solubility or to render them more effective as a regulatory agent.
  • Analogs of such peptides include those containing residues other than the naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic molecules.
  • the polypeptides of the present invention are not intended to be limited to products of any specific exemplary process defined herein.
  • “Derivative” is intended to include both functional and chemical derivatives, including fragments, segments, variants or analogs of a molecule.
  • a molecule is a "chemical derivative" of another, if it contains additional chemical moieties not normally a part of the molecule.
  • Such moieties may improve the molecule's solubility, absorption, biological half-life, and the like, or they may decrease toxicity of the molecule, eliminate or attenuate any undesirable side effect of the molecule, and the like.
  • Moieties capable of mediating such effects are disclosed in Remington's Pharmaceutical Sciences (1980). Procedures for coupling such moieties to a molecule are well known in the art. Included within the meaning of the term “derivatives" as used in the present invention are "alterations,” “insertions,” and “deletions” of nucleotides or peptides, polypeptides or the like.
  • a “fragment” of a polypeptide is included within the present invention if it retains substantially the same activity as the purified peptide, or if it has the described GCC-box binding capability. Such fragment of a peptide is also meant to define a fragment of an antibody.
  • a “variant” or “allelic or species variant” of a protein refers to a molecule substantially similar in structure and biological activity to the protein. Thus, if two molecules possess a common activity and may substitute for each other, it is intended that they are “variants,” even if the composition or secondary, tertiary, or quaternary structure of one of the molecules is not identical to that found in the other, or if the amino acid or nucleotide sequence is not identical.
  • the ERFl polypeptide and ERFl nucleic acid sequences employed in the invention may be exogenous sequences.
  • Exogenous or heterologous denotes a nucleic acid sequence which is not obtained from and would not normally form a part of the genetic makeup of the plant, cell, organ, flower or tissue to be transformed, in its untransformed state.
  • Plants comprising exogenous nucleic acid sequences of ERFl, or erfl mutations are encoded by, but not limited to, the nucleic acid sequences of SEQ ID No: 1 , including alterations, insertions, deletions, mutations, homologues and fragments thereof.
  • Transformed plant cells, tissues and the like, comprising nucleic acid sequence of ERFl or erfl mutations, such as, but not limited to, the nucleic acid sequence of SEQ ID No: 1 are within the scope of the invention.
  • Transformed cells of the invention may be prepared by employing standard transformation techniques and procedures as set forth in Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
  • nucleic acid encoding the plant cell and the like wherein secondary target cell expression is modulated by GCC-box binding
  • the term is meant to encompass DNA, RNA, and the like.
  • ERFl genes encode proteins having specific domains located therein, for example, terminal extensions, transmembrane spans, TM1 and TM2, nucleotide binding folds, a putative regulatory domain, and the C- terminus.
  • a mutant, derivative, homologue or fragment of the subject gene is, therefore also one in which selected domains in the related protein share significant homology (at least about 40% homology) with the same domains in the preferred embodiment of the present invention. It will be appreciated that the definition of such a nucleic acid encompasses those genes having at least about 40% homology, in any of the described domains contained therein under conditions of stringency that would be appreciated by one of ordinary skill in the art.
  • homology when the term "homology" is used herein to refer to the domains of these proteins, it should be construed to mean homology at both the nucleic acid and the amino acid levels. Significant homology between similar domains in such nucleic acids is considered to be at least about 40%, preferably, the homology between nucleic acid domains is at least about 50%, more preferably, at least about 60%, even more preferably, at least about 70%, even more preferably, at least about 80%, yet more preferably, at least about 90% and most preferably, the homology between similar nucleic acid domains is about 99%.
  • the homology between amino acid domains in such protein or polypeptides is considered to be at least about 40%, preferably, the homology between amino acid domains is at least about 50%, more preferably, at least about 60%, even more preferably, at least about 70%, even more preferably, at least about 80%, yet more preferably, at least about 90% and most preferably, the homology between similar amino acid domains is about 99%.
  • the isolated nucleic acid encoding the biologically active ERFl polypeptide or fragment thereof is full length or of sufficient length to encode a regulated or active GCC-box binding protein capable of activating or modulating the expression of the secondary ethylene response genes.
  • the nucleic acid is at least about 200 nucleotides in length. More preferably, it is at least 400 nucleotides, even more preferably, at least 600 nucleotides, yet more preferably, at least 800 nucleotides, and even more preferably, at least 1000 nucleotides in length.
  • the purified preparation of the isolated polypeptide having the described GCC-box binding activity in the ethylene signal system is at least about 60 amino acids in length.
  • the polypeptide encodes the full-length ERFl protein or a regulated version thereof.
  • the invention further includes a vector comprising a gene encoding ERFl .
  • DNA molecules composed of a protein gene or a portion thereof can be operably linked into an expression vector and introduced into a host cell to enable the expression of these proteins by that cell.
  • a protein may be cloned in viral hosts by introducing the Ahybrid ⁇ gene operably linked to a promoter into the viral genome.
  • the protein may then be expressed by replicating such a recombinant virus in a susceptible host.
  • a DNA sequence encoding a protein molecule may be recombined with vector DNA in accordance with conventional techniques.
  • the hybrid gene may be introduced into the viral genome by techniques well known in the art.
  • the present invention encompasses the expression of the desired proteins in either prokaryotic or eukaryotic cells, or viruses that replicate in prokaryotic or eukaryotic cells.
  • the proteins of the present invention are cloned and expressed in a virus.
  • Viral hosts for expression of the proteins of the present invention include viral particles which replicate in prokaryotic host or viral particles which infect and replicate in eukaryotic hosts. Procedures for generating a vector for delivering the isolated nucleic acid or a fragment thereof, are well known, and are described for example in Sambrook et al, supra.
  • Suitable vectors include, but are not limited to, disarmed Agrobacterium tumor inducing (Ti) plasmids (e.g., pBIN19) containing a target gene under the control of a vector, such as the cauliflower mosaic (CaMV) 35S promoter (Lagrimini et al, Plant Cell 2:7-18 (1990)) or its endogenous promoter (Bevan, Nucl. Acids Res. 72:8711-
  • adenovirus adenovirus
  • bovine papilloma virus bovine papilloma virus
  • simian virus tobacco mosaic virus and the like.
  • the DNA constructs may be introduced or transformed into an appropriate host.
  • Various techniques may be employed, such as protoplast fusion, calcium phosphate precipitation, electroporation, or other conventional techniques.
  • viral sequences containing the Ahybrid ⁇ protein gene may be directly transformed into a susceptible host or first packaged into a viral particle and then introduced into a susceptible host by infection. After the cells have been transformed with the recombinant DNA (or RNA) molecule, or the virus or its genetic sequence is introduced into a susceptible host, the cells are grown in media and screened for appropriate activities. Expression of the sequence results in the production of the protein of the present invention.
  • Suitable cells include, but are not limited to, cells from yeast, bacteria, mammal, baculovirus-infected insect, and plants, with applications either in vivo, or in tissue culture. Also included are plant cells transformed with the gene of interest for the purpose of producing cells and regenerating plants having the described GCC-box binding capability, thereby modulating the expression of the target secondary ethylene response elements.
  • Transformation of plants may be accomplished using Agrobacterium-mediated leaf disc transformation methods described by Horsch et ⁇ l, 1988, Leaf Disc
  • Transformation Plant Molecular Biology Manual A5: l). Numerous procedures are known in the art to assess whether a transgenic plant comprises the desired DNA. and need not be reiterated.
  • eukaryotic regulatory regions Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis.
  • Preferred eukaryotic promoters include, but are not limited to, the SV40 early promoter (Benoist et ⁇ l, Nature (London) 2P0:304-310 (1981)); the yeast gal4 gene promoter (Johnston et al, Proc. Natl. Acad. Sci. (USA) 79:6971-6975 (1982)) and the exemplified pYES3 PGK1 promoter.
  • eukaryotic mRNA As is widely known, translation of eukaryotic mRNA is initiated at the codon, which encodes the first methionine. For this reason, it is preferable to ensure that the linkage between a eukaryotic promoter and a DNA sequence which encodes the desired protein does not contain any intervening codons which are capable of encoding a methionine (i.e., AUG).
  • the desired protein encoding sequence and an operably linked promoter may be introduced into a recipient prokaryotic or eukaryotic cell either as a non-replicating DNA (or RNA) molecule, which may either be a linear molecule or, more preferably, a closed covalent circular molecule.
  • the expression of the desired protein may occur through the transient expression of the introduced sequence.
  • permanent expression may occur through the integration of the introduced sequence into the host chromosome.
  • the hybrid gene operably linked to a promoter is typically integrated into the viral genome, be it RNA or DNA. Cloning into viruses is well known and thus, one of skill in the art will know numerous techniques to accomplish such cloning.
  • Cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or more reporter genes or markers which allow for selection of host cells which contain the expression vector.
  • the reporter gene or marker may complement an auxotrophy in the host (such as leu2, or ura3, which are common yeast auxotrophic markers), biocide resistance, e.g., antibiotics, or resistance to heavy metals, such as copper, or the like.
  • the selectable marker gene can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection.
  • Additional elements may also be needed for optimal synthesis of mRNA. These elements may include splice signals, as well as transcription promoters, enhancers, and termination signals.
  • the cDNA expression vectors incorporating such elements include those described by Okayama, H., Mol. Cell Biol. 3:280 (1983), and others.
  • the introduced sequence will be incorporated into a plasmid or viral vector capable of autonomous replication in the recipient host cell.
  • a plasmid or viral vector capable of autonomous replication in the recipient host cell.
  • Any of a wide variety of vectors may be employed for this purpose. Factors of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species.
  • the invention further defines methods for manipulating the nucleic acid in a plant to permit the regulation, control or modulation of germination, abscission, cell elongation, sex determination, flower or leaf senescence, flower maturation, fruit ripening, insect, herbicide or pathogen resistance, or response to stress in said plant.
  • the method activates or enhances the above responses, whereas in another preferred embodiment the method inhibits or prevents the above responses.
  • methods of the present invention define embodiments in which the GCC- box binding activity is prevented or inhibited.
  • prevention is meant the cessation of GCC-box binding to target secondary response proteins in the ethylene signal pathway.
  • inhibition is meant a statistically significant reduction in the amount of GCC-box binding binding, or in the amount of expression of the target ethylene response cells, or of detectable ERFl protein as compared with plants, plant cells, organs, flowers or tissues grown without the inhibitor or disclosed method of inhibition.
  • the ERFl inhibitor reduces GCC-box binding thereby inhibiting or reducing expression of the secondary ethylene response gene by at least 20 %, more preferably by at least 50%, even more preferably by 80% or greater, and also preferably, in a dose-dependent manner.
  • the effect of such prevention or inhibition would block (insensitivity) or inhibit the ethylene response of a plant or plant cell comprising such DNA or protein expression product.
  • Ethylene insensitive plants are disease and pathogen tolerant.
  • disease tolerance is the ability of a plant or plant cell to survive stress, infection or injury with minimal damage or reduction in the harvested yield of commercial product. Plants with disease tolerance may have extensive levels of infection, but little necrosis and few or no lesions, The plants or plant cells may also have reduced necrotic and water soaking responses and chlorophyll loss may be virtually absent. In contrast, resistant plants generally limit the growth of the pathogens and contain the infection to a localized area within multiple apparently injurious lesions.
  • methods of the present invention are also defined in which the GCC- box binding activity is initiated, stimulated or enhanced if there is a statistically significant increase in the amount of GCC-box binding or in the amount of expression of the target ethylene response cells, or of detectable ERFl protein detected as compared with plants, plant cells, organs, flowers or tissues grown without the enhancer or disclosed method of enhancement.
  • the ERFl enhancer increases binding capability by at least 20 %, more preferably by at least 50%, even more preferably by 80% or greater, and also preferably, in a dose-dependent manner.
  • the invention further features an isolated preparation of a nucleic acid which is antisense in orientation to a portion or all of ERFl or of a gene encoding a peptide having plant GCC-box binding capability.
  • the antisense nucleic acid should be of sufficient length as to inhibit expression of the target gene of interest.
  • the actual length of the nucleic acid may vary, depending on the target gene, and the region targeted within the gene.
  • such a preparation will be at least about 15 contiguous nucleotides, more typically at least 50 or even more than 50 contiguous nucleotides in length.
  • a sequence of nucleic acid is considered to be antisense when the sequence being expressed is complementary to, and essentially identical to the non- coding DNA strand of the ERFl gene, but which does not encode ERFl .
  • “Complementary” refers to the subunit complementarity between two nucleic acids, e.g. , two DNA molecules. When a nucleotide position in both molecules is occupied by nucleotides normally capable of base pairing with each other, then the nucleic acids are said to be complementary to each other.
  • nucleic acids are complementary when a substantial number (at least 40% or at least 50%, or preferably at least 60%, or more preferably at least 70% or 80%, or more preferably at least 90% or at least 99%) of the corresponding positions in each of the molecules are occupied by nucleotides which normally base-pair with each other (e.g. , A:T and G:C nucleotide pairs.).
  • antibodies are provided which are directed against the GCC-box binding peptides or polypeptides, such as ERFl , which are capable of binding the GCC-box of secondary response proteins in the ethylene signaling pathway, thereby blocking or modulating their expression.
  • GCC-box binding peptides or polypeptides such as ERFl
  • Such an antibody is specific for the whole molecule, its N- or C-terminal, or internal portions. Methods of generating such antibodies are well known in the art.
  • the term "functional equivalent” refers to any molecule capable of specifically binding to the same antigenic determinant as the antibody, thereby neutralizing the molecule, e.g., antibody-like molecules, such as single chain antigen binding molecules.
  • the invention further includes a transgenic plant comprising an isolated DNA encoded ERFl or a GCC-box binding protein capable of activating the expression of secondary ethylene response genes in the plant ethylene signaling pathway.
  • a transgenic Arabidopsis plant comprising a yeast ccc ⁇ transgene rescued by the addition of ERFl, which when expressed confers upon the plant the ability recognize the presence of ethylene, an ability that had been deleted from the original yeast gene.
  • transgenic plant as used herein, is meant a plant, plant cell, tissue, flower, organ, including seeds, progeny and the like, or any part of a plant, which comprise a gene inserted therein, which gene has been manipulated to be inserted into the plant cell by recombinant DNA technology.
  • the manipulated gene is designated a "transgene.”
  • the "non-transgenic,” but substantially homozygous "wild type plant” as used herein, means a nontransgenic plant from which the transgenic plant was generated.
  • the transgenic transcription product may also be oriented in an antisense direction as describe above.
  • transgenic plants comprising sense or antisense DNA encoding the GCC-box binding molecules, such as ERFl, capable of activating, blocking or modulating the expression ethylene-inducible target genes, may be accomplished by transforming the plant with a plasmid, liposome, or other vector encoding the desired DNA sequence.
  • vectors would, as described above, include, but are not limited to the disarmed Agrobacterium tumor-inducing (Ti) plasmids containing a sense or antisense strand placed under the control of a strong constitutive promoter, such as the CaMV 35S promoter or under an inducible promoter.
  • plants included within its scope include both higher and lower plants of the Plant Kingdom. Mature plants, including rosette stage plants, and seedlings are included in the scope of the invention. A mature plant, therefore, includes a plant at any stage in development beyond the seedling. A seedling is a very young, immature plant in the early stages of development.
  • Transgenic plants are also included within the scope of the present invention, having a phenotype characterized by the ERFl gene or er/7 mutations, or by the E7N3 gene or ein3 mutations (including e/7 mutations) affecting the activation of, or expression of, the RTF3.
  • Preferred plants of the present invention which are affected by ⁇ RF1 or GCC- box binding to modulate expression of the secondary ethylene response genes in the ethylene signal system include, but are not limited to, high yield crop species for which cultivation practices have already been perfected (including monocots and dicots, e.g., alfalfa, cashew, cotton, peanut, fava bean, french bean, mung bean, pea, walnut, maize, petunia, potato, sugar beet, tobacco, oats, wheat, barley and the like), or engineered endemic species.
  • high yield crop species for which cultivation practices have already been perfected including monocots and dicots, e.g., alfalfa, cashew, cotton, peanut, fava bean, french bean, mung bean, pea, walnut, maize, petunia, potato, sugar beet, tobacco, oats, wheat, barley and the like
  • engineered endemic species including monocots and dicots
  • Particularly preferred plants are those from: the Family Umbelliferae, particularly of the genera Daucus (particularly the species carota, carrot) and Apium (particularly the species graveolens dulce, celery) and the like; the Family Solanacea, particularly of the genus Lycopersicon, particularly the species esculentum (tomato) and the genus Solanum, particularly the species tuberosum (potato) and melongena (eggplant), and the like, and the genus Capsicum, particularly the species annum (pepper) and the like; and the Family Leguminosae, particularly the genus Glycine, particularly the species max (soybean) and the like; and the Family Cruciferae, particularly of the genus Brassica, particularly the species campestris (turnip), oleracea cv Tastie (cabbage), oleracea cv Snowball Y (cauliflower) and oleracea cv Emperor (broccoli)
  • the leafy vegetables for example, the Family Cruciferae, especially the genus Arabidopsis, most especially the species thaliana.
  • Preferred plants particularly include flowering plants, such as roses, carnations, chrysanthemums, geraniums and the like, in which longevity of the flower on the stem (delayed abscission) is of particular relevance, and especially include ornamental flowering plants, such as geraniums.
  • Additional preferred plants include leafy green ornamental plants, such as Ficus, palms, and the like, in which longevity of the leaf stem on the plant (delayed abscission) is of particular relevance. Delayed flowering in such plants may also be advantageous.
  • other preferred plants include fruiting plants, such as banana and orange, wherein pectin-dissolving enzymes are involved in the abscission process.
  • the present invention will benefit plants subjected to stress.
  • Stress includes, and is not limited to, infection as a result of pathogens such as bacteria, viruses, fungi, and conditions involving aging, wound healing and soil penetration.
  • Bacterial infections include, and are not limited to, Clavibacter michiganense (formerly Coynebacterium michiganense), Pseudomonas solanacearum and Erwinia stewartii, and more particularly, Xanthomonas campestris (specifically pathovars campestris and vesicatoria), Pseudomonas syringae (specifically pathovars tomato, maculicola).
  • plant viral and fungal pathogens within the scope of the invention include, but are not limited to, tobacco mosaic virus, cauliflower mosaic virus, turnip crinkle virus, turnip yellow mosaic virus; fungi including Phytophthora infestans, Peronospora parasitica, Rhizoctonia solani, Botrytis cinerea, Phoma lingam (Leptosphaeria maculans), and Albugo Candida.
  • the Arabidopsis ecotype Columbia (Col-0) was the parent strain of all mutants and transgenic plants used in the following examples. Triple response screens were performed as described previously by Guzman and Ecker, Plant Cell 2:513-523 (1990). Plant growth in air and ethylene was carried out as described previously by Kieber et al, 1993.
  • RNA extractions and Northern analyses were performed as described by Reuber et al, Plant Cell 8:241-249 (1996) and by Chao et al, 1997.
  • ⁇ -glucuronidase activity was assayed by incubation of the plants with the substrate of the enzyme (X- Glue, 1 mg/ml) in sodium phosphate buffer during 18 h..
  • cDNA clones corresponding to ERFl were isolated by hybridization of a size-selected cDNA library in ⁇ ZAPII (Kieber et al, 1993). The probe, corresponding to a fragment of the tobacco EREBP 1 gene, was obtained by PCR amplification using the primers:
  • EREBPlf 5' CACGCCATAGACATAATAC 3' (SEQ ID No: 3) and EREBPh: 5' GCTACGATTCCTGTTCCTTCAG 3' (SEQ ID No: 4).
  • ERF7 genomic sequences were isolated by hybridization of two BAC genomic libraries (TAMU and IGF) (Choi et al, Weeds World 2:17-20 (1995)). The map position of ERFl was obtained by PCR amplification of YAC pools using specific primers. PCR highlighted two YAC clones (CIC12H5 and CIC12H6), both located in the ABI3 contig.
  • Example 1 Characterization of the ERFl gene and its Expression Product Protein synthesis and DNA analysis
  • ERFl, E1N3 and the EIN3 deletion derivatives were generated by in vitro translation (or cotranslation in the dimerization experiments) using a flexi-rabbit reticulocyte lysate system (PromegaTM) as described by Solano et al, J. Biol. Chem. 272:2889-2895 (1997).
  • PCR and Klenow labeling of promoter fragments and oligonucleotides, DNA binding reactions and electrophoretic mobility shift assays (EMSAs) were performed as described Solano et al, EMBO J. 14:1773-1784 (1995).
  • CHI Arabidopsis and bean basic-chitinase
  • CH5Bmutant 5' CTTCACGCTTGGGAAGTTGTTGGGGTGGGCCCGCAG 3' (SEQ ID No: 9);
  • EBSml 5' GTTGTTTGGGATTCTTCGGGCATGTATCTTGAATCC 3' (SEQ ID No: 1 1) and
  • EBSm2 5' GTTGTTTGGGATTCAAGCCCCATGTATCTTGAATCC 3' (SEQ ID No: 12). Plant transformation
  • a 0.8 kb BamHI-Kpnl fragment of ERFl cDNA was cloned into BamHI-Kpnl- digested pROK2 (Baulcombe, Nature 321 :446-449 (1983)).
  • the C58 strain of Agrobacterium tumefaciens containing the above construct was used to transform the Arabidopsis ecotype Col-0 and the ethylene insensitive mutants ein2-5, ein2-l 7, ein2-26, ein3-l, ein3-3 and ein5-l, by in planta vacuum infiltration (Bechtold et al, C. R. Acad. Sci. Paris Life Sci. 316: 1 194-1199 (1993).
  • Kanamycin resistant (kan R ) Tl plants were selected by plating seeds on MS medium supplemented with 100 ⁇ g/ml kanamycin, and transferring kan R seedlings to soil.
  • Yeast transformation and "two-hybrid" screening Yeast strain Y190 was transformed by the PEG/lithium acetate method as described by Gietz et al, Nucleic Acid. Res. 20:1425 (1992). Growth conditions, screening procedures and filter-lift assay for ⁇ -galactosidase activity were performed as described by Kim et al, Proc. Natl. Acad. Sci. USA 94: 11786-1 1791 (1997).
  • GenBank Accession Numbers GenBank Accession Numbers
  • GenBank accession numbers for the ERFl cDNA and genomic sequences identified in the present invention are AF076277 and AF076278, respectively. Cloning and characterization of ERFl
  • ERFl Ethylene-Response-Factorl
  • ERFl Since overexpression of the ethylene pathway genes E7N3, EIL1 or EIL2 causes activation of all known ethylene response genes and phenotypes, the expression of ERFl was examined. Although the level was somewhat lower than that achieved by exogenous ethylene treatment, ERFl mR ⁇ A showed constitutive high-level expression in 35S::EIN3 -expressing transgenic plants (see Figure 2B), indicating that ⁇ I ⁇ 3 is sufficient for ERFl expression. Taken together, the results demonstrate that E7N3 is both necessary and sufficient for expression of the early ethylene response gene ERFl, a novel
  • ERFl is a primary ethylene response gene
  • ERFl was mapped to chromosome III, in the ABI3 contig, by PCR amplification of YAC pools using ERFi-specific primers.
  • ERE ethylene response elements
  • ERE7 was rapidly induced in response to ethylene gas and constitutively expressed in the presence of the ethylene pathway mutant ctr7. Ethylene induction of ERFl was completely dependent on a functional EIN3 protein, since no expression was detected in the ein3-l mutant. Moreover, transgenic plants overexpressing EIN3 showed high-level expression of ERFl mRNA.
  • EIN3 is both necessary and sufficient for ERFl expression, conclusions which are consistent with ERFl being a direct target of EIN3.
  • the level of ERFl mRNA expression in EIN3 overexpressing plants was somewhat lower than in Ctrl mutants or in ethylene treated wild-type plants. This indicated that although ELN3 is sufficient for ERF7 expression, other factors are required for full ethylene-dependent ERFl induction.
  • ⁇ LN3 as a "bait" in the "two-hybrid” screen, a DNA-binding protein was identified that interacts with EIN3. This protein also bound to the ERF7 promoter in a sequence specific-manner, indicating its role as a partner of ⁇ IN3 and suggesting its importance to full ERFl expression in response to ethylene.
  • Loss-of-function mutations have not been reported for any member of the EREBP family. This finding, together with the fact that over 30 of these genes have been identified in Arabidopsis, suggested a functional redundancy among members of the EREBP family. In the case of functionally redundant genes, loss-of-function alleles may not show a phenotype. A clear example of this has been provided by studies of the ethylene receptors in Arabidopsis (Hua and Meyerowitz, Cell (1998)).
  • Gain-of-function strategy was used to address the in vivo function of ⁇ RF1.
  • Gain-of-function mutations obtained by insertional mutagenesis of T- DNA or transposon elements carrying a CaMV 35S promoter have proven to be a powerful tool for assessing the in vivo function of a gene.
  • a transposon-induced gain-of-function mutant that constitutively expresses an ⁇ R ⁇ BP displayed seedling phenotypes resemble of a partial ethylene response (Wilson et al, 1996), suggesting that TINY may be a partner of ⁇ RF1 in ethylene signaling.
  • ⁇ RF1 may act in concert with other enzymes in the activation of some promoters.
  • Example 3 Sequence-specific binding of EIN3 in the promoter of ERFl
  • EAM electrophoretic mobility shift assays
  • a 6 kb fragment containing the ⁇ RF1 promoter was isolated from genomic sequences (BAC FI 1F14) and subcloned into pBluescriptTM. Five overlapping fragments that covered approximately 1.4 kb upstream of the ERF7 translation initiation site were amplified and radioactively labeled by PCR.
  • EIN3 protein produced two mobility shifted bands, whereas its deletion-derivatives retarded only one band. Since several subproducts were obtained in the EIN3 in vitro translation reaction, the upper band apparently corresponded to full-length ELN3 and the lower band to a truncated ELN3 derivative. Additionally, further experiments demonstrated that the source of the ELN3 protein does not affect its ability to bind DNA. As with the in vitro translated protein, Baculovirus-expressed ELN3 also recognized the 36 bp fragment containing the target sequence. Moreover, in this case only one major mobility shifted band was observed in the EMSA. To more precisely define the sequence requirements of EIN3 -binding, scanning mutagenesis of the 36 bp fragment was performed.
  • the ELN3 binding site shows significant similarity to sequences present in the promoter regions required for ethylene responsiveness in the tomato E4 (Montgomery et al, Proc. Natl. Acad. Sci. USA 90:5939-5943 (1993)) and LEACOl genes (Blume et al, Plant J. 12:731-746 (1997)), and in the carnation GS77 gene (Itzhaki et al, Proc. Natl. Acad. Sci. USA 91 :8925-8929 (1994)), ( Figure 4B).
  • GS77 a 197 bp promoter fragment containing this sequence was also sufficient to confer ethylene responsiveness to a minimal CaMV 35S promoter in transient assays (Itzhaki et al, 1994).
  • FIGs. 5 A and 5B Each lane contains 1 nanogram of labeled EBS.
  • EBS unlabeled ELN3 Binding Site
  • FIGs. 5A and 5B Each lane contains 1 nanogram of labeled EBS.
  • Figure 5A the formation of the ELN3-EBS complex was more efficiently competed by an excess of unlabelled EBS than by any of the EBS mutant versions, further supporting the finding that the ELN3-EBS interaction is sequence specific.
  • Figure 5B represents a summary of EIN3 structural features and mutants used in EMSA experiments, as adapted from Chao et al, 1997.
  • EIN3 is a Novel DNA-Binding Protein that Regulates Expression of ERFl
  • ELN3 and EIL proteins do not share similarity with any known proteins, their nuclear location, presence of conserved basic domains and acidic regions suitable as binding and activation domains, respectively, characterize their role as transcription factors (Chao et al, 1997).
  • DNA-binding assays using in vitro translated and Baculovirus-expressed EIN3 protein demonstrated that EIN3 binds to specific sequences in the ERF7 promoter.
  • EMS A experiments using truncated forms of the protein or antibodies against ELN3 confirmed the presence of EIN3 in the DNA-protein complex.
  • a mutant protein corresponding to the ein3-3 allele of EIN3 was unable to recognize the target sequence. This mutation consists of a Lys to Asn substitution in the basic domain III, which may form part of the DNA-binding motif.
  • EIN3/EIL2 Two additional proteins that belong to the EIN3/EIL family, EILl and EIL2, were also able to specifically recognize the ELN3 target in the promoter of ERFl. Consistent with this result, EIN3 can be functionally replaced by EILl or EIL2 since overexpression of either of these genes in transgenic plants can complement the ein3-l mutation (Chao et al, 1997). Deletion analysis of EIN3 permitted confirmation that its DNA-binding domain falls within the N-terminal half of the protein. This region is the most conserved among all four members of the family and does not contain any previously known DNA- binding motif. The ELN3/EIL DNA-binding domain will be further characterized by structural analysis of the proteins.
  • EIL4 a fifth more recently identified homolog
  • EIL4 possess several predicted ⁇ -helices, two of them rich in basic amino acids offering a DNA-interaction surface. Scanning mutagenesis of the DNA fragment containing the target site permitted determination of the sequence requirements for the EIN3/EIL interaction.
  • the defined target site included two inverted repeats and is recognized by the protein as a dimer.
  • the EIN3 binding site shares significant identity with sequences within the promoter region of the carnation GS77 gene that has been defined as necessary and sufficient for ethylene responsiveness. The conserved sequences are also present in the promoter regions required for ethylene responsiveness in the tomato E4 and LEACOl genes.
  • EIN3 target site represents a primary ethylene response element (PERE) conserved in different species where there are also orthologs of EIN3.
  • PERE primary ethylene response element
  • E4 has been previously identified as a primary ethylene response gene (Lincoln et al, Proc Natl. Acad. Sci. USA 84:2793-2797 (1987)).
  • the GCC element appears to be a secondary ethylene response element (SERE) present only in a subset of the ethylene- regulated genes (e.g., pathogenesis-related genes, HOOKLESS1 and some EREBPs) that are regulated by a subgroup of the EREBP family of proteins.
  • SESE secondary ethylene response element
  • EIN3 has the capacity to form dimers
  • yeast "two-hybrid" system yields et al, Nature 340:245-246 (1989); Durfee et al, Genes Dev. 7:555-569 (1993)).
  • EIN3 being a transcriptional activator
  • BD GAL4 DNA-binding domain
  • an ELN3 derivative containing amino acids 53 to 257, fused to the GAL4-BD was used as a "bait.”
  • the GAL4-activation domain was fused to an Arabidopsis cDNA library constructed using mRNA from etiolated seedlings (Kim et al, 1997).
  • Yeast strain Y190 transformed with the "bait” construct was subsequently transformed with the "prey” and four million independent transformants were screened for positive interactions, as described by Kim et al. (1997). Twenty-six independent positive clones were obtained. The plasmids were recovered and their cDNAs were sequenced.
  • EIN3 is a transcriptional activator that is both necessary and sufficient for ERFl expression. Therefore, it was predicted that ERFl would play a role in directing the expression of target genes containing the GCC element.
  • EREBP involved in the regulation of cold and drought response, is known to bind a DNA sequence unrelated to the GCC element (i.e., C-box/ DRE element; Stockinger et al, Proc. Natl. Acad. Sci. USA 94:1035-1040 (1997)).
  • ERFl contained a functional DNA-binding domain, which would be able to interact with the GCC element in a sequence-specific manner
  • DNA- binding experiments were performed with in vitro translated ERFl protein.
  • Radiolabeled promoter fragments of the ethylene-regulated Arabidopsis basic-chitinase (Samac et al., 1990) and bean chitinase5B genes (Broglie et al, 1989) were incubated with ERFl and analyzed by EMSA.
  • EMSA To examine the specificity of the interaction, a mutated version of the promoter fragments were also used, in which the cytosines of the GCC box element were substituted by thymines.
  • ERFl was able to specifically bind the promoter fragments containing the GCC element, whereas no binding was observed to the mutant sequences.
  • the lower band in each lane containing ERFl and the wild-type element apparently corresponds to a truncated form of ERFl since two major bands were obtained as products of the in vitro translation of ERFl mRNA.
  • transgenic plants were constructed which constitutively expressed ERF7 mRNA under control of a CaMV 35S promoter. T2 segregants of these transgenic lines were examined for ethylene response phenotypes.
  • HOOKLESS1 an ethylene response gene required for apical hook curvature (Lehman et al, Cell 85: 183-194 (1996)), was not expressed in ERFl -overexpressing plants. Expression of only a partial seedling triple response phenotype in these lines is consistent with a role for ERFl in mediating a subset of the ethylene responses. ERF7 may act along with other genes, e.g., EREBPs and others, to fully mediate the various seedling responses to ethylene.
  • the 35 S:: ERFl gene was also introduced into several mutant backgrounds (ein2-5, ein2-17, ein2-26, ein3-l, ein3-3 and ein5-l) that suppress phenotypes resulting from ethylene overproduction.
  • the transgenic plants displayed a morphology indistinguishable from that of 35S..ERF1 -expressing wild-type plants ( Figures 9 and 10).
  • RNA total RNA (5 ⁇ g) was loaded per lane in the middle and right panels, and 50 ⁇ g in the left panel of Figure 10A. Moreover, constitutive expression of chitinase and PDF 1.2 mRNA was observed when the 35S::ERF1 gene was introduced into three different ethylene insensitive mutant backgrounds. The ein2; 35S::ERF1, ein3; 35S::ERF1 and ein5; 35S::ERF1 transgenic lines all showed high level expression of mRNAs for these genes. In the case of ein5-l the lower expression of ERFl in one of the two transgenic lines correlated with the lower expression of PDF 1.2 and basic-chitinase, and with the weaker constitutive ethylene response phenotype.
  • ERF7 is an immediate target of ⁇ I ⁇ 3.
  • binding of ERFl to the GCC element in the promoters of ethylene-regulated genes, and constitutive activation of ethylene response genes and phenotypes in both etiolated seedling and adult plants in the ERFl gain-of-function experiments further define ERFl as a downstream ethylene signaling pathway gene.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nutrition Science (AREA)
  • Botany (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un acide nucléique isolé codant le facteur 1 de réponse éthylénique (Ethylene Response Factor 1 (ERF1), un gène à réponse précoce, codant une protéine de liaison à la séquence GCC dans la voie de signalisation de gaz éthylénique dans des végétaux. L'invention concerne également le peptide ERF1, qui est caractérisé, ainsi que des méthodes d'utilisation d'ERF1 ou d'un produit d'expression de ce dernier pour moduler la réponse de végétaux ou de cellules végétales à l'éthylène. En outre, parce que ERF1 agit en amont de EIN3 et de tous les éléments de la voie de signalisation identifiés antérieurement, et parce que l'expression constitutive de ERF1 entraîne la modulation de plusieurs gènes et phénotypes de réponse éthylénique, l'invention concerne des méthodes nouvelles et utiles de régulation de la voie de signalisation éthylénique.
PCT/US1999/028104 1998-11-25 1999-11-24 Facteur 1 de reponse ethylenique (erf1) dans des vegetaux WO2000032761A1 (fr)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP99967157A EP1141270A4 (fr) 1998-11-25 1999-11-24 Facteur 1 de reponse ethylenique (erf1) dans des vegetaux
AU23495/00A AU2349500A (en) 1998-11-25 1999-11-24 Ethylene-response-factor1 (erf1) in plants
JP2000585392A JP2002541763A (ja) 1998-11-25 1999-11-24 植物中のエチレン応答因子１（ｅｒｆ１）
BR9915704-7A BR9915704A (pt) 1998-11-25 1999-11-24 ácido nucleico isolado, preparação purificada de um polipeptìdeo, célula recombinante, vetor, anticorpo especìfico, sequência de ácido nucleico isolado, planta, célula de planta, órgão de planta, flor de planta, tecido de planta, semente de planta ou progênie de planta e processos para manipulação do ácido nucleico em uma planta e da expressão de erfi em uma célula de planta, para identificação de um composto capaz de afetar a resposta ao etileno no sistema de sinalização de etileno em uma planta e para geração de uma planta
CA002352468A CA2352468A1 (fr) 1998-11-25 1999-11-24 Facteur 1 de reponse ethylenique (erf1) dans des vegetaux
IL14333899A IL143338A0 (en) 1998-11-25 1999-11-24 Ethylene-response-factor (erfi) in plants

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10997398P 1998-11-25 1998-11-25
US60/109,973 1998-11-25

Publications (2)

Publication Number Publication Date
WO2000032761A1 true WO2000032761A1 (fr) 2000-06-08
WO2000032761A8 WO2000032761A8 (fr) 2001-02-15

Family

ID=22330590

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/028104 WO2000032761A1 (fr) 1998-11-25 1999-11-24 Facteur 1 de reponse ethylenique (erf1) dans des vegetaux

Country Status (8)

Country Link
EP (1) EP1141270A4 (fr)
JP (1) JP2002541763A (fr)
AU (1) AU2349500A (fr)
BR (1) BR9915704A (fr)
CA (1) CA2352468A1 (fr)
IL (1) IL143338A0 (fr)
WO (1) WO2000032761A1 (fr)
ZA (1) ZA200104313B (fr)

Cited By (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7598429B2 (en) 2001-04-18 2009-10-06 Mendel Biotechnology, Inc. Transcription factor sequences for conferring advantageous properties to plants
US7663025B2 (en) 1999-03-23 2010-02-16 Mendel Biotechnology, Inc. Plant Transcriptional Regulators
NL2003837A (en) * 2008-11-19 2010-05-21 Rijk Zwaan Zaadteelt En Zaadhandel Bv Resistance to post harvest deterioration in cucumber.
WO2010147825A1 (fr) 2009-06-09 2010-12-23 Pioneer Hi-Bred International, Inc. Promoteur d'endosperme précoce et procédés d'utilisation
US7858848B2 (en) 1999-11-17 2010-12-28 Mendel Biotechnology Inc. Transcription factors for increasing yield
US7888558B2 (en) 1999-11-17 2011-02-15 Mendel Biotechnology, Inc. Conferring biotic and abiotic stress tolerance in plants
WO2011036569A2 (fr) 2009-09-22 2011-03-31 The Board Of Trustees Of The University Of Arkansas, N.A. Cultivar de riz cl 142-ar
WO2011047191A1 (fr) 2009-10-15 2011-04-21 The Board Of Trustees Of The University Of Arkansas, N.A. Cultivar de riz cl181-ar
WO2011056544A1 (fr) 2009-10-26 2011-05-12 Pioneer Hi-Bred International, Inc. Promoteur somatique spécifique à un ovule et procédés d'utilisation
US7964774B2 (en) 2008-05-14 2011-06-21 Monsanto Technology Llc Plants and seeds of spring canola variety SCV384196
US8030546B2 (en) 1998-09-22 2011-10-04 Mendel Biotechnology, Inc. Biotic and abiotic stress tolerance in plants
WO2013096810A1 (fr) 2011-12-21 2013-06-27 The Curators Of The University Of Missouri Variété de soja s05-11482
WO2013096818A1 (fr) 2011-12-21 2013-06-27 The Curators Of The University Of Missouri Variété de soja s05-11268
WO2013103371A1 (fr) 2012-01-06 2013-07-11 Pioneer Hi-Bred International, Inc. Promoteur spécifique d'ovule et méthodes d'utilisation
WO2013103365A1 (fr) 2012-01-06 2013-07-11 Pioneer Hi-Bred International, Inc. Promoteurs de pollen préférés et procédés d'utilisation
WO2014059155A1 (fr) 2012-10-11 2014-04-17 Pioneer Hi-Bred International, Inc. Promoteurs de cellules de garde et leur utilisation
US8835720B2 (en) 2012-04-26 2014-09-16 Monsanto Technology Llc Plants and seeds of spring canola variety SCV967592
WO2014153254A2 (fr) 2013-03-14 2014-09-25 Pioneer Hi-Bred International Inc. Compositions et procédés pour contrôler des insectes ravageurs
WO2014150914A2 (fr) 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Polypeptides phi-4 et leurs procédés d'utilisation
WO2014159306A1 (fr) 2013-03-13 2014-10-02 Pioneer Hi-Bred International, Inc. Application de glyphosate pour désherbage d'une brassicée
US8859857B2 (en) 2012-04-26 2014-10-14 Monsanto Technology Llc Plants and seeds of spring canola variety SCV259778
US8878009B2 (en) 2012-04-26 2014-11-04 Monsanto Technology, LLP Plants and seeds of spring canola variety SCV318181
US8912394B2 (en) 2001-04-18 2014-12-16 Mendel Biotechnology Inc. Transcriptional regulation of plant disease tolerance
WO2015023846A2 (fr) 2013-08-16 2015-02-19 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2015038734A2 (fr) 2013-09-13 2015-03-19 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2015120276A1 (fr) 2014-02-07 2015-08-13 Pioneer Hi Bred International Inc Protéines insecticides et leurs procédés d'utilisation
WO2016022516A1 (fr) 2014-08-08 2016-02-11 Pioneer Hi-Bred International, Inc. Promoteurs d'ubiquitine et introns, et procédés d'utilisation
WO2016044092A1 (fr) 2014-09-17 2016-03-24 Pioneer Hi Bred International Inc Compositions et procédés de lutte contre des insectes ravageurs
WO2016061206A1 (fr) 2014-10-16 2016-04-21 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2016099916A1 (fr) 2014-12-19 2016-06-23 E. I. Du Pont De Nemours And Company Compositions d'acide polylactique à vitesse de dégradation supérieure et à stabilité thermique accrue
WO2016186986A1 (fr) 2015-05-19 2016-11-24 Pioneer Hi Bred International Inc Protéines insecticides et leurs procédés d'utilisation
WO2016205445A1 (fr) 2015-06-16 2016-12-22 Pioneer Hi-Bred International, Inc. Compositions et procédés de lutte contre des insectes nuisibles
WO2017023486A1 (fr) 2015-08-06 2017-02-09 Pioneer Hi-Bred International, Inc. Protéines insecticides d'origine végétale et leurs méthodes d'utilisation
WO2017040343A1 (fr) 2015-08-28 2017-03-09 Pioneer Hi-Bred International, Inc. Transformation de plantes médiée par ochrobactrum
WO2017105987A1 (fr) 2015-12-18 2017-06-22 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2017112006A1 (fr) 2015-12-22 2017-06-29 Pioneer Hi-Bred International, Inc. Promoteurs préférés par un tissu et procédés d'utilisation
WO2017192560A1 (fr) 2016-05-04 2017-11-09 Pioneer Hi-Bred International, Inc. Protéines insecticides et procédés pour les utiliser
WO2017218207A1 (fr) 2016-06-16 2017-12-21 Pioneer Hi-Bred International, Inc. Compositions et procédés de lutte contre des insectes nuisibles
WO2017222821A2 (fr) 2016-06-24 2017-12-28 Pioneer Hi-Bred International, Inc. Éléments régulateurs de plantes et procédés d'utilisation de ceux-ci
WO2018005411A1 (fr) 2016-07-01 2018-01-04 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et procédés pour leur utilisation
WO2018013333A1 (fr) 2016-07-12 2018-01-18 Pioneer Hi-Bred International, Inc. Compositions et procédés de lutte contre des insectes nuisibles
WO2018084936A1 (fr) 2016-11-01 2018-05-11 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2019060383A1 (fr) 2017-09-25 2019-03-28 Pioneer Hi-Bred, International, Inc. Promoteurs ayant une préférence pour des tissus et méthodes d'utilisation
WO2019178042A1 (fr) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et procédés pour leur utilisation
WO2019178038A1 (fr) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et leurs procédés d'utilisation
WO2019226508A1 (fr) 2018-05-22 2019-11-28 Pioneer Hi-Bred International, Inc. Éléments régulateurs de plante et leurs procédés d'utilisation
WO2020005933A1 (fr) 2018-06-28 2020-01-02 Pioneer Hi-Bred International, Inc. Procédés de sélection de plantes transformées
WO2020092487A1 (fr) 2018-10-31 2020-05-07 Pioneer Hi-Bred International, Inc. Compositions et procédés de transformation de plante médiée par ochrobactrum
CN111518185A (zh) * 2020-05-18 2020-08-11 山东农业大学 调控番茄果实品质的转录因子及其应用
WO2022015619A2 (fr) 2020-07-14 2022-01-20 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080084855A (ko) * 2006-01-06 2008-09-19 리즈크 즈완 자드틸트 엔 자드한델 비.브이. 양상추에서의 생리 장애에 대한 저항성

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5444166A (en) * 1992-08-10 1995-08-22 Trustees Of The University Of Pennsylvania Constitutive triple response gene and mutations
US5650553A (en) * 1992-06-16 1997-07-22 The Trustees Of The University Of Pennsylvania Plant genes for sensitivity to ethylene and pathogens

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5650553A (en) * 1992-06-16 1997-07-22 The Trustees Of The University Of Pennsylvania Plant genes for sensitivity to ethylene and pathogens
US5444166A (en) * 1992-08-10 1995-08-22 Trustees Of The University Of Pennsylvania Constitutive triple response gene and mutations

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CORDES ET AL.: "Interaction of a Developmentally Regulated DNA-Binding Factor with Sites Flanking Two Different Fruit-Ripening Genes from Tomato", THE PLANT CELL,, vol. 1, no. 10, October 1989 (1989-10-01), pages 1025 - 1034, XP002923962 *
GORDON-KAMM ET AL.: "Transformation of Maize Cells and Regeneration of Fertile transgenic Plants", PLANT CELL,, vol. 2, July 1990 (1990-07-01), pages 603 - 618, XP002923961 *
GUZMAN ET AL.: "Exploiting the Triple Response of Arabidopsis to Identify Ethylene-Related Mutants", THE PLANT CELL,, vol. 2, 1990, pages 513 - 523, XP002923959 *
SAMAC ET AL.: "Isolation and Characterization of the Genes Encoding Basic and Acidic Chitinase in Arabidopsis Thaliana", PLANT PHYSIOLOGY,, vol. 93, 1990, pages 907 - 914, XP002923958 *
See also references of EP1141270A4 *
SINGH ET AL.: "Production of a Monocot-specific Monoclonal Antibody Against Acetohydroxyacid Synthase and its use in the Purification and Characterization of the Enzyme", PROC. NATL. ACAD. SCI. USA,, vol. 88, June 1991 (1991-06-01), pages 4572 - 4576, XP002923960 *

Cited By (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8030546B2 (en) 1998-09-22 2011-10-04 Mendel Biotechnology, Inc. Biotic and abiotic stress tolerance in plants
US7663025B2 (en) 1999-03-23 2010-02-16 Mendel Biotechnology, Inc. Plant Transcriptional Regulators
US7858848B2 (en) 1999-11-17 2010-12-28 Mendel Biotechnology Inc. Transcription factors for increasing yield
US7888558B2 (en) 1999-11-17 2011-02-15 Mendel Biotechnology, Inc. Conferring biotic and abiotic stress tolerance in plants
US9175051B2 (en) 1999-11-17 2015-11-03 Mendel Biotechnology, Inc. Transcription factors for increasing yield
US7598429B2 (en) 2001-04-18 2009-10-06 Mendel Biotechnology, Inc. Transcription factor sequences for conferring advantageous properties to plants
US8912394B2 (en) 2001-04-18 2014-12-16 Mendel Biotechnology Inc. Transcriptional regulation of plant disease tolerance
US7964774B2 (en) 2008-05-14 2011-06-21 Monsanto Technology Llc Plants and seeds of spring canola variety SCV384196
US8872003B2 (en) 2008-11-19 2014-10-28 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Resistance to post harvest deterioration in cucumber
NL2003837A (en) * 2008-11-19 2010-05-21 Rijk Zwaan Zaadteelt En Zaadhandel Bv Resistance to post harvest deterioration in cucumber.
WO2010057960A1 (fr) * 2008-11-19 2010-05-27 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Résistance à la dégradation post-récolte du concombre
WO2010147825A1 (fr) 2009-06-09 2010-12-23 Pioneer Hi-Bred International, Inc. Promoteur d'endosperme précoce et procédés d'utilisation
WO2011036569A2 (fr) 2009-09-22 2011-03-31 The Board Of Trustees Of The University Of Arkansas, N.A. Cultivar de riz cl 142-ar
WO2011047191A1 (fr) 2009-10-15 2011-04-21 The Board Of Trustees Of The University Of Arkansas, N.A. Cultivar de riz cl181-ar
WO2011056544A1 (fr) 2009-10-26 2011-05-12 Pioneer Hi-Bred International, Inc. Promoteur somatique spécifique à un ovule et procédés d'utilisation
WO2013096818A1 (fr) 2011-12-21 2013-06-27 The Curators Of The University Of Missouri Variété de soja s05-11268
WO2013096810A1 (fr) 2011-12-21 2013-06-27 The Curators Of The University Of Missouri Variété de soja s05-11482
WO2013103371A1 (fr) 2012-01-06 2013-07-11 Pioneer Hi-Bred International, Inc. Promoteur spécifique d'ovule et méthodes d'utilisation
WO2013103365A1 (fr) 2012-01-06 2013-07-11 Pioneer Hi-Bred International, Inc. Promoteurs de pollen préférés et procédés d'utilisation
US8835720B2 (en) 2012-04-26 2014-09-16 Monsanto Technology Llc Plants and seeds of spring canola variety SCV967592
US8859857B2 (en) 2012-04-26 2014-10-14 Monsanto Technology Llc Plants and seeds of spring canola variety SCV259778
US8878009B2 (en) 2012-04-26 2014-11-04 Monsanto Technology, LLP Plants and seeds of spring canola variety SCV318181
WO2014059155A1 (fr) 2012-10-11 2014-04-17 Pioneer Hi-Bred International, Inc. Promoteurs de cellules de garde et leur utilisation
WO2014159306A1 (fr) 2013-03-13 2014-10-02 Pioneer Hi-Bred International, Inc. Application de glyphosate pour désherbage d'une brassicée
WO2014153254A2 (fr) 2013-03-14 2014-09-25 Pioneer Hi-Bred International Inc. Compositions et procédés pour contrôler des insectes ravageurs
EP3744727A1 (fr) 2013-03-14 2020-12-02 Pioneer Hi-Bred International, Inc. Compositions et procédés permettant de lutter contre les insectes nuisibles
WO2014150914A2 (fr) 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Polypeptides phi-4 et leurs procédés d'utilisation
WO2015023846A2 (fr) 2013-08-16 2015-02-19 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2015038734A2 (fr) 2013-09-13 2015-03-19 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
EP3692786A1 (fr) 2013-09-13 2020-08-12 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
EP4159028A1 (fr) 2013-09-13 2023-04-05 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2015120276A1 (fr) 2014-02-07 2015-08-13 Pioneer Hi Bred International Inc Protéines insecticides et leurs procédés d'utilisation
EP3705489A1 (fr) 2014-02-07 2020-09-09 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2016022516A1 (fr) 2014-08-08 2016-02-11 Pioneer Hi-Bred International, Inc. Promoteurs d'ubiquitine et introns, et procédés d'utilisation
WO2016044092A1 (fr) 2014-09-17 2016-03-24 Pioneer Hi Bred International Inc Compositions et procédés de lutte contre des insectes ravageurs
WO2016061206A1 (fr) 2014-10-16 2016-04-21 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2016099916A1 (fr) 2014-12-19 2016-06-23 E. I. Du Pont De Nemours And Company Compositions d'acide polylactique à vitesse de dégradation supérieure et à stabilité thermique accrue
WO2016186986A1 (fr) 2015-05-19 2016-11-24 Pioneer Hi Bred International Inc Protéines insecticides et leurs procédés d'utilisation
WO2016205445A1 (fr) 2015-06-16 2016-12-22 Pioneer Hi-Bred International, Inc. Compositions et procédés de lutte contre des insectes nuisibles
EP3943602A1 (fr) 2015-08-06 2022-01-26 Pioneer Hi-Bred International, Inc. Protéines insecticides d'origine végétale et leurs méthodes d'utilisation
WO2017023486A1 (fr) 2015-08-06 2017-02-09 Pioneer Hi-Bred International, Inc. Protéines insecticides d'origine végétale et leurs méthodes d'utilisation
WO2017040343A1 (fr) 2015-08-28 2017-03-09 Pioneer Hi-Bred International, Inc. Transformation de plantes médiée par ochrobactrum
WO2017105987A1 (fr) 2015-12-18 2017-06-22 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2017112006A1 (fr) 2015-12-22 2017-06-29 Pioneer Hi-Bred International, Inc. Promoteurs préférés par un tissu et procédés d'utilisation
EP4257694A2 (fr) 2015-12-22 2023-10-11 Pioneer Hi-Bred International, Inc. Promoteurs préférés par un tissu et procédés d'utilisation
EP3960863A1 (fr) 2016-05-04 2022-03-02 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2017192560A1 (fr) 2016-05-04 2017-11-09 Pioneer Hi-Bred International, Inc. Protéines insecticides et procédés pour les utiliser
WO2017218207A1 (fr) 2016-06-16 2017-12-21 Pioneer Hi-Bred International, Inc. Compositions et procédés de lutte contre des insectes nuisibles
EP4083215A1 (fr) 2016-06-24 2022-11-02 Pioneer Hi-Bred International, Inc. Éléments régulateurs de plantes et leurs procédés d'utilisation
WO2017222821A2 (fr) 2016-06-24 2017-12-28 Pioneer Hi-Bred International, Inc. Éléments régulateurs de plantes et procédés d'utilisation de ceux-ci
WO2018005411A1 (fr) 2016-07-01 2018-01-04 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et procédés pour leur utilisation
EP3954202A1 (fr) 2016-07-01 2022-02-16 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et leurs procédés d'utilisation
WO2018013333A1 (fr) 2016-07-12 2018-01-18 Pioneer Hi-Bred International, Inc. Compositions et procédés de lutte contre des insectes nuisibles
EP4050021A1 (fr) 2016-11-01 2022-08-31 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2018084936A1 (fr) 2016-11-01 2018-05-11 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2019060383A1 (fr) 2017-09-25 2019-03-28 Pioneer Hi-Bred, International, Inc. Promoteurs ayant une préférence pour des tissus et méthodes d'utilisation
WO2019178038A1 (fr) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et leurs procédés d'utilisation
WO2019178042A1 (fr) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et procédés pour leur utilisation
WO2019226508A1 (fr) 2018-05-22 2019-11-28 Pioneer Hi-Bred International, Inc. Éléments régulateurs de plante et leurs procédés d'utilisation
WO2020005933A1 (fr) 2018-06-28 2020-01-02 Pioneer Hi-Bred International, Inc. Procédés de sélection de plantes transformées
WO2020092487A1 (fr) 2018-10-31 2020-05-07 Pioneer Hi-Bred International, Inc. Compositions et procédés de transformation de plante médiée par ochrobactrum
CN111518185A (zh) * 2020-05-18 2020-08-11 山东农业大学 调控番茄果实品质的转录因子及其应用
WO2022015619A2 (fr) 2020-07-14 2022-01-20 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation

Also Published As

Publication number Publication date
EP1141270A1 (fr) 2001-10-10
IL143338A0 (en) 2002-04-21
CA2352468A1 (fr) 2000-06-08
AU2349500A (en) 2000-06-19
BR9915704A (pt) 2002-01-15
JP2002541763A (ja) 2002-12-10
ZA200104313B (en) 2002-01-22
WO2000032761A8 (fr) 2001-02-15
EP1141270A4 (fr) 2002-08-28

Similar Documents

Publication Publication Date Title
EP1141270A1 (fr) Facteur 1 de reponse ethylenique (erf1) dans des vegetaux
US7220587B2 (en) Ethylene insensitive plants
US20090265813A1 (en) Stress tolerance in plants
KR20100068435A (ko) 식물의 생리적 반응을 변형시키기 위한 조성물 및 방법
AU754803B2 (en) Cyclin-dependent kinase inhibitors and uses thereof
US6808926B1 (en) Repressing gene expression in plants
Curaba et al. GeBP, the first member of a new gene family in Arabidopsis, encodes a nuclear protein with DNA‐binding activity and is regulated by KNAT1
Pontier et al. Differential regulation of TGA transcription factors by post‐transcriptional control
CA2256121A1 (fr) Inhibiteurs de kinase dependante des cyclines en tant que regulateurs de la croissance des plantes
US6579716B1 (en) Better emergence characteristics and improved seedling growth under low-light environments
US5859338A (en) Plant clavata1 nucleic acids, transformed plants, and proteins
JP2002537834A (ja) Ｎｐｒ１と相互作用するｄｎａ結合タンパク質
AU754851B2 (en) A novel mitogenic cyclin and uses thereof
JP5337800B2 (ja) 標的化したエチレンシグナル伝達における低下による穀物収量の増加
Trentmann ERN1, a novel ethylene-regulated nuclear protein of Arabidopsis
EP1237403A1 (fr) Procede d'utilisation de mapk4 et de ses orthologues dans le but de commander la resistance aux maladies et la croissance de plantes
CA2272241A1 (fr) Sequences agl15 de plantes transgeniques
US6995306B1 (en) Nucleic acid encoding an NPR1 interactor from rice and method of use to produce pathogen-resistant plants
US20050060772A1 (en) Regulation of ethylene sensitivity during leaf and flower abscission
WO2003088738A1 (fr) Sensibilite a l'ethylene regulee en vue de reguler la longevite des fleurs dans une plante
MXPA01005355A (en) Ethylene-response-factor1 (erf1) in plants
Chae et al. LIKE HETEROCHROMATIN PROTEIN 1 (LHP1) partially inhibits the transcriptional activation of FT by MYB73 and regulates flowering in Arabidopsis
US20040172685A1 (en) Method of using MAPK4 and orthologues thereof to control plant disease resistance and plant growth
Stepanova Nuclear events in ethylene signaling in Arabidopsis thaliana
WO2001057063A1 (fr) Eto1 et proteines associees, et methodes visant a reguler la biosynthese d'ethylene

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: C1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

WR Later publication of a revised version of an international search report
WWE Wipo information: entry into national phase

Ref document number: 143338

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2352468

Country of ref document: CA

Ref country code: CA

Ref document number: 2352468

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 585392

Kind code of ref document: A

Format of ref document f/p: F

Ref document number: 1999US 9928104

Country of ref document: KE

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2001/04313

Country of ref document: ZA

Ref document number: 1999US9928104

Country of ref document: KE

Ref document number: PA/a/2001/005355

Country of ref document: MX

Ref document number: 200104313

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 23495/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 512263

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 1999967157

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09856834

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1999967157

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1999967157

Country of ref document: EP