WO2000018930A1 - Promoteur de plante - Google Patents

Promoteur de plante Download PDF

Info

Publication number
WO2000018930A1
WO2000018930A1 PCT/GB1999/003021 GB9903021W WO0018930A1 WO 2000018930 A1 WO2000018930 A1 WO 2000018930A1 GB 9903021 W GB9903021 W GB 9903021W WO 0018930 A1 WO0018930 A1 WO 0018930A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
gene promoter
glutathione
transferase
subunit
Prior art date
Application number
PCT/GB1999/003021
Other languages
English (en)
Inventor
Nicola Mary Robertson
Jacqueline Ann Mary Paine
Ian Jepson
Original Assignee
Syngenta Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Syngenta Limited filed Critical Syngenta Limited
Priority to JP2000572377A priority Critical patent/JP2002525118A/ja
Priority to AU58733/99A priority patent/AU5873399A/en
Priority to EP99946316A priority patent/EP1121443A1/fr
Publication of WO2000018930A1 publication Critical patent/WO2000018930A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/8223—Vegetative tissue-specific promoters
    • C12N15/8226—Stem-specific, e.g. including tubers, beets

Definitions

  • the present invention relates to a promoter.
  • the present invention relates to a promoter which is constitutive in tubers and in the stems of plants. More particularly, the present invention relates to a method of constitutively expressing a target gene in a storage organ or stem of a plant.
  • Gene expression is controlled by various regulatory components, including nucleic acid and protein elements.
  • gene expression is controlled by a region commonly referred to as the "promoter” which lies upstream (5') of the protein encoding region.
  • a promoter may be constitutive or tissue-specific, developmentally-regulated and/or inducible.
  • Within the promoter region there are several domains which are necessary for full function of the promoter. The first of these domains lies immediately upstream of the structural gene and forms the "core promoter region" containing consensus sequences, normally 70 base pairs immediately upstream of the gene.
  • the core promoter region contains the characteristic CAAT and TATA boxes plus surrounding sequences, and represents a transcription initiation sequence which defines the transcription start point for the structural gene.
  • the precise length of the core promoter region is indefinite but it is usually well-recognisable. Such a region is normally present, with some variation, in all promoters.
  • the base sequences lying between the various well-characterised "boxes" appear to be of lesser importance.
  • the presence of the core promoter region defines a sequence as being a promoter: if the region is absent, the promoter is non-functional. Furthermore, the core promoter region is insufficient to provide full promoter activity. A series of regulatory sequences upstream of the core constitute the remainder of the promoter. The regulatory sequences determine expression level, the spatial and temporal pattern of expression and, for an important subset of promoters, expression under inductive conditions (regulation by external factors such as light, temperature, chemicals, hormones).
  • Manipulation of crop plants to alter and/or improve phenotypic characteristics requires the expression of heterologous genes in plant tissues.
  • Such genetic manipulation therefore relies on the availability of means to drive and to control gene expression as required; for example, on the availability and use of suitable promoters which are effective in plants and which regulate gene expression so as to give the desired effect(s) in the transgenic plant. It is advantageous to have the choice of a variety of different promoters so that the most suitable promoter may be selected for a particular gene, construct, cell, tissue, plant or environment. Promoters (and other regulatory components) from bacteria, viruses, fungi and plants have been used to control gene expression in plant cells.
  • a range of naturally-occurring promoters are known to be operative in plants and have been used to drive the expression of heterologous (both foreign and endogenous) genes in plants: for example, the constitutive 35S cauliflower mosaic virus promoter, the ripening-enhanced tomato polygalacturonase promoter (Bird et al, 1988, Plant Molecular Biology, 11 :651-662), the E8 promoter (Diekman & Fischer, 1988, EMBO, 7:3315-3320) and the fruit specific 2A11 promoter (Pear et al, 1989, Plant Molecular Biology, 13:639-651) and many others.
  • the constitutive 35S cauliflower mosaic virus promoter the ripening-enhanced tomato polygalacturonase promoter (Bird et al, 1988, Plant Molecular Biology, 11 :651-662), the E8 promoter (Diekman & Fischer, 1988, EMBO, 7:3315-3320) and the fruit specific 2A11 promote
  • Overexpression is achieved by insertion of one or more than one extra copies of the selected gene. It is, however, not unknown for plants or their progeny, originally transformed with one or more than one extra copy of a nucleotide sequence, to exhibit the effects of underexpression as well as overexpression.
  • Gene control by any of these methods requires the insertion of a selected gene or genes into plant material which can be regenerated into plants.
  • This transformation process can be performed via a number of methods, for example: the Agrobacterium- ediated transformation method.
  • Potatoes cannot be grown throughout the year in most growing regions and it is therefore desirable to store them when they are not in the growing season.
  • One of the potentially most damaging phenomena during storage is premature sprouting.
  • Current methods of sprouting suppression include cooling and chemical sprout suppressants. Cooling, usually done in Northern Europe by ventilation with air at ambient temperature is one of the methods to inhibit sprouting. Apart from the associated costs, longer term cooling at 4 °C gives rise to the problems of cold sweetening and melanisation (darkening).
  • the use of chemical sprouting suppressants is currently the only possibility for inhibiting sprouting in potatoes destined for processing and fresh consumption, since low temperature storage leads to unacceptable accumulation of reducing sugars. It would also be desirable to obviate the use of chemicals and their associated costs and inconvenience. There is therefore a real need for an alternative method of controlling sprouting in vegetative storage organs such as tubers. An alternative approach to delay sprouting would be the use of transgenic plants with a prolonged quiescence period.
  • the first step is the mobilisation of reserves, mainly starch. Starch breakdown occurs in amyloplasts. After transfer into the cytosol the produced hexoses and hexose-phosphates are distributed between glycolysis and sucrose synthesis.
  • the third step is the formation of sucrose in the cytosol. Sucrose synthesis is energy dependent thus glycolysis and respiration are required.
  • the fourth step is the transport of sucrose to the developing sprout. Finally, the imported sucrose is utilised in the sprout to support growth and development.
  • the present invention therefore seeks to provide a promoter which is expressed constitutively throughout development, storage and sprouting of a vegetative storage organ and in the stem of a plant.
  • a promoter could be used in the suppression of sprouting of tubers and more particularly in potato tubers.
  • a method of constitutively expressing a target gene in a vegetative storage organ or stem of a plant comprising incorporating, preferably stably incorporating, into the genome of the plant a DNA construct comprising a first polynucleotide sequence comprising the gene promoter region for the 27 kD subunit of the glutathione-S-transferase, isoform II, or a deleted fragment thereof which retains the activity of the gene promoter region, operably linked to and controlling a target gene sequence.
  • the DNA construct further comprises a second polynucleotide sequence comprising at least one DNA sequence operably linked to and under the control of an inducible promoter region.
  • expression of the target gene results in the suppression of sprouting of the storage organ.
  • the suppression of sprouting is neutralised by inducing expression of the second polynucleotide sequence.
  • the second polynucleotide sequence is a sense, antisense or partial sense sequence corresponding to said first polynucleotide sequence or a DNA sequence capable of causing suppression of the protein encoded by the target gene.
  • the first and second polynucleotide sequences further comprise a transcription terminator region.
  • the gene promoter is the maize 27 kD subunit of the glutathione-S- transferase, isoform II gene promoter (GST promoter, Figure 8 and SEQ ID NO:l), although similar promoters from other organisms may also be used.
  • GST promoter is described in our earlier patent applications publication Nos. WO 93/01294 and WO 97/11189.
  • variants of the GST promoter of SEQ ID NO: 1 which are substantially homologous thereto.
  • BESTFIT When comparing nucleic acid sequences for the purposes of determining the degree of homology or identity one can use programs such as BESTFIT and GAP (both from the Wisconsin Genetics Computer Group (GCG) software package) BESTFIT, for example, compares two sequences and produces an optimal alignment of the most similar segments. GAP enables sequences to be aligned along their whole length and finds the optimal alignment by inserting spaces in either sequence as appropriate. Suitably, in the context of the present invention compare when discussing homology of nucleic acid sequences, the comparison is made by alignment of the sequences along their whole length.
  • GCG Wisconsin Genetics Computer Group
  • sequences which have substantial homology have at least 50% sequence homology, desirably at least 70% sequence homology and more desirably at least 80% , 90% or at least 95% sequence homology, in increasing order of preference, with said sequences.
  • sequence homology may be 99% or above.
  • the term "substantial identity" indicates that said sequence has a greater degree of identity with any of the sequences described herein than with prior art nucleic acid sequences.
  • variants of SEQ ID NO: 1 can be used as the promoter sequence, it is greatly preferred that the sequence from about base 3590 to 3822 is substantially conserved, or at least not less than 80% homologous with the SEQ ID NO: 1.
  • fragments include the following regions of the 27 kD subunit of glutathione-S-transferase: a sequence comprising 897 base pairs immediately upstream of the transcription start point of the gene promoter sequence of the 27kD subunit of glutathione S-transferase; a sequence comprising 570 base pairs immediately upstream of the transcription start point of the gene promoter sequence of the 27kD subunit of glutathione S-transferase; or a sequence comprising 378 base pairs immediately upstream of the transcription start point of the gene promoter sequence of the 27kD subunit of glutathione S-transferase.
  • the transcription start point of the gene promoter sequence of the 27kD subunit of glutathione S-transferase is defined in WO 93/01294 and WO 97/11189 as being at position 3701 of SEQ ID NO: 1.
  • One useful fragment comprising 570 base pairs immediately upstream of the transcription start point of the gene promoter sequence of the 27kD subunit of glutathione S- transferase is the 693 base fragment shown in Figure 9 (SEQ ID NO: 2).
  • the storage organ is a tuber.
  • the plant is a potato plant.
  • a method of constitutively expressing a target gene in a storage organ or stem of a plant comprising incorporating, preferably stably incorporating, into the genome of the plant a DNA construct comprising a first polynucleotide sequence comprising the gene promoter region for the 27 kD subunit of the glutathione-S-transferase, isoform II, or a deleted fragment thereof which retains the activity of the gene promoter region, operably linked to and controlling a target gene sequence, the DNA construct further comprising a second polynucleotide sequence comprising at least one DNA sequence operably linked to and under the control of an inducible promoter region.
  • transgenic in relation to the present invention does not include a wild type regulator promoter in its natural environment in combination with its associated functional gene in its natural environment.
  • target gene with reference to the present invention means any gene of interest.
  • a target gene can be any gene that is either foreign or natural to the plant in question.
  • construct which is synonymous with terms such as “cassette”, “hybrid” and “conjugate” - includes a target gene directly or indirectly attached to the regulator promoter, such as to form a cassette.
  • An example of indirect attachment is the provision of a suitable spacer group such as an intron sequence intermediate the promoter and the target gene.
  • fused in relation to the present invention which includes direct or indirect attachment.
  • constructs also include plasmids and phage which are suitable for transforming a cell of interest.
  • inducible promoter includes promoters which may be induced chemically.
  • the use of a promoter sequence which is controlled by the application of an external chemical stimulus is most especially preferred.
  • the external chemical stimulus is preferably an agriculturally acceptable chemical, the use of which is compatible with agricultural practice and is not detrimental to plants or mammals.
  • references to “potatoes” also include other plants of the potato family, such as sweet potatoes and similar plants.
  • the inducible promoter region most preferably comprises an inducible switch promoter system such as, for example, a two component system such as the alcA/alcR gene switch promoter system described in our published International Publication No. WO 93/21334 and the ecdysone switch system as described in our International Publication No. WO 96/37609, the teachings of which are incorporated herein by reference.
  • Such promoter systems are herein referred to as "switch promoters”.
  • the switch chemicals used in conjunction with the switch promoters are agriculturally acceptable chemicals making this system particularly useful in the method of the present invention.
  • the preferred chemical inducer is ethanol in either liquid or vapour form.
  • Suitable transcription terminators which may be used are also well known in the art and include, for example, the nopaline synthase terminator and octopine synthase terminators.
  • the DNA sequences in the DNA construct may be endogenous or heterologous with respect to the transformed host.
  • ATPase in long distance phloem transport and in phloem unloading e.g. inorganic pyrophosphorylase (iPPase); and in the utilisation of reserves during dormancy such as in assimilate breakdown e.g. the breakdown of sucrose in the growing sprout, i.e. invertase; and in the utilisation of assimilates e.g. utilisation of sucrose-derived metabolites, in the provision of energy required for sprout formation e.g.adenine nucleotide translocator (ANT) and malate oxoglutarate translocator (MOT) and inhibitors thereof such as uncoupling proteins.
  • ANT adenine nucleotide translocator
  • MOT malate oxoglutarate translocator
  • inhibitors thereof such as uncoupling proteins.
  • useful DNA sequences also include any other sequences which are involved in potato sprouting.
  • Examples of preferred target DNA sequences which may be used in the method of the present invention to control sprouting include those resulting in the production of sense, anti- sense or partial sense sequence(s) to, and/or coding for, proteins involved in the mobilisation and/or utilisation of sucrose, in potato sprouting and in mitochondrial function, such as in respiration.
  • target DNA sequences include those coding for an invertase derived from plant, bacterial or fungal sources e.g. from yeast, a pyrophosphatase derived from plant, bacterial or fungal sources and proteins involved in mitochondrial function such as adenosine nucleotide translocator protein (ANT) or mitochondrial oxoglutarate translocator (MOT) derived from plant, bacterial or fungal sources.
  • ANT adenosine nucleotide translocator protein
  • MOT mitochondrial oxoglutarate translocator
  • Down-regulation of a desired target DNA sequence(s) may be achieved using methods well known in the art such as, for example, by use of repressor proteins, sense, anti- sense, partial-sense, and expression of a complementary protein.
  • suitable operator/repressor systems include for example the lac, tet or lambda 434 systems and mutants thereof such as the Lac I ⁇ His mutant (Lehming, N., Sartoris, J., Niemoeller, M., Genenger, G., v. Wilcken-Bergman, B. and Muller-Hill, Benno (1987), EMBO J. 6(10) 3145-3153 - where the mutant has a change in amino acid 17 of Lac I altering tyrosine for histidine).
  • an AmpliconTM may be used to down-regulate genes (Angell, S.M., Baulcombe, D.C., (1997) 16. 3675-3684).
  • VX replicating potato virus
  • expression of the DNA sequence(s) in the first polynucleotide sequence may result in the production of a sense, anti-sense or partial-sense sequence(s) which acts to suppress a gene involved in sprouting or in the expression of an AmpliconTM.
  • sprouting is restored by switching on expression of the DNA sequence(s) in the second polynucleotide sequence which results in production of the protein or a corresponding protein to that, the production of which was suppressed by the sense, anti-sense or partial- sense sequence(s) in the first DNA sequence.
  • Sprouting may also be restored by means of a suitable operator/repressor system. Where either or both of the polynucleotide sequences in the construct comprise more than one DNA sequence it is preferable that they are not identical to avoid any co- suppression effects.
  • the DNA sequence(s) in the second polynucleotide sequence of the construct is under the control of an inducible promoter region.
  • Suitable transcription terminators which may be used are also well known in the art and include for example the nopaline synthase terminator and octopine synthase terminators.
  • the inducible promoter region for use in the method of the present invention is preferably the alcA/ alcR promoter switch system.
  • Restoration of sprouting is preferably achieved using switchable antisense or switchable sense or partial sense methods as is described more fully herein or alternatively by use of an AmpliconTM or by means of a suitable operator/repressor system.
  • Down-regulation of gene activity, due to partial sense co- suppression is described in our International Patent Application No. WO 91/08299 the teachings of which are incorporated herein and this may be avoided if necessary by using gene sequences derived from different organisms.
  • An advantage of the present invention is that expression is maintained throughout tuber development to tuber sprouting.
  • the GST-II-27 promoter was originally isolated in maize and it was shown to be inducible in leaf tissue as described in our International publication Nos. WO 90/08826 and WO 93/01294.
  • the genomic DNA sequence encoding the gene promoter for the 27kD subunit of the glutathione-S-transferase, isoform II, enzyme (GST-II-27), containing the nucleotide sequence shown in Figures 8 and 9 herewith was deposited as plasmid pGIE7 within E.coli strain XLI-Blue in the National Collections of Industrial and Marine Bacteria (NCIMB) under accession number NCIMB 40426.
  • Tubers are not root tissue, but are initiated on underground stems called stolons. Tuberisation starts in the youngest elongating internode, just below the stolon apex. The stolon elongation stops and radial growth begins by cell expansion and then division. Starch accumulates in the developing tuber and storage glycoproteins are formed.
  • a tuber may be described as a modified stem, as it has nodes, internodes and axillary buds.
  • the GST-II-27 promoter can be used as a constitutive promoter in stems and tubers as it is expressed in the absence of any inducer being applied to the plant. It will not be expressed in leaf tissue unless a GST-II-27 inducer is applied.
  • Applications of such a constitutive promoter include expression of a tuber sprout suppressant gene from the GST-II- 27 promoter, which could be reversed, for example, by antisense or co-suppression from an inducible promoter.
  • the DNA construct comprising the gene promoter region for the 27 kD subunit of the glutathione-S-transferase, isoform II, or a deleted fragment thereof which retains the activity of the gene promoter region, operably linked to and controlling a target gene sequence comprises a further aspect of the invention.
  • the target gene will generally be a gene whose expression results in the suppression of sprouting in the vegetative storage organ of a plant such as a potato.
  • Preferred types of sprouting suppression genes are as discussed above in relation to the first aspect of the invention.
  • a particularly suitable gene promoter for use in the DNA construct of the invention is the maize 27 kD subunit of the glutathione-S-transferase, isoform II gene promoter (SEQ ID NO: 1) or a sequence substantially homologous thereto as defined above. Fragments of the 27 kD subunit of the glutathione-S-transferase, isoform II gene promoter which retain the activity of the gene promoter region may also be used. As already mentioned, such fragments include: .
  • the transcription start point of the gene promoter sequence of the 27kD subunit of glutathione S-transferase is defined in WO 93/01294 and WO 97/11189 as being at position 3701 of SEQ ID NO: 1.
  • One useful fragment comprising 570 base pairs immediately upstream of the transcription start point of the gene promoter sequence of the 27kD subunit of glutathione S- transferase is the 693 base fragment shown in Figure 9 (SEQ ID NO: 2).
  • the DNA construct of the invention also comprises a second polynucleotide sequence comprising at least one DNA sequence operably linked to and under the control of an inducible promoter region.
  • the second polynucleotide sequence may be a sense, antisense or partial sense sequence corresponding to said first polynucleotide sequence or a DNA sequence capable of causing suppression of the protein encoded by the target gene.
  • the construct may also comprise a transcription terminator region.
  • the DNA construct of the invention may be used to transform a plant of the potato family in order to suppress sprouting of the tubers. Therefore, in a further aspect of the invention, there is provided potato plant germ plasm comprising a DNA construct as defined above.
  • the invention also provides a potato plant, potato seed or potato plant cell comprising a DNA construct as defined above.
  • a method for preventing or inhibiting sprouting in a potato tuber comprising causing the tuber to express a target sequence as defined above under the control of the gene promoter region for the 27 kD subunit of the glutathione-S-transferase, isoform II, or a deleted fragment thereof which retains the activity of the gene promoter region.
  • Figure 1 A is a graph showing induction of the GST promoter in Solanum tuber osum variety solara leaf tissue.
  • Figure IB is a graph showing a further root drench induction of the GST promoter.
  • Figure 2 is a graph showing a time course experiment using GST:GUS line 6 plants.
  • Figure 3 A is a graph showing a fluorometric GUS assay of tissues of 6 week old plants root drenched with safener, 3-dichloroacetyl-2,2,5-trimethyl-l,3-oxazolidone.
  • Figure 3B is a photograph showing histochemical staining with X-gluc (5-Bromo-4- Chloro-3-Indolyl- ⁇ -D-Glucuronide with tissue pieces from plants used in the fluorometric assay.
  • Figure 3C is a photograph showing histochemical staining on uninduced and induced stained stem sections.
  • Figure 3D is a photograph showing a longitudinal section through the stem of safener a induced plant stained with X-gluc.
  • Figure 4 is a photograph showing a transverse section through uninduced 6 week old potato stem stained with X-gluc.
  • FIG. 5 A is a photograph showing histochemical staining of tubers from 4 month old plants harvested before and after root drenching with 3-dichloroacetyl-2,2,5-trimethyl-l,3- oxazolidone safener and stained with X-gluc.
  • Tubers shown were obtained from wild type, 35SGUS and from transgenic plants which contained a 3822 base pair GST-27 promoter fused to a GUS reporter gene. Tubers from two of the transgenic lines are shown here. The lines are known as G6 and G44. These were identified as high expressors of GST-27:GUS in the primary transformants. This was achieved by treating the primary transformants with safener in a root drench and assaying leaf tissue by fluorometric means for GUS protein (see Figure IB).
  • Figure 5B is a graph showing a fluorometric assay of tubers from uninduced and induced plants.
  • Figure 6A is a photograph showing the histochemical staining of 6 month old tubers from storage from lines G6 and G44 and a wild type negative control.
  • Figure 6B is a photograph showing histochemically stained 8 month old tubers at the sprouting stage.
  • Figures 7A and 7B are photographs showing stained tubers throughout the potato lifr- cycle - 2 months, 4 months, 6 months and 8 months compared with wild type and CaMV 35S controls.
  • Figure 8 shows the full GST promoter sequence comprising 3822 base pairs. The part which comprises the deleted GST promoter sequence is highlighted.
  • Figure 9 shows a deleted GST promoter sequence comprising 693 bases.
  • Figure 10 shows a construct comprising the full GST promoter sequence.
  • Figure 11 shows a construct comprising a deleted GST promoter sequence.
  • Figure 12 is a set of photographs showing slices from tubers from transgenic plants which contained the fragment of SEQ ID NO: 2 of the GST-27 promoter fused to a GUS reporter gene compared with a slice from a tuber from line G6. The slices are histochemically stained with X-gluc to test for GUS expression.
  • Figure 13 is is a set of photographs showing two sets of slices from tubers from transgenic plants which containing the full length 3.8 kb GST promoter fused to a GUS reporter gene compared with a slice from a wild type tuber.
  • the first set of slices is uninduced and the second set has been treated with the chemical safener 3-dichloroacetyl- 2,2,5-trimethyl-l,3-oxazolidone applied at the rate of 20mg/40ml (0.5 g/1).
  • the slices are histochemically stained with X-gluc to test for GUS expression.
  • Figure 14 is a plot showing GST and patatin controlled expression of GUS throughout the life cycle of various plants.
  • Figure 15 is a plot showing a comparison of GUS activity in tuber tissue over time for a variety of plants, including wild type, CaMV 35S, patatin:GUS and GST:GUS plants.
  • Figures 16a to 16e is a series of plots showing expression of GUS throughout the tuber life cycle for a selection of plants as follows: wild type ( Figure 16a), G6 ( Figure 16b) 842-06 ( Figure 16c), 842-07 ( Figure 16d) and 842-03 ( Figure 16e).
  • the plants designated 842 contain the patatin promoter.
  • Figure 17 is a series of photographs 12 showing slices from tubers from wild type and transgenic plants containing a promoter fused to a GUS reporter gene. The slices were taken at various times during the growth and storage of the plants and are histochemically stained with X-gluc to test for GUS expression.
  • Figure 18 is a photograph showing the size of the sprouts on the tubers of lines GST- II-27:GUS 6, GST-II-27:GUS 44, 35S:GUS (410), PatatimGUS (842) and wild type.
  • the tubers were removed from storage at 47 weeks and contained sprouts of between 0.5 and 3cm in length.
  • the tubers were sampled for histochemical and fluorometric GUS analysis.
  • Figure 19 is a photograph showing a slice of a GST-II-27:GUS line 6 tuber sampled at 47 weeks. The tuber was sprouting. The slice was histochemically stained using X-gluc to show expression of GUS activity at sprouting.
  • Example 1 A construct comprising the 3822 base pair 5' region of the GST-II-27 promoter fused to the GUS reporter gene and the Nos 3' termination region was transformed into potato.
  • Figures 10 and 1 1 show constructs comprising both the full and deleted GST promoters.
  • a PCR product was synthesised using a pAI5 oligo at the 5' end and a pAI2 oligo at the 3' end of the GST-27 promoter fragment.
  • the 5' pAI5 oligo had the sequence GCGGCAAGCTTAATATGTGATGATA and contained a Hindlll site.
  • the pAI2 oligo had the sequence TGCCTGCTGCAGCTGCTACTTAT, and hybridised to a promoter sequence which contained a Pstl site.
  • the purified PCR fragment was digested with Hindlll and Pstl and ligated into a Hindlll-Pstl vector fragment of the pGSTTAK clone
  • C58Cl :pGV2260 was carried out as described by H ⁇ fgen and Willmitzer (1988) (J. loc cit).
  • Potato transformation (solard) using Agrobacterium-mediate ⁇ gene transfer was performed as described by Rocha-Sosa et al. (1989) (J. loc cit).
  • Example 2 Analysis of the GST -27 expression patterns in these potato plants was carried out.
  • Tissue from various plant parts were taken from untreated plants and plants treated with the herbicide safener, NN-diallyl 1-2,2-dichoroacetamide.
  • the GST:GUS construct was induced in Sol ⁇ num tuberosum variety sol ⁇ r ⁇ via root drench with chemical safener, NN-diallyl 1-2,2-dichoroacetamide. Results from induction in leaf tissue are shown in Figure 1A.
  • Primary analysis shows a clear induction of GST:GUS after application of NN-diallyl 1-2,2-dichoroacetamide safener by addition to the growth media. It was found that a concentration of 10 % safener produced the greatest level of safener induction.
  • a transverse section through uninduced 6 week old potato stem stained with X-gluc shows xylem (inner), cambium and phloem (outer) to be stained blue, indicating high GST:GUS expression in the vascular bundles in stems. Expression of GST:GUS in vascular tissue of the stem is constitutive.
  • Example 4 Four month old lines of G44 and G6, wild type and 35S:GUS were root drenched with 3-dichloroacetyl-2,2,5-trimethyl-l,3-oxazolidone safener. Tubers from these lines were histochemically stained with X-gluc pre and post chemical treatment (see Figure 5A).
  • Negative control wild type tubers show no staining as expected; positive control CaMV 35S tubers stained deep blue. G44 showed slight coloration in the centre of uninduced tubers whereas G6 tubers stained deep blue in uninduced and induced tubers showing constitutive expression of GST:GUS in tubers.
  • a fluorometric assay of tubers from uninduced and induced plants as carried out (see Figure 5B). No expression from wild tpe plants was seen and a relatively high expression from CaMV 35S tubers was seen. Tubers from lines G6 and G44 have a high uninduced GUS expression which increases after safener application in G6 but decreases after treatment in line G44 tubers. Histochemical and fluorometric results point to constitutive expression of GST:GUS in tubers, with a G6 being the highest expressing line.
  • Example 7 Eight month old tubers which were at the sprouting stage were histochemically stained. As can be. seen from Figure 6B, G6 shows deep blue coloration with staining and shows GST is expressed throughout dormancy and throughout sprouting and does not appear to drop in expression levels.
  • Figures 7A and 7B show stained tubers throughout the potato life-cycle at 2, 4, and 8 months compared with the wild type and CaMV 35S controls. It can be clearly seen that the expression of GST:GUS remains high throughout dormancy and onto the new sprouting stage to be used as seed.
  • Comparison of the full length 3822 base pair promoter to the patatin tuber-specific promoter, 35S promoter and to wild type tubers is carried out by analysing GUS expression. Inducible leaf expression by application of chemical safener, 3-dichloroacetyl-2,2,5- trimethyl- 1,3 -oxazolidone to various plant lines including GST-27:GUS (lines G6, G44 described above), CaMV 35S:GUS, patatin:GUS and wild type plants is analysed by fluorometric assay.
  • Uninduced tuber gene expression of the above lines is measured fluorimetrically and histochemically comparing GUS expression levels at all stages throughout dormancy. This allows a direct comparison between patatin, full GST-27 and deleted GST-27 promoter expression in tubers. There is some evidence that the level of expression of the patatin promoter decreases in tubers during dormancy; a promoter which is expressed at consistent high levels throughout the tuber dormancy and sprouting could be used to drive the expression of target genes in the suppression of sprouting of the tuber. The expression of the GST-27 promoter is determined throughout dormancy by comparison with the patatin promoter.
  • a deleted version of the GST-II-27 promoter region (SEQ ID NO: 2) was also prepared and tested (see Figure 11). This promoter region can then be compared with the 3822 base pair full length GST-II-27 promoter region.
  • the present invention may also be useful in the expression of antibodies and storage proteins.
  • the potato tuber is an important food source and it could therefore be used to express genes which are involved in the synthesis of micronutrients, for example, enzymes leading to expression of carotenoid or vitamin E. It is envisaged that the present invention could also be used to express genes which affect plastid number or size which could lead to an altered or increased starch content or other plastid component deposition.
  • Tubers with the deleted version (SEQ ID NO: 2) of the GST-II-27 promoter were harvested from plants at 18 weeks and stored at 4°C. At 22 weeks the tubers were sliced and histochemically stained with X-gluc to test for GUS expression (see Figure 12). The stained tubers show GST drives expression of GUS in the tuber without application of the chemical safener 3-dichloroacetyl-2,2,5-trimethyl-l ,3-oxazolidone and is constitutively expressed in tubers.
  • a number of GST-II-27:GUS lines containing the full length 3.8 kb GST promoter were grown and induced whilst still attached to the plants at 15 weeks. Uninduced tubers were sampled from the plants before application of the chemical safener 3-dichloroacetyl- 2,2,5-trimethyl-l ,3-oxazolidone. Safener was applied at the rate of 20mg/40ml (0.5 g/1). Tuber samples were also harvested after safener application. The tubers were sliced and stained with X-gluc to detect GUS activity. Figure 13 shows the 3.8 kb GST-II-27: GUS lines after staining. The uninduced lines are stained blue, showing GUS activity before application of chemical inducer.
  • the induced lines are also stained blue and have comparable GUS activity to the uninduced lines. This shows that a number of other lines containing the GST- II-27 promoter have constitutive expression in the tubers and it is not unique to lines GST-II- 27:GUS 6 and GST-II-27:GUS 44.
  • Example 12
  • Assay Buffer for GUS Assays 1 mM 4-methyl umbelliferyl ⁇ -D glucuronide 80% extraction buffer 20% methanol Staining Buffer
  • Tubers were harvested when the plants showed signs of senescence; at this point the plants were in soil for 18 weeks.
  • the tubers were washed in water, dried and placed in nylon bags.
  • the bags were originally stored in a seed store at 13°C, 30% humidity in the dark for 5 weeks; the stored tubers were moved from this store at 23 weeks into a cooler store at 4°C, 30% humidity.
  • Tuber samples were taken from the plants at regular intervals throughout the tuber life cycle, as indicated below.
  • tubers were sampled per line (one tuber per plant). Two bores were taken from each tuber using a metal borer, 0.5cm wide and 1.5 cm-2 cm in length. The tuber bores were stored in GUS extraction buffer at -80°C until all samples were collected. Tuber slices were also cut from the sampled tubers at each time point and histochemically stained using X-gluc, which gave an initial measure of GUS activity.
  • GST-II-27:GUS 6 is expressed in tuber tissue throughout dormancy and breakage of dormancy in the absence of a chemical inducer ( Figures 14, 15, 16b). A slight fluctuation is seen in the expression level of GST-II-27:GUS 6 in growing tubers (week 8), ( Figure 16b). Overall, GST-II-27 expresses at an even level throughout the life cycle of the tuber.
  • Patatin expression shows a general decrease of expression throughout the tuber life cycle ( Figures 14, 16c, 16d, 16e).
  • Patati GUS line 842-07 is the lowest expressing patatin line tested here and has lower GUS expression than GST-II-27: GUS 6 after dormancy break ( Figure 16e).
  • the Patatim.GUS high expressing lines analysed here have a greater level of expression than the GST-II-27:GUS lines analysed (e.g. 842-06) ( Figure 14).
  • 842-03 and 842-06 PatatimGUS lines have a higher level of expression than the CaMV 35S:GUS lines tested in tubers (410-89, 410-92, 410-95) ( Figure 15).
  • the GST-II-27 promoter is expressed constitutively throughout potato tuber development, dormancy and dormancy breakage.
  • the GST-II-27 lines used here express GUS at a lower level than the Patatin promoter lines analysed; however, it can be seen that the level of expression is more uniform in the GST-II-27 lines.
  • GST tuber lines were compared throughout the tuber life cycle to PatatimGUS (842), 35S:GUS (410) and wild type tuber lines. Tubers were taken from the plants at regular intervals and sampled during storage. Tubers were sliced and histochemically stained with X-gluc. Figure 17 shows the stained tubers at all stages during the tuber development. It is clearly shown that GST-II-27: GUS 6 is expressed constitutively throughout endodormancy, ecodormancy and paradormancy at uniform levels. GST-II-27:GUS 44 is expressed throughout the tuber life cycle at a lower level than 35S:GUS and PatatimGUS lines. Example 14
  • Figure 18 shows the size of the sprouts on the tubers of lines GST-II-27:GUS 6, GST-II-27:GUS 44, 35S:GUS (410), PatatimGUS (842) and wild type.
  • the tubers were removed from storage at 47 weeks and contained sprouts of between 0.5 and 3cm in length.
  • the tubers were sampled for histochemical (see Figure 17) and fluorometric GUS analysis.
  • GST-II-27 GUS line 6 tuber was sampled at 47 weeks. The tuber was sprouting and was sliced and histochemically stained using X-gluc. The tuber shows expression of GUS activity at sprouting ( Figure 19).

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne la zone du promoteur du gène pour la sous-unité 27 kD de la glutathione-S-transférase, isoforme II, ou un frament supprimé de ce dernier qui retient l'activité de la zone du promoteur du gène. Ces promoteurs sont constitutifs dans les tubercules et peuvent parfois être utilisés pour contrôler l'expression d'un gène pour prévenir ou inhiber la germination des tubercules.
PCT/GB1999/003021 1998-09-25 1999-09-13 Promoteur de plante WO2000018930A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2000572377A JP2002525118A (ja) 1998-09-25 1999-09-13 植物プロモーター
AU58733/99A AU5873399A (en) 1998-09-25 1999-09-13 Plant promoter
EP99946316A EP1121443A1 (fr) 1998-09-25 1999-09-13 Promoteur de plante

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB9820970.3A GB9820970D0 (en) 1998-09-25 1998-09-25 Promoter
GB9820970.3 1998-09-25

Publications (1)

Publication Number Publication Date
WO2000018930A1 true WO2000018930A1 (fr) 2000-04-06

Family

ID=10839514

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1999/003021 WO2000018930A1 (fr) 1998-09-25 1999-09-13 Promoteur de plante

Country Status (6)

Country Link
EP (1) EP1121443A1 (fr)
JP (1) JP2002525118A (fr)
AU (1) AU5873399A (fr)
GB (1) GB9820970D0 (fr)
PE (1) PE20001130A1 (fr)
WO (1) WO2000018930A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7091398B2 (en) 2001-02-22 2006-08-15 Pioneer Hi-Bred International, Inc. Isolated sucrose sythase polynucleotides and uses thereof

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993001294A1 (fr) * 1991-07-02 1993-01-21 Zeneca Limited Enzyme derivee de plantes, sequences d'adn et leurs utilisations
DE4213444A1 (de) * 1992-04-18 1993-10-28 Inst Genbiologische Forschung Verfahren zur Herstellung von Kartoffelpflanzen, deren Knollensprossung unterdrückt ist
WO1993021334A1 (fr) * 1992-04-13 1993-10-28 Zeneca Limited Produits de recombinaison d'adn et plantes les incorporant
WO1994011520A2 (fr) * 1992-11-09 1994-05-26 Zeneca Limited Nouvelles plantes et procedes de production
WO1994028149A1 (fr) * 1993-05-28 1994-12-08 Monsanto Company Procede d'amelioration de la qualite de pommes de terre stockees
WO1995024487A1 (fr) * 1994-03-09 1995-09-14 Hoechst Schering Agrevo Gmbh Procedes d'inhibition et de declenchement de la floraison des plantes
WO1997004116A1 (fr) * 1995-07-24 1997-02-06 Zeneca Limited Inhibition de la respiration cellulaire et production de plantes males steriles
WO1997011189A2 (fr) * 1995-09-22 1997-03-27 Zeneca Limited Promoteur de la glutathione s-transferase vegetale
WO1997044465A1 (fr) * 1996-05-20 1997-11-27 Monsanto Company Procede de regulation de la germination de graines au moyen de sequences d'acyl-coa oxydase du soja
EP0812917A1 (fr) * 1995-12-27 1997-12-17 Japan Tobacco Inc. Sequences promotrices inductibles a froid
WO1999006578A2 (fr) * 1997-07-30 1999-02-11 Zeneca Limited Procede genetique pour controler la formation de pousses

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993001294A1 (fr) * 1991-07-02 1993-01-21 Zeneca Limited Enzyme derivee de plantes, sequences d'adn et leurs utilisations
WO1993021334A1 (fr) * 1992-04-13 1993-10-28 Zeneca Limited Produits de recombinaison d'adn et plantes les incorporant
DE4213444A1 (de) * 1992-04-18 1993-10-28 Inst Genbiologische Forschung Verfahren zur Herstellung von Kartoffelpflanzen, deren Knollensprossung unterdrückt ist
WO1994011520A2 (fr) * 1992-11-09 1994-05-26 Zeneca Limited Nouvelles plantes et procedes de production
WO1994028149A1 (fr) * 1993-05-28 1994-12-08 Monsanto Company Procede d'amelioration de la qualite de pommes de terre stockees
WO1995024487A1 (fr) * 1994-03-09 1995-09-14 Hoechst Schering Agrevo Gmbh Procedes d'inhibition et de declenchement de la floraison des plantes
WO1997004116A1 (fr) * 1995-07-24 1997-02-06 Zeneca Limited Inhibition de la respiration cellulaire et production de plantes males steriles
WO1997011189A2 (fr) * 1995-09-22 1997-03-27 Zeneca Limited Promoteur de la glutathione s-transferase vegetale
EP0812917A1 (fr) * 1995-12-27 1997-12-17 Japan Tobacco Inc. Sequences promotrices inductibles a froid
WO1997044465A1 (fr) * 1996-05-20 1997-11-27 Monsanto Company Procede de regulation de la germination de graines au moyen de sequences d'acyl-coa oxydase du soja
WO1999006578A2 (fr) * 1997-07-30 1999-02-11 Zeneca Limited Procede genetique pour controler la formation de pousses

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7091398B2 (en) 2001-02-22 2006-08-15 Pioneer Hi-Bred International, Inc. Isolated sucrose sythase polynucleotides and uses thereof

Also Published As

Publication number Publication date
AU5873399A (en) 2000-04-17
GB9820970D0 (en) 1998-11-18
JP2002525118A (ja) 2002-08-13
EP1121443A1 (fr) 2001-08-08
PE20001130A1 (es) 2000-10-31

Similar Documents

Publication Publication Date Title
US5689042A (en) Transgenic plants with altered senescence characteristics
Kobayashi et al. Identification of novel cis‐acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron‐deficiency‐inducible, root‐specific expression in heterogeneous tobacco plants
EP0812917B1 (fr) Sequences promotrices inductibles a froid
Klee et al. Control of ethylene synthesis by expression of a bacterial enzyme in transgenic tomato plants.
Douglas et al. Exonic sequences are required for elicitor and light activation of a plant defense gene, but promoter sequences are sufficient for tissue specific expression.
JP2001502551A (ja) トランスジェニック植物における遺伝子の葉部特異的発現
HUT67084A (en) Expression cassette and plasmids for a guard cell specific expression and their use for the introduction of transgenic plant cells and plants
Twell et al. The 5′ flanking DNA of a patatin gene directs tuber specific expression of a chimaeric gene in potato
CA2136828A1 (fr) Sequences d'adn et plasmides pour la preparation de plantes a concentration modifiee de sucrose
CN102675441A (zh) OsMADS57蛋白或其编码基因在抑制水稻分蘖中的应用
CN102690341A (zh) 一种与植物分蘖相关蛋白及其编码基因
JP4219928B2 (ja) ストレス誘導性プロモーター及びその利用方法
US7176301B2 (en) Nitrate inducible promoter
JP3538428B2 (ja) 植物プロモーターおよび該プロモーターを用いた遺伝子発現方法
AU758055B2 (en) Genetic method
US6700039B1 (en) Genetic method for controlling sprouting
US7557264B2 (en) Gossypium hirsutum tissue-specific promoters and their use
US7244875B2 (en) Expression vectors comprising nucleic acids encoding SEBF proteins and uses thereof
WO2000018930A1 (fr) Promoteur de plante
WO2002005627A1 (fr) Homologue crt1 du melon
US6248936B1 (en) Sugarbeet storage-root-tissue-specific regulon
JP2000050877A (ja) エチレン誘導性遺伝子群の発現を制御する転写因子
US7157280B2 (en) Nucleic acids coding for vacuolar invertases, vegetal cells and plants containing said nucleic acids and the use thereof
EP1017819A1 (fr) Sequences promotrices des genes et leurs utilisations
WO2000031251A1 (fr) Regulation de l'expression genique post-recolte chez les plantes a l'aide de promoteurs de genes regules par la recolte

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1999946316

Country of ref document: EP

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 572377

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 09815662

Country of ref document: US

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1999946316

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1999946316

Country of ref document: EP