EP1237403A1 - Procede d'utilisation de mapk4 et de ses orthologues dans le but de commander la resistance aux maladies et la croissance de plantes - Google Patents

Procede d'utilisation de mapk4 et de ses orthologues dans le but de commander la resistance aux maladies et la croissance de plantes

Info

Publication number
EP1237403A1
EP1237403A1 EP00981177A EP00981177A EP1237403A1 EP 1237403 A1 EP1237403 A1 EP 1237403A1 EP 00981177 A EP00981177 A EP 00981177A EP 00981177 A EP00981177 A EP 00981177A EP 1237403 A1 EP1237403 A1 EP 1237403A1
Authority
EP
European Patent Office
Prior art keywords
gene
mapk4
plant
mpk4
promoter
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00981177A
Other languages
German (de)
English (en)
Inventor
John Mundy
Anders Boegh Jensen
Morten Petersen
Henrik Naested
Peter Brodersen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Københavns Universitet
Original Assignee
Københavns Universitet
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Københavns Universitet filed Critical Københavns Universitet
Publication of EP1237403A1 publication Critical patent/EP1237403A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/8223Vegetative tissue-specific promoters
    • C12N15/8225Leaf-specific, e.g. including petioles, stomata
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8281Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for bacterial resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • This invention relates to the field of molecular biology and genetic transformation in higher plants More specifically, the invention relates to novel use of genes encoding MAP kinase 4 to control the expression of plant wounding and/or pathogen response genes and to control the growth of a plant
  • SAR systemic acquired resistance
  • PAD4 and EDS1 encode lipase-like proteins (Falk et al., 1999; Jirage et al., 1999), whereas NPR1 encodes an an- kyrin repeat protein (Cao et al., 1997). NPR1 interacts with basic leucine zipper transcription factors that bind to PR1 promoter elements, suggesting a direct link between NPR1 activity and regulation of PR gene expression (Zhang et al., 1999).
  • the CPR6 and SSI1 proteins may participate in signal communication between SA- and JA-dependent pathways.
  • Such pathway crosstalk is consistent with studies demonstrating antagonism between SA and JA signalling in defenses against pathogens and insect herbivores (Felton et al., 1999).
  • Mitogen-activated protein kinases (MAPKs or MPKs) have been identified in plants which are thought to be involved in the defence response to wounding and pathogen attacks (Mizoguchi et al., 1997).
  • MAP kinases such as Arabidopsis MPK4 (AtMPK4) act down- stream of MAPK kinases (MAPKK) and MAPKK kinases (MAPKKK) in reversible protein phosphorylation cascades to mediate intracellular signals.
  • MAPKK MAPK kinases
  • MAPKKK MAPKK kinases
  • MAPKKK MAPKK kinases
  • Activation of the MAP kinases occurs through threonine/tyrosine phosphorylation catalysed by the dual-specificity MAPKK, which in turn is activated through serine phosphorylation catalysed by MAPKKK. While these cascades amplify specific signals, they may integrate different signals by crosstalk via higher-order complexes (Madhani & Fink, 1998).
  • Arabidopsis contains numerous MAPKKs and MAPKs although the signals their pathways transduce remain unknown (Mizoguchi et al., 1997).
  • yeast 2-hybrid experiments indicate that Arabidopsis AtMAPK4 and the MAPKKs AtMKK2 and AtMEKI specifically interact with the MAPKKK AtMEKKI (lchimura et al., 1998). They may therefore participate in one or more cascades.
  • Morris et al. (1997) showed that AtMEKI mRNA accumulates slowly after wounding, while AtMEKKI mRNA accumulates in response to cold, salinity and touch (Mizoguchi et al., 1996).
  • MAPKK and MAPKKK genes An explanation for the apparent induction of expression of these MAPKK and MAPKKK genes is that the kinases are acting downstream of them and are part of a kinase cascade mediating responses to these stress stimuli (lchimura et al., 1998).
  • a model explaining their stress-induced expression is that the kinase cascade positively regulates responses to the stress, and their own expression is part of a positive feedback or amplification loop.
  • the activated MAPK phosphorylates downstream targets such as transcrip- tion factors, which activate or derepress the expression of genes needed for stress tolerance or adaptation.
  • MAPKs which are phosphorylated and activated by wounding, pathogenic inoculation, pathogen elicitors and salicylate (Romeis et al. 1999; Lipporink et al. 1997; Zhang & Klessig 1998).
  • the 48 kD MAP kinase, ERMK is rapidly activated upon high-affinity binding of a fungal elicitor to a plasma membrane receptor in parsley cells (Lcklerink et al. 1997).
  • the activated ERMK is translocated into the nucleus where it may be involved in the transcriptional activation of defence genes.
  • SIPK MAP kinase SA-induced-protein-kinase
  • MAP kinases may be involved in the regulation of cellular and developmental events in a plant.
  • dwarfism and sterility in MAP kinase mutants may be due to metabolic imbalance resulting from the energy required for mounting a constitutive pathogen response.
  • Other mu- tants with lesions in such stress response pathways also exhibit growth defects including dwarfism.
  • dwarf plants lacking the CTR1 MAPKKK and upstream ethylene receptors exhibit constitutive responses to the hormone ethylene (Hua SMeyerowitz, 1998).
  • constitutive pathogen response (CPR) mutants constitutively express pathogenesis related (PR) genes and are semi-dwarfed (Bowling et al., 1994). This study suggest that in CPR mutants salicylate may be involved as a signal controlling systemic acquired resistance (SAR).
  • SAR systemic acquired resistance
  • MAP kinases are an important component in the signal transduction pathways of plant defence to pathogen infection and wounding and in the regulation of plant growth.
  • Genes encoding these MAP kinases can thus be used in a variety of ways to improve or enhance the disease resistance response in commercially important cultivars and to control the growth of such cultivars. Accordingly, there is an industrial need to identify new useful genes that are involved in such disease resistance response and growth and to determine their function and mechanism in order to be able to use them in the control of the expression of defence genes and growth in commercial cultivars.
  • the present invention pertains to a method of controlling the growth of a plant and/or the expression of at least one wounding or pathogen response gene in said plant, the method comprising altering in the plant the level of the gene product of a MAPK4 gene.
  • a transgenic plant having enhanced wound and/or disease resistance comprising an antisense MAPK4 construct, wherein said construct leads to an increase in the expression of wounding and/or pathogen responsive genes.
  • the present invention provides a transgenic plant having enhanced wound and/or disease resistance, said plant comprising a consti- tutively active form of MAPK4.
  • the present invention also provides a transgenic plant having enhanced wound and/or disease resistance, said plant comprising a catalytically inactive MAPK4 construct, wherein said construct leads to an increase in the expression of wounding and/or pathogen responsive genes.
  • the present invention provides a transgenic plant having enhanced wound and/or disease resistance, said plant comprising a mutation in the MAPK4 gene which results in a loss of function of said gene, wherein said mutation leads to an increase in the expression of wounding and/or pathogen responsive genes.
  • the present invention relates to a recombinant DNA construct comprising the coding region of MAPK4 gene operably linked in an antisense orientation to an appropriate promoter. Furthermore, the present invention provides a transgenic plant cell transformed with the DNA construct according to the invention.
  • the present invention relates to a method for screening a plant population for plants carrying an insertion element within the MAPK4 gene whereby the gene is functionally inactivated, the method comprising the steps of a) providing a MAPK4 specific primer and an insertion element specific primer, b) providing DNA of each of said plants, c) performing PCR reactions using said primers, and d) selecting a plant carrying an insertion element within the MAPK4 gene whereby the gene is functionally inactivated by identifying a PCR product primed by said primers.
  • the invention pertains to the use of a MAPK4 gene for providing MAPK4 primers useful in the method according to the invention.
  • MAPK4 may play an important role in signal transduction for activation of plant defence mechanisms against plant pathogens and wounding and in developmental events in a plant. Accordingly, the new methods, plants and plant cells provided herein offer a novel and significant advance in the field of transforming higher plants and plant breeding to enhancing the plant disease resistance response in the most important agronomic plants.
  • the MAPK4 gene was cloned from Arabidopsis thaliana by Mizoguchi et al. (1993) and is a member of a gene family consisting of at least nine members (AtMPK1-9) which are classified into four subgroups based on phylogenetic analysis of their amino acid se- quences (Mizoguchi et al. 1997). It was shown that AtMAPK4 may act downstream of MAPKK and MAPKKK in a reversible protein phosphorylation cascade, as described above, to mediate intracellular signals. However, the specific function of AtMAPK4 in the signal transduction has until now been unknown.
  • Example 1 it was possible for the inventors of the present invention to identify by visual examination of stable transposant lines a recessive dwarf Arabidopsis mutant ⁇ mpk4), caused by the insertion of a modified maize Ds transposon in the MAP kinase 4 gene ⁇ Mpk4).
  • mpk4 knockout By analysis of the nature of the mpk4 knockout, it was found that the growth of a plant and/or the expression of wounding or pathogen reponse in a plant is controlled by the level and activity of the gene product of the MAPK4 gene.
  • the terms "MAPK4 gene” and "MPK4 gene” is used interchangeably and designate the gene coding for the MAPK4 protein.
  • the MAPK4 in one instance negatively regulates the expression of genes associated with disease (e.g. PR-genes) and wound responses such that the loss of MAPK4 function leads to their derepression.
  • the expression "negatively regulates” indicates the genes' capability to suppress or depress the expression of specific genes.
  • the expression of the MAPK4 gene is required for responses to jasmonates.
  • jasmonates relates to the whole family of jasmonates and include e.g. jasmonate (JA) and methyl jasmonate (MeJA).
  • Arabidopsis thaliana MAPK4 cDNA (AtMPK4) is exemplified herein, this invention is intended to encompass the use of MAPK4 nucleic acids and
  • MAPK4 proteins from other plant species that are sufficiently similar to be used instead of the Arabidopsis MAPK4 for the purposes described below.
  • MAP kinases are found in a variety of plant species and are highly conserved among plants (Mitzoguchi et al. 1996).
  • a person skilled in the art would expect to find se- quence variation among these MAP kinases, due to small changes in the genetic code, while still conserving the unique properties of the MAPK4 gene intended for the use in the present invention.
  • the present invention contemplates the use of MAPK4 nucleic acid molecules that encode MAPK4 polypeptides, the nucleic acid molecules having a homology of at least 70%, preferably at least 80% and most preferably at least 90% ho- mology, such as at least 95% homology, with the nucleotide sequence of Arabidopsis MAPK4 shown in SEQ NO ID: 1.
  • the invention relates to MAPK4 polypeptides that include an amino acid sequence having at least 50%, e.g. at least 60%, including at least 70%, such as at least 80%, e.g. at least 90% homology to the sequence shown in SEQ NO ID:2.
  • sequence identity indicates a quantitative measure of the degree of homology between two amino acid sequences of equal length or between two nucleotide sequences of equal length. If the two sequences to be compared are not of equal length, they must be aligned to the best possible fit.
  • sequence identity can be
  • a gap is counted as non-identity of the specific residue(s), i.e. the DNA sequence AGTGTC will have a sequence identity of
  • Sequence identity can alternatively be calculated by the BLAST program, e.g. the BLASTP program (Pearson & Lipman (1988) (www.ncbi.nlm.nih.gov/cgi-bin/BLAST).
  • BLASTP program Pearson & Lipman (1988) (www.ncbi.nlm.nih.gov/cgi-bin/BLAST).
  • alignment is performed with the global align algorithm with default parameters as described by Huang & Miller (1991), available at
  • the MAPK4 orthologues according to the present invention include, but are not limited to, nucleic acid sequences similar to the AtMPK4 sequence but differing from this sequence by one or more substitutions, deletions and/or additions.
  • the level of the gene product of a MAPK4 gene is altered in the plant by the following steps a) providing a recombinant DNA construct in a suitable vector in which the coding region of a MAPK4 gene is operably linked in an anti-sense orientation to an appropriate promoter such that 5 the expression of the MAPK4 gene is regulated by said promoter; b) transforming regenerable cells of a plant with said recombinant DNA construct; and c) regenerating a transgenic plant from said transformed cell.
  • transgenic plant refers to a plant which by the process of 30 transformation is made to contain DNA sequences which are not normally present in the plant, or DNA sequences which are in addition to the sequences which are normally in the plant, or DNA sequences which are normally in the plant but which are altered compared to the native sequence.
  • DNA construct refers to a genetic sequence used to transform plant cells and generate progeny transgenic plants.
  • a DNA construct comprises at least a coding region for a desired gene product, operably linked in an anti-sense orientation to the 5' and 3' regulatory sequences for the expression in plants.
  • such DNA constructs are chimeric, i.e. consisting of a mixture of sequences from different sources.
  • non-chimeric DNA constructs may also be used in the present invention.
  • the DNA construct may also be operably linked in a sense orientation, according to the discussion below.
  • anti-sense refers to the sequence of the DNA strand that is complementary to the sequence of the sense strand and cannot be translated into the polypeptide encoded by the structural gene.
  • antisense refers to a DNA construct that is operably linked to a promoter in the reverse orientation such that when the DNA is transcribed, an antisense RNA molecule is produced that has a nucleotide se- quence that is complementary to and capable of hybridising to an mRNA produced from the same DNA sequence in the sense orientation leading to a reduced level of endogenous MAPK4 protein.
  • sense refers to the sequence of the DNA strand of a structural gene that is transcribed into an mRNA molecule copy which is then translated into the polypeptide encoded by the structural gene.
  • DNA construct in a vector in which the coding region of an intact MAPK4 is operably linked in a sense orientation to a promoter is discussed below.
  • operably linked means that the regulatory sequences which are necessary for the expression of the coding sequence are placed in the DNA molecule in the appropriate position relative to the coding sequence so as to effect the expression of the coding sequence.
  • promoter means herein a DNA sequence which causes transcription of DNA into an RNA molecule.
  • promoter is used to denote DNA sequences that permit transcription in a plant.
  • vector means a DNA molecule that is capable of replicating in a cell to which another DNA sequence can be operably linked as to bring about replication of the attached DNA sequence. Commonly used vectors are discussed below and include bacterial plasmids and bacteriophages.
  • the DNA constructs can be incorporated in plant cells using conventional recombinant DNA technologies. Generally, such techniques involve inserting the DNA in an expression vector which contains the necessary elements for the transcription and translation of the inserted protein coding sequence and one or more marker sequences to facilitate selection of transformed cells or plants. Once the DNA construct (chimeric or non-chimeric) has been cloned into an expression vector, it may be introduced into the plant cell using conventional transformation procedure known by a person skilled in the art.
  • plant cell is intended to encompass any cell derived from the plant including undifferentiated tissues such as callus and suspension cultures, as well as plant seed, pollen or plant embryos.
  • Plant tissues suitable for transformation includes leaf tissue, root tissue, meristems, protoplasts, hypocotyls, cotyledons, scutellum, shoot apex, root, im- mature embryo, pollen and anther.
  • the term “resistance” indicates the ability of a transgenic plant cell to resist the effect of wounding and pathogen attack.
  • “enhanced” or “increased” resistance is meant a greater level of resistance to a disease-causing pathogen and/or wounding in a transgenic plant (or cell or seed hereof) produced in the method of the invention than the level of resistance relative to a control plant (e.g. a non-transgenic plant or non-transgenic mother plant).
  • the level of resistance to wounding or to a pathogen is at least 10%, e.g. at least 20%, including at least 30%, such as at least 40%, e.g. at least 50% greater than the resistance of a control plant.
  • the level of resistance to wounding and/or a pathogen is at least 60%, e.g. at least 70%, including at least 80%, such as at least 90% greater than the resistance of the control plant; with up to 100% above the level of resistance as compared to the control plant being most preferred.
  • the level of resistance is measured by conventional methods.
  • the level of resistance to wounding or a pathogen may be determined by comparing physical features and characteristics (e.g. plant height and weight, or by comparing disease symptoms, e.g. delayed lesion development, reduced lesion size, leaf wilting and curling, water-soaked spot, and discoloration of cells) of transgenic plants (Jach et al., 1995, Whalen et al., 1991).
  • the term "pathogen” relates to an organism whose infection of viable plant tissue elicits a disease response in the plant tissue.
  • the transgenic plant has an enhanced resistance to plant pathogens selected from the group consisting of virus, viroids, fungi, bacteria, in- sects, mycoplasma, and nematodes. Plant diseases caused by these pathogens are described in the Chapters 11-16 of Agrios (1988).
  • disease defence response is used interchangeably with the terms “disease resistance response” or “pathogen response” and refers to a change in metabolism bio- synthetic activity or gene expression that enhances the plants' ability to suppress the replication and spread of a microbial pathogen (i.e. to resist the microbial pathogen).
  • plant disease defence reponse include, but are not limited to, syntheses of antimicrobial compounds (referred to as phytoalexins) and induction of expression of defence genes, whose products include e.g. peroxidases, cell wall proteins, proteinase inhibitors, hydrolytic enzymes, pathogenesis related (PR) proteins and biosynthetic enzymes.
  • defence response pathways are salicylic acid (SA) dependent, while others are partially SA dependent and still others are SA independent (Bowling et al. 1994). Furthermore, some defence response pathways are jasmonic acid (JA) or methyl jasmonate (JA) dependent as explained in detail below.
  • SA salicylic acid
  • JA jasmonic acid
  • JA methyl jasmonate
  • a plant species or cultivar may be transformed with a DNA construct that encodes a poly- petide from a different plant species or cultivar (e.g. rice transformed with a gene encoding the tobacco MAPK4) or alternatively, a plant species or cultivar may be transformed with a DNA construct that encodes a polypeptide from the same plant or cultivar.
  • a plant species or cultivar may be transformed with a DNA construct that encodes a polypeptide from the same plant or cultivar.
  • the transgenic plant has an enhanced wound and/or disease resistance. Since MAPK4 and its othologues are likely to be involved in a MAP kinase signal transduction cascade that negatively regulates defence gene expression, transgenic plants with an inactive MAPK4 produced in the method according to the invention have an altered expression of their naturally plant disease defence genes such as PR-genes. If a constitutive promoter is used, antisense MAPK4 transcripts lead to reduced accumulation and/or expression of endogenous MAPK4 mRNA, thereby reducing the expression of functional MAPK4 protein.
  • the reduced levels of endogenous MPK4 protein may lead to the constitutive expression of PR genes such that they are expressed in a healthy plant in the absence of wounding and/or pathogen presence or infection. The plant is thus prepared for an attack by pathogens.
  • an MAPK4 gene or parts thereof may be used to produce antisense MAPK4 under the control of inducible promoters.
  • PR gene expression would be derepressed in response to the application to plants of an inducing substance or mixture or in response to a given abiotic treatment.
  • the transformation with the antisense MAPK4 construct leads, relative to the wild type plant, to an increased content of salicylic acid (SA) in the transgenic plant.
  • SA salicylic acid
  • the increased content of salicylic acid results in the induction of a SA-dependent systemic acquired resistance (SAR).
  • JA jasmonic acid
  • JA methyl jasmonate
  • SA-responsive genes and JA-responsive genes may work in part antagonistically in a plant to induce different types of resistance to different types of pathogens (Thomma et al., 1998; Schenk et al., 2000).
  • these two major pathways are oppositely affected in mpk4 mutants, in contrast other plants such as e.g. tobacco, a simultaneous activation of the SA and JA- dependent pathway is possible.
  • the DNA construct comprises a further MAPK4 gene which is operably linked to an appropriate promoter, such that the expression of that MAPK4 gene is regulated by said promoter.
  • an increased JA-responsive gene expression may be obtained by the following two approaches.
  • the first approach is a constitutive overexpression of a wildtype MPK4 protein which reduces the induction of SA-responsive SAR and makes the JA- responsive gene expression hyperinducible.
  • the further MAPK4 gene is overexpressed. This increased expression of the MAPK4 gene leads to an increased response to jasmonates in the transgenic plant.
  • the second approach involves the production of inducible MPK4 versions either wildtype protein or constitutively activated MPK4 forms. Induction of the constitutively activated MPK4 forms will boost JA-inducible defences.
  • constitutively active MPK4 there are at least two ways in which to produce a constitutively active MPK4 form.
  • the term "constitutively active MPK4" relates to a kinase form which is continually or more than normally capable of phosphorylating its sepcific substrates. This can in theory be accomplished in two ways.
  • a fusion between a MAPK to an upstream MAPKK which is made catalytically constitutive active by mutation (see below) leads to a constitutively active MAPKK/MAPK fusion protein.
  • This is due to the fact that if the MAPKK is active itself, its proximity to the MAPK allows it to phosphorylate the MAPK all the time, thereby making it constitutively active.
  • MPK4 interacts with two Arabidopsis MAPKKs, AtMEKI and AtMKK2. It has been shown that AtMKK2 Thr 220 and Thr 226 are required for AtMKK2 activity.
  • the gene product of the further MPK4 gene is produced in a constitutively active form.
  • the increased activity of MAPK4 leads to an increased jasmonate (JA) response in the transgenic plant.
  • JA jasmonate
  • These responses include, but are not limited to, the induction of resistance or response(s) to the fungus Alternaria bassicicola and the induction of certain defensive genes such as the gene coding for PDF1.2 (a defensin) and THI2.1 (a thionin), both of which are anti-microbial polypeptides.
  • the level of the gene product of a MAPK4 gene is altered in the plant by the following steps a) providing a gene coding for an active MAPKK, b) fusing said MAPKK gene with a recombinant DNA construct in a suitable vector in which the coding region of a MAPK4 gene is operably linked to an appropriate promoter such that the expression of the MAPK4 gene is regulated by said promoter, in order to obtain an activated MAPKK/MAPK4 fusion protein, c) transforming regenerable cells of a plant with said MAPKK/MAPK4 fusion protein in order to express a constitutively activated MAPK4 in said cells, d) regenerating a transgenic plant from said transformed cell.
  • the expression of the MAPK4 gene is increased which in turn leads, relative to the wild type plant, to an increased response to jasmonates (JAs) in the transgenic plant.
  • the increased JA- response results in the expression of JA-responsive genes selected from the group consisting of the PDF1.2 gene and the THI2.1 gene.
  • the method comprises the steps of a) providing a recombinant DNA construct in a suitable vector in which the coding region of a gene coding for a catalytically inactive MAPK4 is operably linked in a sense orientation to an appropriate promoter such that the expression of the catalytically inactive MAPK4 encoding gene is regulated by said promoter; b) transforming regenerable cells of a plant with said recombinant DNA construct; and c) regenerating a transgenic plant from said transformed cell.
  • the DNA construct can be incorporated into plant cells using the conventional recombinant techniques as described above.
  • this method takes advantage of the fact that it is possible to make phosphorylatable but catalytically inactive MAP kinases by mutating amino acid residues involved in ATP binding. These forms can still interact and be modified by other proteins such as by phosphorylation by one or more upstream MAPKK(s).
  • phosphorylatable, inactive MAPK4 forms could be generated by in vitro mutagenesis of residues corresponding to Arabidopsis MAPK4 tyrosine 54 or lysine 72 to phenylalanine or argin- ine, respectively.
  • Such catalytically inactive MAPK forms expressed as sense trans- genes, may compete with endogenous, catalytically activatable forms either for interaction with upstream proteins, such as MAPKKs, or for interaction with downstream partners such as transcription factor(s) controlling the expression of PR genes. Depending upon the strength of this competition, a catalytically inactive form may lead to derepression, and therefore expression of PR genes.
  • Non-phosphorylatable and therefore inactive MAPKs may e.g. be produced by mutating amino acid residues involved in MAPK phosphorylation by MAPKKs, for example by using in vitro mutagenesis of residues corresponding to Arabidopsis MPK4 threonine 201 and tyrosine 203 to alanine and phenylalanine, respectively.
  • the product of the inactive MAPK4 gene is non-phosphorylatable. The generation of such non-phoshorylatable, catalytically inactive MAPK forms is known by the person skilled in the art.
  • one method of generating non- phosphorylatable, inactive MPK4 forms could be by using in vitro mutagenesis of residues corresponding to Arabidopsis MPK4 threonine 201 and tyrosine 203 to alanine and phenylalanine, respectively.
  • This embodiment of the invention has the advantage over antisense strategy that the control and monitoring of expression levels of sense transgenes, such as catalytically inactive, sense MAPK4 forms, may be more simple than the control and monitoring of expression levels of an antisense construct and of the endogenous, catalytically activatable MAP kinases.
  • a sense form of a catalytically inactive, Arabidopsis MAPK4 might, as discussed above, exhibit derepressive effects not only in Arabidopsis but also in other species depending upon structural and functional conservation. This means that a single sense construct can be used in many different plants.
  • one possible way of controlling the growth of a plant and/or the expression of at least one wounding or pathogen response gene in a plant is by mutating the MAPK4 gene in said plant in order to obtain a so-called knock-out mutant or a loss of function mutant.
  • the level of the gene product of a MAPK4 gene is altered in the plant by the following steps a) mutating in a regenerable plant cell the MAPK4 gene so as to obtain a loss of function of said gene, and b) regenerating a transgenic plant from said transformed cell.
  • said mutation is provided by inserting an insertion element within the MAPK4 gene, wherein the insertion element is selected from the group consisting of a T-DNA and a transposon.
  • the term "insertion element" relates to a segment of DNA, such as T-DNA or transposons, which is inserted in a specific gene.
  • pathogenesis related (PR) genes means genes or their encoded proteins which are expressed, synthesised or activated in conjunction with the infection with a pathogen to which the plant is usually resistant.
  • PR genes are expressed in association with the establishment of systemic acquired resistance (SAR) and local acquired resistance response (LAR) or a jasmonic acid or methyl jasmonate (JA) dependent reponse.
  • SAR systemic acquired resistance
  • LAR local acquired resistance response
  • JA methyl jasmonate
  • the wounding and pathogen reponse genes are genes coding for gene products selected from the group consisting of chitinase, extensin (EXT1), PR1 , PR5, lipid transfer protein (LTP), ⁇ -1 ,3-glucanase (BGL2/PR2), ⁇ -1 ,3-glucanase (BGL3), glutathione S-transferase (ERD11), glutathione S-transferase (PM24), ascorbate free radical reductase, lipid transfer protein, pectin methylesterase (PME1), LRR receptor kinase, oxalate oxidase-like (GLP5), osmotin, thioni, glycin-rich proteins (GPRs), phenylalanine ammonia lyase (PAL), lipoxygenase (LOX), monodehydroascorbate reductase, a lipid transfer protein, pect
  • wounding or pathogen response gene is overexpressed.
  • the overexpression results in an enhanced resistance to plant pathogens selected from the group consisting of viruses, fungi, bacteria, insects and nematodes.
  • wounding response relates to a change in metabolism, biosynthetic activity or gene expression that occurs in a plant in response to wounding (e.g. cutting, abrasion).
  • Wounding related genes and their encoded proteins are activated in association with wounding of a plant. These genes are also referred to as wounding inducible genes, as they may be induced in a disease defence response or a wounding response, with similar or differing kinetics of induction.
  • transgenic plants produced by the method according to the invention and comprising an altered level of the gene product of a MAPK4 gene may also exhibit visible, phenotypic abnormalities including reduced size.
  • the transgenic plant, relative to a wild type plant has a reduced growth.
  • the inventors propose that the dwarfism of plants transformed with the antisense MAPK4 construct may be due to metabolic imbalance resulting from the energy required to mount a constitutive pathogen response and may be caused by many types of genetic lesions.
  • the responses of mpk4 mutants and wild type plants were found to be equivalent to various plant growth regulators and abiotic stresses as measured by a panel of physiological and molecular assays.
  • northern hybridisation demonstrated that mpk4 mutants ectopically over-expressed several pathogenesis responsive (PR) genes.
  • PR pathogenesis responsive
  • the reduction in MAPK4 protein and/or its activity may also be such that a plant produced with the method according to the invention is phenotypically different from other plants which also are resistant to wounding and/or pathogens, as the transgenic plant produced by the method according to the invention does not exhibit hypersensitive expression of PR genes when wounded and/or challenged by a pathogen and thus does not get necrotic lesions.
  • hypersensitive expression or "hypersensitive response” relates to an induced response by which the plant deprives the pathogen of living host cells by localised cell death at the site of attempted pathogen ingress.
  • an agronomically important plant may in accordance to the method of the invention be stably transformed with the above mentioned antisense or mutant MAPK4 transcribed regions and their expression induced for the purpose to control or regulate plant growth, e.g. in cereal crops or in ornamental plants.
  • the same MAPK4 regions could be placed under the control of a developmentally regulated or tissue-specific promoter in order to decrease the growth of the plant at a given developmental stage or to decrease the growth of a specific organ or tissue.
  • dwarf plants could be produced for the purpose of bonsai culture by selecting for homozygous MAPK4 null alleles or by constitutive expression of an MAPK4 antisense.
  • control or “regulate” are used interchangeably with respect to size and relate to increasing or decreasing of the vegetative size of the plant.
  • the MAPK4 gene may be placed under a powerful constitutive promoter in the DNA construct.
  • the promoter is a constitutive promoter selected from the group consisting of cauliflower mosaic virus 35S promoter, cauliflower mosaic virus 90 with G-box 10 tetramer promoter (Ishige-Fumiharu et al. 1999), maize Adh promoter (Last et al., 1991), maize ubiquitin Ubi -I promoter (Christensen & Quail, 1996) and rice Act1 promoter (McElroy et al., 1990).
  • constitutive promoter is meant a promoter that is active all the time and does not require any specific stimulus for its activation.
  • transgenic plants expressing the MAPK4 gene under an inducible promoter are also contemplated to be within the scope of the present invention.
  • the promoter is an inducible promoter, e.g.
  • inducible promoter relates to promoters which are activated in the presence of a specific agent (the inducer), which may be a chemical compound or a physical stimulus such as heat or light.
  • the chemical compound may be a chemical regulator which is not normally found in the plant in an amount sufficient to effect activation of the promoter, and thus the transcription of the DNA construct, to the desired degree at the time desired.
  • an agronomically important plant may be stably transformed with a chimeric gene containing e.g. one of the above inducible promoters driving the expression of the whole or a part of the transcribed region of an MAPK4 in the anti-sense orientation. If the inducer is applied to the plant during a period of pathogen attack, induced MAPK4 antisense ex- pression will reduce expression or accumulation of endogenous sense MAPK4 mRNA, thereby reducing levels of endogenous MAPK4 protein. As MAPK4 represses the expression of downstream PR genes, chemical induction of the antisense will lead to expression of PR genes and hence increased pathogen protection.
  • an agronomically important plant may be stably transformed with a chimeric gene containing an inducible promoter driving the expression of a catalytically inactive MAPK4 mutant protein. If the inducer is applied to the transgenic plant, inactive MAPK4 will compete with endogenous, activatable MAPK4, thereby leading to expression of downstream genes. This mechanism is explained in detail below.
  • the methods according to the invention are useful in enhancing resistance to disease- causing pathogens in both monocotyledonous plants ("monocots") or dicotyledonous plants ("dicots").
  • monocots such as rice, wheat, barley, rye, corn, maize or asparagus
  • dicots such as avocado, apple, apricot, banana, bean, blackberry, broccoli, cabbage, carrots, cauliflower, celery, cherry, chicory, cucumber, garlic, grape, lettuce, mango, melon, nectarine, onion, papaya, parsley, pea, peach, pear, pepper, pineapple, plum, pumpkin, potato, radish, raspberry, squash, spinach, strawberry, soybean, sweet potato, tobacco, turnip, zucchini and pot plants and ornamental plants such as e.g. pelargonium, petunia, geranium, roses, tulips, daff
  • transgenic plants produced by the method according to the invention and comprising the inactive MAPK4 sense transcripts may also exhibit visible, phenotypic abnormalities including reduced size.
  • the transgenic plant has, relative to the wild type plant, reduced growth.
  • Arabidopsis thaliana MAPK4 cDNA (AtMPK4) is exemplified herein, this invention is intended to encompass the use of MAPK4 nucleic acids and MAPK4 proteins, as well as corresponding antisense nucleic acid sequences and nucleic acid sequences encoding catalytically inactive MAPK4 proteins, from other plant species that are sufficiently similar to be used instead of the Arabidopsis MAPK4 for the purposes described herein.
  • the present invention relates to a transgenic plant having enhanced wound and/or disease resistance, said plant comprising an antisense MAPK4 construct, wherein said construct leads to an increase in the expression of wounding and/or pathogen responsive genes.
  • the invention in another aspect relates to a transgenic plant having enhanced wound and/or disease resistance, said plant comprising a constitutively active form of MAPK4.
  • the invention relates to a transgenic plant having enhanced wound and/or disease resistance, said plant comprising a catalytically inactive MAPK4 construct, wherein said construct leads to an increase in the expression of wounding and/or pathogen responsive genes.
  • the invention provides a transgenic plant having enhanced wound and/or disease resistance, said plant comprising a mutation in the MAPK4 gene which results in a loss of function of said gene, wherein said mutation leads to an increase in the expression of wounding and/or pathogen responsive genes.
  • the transgenic plants according to the invention have, relative to the wild type plants, reduced growth.
  • the transgenic plants according to the invention are monocots or a dicots.
  • the present invention relates to a recombinant DNA construct comprising the coding region of MAPK4 gene operably linked in an antisense orientation to an appropriate promoter. It will be appreciated that a useful promoter may be selected from the constitutive or inducible promoter described above. In a still further aspect the invention relates to a transgenic plant cell transformed with the DNA construct according to the invention.
  • Such methods for screening a plant population are generally recognised in the art as a "reverse genetic screen or analysis” and/or as a "gene machine”.
  • the invention pertains to the use of a MAPK4 gene for providing MAPK4 primers useful in the method according to the invention.
  • Fig. 1 shows the MPK4 genomic fragment amplified by primers (18mers at ends of this sequence: no name BamH1 linker and p3y).
  • the sequence is the complement of nt4700- 7918 of BAC IG002N01 (GENBANK/EMBL accession AF007269, NID 2191126 deposited 12/6/97. According to accession, gene starts at 130 of this sequence. Underlined are ex- ons from cDNA (accession D21840, NID 457399), bold are start, stop, and > is Ds insertion site;
  • Fig. 2 shows in (B) the sequence of the MPK4 first intron with acceptor site (AGT) from wild type Ler.
  • AGT acceptor site
  • the numbers above are base pairs from the same sequence of wild type Col-0 (complement of GL2191126; ABB61033).
  • Middle the 8bp Ds target site insertion in mpk4 (bold).
  • Bottom the 7bp footprint with a single nucleotide change in the revertant produced by Ds excision.
  • C Northern blot of 10 ⁇ g total RNA from wild type (wt) and mpk4 probed with radio-labelled MPK4 cDNA and EF-1 ⁇ cDNA as a loading control.
  • Fig. 3 shows the resistance of mpk4 to bacterial and oomycete pathogens.
  • A Four-week- old wild type and mpk4 plants were inoculated with the virulent strain DC3000 of Pseu- domonas syringae pv. tomato at a concentration of 1x10 5 colony forming units per ml (cfu/ml). Values represent average and standard deviations of cfu extracted from leaf disks in three independent samplings;
  • Fig. 4 shows the accumulation of PR mRNAs and SA in wild type and mpk4.
  • A RNA gel blots of 10 ⁇ g total RNA from wild type (wt) and mpk4 probed with radiolabelled PR1 , PR2, PR5, and EF-1 ⁇ loading control.
  • B Leaves from 4-week-old plants grown in soil were harvested and free SA and SAG contents (ng/g fresh weight) quantified by HPLC;
  • Fig. 5 shows in (B) a RNA gel blot showing the accumulation of PR1 mRNA in mpk4, ho- mozygous mpk4 expressing NahG, and the npr1-1/mpk4 double mutant. EF-1 ⁇ (bottom) is the loading control.
  • C Growth of the virulent strain DC3000 of Pseudomonas syringae pv. tomato after inoculation into nahG/mpk4 and the parental nahG and mpk4 lines. Experimental conditions were as described in fig. 3A.
  • D Similar experiment as (C) carried out on the npr1-1/mpk4 double mutant and parental lines;
  • Fig. 6 shows the accumulation of PDF1.2 mRNA in wild type, mpk4 mutant and in plants expressing nahG.
  • A Northern blot showing the accumulation of the JA-inducible PDF1.2 mRNA in wild type (wt) and mpk4.
  • EF-1 ⁇ bottom is the loading control.
  • B Accumulation of PDF1.2 mRNA in wild type and mpk4 mutants expressing nahG.
  • mutant phenotypes caused by gene knockouts is an important first step in elucidating the functions of corresponding genes (Miklos & Rubin, 1996).
  • insertions in a specific gene of interest can be identified by screening individual or pooled plant DNA by PCR with gene-specific and T-DNA- or transposon- specific primers.
  • a drawback of the high frequency insertion systems is that backcrossing is generally required to obtain lines carrying single site insertions for mutants analysis.
  • specific, loss of function gene disruption can be
  • RNA blot and cDNA microarray hybridizations demonstrate that the mutant constitutively expresses PR genes normally induced by SA and fails to induce PDF1.2 and THI2.1 mRNA in re- sponse to JA.
  • Molecular cloning, revertant analysis and complementation studies demonstrate that the phenotype of the mutant ⁇ mpk4) is caused by loss of MPK4 activity.
  • Transposant lines were generated as described by Sundaresan et al. (1995) using the transgenic parental lines in the Ler ecotype obtained from the Arabidopsis Information Service (http://aims.cps.msu.edu/aims/) expressing maize Ac transposase (Ac1 , order #CS8043/N8043) and carrying an engineered maize Ds gene trap cassette ⁇ DsG1, order # CS8046/N8046).
  • F3 seeds from individual selfed, F2 plants (named G1-n for gene-trap in the order F2 plants were harvested) were selected on kanamycin. A minimum of 12 of these plants were then transferred to soil and allowed to grow to maturity in a green house. Plants were examined visually during growth and flowering for phenotypic abnormalities.
  • leaves were fixed overnight at 5°C in 0.1 M phosphate buffered (pH 7.0) 2.5% glutaraldehyde and 2% paraformaldehyde, postfixed in 1% Os0 , dehydrated in acetone, critical-point-dried via C0 2 , gold sputter-coated, and examined in a Philips 515 scanning electron microscope.
  • phosphate buffered pH 7.0
  • glutaraldehyde and 2% paraformaldehyde postfixed in 1% Os0 , dehydrated in acetone, critical-point-dried via C0 2 , gold sputter-coated, and examined in a Philips 515 scanning electron microscope.
  • DNA manipulations were performed after standard procedures (Maniatis et al., 1982). More specialised protocols relating to plant growth, nucleic acid extraction and purification and plant transformation are described by the inventors electronically at http://genome- www.stanford.edu/Arabidopsis/Protocols Mundy2.html.
  • the transposon Ds insertion region was identified by Southern blotting of genomic DNA from the G16 dwarf progeny di- gested with EcoRI (single site in Ds) probed with the E. coli UidA (GUS) gene carried on the end of Ds (Sundaresan et al., 1995).
  • a 4.5kb hybridising fragment (SEQ ID NO:1) including 2.4kb GUS and Ds sequences and 2.1kb flanking genomic sequence was purified by gel electrophoresis, ligated to EcoRI digested lambda gt11 arms, and the flanking region between Ds and the vector arm amplified with a long range PCR kit (Perkin-Elmer) using a vector primer (5'CAGACCAACTGGTAATGGTAGCG, SEQ ID NO:3) and a GUS primer (5' CTGCATCGGCGAACTGATCG, SEQ ID NO:4) (Fig. 1). Sequencing of both strands on an Applied Biosystems ABI 310 and comparison of these sequences using BLAST (Altschul et al.
  • RNA was prepared for RNA gel blot hybridisation using standard protocols (RNA- gents ® Total RNA, Promega). Probe templates were amplified by PCR from cDNAs or genomic DNA with primer sequences from: MPK4 (GL457399), PR1 (GL4454853), ⁇ -1 ,3- glucanase or PR2 (GM66637), PR5 (GL6646759), PDF1.2 (Gl: 4759674), THI2.1 (Gl: 1181530) and elongation factor 1 ⁇ control (GL16260).
  • MPK4 GL457399
  • PR1 GL4454853
  • ⁇ -1 ,3- glucanase or PR2 GM66637
  • PR5 GL6646759
  • PDF1.2 Gl: 4759674
  • THI2.1 Gl: 1181530
  • elongation factor 1 ⁇ control GL16260
  • RNA was purified from 200 ⁇ g total RNA with 2 ⁇ g of Dynabeads Oligo(dT) 25 (Dynal). cDNA microarray production, preparation of fluorescent probes and microarray hybridisation and scanning have been described previously (Ruan et al., 1998). The hybridisation experiment was performed twice using microarrays hy- bridised to cDNAs from two samples each of mpk4 and wild type mRNA.
  • the 17 putative promoter regions were used as input in a Gibb's sampler, which can detect short patterns or matrices that are not necessarily 100% conserved (Lawrence et al., 1993), to identify sequences which might be regulatory c/s-elements. Searches were performed for elements ranging from 6 to 16 bp. The sampler repeatedly found Matrix 1 (TTGACT) and Matrix 2 (GACTWWHC) when searching for elements of 6 or 8 bp, respectively. The best matrices found for 7, 9, 10, 11 and 12 bp all had similarity to Matrix 2, but lower information content.
  • the nucleotides in the 17 promoter sequences were shuffled 300 times, producing 300 sets of 17 promoter se- quences of conserved lengths and nucleotide compositions. Gibbs sampling was performed on each of the shuffled sequence sets for both 6 and 8 bp elements, and the total information content for the best matrix was collected.
  • the information content for the 300 best matrices was approximately Gaussian distributed, with a mean of 7.7bit and 8.8bit and a standard deviation of 0.27bit and 0.25bit, and with the highest information content found 8.5bit (twice) and 9.6bit (once) for the 6 and 8bp matrices respectively.
  • F1 progeny of crosses between mpk4 and npr1-1 plants were selfed, and F3 seeds from 60 individual F2 plants plated on MS with 250 ⁇ M SA. This allowed the identification of 26 nprl homozygotes by seedling hypersensitivity to SA (Bowling et al., 1997). Lines homozygous for nprl were tested for Ds in mpk4 by PCR. 40 F3 seeds from plants homozygous for nprl and heterozygous for mpk4 were grown in soil. All of these lines segregated for the mpk4 dwarf phenotype indicating that mpk4 dwarfism was independent of nprl. All homozygous nprl dwarves examined expressed PR1 constitutively and were confirmed by sequencing as homozygous for npr1-1.
  • a Notl tinkered genomic MPK4 fragment including the 1150 bp promoter was amplified from La-0 genomic DNA and cloned into that site of pSLF172 (Forsburg and Sherman, 1997) to produce a C-terminally triple HA-tagged MPK4.
  • the activation loop mutant (T201A/Y203F) was made using the QuickChange kit (Stratagene).
  • HA-tagged mutant and wild type MPK4 were subcloned into pCAMBIA3300, and transformed into mpk4 het- erozygotes. Homozygous mpk4 lines expressing HA-tagged MPK4 versions were identified in T2.
  • Protein extracts were prepared as described (Romeis et al., 1999), except that no buffer change was made prior to immunoprecipitation. 100 ⁇ g of total protein was immunopre- cipitated with 2 ⁇ g/ l monoclonal 12CA5 HA-antibody (Boehringer) as described (Romeis et al , 1999) In-gel kinase assays were performed as previously described (Zhang and Klessig, 1998) Western blots were developed using alkaline phosphatase conjugated anti-mouse antibody (Promega)
  • An 1150bp 5' upstream fragment containing the MPK4 promoter was isolated as a BamH1//-//t7c/lll-l ⁇ nkered PCR product and transcnptionally fused upstream of GUS in pCAMBIA3300 Plants were transformed by vacuum infiltration, and transgenics selected with BASTA
  • RT-ISPCR on FAA fixed leaves was performed according to Johansen (1997) without pepsin and DNase treatment MPK4 mRNA-specific primers spanning exons I were used for reverse transcription and PCR amplification An anti-DIG-AP Fab fragment (Boehringer Mannhheim) was used for detection
  • the mpk4 mutant is a dwarf identified among stable transposant lines generated with a modified maize Ds element (Sundaresan et al , 1995) mpk4 has curled leaves, and flowers with reduced pollen production and fertility Due to the infertility of the dwarf plants, the mutation was maintained in the heterozygous state during subsequent generations Mi- croscopy revealed that mpk4 dwarfism was caused by decreased cell size mpk4 seed germinated with normal cotyledons and first exhibited dwarfism at the two to three leaf stage Dwarf leaves had normal numbers of cells of significantly reduced size ( ⁇ 20-30% of heterozygote or parental wild type) and normal numbers of stomates, many with a distinct, donut shape Reduced epidermal cell size of the dwarf resulted in increased numbers of stomates per surface area ( ⁇ 1 8 times wt) Perfusion chamber tests indicated that stomates of the dwarf did not close fully in response to water-stress (_ ⁇ 28% of wt) This effect caused the dwarf
  • RNA blot hybridization showed that mpk4 homozygotes did not accumulate detectable MPK4 mRNA, in contrast to wild type (Fig 2B) as well as the re- vertant (not shown)
  • mpk4 mutants were rescued by transformation with a 3 3kbp fragment containing MPK4 and 1150bp of 5' upstream and 506bp of 3' downstream se-
  • mpk4 was complemented with the same genomic fragment containing a triple HA-epitope tag at the C-terminus of MPK4 Western blotting and in gel kinase assay showed that MPK4 is active in wild type plants (Fig 2C) In contrast, equivalent levels of a catalytically inactive, HA-tagged MPK4 containing two mutations in activation loop residues (T201A/Y203F) had no effect on the mpk4 phenotype (AEF-HA, Fig 2C)
  • MPK4 is involved in stress signalling.
  • mpk4 exhibit dwarfism and leaf curling similar to mpk4 (Bowling et al., 1994; Shah et al., 1999; Weymann et al., 1995), so the resistance of mpk4 to pathogens was examined. It was found that mpk4 is highly resistant to a virulent bacterial pathogen, Pseudomonas syringae pv. tomato DC3000, and to infection by a virulent isolate of the oomycete pathogen, Peronospora parasitica (Cala2; Parker et al., 1996). This pathogen rapidly colonised and caused dis- ease symptoms on wild type plants but was undetectable in mpk4 plants (Fig. 3A). Thus, mpk4 exhibits enhanced resistance to at least two unrelated types of pathogens.
  • mpk4 exhibited resistance to pathogens
  • the expression of PR genes in mpk4 and wild type was compared.
  • RNA blots demonstrated that PR1, PR2 and PR5, that are normally induced during the development of SAR (Glazebrook, 1999), were constitutively expressed in mpk4. This suggests that MPK4 negatively regulates the expression of these PR genes.
  • mpk4 expressing the inactive T201A/Y203F MPK4 form expressed PR1 to the same level as the knockout mutant (data not shown), indicating that MPK4 activity is required for the negative regulation of PR gene expression.
  • chitinase and ⁇ -1 ,3-glucanases include chitinase and ⁇ -1 ,3-glucanases (PR2) which have anti- fungal activities, extensin and pectin methylesterase involved in cell wall modification (Merkouropoulos et al., 1999), and glutathione-S-transferases, ascorbate reductase (Grantz et al., 1995), and oxalate oxidase (Zang et al., 1995), the latter potentially involved in oxidative cell wall cross-linking.
  • lipid transfer proteins may contribute to plant defense (Molina and Olmedo, 1997), and LRR receptor kinases are involved in plant pathogen signalling (Glazebrook et al., 1997).
  • ER endoplasmic reticulum
  • PDI protein disulfide isomerase
  • CRT calreticuiin
  • cDNAs encoding homologues of the heat shock proteins HSP70 and HSP90 and of the reticuloplasmins BiP, PDI, CRT and calnexin, were between 3.5 and 4.5 more highly expressed in mpk4 than in wild type (not shown).
  • the constitutive expression of the PR genes suggests that a pathway in which MPK4 participates may regulate the activity of a transcription factor or complex controlling PR gene expression.
  • 5' upstream sequences of 17 of these genes (15 from the microarray and PR1 and PR5) could be identified in the database. These sequences were searched for the occurrence of conserved sequence motifs which might be binding sites for common regulatory factors. Two consensus sequences were identified with statistically significant frequencies of occurrence (Table 1).
  • TTGACT is a negative regulatory element in the Arabidopsis PR1 promoter ⁇ LS4; Lebel et al., 1998), and a similar element binds an elicitor induced, WRKY transcription factor in the parsley PR1 gene (W-box; Eulgem et al., 1999).
  • npr1-1 mutant is blocked in SA-mediated induction of PR genes (Cao et al., 1994).
  • npr1-1 is epistatic to mpk4
  • the double mutant fully retained mpk4 dwarf stature, constitutively expressed PR1, and exhibited bacterial resistance as mpk4 (Fig. 5A&C).
  • Fig. 5A&C bacterial resistance
  • MPK4 and NPR1 participate in two different pathways leading to SAR, or MPK4 functions downstream of NPRL
  • PR gene overexpression in mpk4 was the most striking difference revealed by the microarray analysis. However, eight genes hybridised >3 times less intensely to mpk4 than wild type cDNA. The most affected of these (Acc#4587541 ; ⁇ 3.7 fold wild type) encodes a homologue of a myrosinase associated protein from Brassica napus (MyAP; Taipalensuu et al., 1997). MyAP expression is induced by wounding and JA but is repressed by SA. JA is an important secondary signal in plant defense responses, and there is evidence for specific crosstalk between SA and the JA and ethylene signaling pathways (Pieterse and van Loon, 1999).
  • the expression pattern of MPK4 was examined in transgenic plants carrying a transcriptional fusion between the GUS reporter and the same 1 150bp of 5' upstream MPK4 sequence used to drive the expression of the complementing genomic clones.
  • strong GUS activity was detected in the veins and stomatal guard cells of leaf plates, petioles, stem and flowers, while leaf mesophyl cells showed weaker staining.
  • the leaf expression pattern was confirmed by in situ PCR with MPK4 cDNA specific primers which detected highest levels of MPK4 mRNA in phloem, leaf edges and stomata.
  • mpk4 mutant exhibits constitutive SAR. Loss of MPK4 function leads to increased SA levels and, similar to other SA-accumulating mu- tants, mpk4 exhibits enhanced resistance to virulent pathogens. Furthermore, RNA blot analysis showed that mpk4 constitutively expresses molecular markers of SAR. This was confirmed by microarray analysis which showed that mRNAs corresponding to 16 of the 7684 (0.2%) displayed cDNAs expressed in seedlings were statistically significantly more highly expressed in mpk4 than in wild type. Eight of these 16 genes have been shown to be responsive to SA or induced by wounding and/or pathogen infection (Glazebrook et al., 1997).
  • the 5' upstream regions of these genes contain a consensus GACTWWHC motif and the W-box (TTGACT) involved in the control of Arabidopsis and parsley PR1 expression in response to elicitors and SA (Lebel et al., 1998; Eulgem et al., 1999).
  • TTGACT W-box
  • mpk4 does not exhibit necrotic lesions, and therefore does not fall into the common class of lesion-mimic mutants.
  • the lack of spontaneous cell death in mpk4 is critical, since disruption of normal cell function might be expected to turn on PCD pathways.
  • microarray hybridization showed no other obvious differences than in defense related transcripts, suggesting that SAR expression is the only deviation from homeostasis in mpk4.
  • mpk4 responded normally to a range of abiotic stresses and phytohormones, and MPK4 is therefore not involved in responses to these stimuli.
  • MPK4 is constitutively active under normal conditions and its activity is required to repress SAR, since the inactive MPK4 mutant
  • the basis for the dwarfism of mpk4 and other constitutive SAR mutants may 5 include the metabolic cost of increased PR-protein synthesis and maintenance of a secretory pathway tuned for massive protein secretion. Incomplete suppression of dwarfism by NahG is also observed in the cprl and dndl mutants (Bowling et al., 1994; Clough et al., 2000), suggesting that other targets which influence cell and resultant plant size are deregulated independently of SA in these mutants.
  • NPR1 has been shown to function downstream of SA accumulation in SA-mediated expression of PR genes and SAR (Delaney et al., 1995; Cao et al., 1997; Shah et al., 1999).
  • double npr1-1/mpk4 mutants retain the dwarf, enhanced resistance and constitutive PR7 gene expression phenotypes of mpk4, but also exhibit the SA hypersen-
  • tobacco SIPK SA hduced protein kinase
  • TMV tobacco mosaic virus
  • fungal elicitors fungal elicitors
  • nitric oxide nitric oxide
  • SA wounding
  • Tobacco WIPK wound induced protein kinase
  • TMV/ ⁇ /-interaction wound induced protein kinase
  • overexpression of WIPK leads to elevated JA levels and constitutive expression of the JA-responsive gene Pl-ll (Seo et al. 1999).
  • wild type plants accumulate JA and its target gene mRNAs in response to wounding
  • sense-suppressed wipk plants accumulate SA and express SAR target genes (Seo et al., 1995).
  • Our microarray and RNA blot analyses show that induction of certain JA-responsive genes is blocked in mpk4.
  • MPK4 is required for JA-mediated gene expression. MPK4 may therefore be involved in integrating SA- or JA-dependent responses to selectively engage defenses against particular pathogen types or environmental stresses (Pieterse and van Loon, 1999; Felton et al., 1999).

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne des utilisations de MAPK4, un membre de la famille des protéines kinases activées par mitogène (MAP), sur la base de la découverte que la MAPK4 régule négativement l'expression de gènes associés à des réponses de maladie (des gènes associés à la pathogénie (PR), par exemple) et de blessure, chez des plantes, de façon que la perte de fonction de MAPK4 entraîne leur dérépression. La présente invention concerne également des procédés permettant de commander la croissance d'une plante et/ou l'expression d'au moins un gène de réponse pathogène ou de blessure dans ladite plante. Ces procédés consistent à modifier le taux du produit génique d'un gène MAPK4 dans la plante. De plus, la présente invention concerne des plantes transgéniques, qui sont transformées avec une construction MAPK4 et présentent une résistance aux blessures et/ou aux maladies améliorée.
EP00981177A 1999-12-06 2000-12-06 Procede d'utilisation de mapk4 et de ses orthologues dans le but de commander la resistance aux maladies et la croissance de plantes Withdrawn EP1237403A1 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
DKPA199901746 1999-12-06
DK174699 1999-12-06
US16961499P 1999-12-08 1999-12-08
US169614P 1999-12-08
PCT/DK2000/000674 WO2001041556A1 (fr) 1999-12-06 2000-12-06 Procede d'utilisation de mapk4 et de ses orthologues dans le but de commander la resistance aux maladies et la croissance de plantes

Publications (1)

Publication Number Publication Date
EP1237403A1 true EP1237403A1 (fr) 2002-09-11

Family

ID=26066084

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00981177A Withdrawn EP1237403A1 (fr) 1999-12-06 2000-12-06 Procede d'utilisation de mapk4 et de ses orthologues dans le but de commander la resistance aux maladies et la croissance de plantes

Country Status (3)

Country Link
EP (1) EP1237403A1 (fr)
AU (1) AU1851401A (fr)
WO (1) WO2001041556A1 (fr)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003203452A1 (en) * 2003-03-28 2004-10-14 Austin Health Topical composition
WO2005052169A2 (fr) * 2003-11-28 2005-06-09 University Of Copenhagen Resistance a une maladie des plantes et proteine regulatrice de la resistance acquise systemique (sar)
CA2706799A1 (fr) * 2007-11-27 2009-06-04 Basf Plant Science Gmbh Plantes transgeniques presentant une tolerance au stress et un rendement accrus
CN103667339B (zh) * 2013-11-29 2015-06-24 中国科学院遗传与发育生物学研究所 来源于水稻的蛋白质OsMKK4及其相关生物材料在调控植物穂型中的应用
CN105755020B (zh) * 2016-04-20 2019-02-19 昆明理工大学 三七丝裂原活化蛋白激酶激酶基因PnMAPKK1及其应用
CN111560389B (zh) * 2020-06-11 2022-07-01 云南中烟工业有限责任公司 烟草丝裂原活化蛋白激酶基因NtMAPK8及其应用
CN116612812A (zh) * 2023-05-08 2023-08-18 沈阳农业大学 一种蔷薇科属基因复制及功能分化的鉴定方法
CN117535317B (zh) * 2023-09-28 2024-07-12 安徽农业大学 Mapk基因及其在抗杨树真菌感染中的应用

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5986082A (en) * 1996-12-13 1999-11-16 Novartis Ag Altered forms of the NIM1 gene conferring disease resistance in plants
AU2781999A (en) * 1998-02-24 1999-09-15 Rutgers, The State University Of New Jersey Methods of using a pathogen-activatable map kinase to enhance disease resistancein plants

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0141556A1 *

Also Published As

Publication number Publication date
AU1851401A (en) 2001-06-18
WO2001041556A1 (fr) 2001-06-14

Similar Documents

Publication Publication Date Title
US10787677B2 (en) Yield and stress tolerance in transgenic plants IV
EP1601758B1 (fr) Polynucleotides et polypeptides dans des plantes
US8030546B2 (en) Biotic and abiotic stress tolerance in plants
Shen et al. The stress-and abscisic acid-induced barley gene HVA22: developmental regulation and homologues in diverse organisms
JP4365021B2 (ja) 植物のストレス耐性および老化遅延
US7897843B2 (en) Transcriptional regulation of plant biomass and abiotic stress tolerance
AU2010234125B2 (en) Rice zinc finger protein transcription factor DST and use thereof for regulating drought and salt tolerance
EP2912938B1 (fr) Amelioration du rendement et de la tolerance au stress de plantes transgeniques
US20090265813A1 (en) Stress tolerance in plants
US20060162018A1 (en) Plant transcriptional regulators of disease resistance
EP1682668A2 (fr) Regulateurs transcriptionnels de plantes
US20210102218A1 (en) Expression of transcription regulators that provide heat tolerance
Li et al. Over-expression of a DUF1644 protein gene, SIDP361, enhances tolerance to salt stress in transgenic rice
US10487337B2 (en) Methods for monocot plant improvement
WO2001041556A1 (fr) Procede d'utilisation de mapk4 et de ses orthologues dans le but de commander la resistance aux maladies et la croissance de plantes
Fu et al. Identification of an Arabidopsis Nodulin-related protein in heat stress
US8203031B2 (en) Transgenic plants exhibiting increased resistance to biotic and abiotic stresses and methods for producing the same
US20040172685A1 (en) Method of using MAPK4 and orthologues thereof to control plant disease resistance and plant growth
WO2000009712A1 (fr) Facteurs de transcription regulant l'expression de genes inductibles par ethylene
CA2966100C (fr) Procedes d'amelioration d'une plante monocotyledone
Wawrzynska et al. Powdery mildew resistance conferred by loss of the EDR1 protein kinase is suppressed by a missense mutation in KEG, a regulator of ABA signaling
Xiong Journal research area

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020708

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

RIN1 Information on inventor provided before grant (corrected)

Inventor name: BRODERSEN, PETER

Inventor name: NAESTED, HENRIK

Inventor name: MUNDY, JOHN

Inventor name: JENSEN, ANDERS, BOEGH

Inventor name: PETERSEN, MORTEN

17Q First examination report despatched

Effective date: 20041102

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050313