WO1997044465A1 - Procede de regulation de la germination de graines au moyen de sequences d'acyl-coa oxydase du soja - Google Patents

Procede de regulation de la germination de graines au moyen de sequences d'acyl-coa oxydase du soja Download PDF

Info

Publication number
WO1997044465A1
WO1997044465A1 PCT/US1997/008732 US9708732W WO9744465A1 WO 1997044465 A1 WO1997044465 A1 WO 1997044465A1 US 9708732 W US9708732 W US 9708732W WO 9744465 A1 WO9744465 A1 WO 9744465A1
Authority
WO
WIPO (PCT)
Prior art keywords
germination
plant
seed
protein
promoter
Prior art date
Application number
PCT/US1997/008732
Other languages
English (en)
Inventor
Ametta Kishore Agarwal
Sherri Marie Brown
Youlin Qi
Original Assignee
Monsanto Company
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Monsanto Company filed Critical Monsanto Company
Priority to AU31394/97A priority Critical patent/AU3139497A/en
Publication of WO1997044465A1 publication Critical patent/WO1997044465A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/823—Reproductive tissue-specific promoters
    • C12N15/8234—Seed-specific, e.g. embryo, endosperm
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8237—Externally regulated expression systems
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8237—Externally regulated expression systems
    • C12N15/8238—Externally regulated expression systems chemically inducible, e.g. tetracycline
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/8267—Seed dormancy, germination or sprouting

Definitions

  • This invention is directed to a method for controlling seed germination, as well as to DNA constructs, plants, plant cells and seeds genetically engineered for control of seed germination.
  • Biotechnological research has provided valuable tools for engineering novel and improved traits into a variety of commercial crops. This typically involves the introduction/transformation of foreign genetic material into plant cells followed by the regeneration of the plant cells into transgenic plants.
  • the foreign genetic material generally comprises one or more recombinant DNA constructs which can promote or inhibit the expression of a protein of interest, depending upon the design of the transgene. In this way, it is possible to manipulate certain plant characteristics for the purpose of achieving agronomically desirable traits which were previously not attainable, or that were possible only through more expensive or laborious procedures.
  • germination control One plant characteristic that may be addressed by a genetic-based approach is germination control. For example, it would be desirable to control crop outcrossing and volunteer seeds with selective germination control.
  • the displacement of many plant species beyond their intended location of cultivation can occur as pollen is carried away, e.g., by wind, birds or small mammals, thereby allowing pollination of the same or related species.
  • crop species can outcross with related weed species such that the progeny seed are fertile. Plants from such seed can themselves assume the status of weeds, and may grow at times or in areas which are unintended and undesirable.
  • the seeds may remain in subsequent crops as volunteers, i.e., seeds which germinate in places or at times when they were not intended to germinate, for example, in non-field conditions or during post-harvest crop rotation.
  • Seed dormancy i.e., the inhibition of germination
  • seed from such species can initiate the germination process prematurely while still on the plant in a process known as preharvest sprouting. This condition can be exacerbated by environmental conditions such as humidity and temperature. Preharvest sprouting has unfortunate consequences in that it can compromise crop quality and yield.
  • WO94/03619 discloses a method of controlling plant development by providing transgenic plants containing in their genomes two or more recombinant DNA constructs.
  • a first DNA construct comprises an externally inducible promoter linked to a gene encoding a repressor protein.
  • the second DNA construct contains a plant developmentally regulated promoter and an operator region linked to a disrupter protein gene (e.g., a cytotoxin, recombinase, or antisense).
  • a disrupter protein gene e.g., a cytotoxin, recombinase, or antisense.
  • the invention is generally directed to a method of controlling seed germination that uses a plant, plant cell or seed having a genome comprising (a) a promoter operably linked to a first DNA sequence and a 3 ' untranslated region, wherein the first DNA sequence encodes a germination inhibitor; and (b) an inducible promoter operably linked to second
  • Seed germination may be selectively controlled by expressing the first DNA sequence to inhibit germination and, subsequently, by inducing the inducible promoter to allow expression of the second DNA sequence to restore seed germination.
  • the germination inhibitor comprises a protein for inhibiting germination.
  • the germination inhibitor may comprise an antisense molecule, a co-suppression molecule containing sequences homologous to endogenous gene sequences, or a ribozyme, in each case capable of inhibiting the level or function of an endogenous mRNA or protein.
  • the germination restorer preferably comprises an antisense RNA molecule capable of inhibiting the expression of the germination inhibitor or a protein that is functionally equivalent in planta to a protein necessary for germination which is inhibited by the germination inhibitor.
  • the invention is also directed to a method of controlling seed germination comprising (i) providing a seed having a genome comprising a promoter operably linked to a DNA sequence and a 3' non-translated region, wherein the DNA sequence encodes a germination inhibitor that inhibits the seed's production of a compound necessary for germination; and (ii) restoring seed germination by providing to the seed another compound that restores germination.
  • the invention is further directed to DNA constructs, plants, plant cells and seeds having DNA elements comprising (a) a promoter operably linked to a first DNA sequence and a 3' untranslated region, wherein the first DNA sequence encodes a germination inhibitor; and (b) an inducible promoter operably linked to second DNA sequence and a 3 ' untranslated region, wherein the second DNA sequence encodes a germination restorer.
  • FIG. 1 represents a vector map of plasmid pMON29400.
  • FIG. 2 represents a vector map of plasmid pMON29724.
  • FIG. 3 represents a vector map of plasmid pMON2971 1.
  • FIG. 4 represents a vector map of plasmid pMON29725.
  • FIG. 5 represents a vector map of plasmid pMON29444.
  • FIG. 6 represents a vector map of plasmid pMON 10098.
  • FIG. 7 represents a vector map of plasmid pMON29705.
  • FIG. 8 represents a vector map of plasmid pMON29403.
  • FIG. 9 represents a vector map of plasmid pMON29404.
  • FIG. 10 represents a vector map of plasmid pMON 17227.
  • FIG. 11 represents a vector map of plasmid pMON29405.
  • FIG. 12 represents a vector map of plasmid pMON999.
  • FIG. 13 represents a vector map of plasmid pMON29726.
  • FIG. 14 represents a vector map of plasmid pMON29415.
  • FIG. 15 represents a vector map of plasmid pMON29727.
  • FIG. 16 represents a vector map of plasmid pMON29729.
  • FIG. 17 represents a vector map of plasmid pMON29728.
  • FIG. 18 represents a vector map of plasmid pMON25289.
  • FIG. 19 represents a vector map of plasmid pMON25291.
  • FIG. 20 represents a vector map of plasmid pMON25292.
  • FIG. 21 represents a vector map of plasmid pMON25290.
  • FIG. 22 represents a vector map of plasmid pMON25294.
  • FIG. 23 represents a vector map of plasmid pMON25293.
  • FIG. 24 represents a vector map of plasmid pMON33501.
  • FIG. 25 represents a vector map of plasmid pMON33502.
  • FIG. 26 represents a vector map of plasmid pMON 19648.
  • FIG. 27 represents a vector map of plasmid ⁇ MON29407.
  • FIG. 28 represents a vector map of plasmid pMON29412.
  • FIG. 29 represents a vector map of plasmid pMON29408.
  • FIG. 30 represents a vector map of plasmid pMON29409.
  • FIG. 31 represents a vector map of plasmid pMON29410.
  • FIG. 32 represents a vector map of plasmid pMON2941 1.
  • “Germination” refers to the plant germination process which, for purposes of this invention, includes uptake of water by the seeds (imbibition), elongation by the embryonic axis (the radicle), and all related seedling growth events which result in the establishment of a vigorous seedling.
  • “Germination inhibitor” refers to an RNA or protein capable of inhibiting one or more germination events, observable as compromised growth, inferior vigor, reduced root growth, delayed emergence, non-uniform germination, reduced viability, and/or reduced germination rate.
  • the germination inhibitor for example, may impair the production or use of a component necessary for germination or may enhance production of a component that impairs germination.
  • “Germination restorer” refers to a chemical, RNA or protein capable of restoring the impaired plant germination events caused by the germination inhibitor.
  • “Inducible promoter” refers to a promoter which is responsive to an externally administered inducer comprising a chemical or other stimulus. In the absence of inducer, the promoter of the second DNA molecule of the present invention is not substantially active; it is either not expressed at all or is expressed at levels which are insufficient to cause significant restoration of the impaired germination events caused by the first DNA molecule.
  • the method of controlling seed germination generally involves a seed having a genome comprising (a) a promoter operably linked to a first DNA sequence and a 3' untranslated region, wherein the first DNA sequence encodes a germination inhibitor; and (b) an inducible promoter operably linked to second DNA sequence and a 3' untranslated region, wherein the second DNA sequence encodes a germination restorer.
  • Seed germination may be selectively controlled by expressing the first DNA sequence to inhibit germination and, subsequently, by inducing the inducible promoter to allow expression of the second DNA sequence to restore seed germination.
  • the invention is further directed to DNA constructs, plants, plant cells and seeds having DNA elements comprising (a) a promoter operably linked to a first DNA sequence and a 3' untranslated region, wherein the first DNA sequence encodes a germination inhibitor; and (b) an inducible promoter operably linked to second DNA sequence and a 3' untranslated region, wherein the second DNA sequence encodes a germination restorer.
  • DNA constructs according to the invention include transformation vectors which are capable of introducing foreign DNA, such as the first and second DNA sequences, into plants.
  • the design of such DNA constructs and plant transformation methods using such constructs may employ a variety of conventional techniques.
  • Plant transformation vectors generally comprise one or more coding sequences of interest under the transcriptional control of 5' and 3' regulatory sequences, including a promoter, and a selectable marker. Typical regulatory sequences include a transcription initiation start site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
  • Plant promoters can be inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific.
  • promoters include the CaMV 35S promoter (Odell et al., Nature 313:810 (1985)), the enhanced CaMV 35S promoter, the Figwort Mosaic Virus (FMV) promoter (Richins et al., NAR 20:8451 (1987)), the mannopine synthase (mas) promoter, the nopaline synthase (nos) promoter, and the octopine synthase (ocs) promoter.
  • Useful inducible promoters may include heat-shock promoters (Ou-Lee et al., Proc. Natl. Acad. Sci.
  • Promoter hybrids can also be constructed to enhance transcriptional activity (Hoffman, U.S. Patent No. 5,106,739), or to combine desired transcriptional activity, inducibility and tissue specificity.
  • Representative vectors typically comprise, operably linked in sequence in the 5' to 3' direction, a promoter sequence that directs the transcription of a downstream heterologous structural DNA in a plant; optionally, a non-translated leader sequence; a nucleotide sequence that encodes a protein of interest; and a 3 ' non-translated region that encodes a termination/polyadenylation signal which functions in plant cells to cause the termination of transcription and the addition of polyadenylate nucleotides to the 3' end of the mRNA encoding said protein.
  • the promoters used in the DNA constructs (i.e., chimeric/recombinant plant genes) of the invention may be modified, if desired, to affect their control characteristics. Promoters can be derived by means of ligation with operator regions, random or controlled mutagenesis, etc. Furthermore, the promoters may be altered to contain multiple "enhancer sequences" to assist in elevating gene expression. Examples of such enhancer sequences have been reported by Kay et al. (1987).
  • the RNA produced by a DNA construct of the present invention also contains a 5' non-translated leader sequence.
  • This sequence can be derived from the promoter selected to express the gene, and can be specifically modified so as to increase translation of the mRNA.
  • the 5' non-translated regions can also be obtained from viral RNA's, from suitable eukaryotic genes, or from a synthetic gene sequence.
  • the present invention is not limited to constructs wherein the non-translated region is derived from the 5' non-translated sequence that accompanies the promoter sequence. W
  • An antisense expression construct generally contains a DNA sequence which provides for the production of an RNA sequence which is complementary to a mRNA sequence sought to be inhibited.
  • An antisense construct can be generated in a number of ways, provided it is capable of being transcribed into RNA which is complementary to and capable of blocking the translation of mRNA produced by the endogenous gene. Typically, the construct is generated by inverting some or all of the coding region of the endogenous gene to allow for transcription of its complement.
  • the antisense RNA molecule should contain sufficient complementarity in sequence and sufficient length of sequence to the endogenous mRNA molecule in order to achieve the desired inhibition/inactivation.
  • Various types of antisense constructs can be used to carry out the specific embodiments of the present invention. Thus, the endogenous mRNA targeted for inhibition/inactivation will determine the promoter required to carry out the invention.
  • a cosuppression construct generally contains a DNA sequence which is capable of inhibiting the accumulation of normal levels of mRNA or protein (Meyer, P., Ann. Rev. Plant Physiol. Plant Mol. Biol. 47:23-48 (1989)).
  • the DNA sequence contains homology to endogenous genes.
  • the construct could consist of homology to endogenous promoters and influence their transcription.
  • the cosuppression construct can consist of a sequence containing the full length or partial mRNA sequence in 5' to 3' sense orientation and is usually joined to promoter and 3' terminator sequence that allow for transcription into RNA.
  • Another alternative for decreasing expression of an endogenous gene is a ribozyme
  • the ribozyme consists of sequences homologous to the mRNA to be inhibited and the sequences required for catalytic activity of the ribozyme. This specific ribozyme RNA is joined to promoter and 3' terminator sequences that allow for transcription into RNA.
  • a variety of different methods can be employed to introduce such vectors into plant protoplasts, cells, callus tissue, leaf discs, meristems, etc., to generate transgenic plants, including Agrobacterium-mediated transformation, particle gun delivery, microinjection, electroporation, polyethylene gly col-mediated protoplast transformation, liposome-mediated transformation, etc. (reviewed in Potrykus, Annu. Rev. Plant Physiol. Plant Mol. Biol.
  • transgenic plants comprising cells containing the DNA molecules of the present invention can be produced by transforming plant cells with a DNA construct as described above via any of the foregoing methods; selecting plant cells that have been transformed on a selective medium; regenerating plant cells that have been transformed to produce differentiated plants; and selecting a transformed plant which expresses the recombinant DNA molecule(s) and exhibits the desired germination inhibition/inactivation.
  • the encoding DNAs can be introduced either in a single transformation event (all necessary DNAs present on the same vector), a co-transformation event (all necessary DNAs present on separate vectors that are introduced into plants or plant cells simultaneously), by independent transformation events (all necessary DNAs present on separate vectors that are introduced into plants or plant cells independently) or by re- transformation (transforming an already transformed line generated by a single transformation, co-transformation, or independent transformation events).
  • a single transformation event all necessary DNAs present on the same vector
  • co-transformation event all necessary DNAs present on separate vectors that are introduced into plants or plant cells simultaneously
  • independent transformation events all necessary DNAs present on separate vectors that are introduced into plants or plant cells independently
  • re- transformation transforming an already transformed line generated by a single transformation, co-transformation, or independent transformation events.
  • the methods and DNA constructs according to the invention are applicable to any plant, plant cell or seed for which it may be desirable to control germination.
  • the invention is particularly applicable for use in barley, canola, corn, cotton, oat, pea, peanut, rice, sorghum, soybean, sugarcane, and wheat.
  • the reversible germination system of the present invention comprises two general components: 1) a way to disrupt or inhibit normal germination in situations where germination is not desirable and 2) a way to recover or rescue normal germination when germination is desired.
  • the first component could be accomplished by inhibiting genes or functions that are essential for germination or early seedling growth, vigor, or yield.
  • the second component in the form of a seed coating or spray application would be used which would consist of compound(s) capable of replacing the missing gene or its products directly or inducing another gene to complement the missing gene or its products.
  • Another way to obtain germination control is to enhance expression or overexpress a gene product which itself inhibits germination or early seedling growth/vigor/yield.
  • the gene product could keep a seed in a dormant state or could influence vital processes in the germination/early seedling development phase.
  • the rescue treatment would function to inhibit the inhibitor gene or its product/function or induce a secondary pathway or process that would relieve the block or bypass it.
  • the invention generally involves four genetic components for purposes of selective seed germination control: 1) a gene which acts as an inhibitor of germination (germination inhibitor), 2) a specific promoter to regulate the germination inhibition gene, for example a germination enhanced promoter, 3) a rescue gene (germination restorer), and 4) a regulatable promoter (inducible promoter).
  • a further component of the present invention is the rescue treatment used to restore germination, preferably a chemical seed treatment, a foliar application, or a nonchemical induction such as heat, cold, light, etc.
  • a method of controlling seed germination in transgenic plants wherein a first recombinant DNA molecule functions to cause a germination inhibition phenotype.
  • a preferred mechanism to inhibit germination is to interfere with the ability of the seed to utilize its lipid storage reserves.
  • a number of enzymes are involved in this process which function to break down the lipid and/ or reconvert the intermediates to carbohydrate in the process of gluconeogenesis.
  • enzymes and processes could be inhibited by interfering with the gene, its expression, or activity. Mutation breeding could be used to identify plants missing a given gene or function. Antisense, co-suppression, or ribozymes could be used to interfere with normal accumulation of mRNA encoding germination enzymes. Alternatively, dominant negative or other proteinaceous inhibitors could be overexpressed to decrease a germination enzyme's function. Additionally, enzymes which divert important pathway intermediates could be used to decrease the flux through the lipid utilization pathway and thereby inhibit germination.
  • a preferred enzyme to be inhibited by the first DNA molecule of the present invention is acyl CoA Oxidase (ACOX).
  • ACOX is the first enzyme of peroxisomal ⁇ - oxidation of fatty acids which catalyzes the oxidation of acyl CoAs to 2-trans-enoyl-CoAs. It donates electrons directly to molecular oxygen, thereby producing H 2 O 2 .
  • ACOX genes have been isolated from rat (Miyazawa et al. (1987)), humans (Aoyama et al. (1994)), Candida tropicalis (Okazaki et al. (1986)), Candida maltosa (Hill et al. (1988)), Saccharomyces cerevisiae, (Dmochowska et al. (1990)) and barley (Grossi et al. (1995)).
  • rat Miyazawa et al. (1987)
  • humans Aoyama et al
  • enzymes in the lipid mobilization pathway could be inhibited by the first DNA molecule of the present invention in order to block germination, for example: 1) lipases which cause hydrolysis of the fatty acid ester bonds in the triacylglycerols stored in the seed, ultimately resulting in the formation of glycerol and free fatty acids.
  • Lipase activity is absent in ungerminated seeds and increases rapidly in postgermination (Huang (1993)); 2) other enzymes in the fatty acid ⁇ -oxidation pathway such as a) acyl coA synthetase which activates free fatty acids to acyl CoAs, b) multifunctional protein, a single protein which catalyzes the hydration of 2-trans-enoyl-CoA to 3-hydroxyacyl-CoA and its subsequent oxidation to 3-oxoacyl-coA, and c) thiolase which cleaves 3-oxoacyl CoA to acyl CoA and acetyl CoA by a thiolytic cleavage and appears to be the rate-limiting step in the ⁇ -oxidation pathway; and 3) enzymes in the glyoxylate cycle, which is involved in gluconeogenesis such as isocitrate lyase and malate synthase which are coordinately expressed in canola cotyledons and
  • the specificity of the first DNA molecule of the present invention can be provided by inhibiting a germination specific or intensive process or gene or by interfering with a nonspecific process in a germination specific way.
  • a function to be knocked out is germination specific, it could be knocked out using constitutive viral promoters such as the cauliflower mosaic virus 35S or figwort mosaic virus 35S promoters or cellular promoters such as a ubiquitin, actin, or cyclophilin promoter. If the function is essential for germination, but its gene expression is not limited to this time, a specific promoter could be used.
  • the preferred promoter would be only expressed in the appropriate tissues and cells at the appropriate developmental time to inhibit the germination enzyme only during germination or early seedling growth.
  • Germination-enhanced promoters have been isolated from genes encoding the glyoxysomal enzymes isocitrate lyase and malate synthase from several plant species (Zhang et al. (1994); Reynolds and Smith (1995); Comai et al. (1992)).
  • promoters include SIP-seedling imbibition protein (Heck, G.R., "Regulation of Gene Expression During Barley Seed Germination,” PhD thesis, Washington University, St. Louis, Missouri (1991); Heck, G.R. et al., "Gibberellin-repressible gene expression in the barley aleurone layer,” Plant Molecular Biology 30:61 1-623 (1996)) and others such as a cysteine endopeptidase promoter (Yamauchi et al. (1996)). Additionally, promoters could be isolated from other genes whose mRNAs appear to accumulate specifically during the germination process, for example class I ⁇ -l,3-glucanase B from tobacco (Vogeli-Lange, et al.
  • a means to rescue the germination inhibition phenotype by use of a chemical or other inducer which can circumvent the effects of the first DNA molecule A compound which directly complements the blocked enzyme could be utilized.
  • plants with loss of ACOX or other lipid utilization enzyme activities would be expected to be restored to normal growth by supplementation with sucrose, the pathway ' s end product, or with other intermediates/products of the pathway such as citrate, malate, succinate or glyoxylate.
  • other carbon sources could be utilized as a rescue agent to provide energy for the growing seedling normally provided by the products of lipid degradation.
  • Such compounds can be used to restore germination since they complement the germination inhibition phenotype caused by the first DNA molecule.
  • a chemical or other inductive treatment which can induce the expression a complementing gene.
  • a second DNA molecule of the present invention comprises an inducible promoter operably linked to a DNA sequence which functions to restore germination.
  • the gene could complement the blocked step by directly replacing it or by circumventing the need for that enzyme or part of the pathway.
  • the inducer could drive expression of an inhibitor which would repress the germination inhibition construct or inhibit the activity of its produces).
  • an ACOX gene preferably from a non-plant source (e.g., fungal or mammalian), could be used in the second DNA molecule in order to rescue the germination inhibition.
  • a nonplant gene to replace the antisensed plant ACOX gene's activity, it must be able to be expressed at the right levels and in the right subcellular location. In addition, it must replace the required enzymatic activity with the functionally relevant substrate specificity.
  • ACOX genes have been isolated from a number of nonplant sources such as rat (Miyazawa et al.
  • a rescue gene that lacked the portion in the antisense construct could be overexpressed.
  • a plant ACOX For example, if the 3' untranslated region of a plant ACOX mRNA were used to effectively inhibit seed germination, the rescue could be achieved using the same or similar plant ACOX expressed as a fusion gene containing the plant ACOX with a nonACOX 3' terminator such as the nopaline synthase terminator (Fraley et al.
  • a potential advantage would be a closer match to the endogenous substrate specificity and possibly better plant expression than a heterologous ACOX coding sequence.
  • a related approach would utilize a full or partial synthetic gene which would encode a functional ACOX with the appropriate substrate specificity to replace that knocked out by the inhibitory (e.g., antisense) construct but with a lack of sufficient nucleotide homology to be downregulated itself by the antisense sequence.
  • Yet another alternative is to use a second DNA molecule which functions to repress the antigermination effects of the first DNA molecule by decreasing its expression by antisense (or cosuppression, ribozyme, etc.). If the first DNA molecule comprises an antisense construct, a unique region of the mRNA expressed would act as a target of the second DNA molecule.
  • the second DNA molecule is preferably regulated by a chemically inducible promoter or other regulated gene expression system.
  • Plant genes are induced by a variety of signals, some of which may be mimicked by addition of a chemical stimulus or by other environmental stimulus.
  • Safener- induced promoters could be used, for example the 27Kd subunit of glutathione-S-transferase II (WO90/08826); other chemically induced promoters such as the soybean GH2/4 promoter (Ulmasov et al. (1995)) which is induced by a variety of chemicals, or hormonally induced promoters such as ⁇ -amylase or HVA22 (Shen and Ho (1995)).
  • prokaryotic transcriptional regulatory systems can be utilized in plants.
  • the tetracycline repressor system from transposon TnlO can be utilized as a repressible (Gatz and Quail (1988); Gatz et al. (1991)) or inducible system (Weinmann et al. (1994)).
  • the E.coli lac operator/repressor system Wangde et al. (1992)
  • eukaryotic regulated expression systems could also be utilized such as the glucocorticoid inducible system (Aoyama and Chua (1997)), copper inducible system (Vadim and Reynolds), nitrate inducible promoter (Back et al. (1991)).
  • Hom2a 5 * - TIT TYC Cl Y TI Y TIG CIW SNG C -3' (SEQ ID NO.1 )
  • Hom4 5'- GIA ARY TIT GYG GIG GIC AYG G -3' (SEQ ID NO.2)
  • Hom8 5'- RTA ACR TTI CCR TCR TAI CKN C -3' (SEQ ID NO.3)
  • RT-PCR Reverse transcription-polymerase chain reaction
  • RNA was isolated from soybean cotyledons from 4 day old seedlings and first strand cDNA was made in a reaction containing using the Superscript pre-amplification kit (Gibco-BRL) using conditions recommended by the manufacturer. The products of the reverse transcription reaction were then amplified using PCR amplification conditions. After an initial 3 minute 94°C denaturation step, 30 cycles were run, each with 94°C, 20 second denaturation, followed by 1 minute annealing, followed by 2 minutes extension at 72°C.
  • the annealing temperature of the first two cycles was 58°C and after every other cycle, the annealing temperature was lowered 1°C to a final temperature 44°C.
  • Ten additional cycles were run with a 94°C, 20 sec; 43°C, 1 min; and 72°C, 2 min temperature regime.
  • the PCR reactions yielded a 0.7-0.8Kb band and were purified by agarose gel electrophoresis.
  • the putative ACOX fragments were cloned into the TA vector (Invitrogen) to form pMON29400 (FIG.l), pMON29401, and pMON29402.
  • Nucleotide sequence was obtained from each insert (SEQ ID NOS.4-6). Nucleotide sequence homology alignments were performed (Gish and David (1993); Altschul et al. (1990)) which indicated that the soybean fragments were significantly similar to the ACOX sequences from other organisms.
  • the soybean ACOX PCR fragment from pMON29400 was used to screen a ⁇ gtlO library prepared from 10 day old soybean seedlings.
  • An initial screen of 300,000 plaques resulted in the isolation of 5 partial overlapping clones.
  • a second screen of 800,000 plaques was carried out with the longest clone from the first screen resulting in the isolation of 10 clones.
  • Sequence analysis of all 15 clones revealed that the clones fell into two distinct classes. Of the 15 clones, 1 1 belonged to one class (Class I) and 4 to the second class (Class II).
  • the longest clone (clone #20. la) obtained was 2.1 kb long and belonged to Class I.
  • the cDNA insert from this clone was amplified with ⁇ gtlO-lft and ⁇ gtlO-rt primers (Clontech Laboratories, Palo Alto, CA) which flank the EcoRI cloning site in ⁇ gtlO and the resulting PCR fragment was cloned into the TA vector (Invitrogen) to form pMON29724 (FIG.2).
  • This ACOX clone was found to be incomplete at the 3' end and therefore it was joined to another Class I clone containing the complete 3' end.
  • clone #la The 3' end containing clone (clone #la) was also amplified as described above and cloned into the TA vector (Invitrogen) to form pMON2971 1 (FIG.3).
  • pMON29724 was digested with Notl/Xbal and pMON2971 1 was digested with Xbal/Kpnl. The resulting two fragments were then inserted between the Notl/Kpnl sites of pMON2971 1 in a triple ligation.
  • the resulting construct pMON29725 contained a full-length soybean ACOX Class I clone containing 156 bp of the 5' UTR, the entire coding region and 130 bp of the 3' UTR.
  • the sequence obtained from this clone is shown in SEQ ID NO.7.
  • the longest clone belonging to Class II (Clone#2a) was a partial clone and its sequence is shown in SEQ ID NO.8. This Class II clone shows 87% identity with the full-length Class I clone.
  • the gel was rinsed several times with dH 2 0 and then soaked in neutralization buffer containing 1.5 M NaCI, 0.5M Tris HCI pH 7 and 0.001M EDTA for 15 minutes.
  • the gel was blotted in 20X SSC (3M NaCI, 0.3M Sodium Citrate) onto Hybond N nylon membrane (Amersham).
  • the DNA was UV crosslinked to the membrane using the UV Stratalinker (Stratagene).
  • the Southern blot was probed with a partial ACOX cDNA fragment which shows high homology to both classes of soybean ACOXs.
  • the probe was prepared by random priming using the Rediprime DNA labelling system from Amersham.
  • Hybridization was performed at 37°C for 20 hours in 50% formamide, 6X SSC, 5X Denhardts solution, 0.2% SDS and 100 ⁇ g/ml denatured salmon sperm DNA.
  • the blot was washed by first rinsing in 2X SSC, 0.5% SDS at RT, followed by two 15 minute washes at RT in 2X SSC, 0.1% SDS, followed by two 30 minute washes at 52°C in IX SSC, 0.1% SDS.
  • the blot was exposed with intensifying screen at -70°C to Kodak X-OMAT film.
  • the blot was re-washed two times in a high stringency buffer consisting of 0.1 X SSC, 0.1% SDS at 65°C for 30 minutes each. Two to three bands of hybridization were detected for each digest under high stringency conditions. This suggests that at least two to three ACOX genes exist in soybean. Low stringency conditions revealed the presence of one to three extra bands in each digest, suggesting the existence of more distantly related ACOX genes.
  • soybean ACOX Class I and II show a high degree of nucleotide sequence homology, 76 and 77% respectively, to an Arabidopsis ACOX EST (EST ID#35H7T7P).
  • EST ID#35H7T7P Arabidopsis ACOX EST
  • EST ID#5F12T7P Arabidopsis ACOX EST
  • the soybean ACOXI and ACOXII sequences have 52% and 54% identity, respectively, to EST ID#5F12T7P.
  • Southern analysis was performed using this EST as the probe.
  • RNA samples were separated on a 1% agarose gel.
  • the gel was transferred in 10X SSC onto Hybond N nylon membrane (Amersham) which was then UV crosslinked using the UV Stratalinker (Stratagene).
  • the Northern blot was probed with a partial ACOX class I cDNA which shows homology to two classes of soybean ACOXs.
  • the probe was prepared by random priming using the RTS Radprime DNA labeling system from GIBCO BRL. Hybridization was performed for 20 hours at 42°C in 50% formamide, 6X SSC, 5X Denhardts solution, 0.2% SDS and 100 ⁇ g/ml denatured salmon sperm DNA.
  • the blot was washed by first rinsing at room temperature in 2X SSC, 0.5% SDS; followed by two 15 minute washes at room temperature in 2X SSC, 0.1% SDS; followed by two 45 minute washes at 55°C in 0.1 X SSC, 0.1% SDS.
  • the blot was exposed with an intensifying screen at -70°C to Kodak X-OMAT film.
  • ACOX mRNA was detected as early as 6 hours after imbibition. In the early seedling samples (until 2 days after imbibition), the mRNA level was higher in the growing axis than in the cotyledons. In the later seedling samples (until 7 days after imbibition), ACOX mRNA was detected in all tissues examined (cotyledons, hypocotyls, epicotyls and roots). Maximum expression was seen in hypocotyl tissue from 5 day old seedlings. Expression levels decreased after 5 days. In addition, the ACOX mRNA was found to accumulate in mature leaves and also during late seed development. In all cases, the mRNA was approximately 2.8 kb in size. The results are summarized in the following Table:
  • HAI Hours after imbibition
  • DAI Days after imbibition
  • pMON29444 was then transformed into the E. coli strain, BL21(DE3) (Novagen).
  • the soybean ACOX-I protein was then overexpressed by adding IPTG to ImM in the growth medium, LB broth, and purified by using Novagen' s His Tag Ni2+ chelation resin (Cat. #69670).
  • the purified ACOX-I protein was injected into rabbit for antibody production (Scientific Association Inc., St. Louis).
  • the antisera was used to detect ACOX expression pattern during soybean seedling growth.
  • Total protein was extracted (extraction buffer: 150 mM KPO4, pH 7.5; 10% glycerol; 1 mM EDTA; 5 mM ⁇ -mecaptoethanol; 0.1% triton; 2 mM Pefabloc) from soybean dry seeds, cotyledons (one, two, three, five and seven day after imbibition(DAI)), axis (one, two and three DAI), roots (three, five and seven DAI), and epicotyls and hypocotyls (five and seven DAI).
  • 20 ⁇ g of each total protein sample was separated on a 10- 20% polyacrylamide gradient gel (BioRAD) and transferred onto ECL nitrocellulose membrane (Amersham).
  • a 1 :30,000 dilution of primary antisera was used to detect ACOX protein using the ECL detection system (Amersham).
  • a 75Kd protein was detected in all the samples in this assay and the protein size was consistent with the size deduced from the amino acid sequence of ACOX protein.
  • the ACOX protein was at low levels in dry seeds and the level increased after two DAI.
  • ACOX protein level was higher in axis, root, epicotyls and hypocotyls and lower in cotyledons.
  • the maximal accumulation was detected in epicotyls and hypocotyls of five and seven day old seedling.
  • ACOX protein was also found in mature leaf tissues, but the levels were lower than that in five and seven day old epicotyls and hypocotyls. The results are summarized in the following table:
  • pMON29705 contained the enhanced 35S promoter, an ⁇ sense-Arabidopsis ACOX, and an E9 terminator.
  • pMON29705 also contained a kanamycin cassette for constitutive expression in plants for use in kanamycin selection and two border sequences for T-DNA transfer.
  • pMON29705 was introduced into Agrobacterium tumefaciens and utilized in Arabidopsis transformation by vacuum infiltration (Bechtold et al. (1993)).
  • sucrose is the end product of the lipid utilization pathway
  • plants with loss of ACOX or other lipid utilization enzyme activities would be expected to be restored to normal growth by supplementation with sucrose, the pathway's end product.
  • sucrose containing media Fifty seeds from each line were treated as above and plated on MS medium containing 20 mM sucrose. All 24 lines showed improved growth on sucrose containing media; most lines were totally restored to wild type growth.
  • sucrose-dependent early seedling growth phenotype suggests that ACOX is required for normal early seedling growth in oil seed plants such as Arabidopsis. soybean, cotton and canola.
  • Antisense vectors for germination enhanced expression in plants were constructed using one of the soybean ACOX fragments.
  • pMON29400 (FIG.1 ) was digested using EcoRI and the ends of the 0.8Kb soybean ACOX fragment made blunt by filling in the 5' EcoRI overhangs with Klenow polymerase followed by purification by gel electrophoresis. The fragment was then inserted into pMON29403 (FIG.8) into the Stul site between the Brassica isocitrate lyase (ICL) promoter (Zhang et al. (1993); Zhang et al. (1994); Zhang et al.
  • pMON29404 (1996)) and the nopaline synthase 3' terminator (NOS, Fraley et al. (1983); Depicker et al. (1982)) to form pMON29404 (FIG.9).
  • pMON29405 In addition to the P-ICL/antiACOX/NOS sequences, pMON29405 also contains a CP4 cassette for constitutive expression in plants for use in glyphosate selection and two border sequences for T-DNA transfer into the plant chromosome. PMON29405 is introduced into Agrobacterium tumefaciens and utilized in soybean transformations as described (U.S. Patent Nos. 5,416,011 and 5,569,834).
  • Antisense vectors were constructed which contained the full-length soybean ACOXI sequence in antisense orientation under the control of a constitutive promoter (35S) and a germination enhanced promoter (Isocitrate lyase).
  • DNA from pMON29725 was amplified using the following primers:
  • PCR reaction was performed using 1 ng of pMON29725 DNA and 29725-Kpn and 29725-Bam as 5' and 3' primers respectively.
  • the PCR conditions consisted of one denaturation cycle at 92°C for 2 minutes followed by 30 cycles consisting of 92°C denaturation for 1 minute, 55°C annealing for 1 minute 30 seconds, 68°C extension for 2 minutes.
  • the resulting 2 kb fragment was purified by electrophoresis, digested with Kpnl/BamHI and inserted between the Kpnl/Bglll sites of pMON999 (FIG.12) to create pMON29726 (FIG.13).
  • the fragment was thus placed between the enhanced 35S promoter and the nopaline synthase 3' terminator (NOS).
  • NOS nopaline synthase 3' terminator
  • PCR reaction was also performed using 1 ng of pMON29725 DNA and 29725-Kpn and 29725-Stu as 5' and 3' primers respectively.
  • the PCR conditions used were the same as described above.
  • the resulting 2.2 kb fragment was purified by electrophoresis, digested with Kpnl/Stul and inserted between the Kpnl/Stul sites of pMON29415 (FIG.14) to create pMON29727 (FIG.15).
  • the fragment was thus placed between the Isocitrate lyase promoter and the NOS terminator. This fragment contained the 5' and 3' untranslated regions and the entire coding region of soy ACOXI.
  • pMON29726 and pMON29727 were excised as a Notl fragment and inserted into the Notl site in pMON 17227 (which contained a cassette for constitutive expression of CP4 EPSPS to allow for glyphosate selection in plant transformation) to form pMON29729 and pMON29728 respectively (FIGS.16 & 17).
  • the two constructs, pMON29729 and pMON29278 were then introduced into Agrobacterium for plant transformation. Glyphosate is employed as a selectable marker (Hinchee et al. (1994)) to identify transformed soybean tissue.
  • Leaves of glyphosate-resistant soybean transformants are screened for CP4 EPSPS expression by ELISA (Padgette et al. (1995)). Seeds from RQ CP4-positive plants (designated Rl seeds) are collected and germination, early seedling growth, lipid content, and other growth characteristics evaluated. In addition, levels of ACOX mRNA, protein, and enzyme activity are measured to determine the extent to which the antisense construct has altered the expression level of the endogenous ACOX gene.
  • Candida tropicalis was obtained from the American Type Culture Collection (ATCC) and was grown overnight in YPD media at 30°C. The cells were pelleted and DNA was isolated using the procedure described in Ausubel et al.(1994). PCR was performed using Extend Long Template PCR System Kit (Boehringer Mannheim) with lOOng yeast DNA template and the following primers:
  • CTR11 5*-CAGATCTTCACGACATAATG-3* (POX4) (SEQIDNO.12) CTR12:5'-CGAGCTCTTCTATTCTTACTTGG-3' (POX4)(SEQIDNO.13) CTR21:5'-CAGATCTCGCTATCATGCCTACGG-3 * (POX5) (SEQIDNO.14) CTR22: 5'-CCTAGAGCTCTATTAACTGGAC-3' (POX5) (SEQIDNO.15)
  • the PCR reaction conditions were:
  • the 2.2Kb PCR fragment for POX4 and a 2.0 Kb fragment for POX5 were purified by 1% agarose gel electrophoresis and inserted into TA vector (Invitrogen) to form W
  • Vectors for overexpression of the yeast ACOX sequences in plants were constructed using the PCR fragments.
  • the POX4 sequence was excised from pMON25289 as a Smal-
  • FIG.20 The POX5 sequence was excised from pMON25291 as a Bglll-EcoRI fragment and ligated into the Bglll-EcoRI sites in pMON 19648 to form pMON25290 (FIG.21).
  • Each of these vectors contained the CaMV 35S promoter with duplicated enhancer sequence (E35S) and nopaline synthase 3' terminator (NOS, Fraley et al. 1983; Depicker, et al. 1982) to drive overexpression of yeast ACOX genes in plants.
  • the entire expression cassette in pMON25292 and pMON25290 was excised as a Notl fragment and inserted into the Notl site in pMON 17227 (which contained a cassette for constitutive expression of the CP4
  • EPSPS to allow for glyphosate selection in plant transformation
  • pMON25294 POX4; FIG.22
  • pMON25293 POX5; FIG.23
  • pMON25294 and pMON25293 were then introduced into Agrobacterium for plant transformation.
  • Transgenic Arabidopsis plants were generated by the method of Bechtold et al.(1993).
  • the yeast ACOX proteins were then overexpressed by adding IPTG to ImM in the LB broth growth medium and purified by using Novagen' s His Tag Ni2 + chelation resin (Cat. #69670).
  • the purified POX4 and POX5 proteins were injected into rabbits for antibody production (Scientific Association Inc., St. Louis).
  • the antisera against POX5 protein was used to detect POX5 overexpression in transgenic Arabidopsis plants transformed with pMON25293 (pEnhCaMV35S/POX5/NOS- 3', Example 4a).
  • Total protein was extracted from 100 mg of tissue with extraction buffer containing 50 mM Tris-HCl pH 6.8, 100 mM dithiothreitol, 2% SDS, 0.1% bromophenol blue and 10% glycerol.
  • the protein samples were separated on a 10-20% polyacrylamide gradient gel (BioRAD) and transferred onto ECL nitrocellulose membrane (Amersham).
  • a 1 :1000 dilution of primary antisera was used to detect POX5 protein using the ECL detection system (Amersham).
  • Transgenic soybean plants are made as described in Example 3.
  • R0 plants as well as Rl seeds and seedlings are carefully monitered to determine if any adverse phenotypes are observed.
  • Rl seed composition is analyzed to determine if there is any alteration in lipid, protein, or carbohydrate content.
  • germination and early seedling growth characteristics are determined.
  • POX 4 and POX5 expression is characterized by Northern and Western blot analyses.
  • ACOX enzyme assays are performed with short, medium, and long chain fatty acid substrates (Shimizu et al. (1979)) to determine if the total ACOX enzyme activity has changed or if the profile of substrate specificity is altered.
  • the GmHSP26(GH2/4) promoter region was identified from soybean by Ulmasov et al (1995) and a promoter-GUS fusion construct was shown to be induced by a wide variety of chemical agents in a tissue-specific and concentration-dependent manner in transgenic tobacco plants.
  • PCR was used to isolate the GmHSP26(GH2/4) promoter sequences utilizing primers HSP1 and HSP5 which contain sequences homologous to the promoter with restriction sites on the ends for cloning.
  • HSP1 GGTACCAAGCTTAGGTTACGATCTCAAAATCG(SEQIDNO.16)
  • HSP5 CCACCATGGAGATCTGCTACAATACAAACAATG(SEQIDNO.17)
  • Soybean genomic DNA was isolated using standard methods (Fedoroff, Cell 35:225-233 (1983)). 100 ng genomic soybean DNA was used as template in a reaction using the Expend Long Template PCR System Kit (Boehringer Mannheim).
  • the PCR reaction conditions were:
  • the 880 PCR fragment containing the HSP26 promoter was purified by 1% agarose gel electrophoresis, digested with Hindlll and Ncol and ligated into the HindlH and Ncol sites of pMON 19648 (FIG.26) to yield pMON29407 (Fig.27; P-HSP26/GUS/NOS 3'). Nucleotide sequence analysis of the PCR generated insert in pMON29407 was used to confirm that the sequence is intact.
  • pMON29407 The entire expression cassette in pMON29407 was excised as a Notl fragment and inserted into the Notl site in pMON 17227 (which contains a cassette for constitutive expression of the CP4 EPSPS to allow for glyphosate selection in plant transformation) to form pMON29412 (FIG.28).
  • HSP26 promoter sequence was excised from pMON29407 as an Hindlll /Bgllll fragment and ligated into the HindlH/Bglll sites in pMON25292 and pMON25290 to replace the enhanced 35S promoter and to form pMON29408 (FIG.29; P-HSP26/POX4/NOS) and pMON29409 (FIG. 30; P- HSP26/POX5/NOS).
  • pMON29408 and pMON29409 were excised as Notl fragments and each inserted into the Notl site in pMON 17227 (which contains a cassette for constitutive expression of the CP4 EPSPS to allow for glyphosate selection in plant transformation) to form pMON29410 (FIG.31) and pMON2941 1 (FIG.32).
  • pMON29410, pMON2941 1, and pMON29412 were introduced into Agrobacterium tumefaciens and utilized in plant transformations.
  • Glyphosate is employed as a selectable marker (Hinchee et al. (1994)) to identify transformed plant tissue. Leaves of glyphosate-resistant transformants (designated RQ generation) are screened for CP4 EPSPS expression by ELISA (Padgette et al. (1995)). Seeds from RQ CP4-positive plants (designated Rl) are collected and germination, early seedling growth, lipid content, and other growth characteristics evaluated.
  • the expression pattern of the HSP26 promoter throughout the lifecycle of the plant is characterized in the presence and absence of a several inducers including: 2,4D (a synthetic auxin), heat, and 3-(dichloroacetyl)-5-(2-furanyl)-2,2-dimethyl-oxazolidine (furilazole).
  • 2,4D a synthetic auxin
  • heat heat
  • 3-(dichloroacetyl)-5-(2-furanyl)-2,2-dimethyl-oxazolidine furilazole.
  • Detailed analysis of tissue and cell type distribution and timing of expression is obtained from germinating seedlings containing pMON29412 (P-HSP26/GUS).
  • the best inducer of the P-HSP26/GUS expression is utilized to characterize the lines containing an inducible ACOX construct such as pMON29410 and pMON2941 1.
  • Leaves of Ro plants are treated with inducer and expression of ACOX utilizing short, medium, and long chain fatty acid substrates is assayed as described (Shimizu et al. (1979)).
  • Several lines with good induction profiles are chosen for further analysis. These lines are allowed to self and also outcrossed to lines with reduced ACOX levels during germination due to the ACOX antisense construct pMON29405 (Example 3).
  • Progeny from the cross between pMON29405-containing (Example 3) and pMON29410- or pMON29411 -containing lines (Example 5) are planted and the lines containing both constructs identified. Lines containing one of the constructs are retained as controls. The plants are allowed to produce seed for evaluation and to create plants homozygous for both transgenes. Seeds are germinated in the presence or absence of inducer. In the absence of inducer, germination inhibition phenotype is observed. In the presence of inducer, seed treatment of fuvilazole, expression of POX4 or POX5 is turned on. The expression of yeast ACOX enyzme restores the ability of the seedling to break lipids and allows them to germinate and grow normally. In this way, the two constructs plus an inducer combine to form a chemically controllable seed germination system.
  • Varanasi U., Chu, R., Chu, S., Espinosa, R., LeBeau, M.M., and Reddy, J.K., "Isolation of the human peroxisomal acyl-CoA oxidase gene: organization, promoter analysis and chromosomal localization," Proc. Natl. Acad Sci. USA. 91 :3107-31 1 1 (1994).
  • TTCCACTGGC TGCATTAACC CAAAACAAGG ATCACTTGCA AGTGAGCAGC TGAGAAACTT 780 ATATTCACAG GTCCGTCCTA ATGCAATTGC GCTTGTTGAT GCATTTAACT ACACTGATCA 840
  • TAGAACTTCT TTGTAGCATT TACGCTTTGT TTCTTCTTCA CAAGCATTTG GGTGATTTTC 540 TTGCAACTGG CTGCATCACT CCCAAACAGG GTTCCCTTGC AAATGAGCTG CTGAGGTCCT 600 GTATTCACAG GTTCGTCCTA ATGCAATTGC ACTTGTTGAT GCGTTTAACT ACACTGATCA 660

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Developmental Biology & Embryology (AREA)
  • Pregnancy & Childbirth (AREA)
  • Reproductive Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physiology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

La présente invention concerne un procédé permettant de réguler de manière sélective la germination de graines, procédé selon lequel on parvient à inhiber la germination par l'expression d'un inhibiteur de germination, et à induire ensuite ladite germination par l'intermédiaire d'un promoteur inductible relié de manière fonctionnelle à un restaurateur de germination. On décrit également des plantes, des cellules végétales, des graines et des produits de recombinaison d'ADN produits par génie génétique dans un but de régulation de la germination des graines.
PCT/US1997/008732 1996-05-20 1997-05-20 Procede de regulation de la germination de graines au moyen de sequences d'acyl-coa oxydase du soja WO1997044465A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU31394/97A AU3139497A (en) 1996-05-20 1997-05-20 Method for controlling seed germination using soybean acyl coa oxidase sequences

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US1761496P 1996-05-20 1996-05-20
US60/017,614 1996-05-20

Publications (1)

Publication Number Publication Date
WO1997044465A1 true WO1997044465A1 (fr) 1997-11-27

Family

ID=21783579

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/008732 WO1997044465A1 (fr) 1996-05-20 1997-05-20 Procede de regulation de la germination de graines au moyen de sequences d'acyl-coa oxydase du soja

Country Status (2)

Country Link
AU (1) AU3139497A (fr)
WO (1) WO1997044465A1 (fr)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0894864A1 (fr) * 1997-07-29 1999-02-03 Axel Dr. Brennicke Gènes codant pour des enzymes de la famille ACDH de plantes; méthodes pour la production de semences ou de plantes transgéniques caractérisées par une teneur améliorée ou une composition modifiée en acides gras et/ou en acides amines
WO1999006578A2 (fr) * 1997-07-30 1999-02-11 Zeneca Limited Procede genetique pour controler la formation de pousses
WO2000009708A1 (fr) * 1998-08-17 2000-02-24 Syngenta Limited Constructions d'adn comprenant des sequences de codage de proteases ou des inhibiteurs de celles-ci
WO2000018930A1 (fr) * 1998-09-25 2000-04-06 Syngenta Limited Promoteur de plante
WO2000075350A2 (fr) * 1999-06-08 2000-12-14 Calgene Llc Sequences d'acide nucleique codant des proteines impliquees dans la beta-oxydation des acides gras et procedes d'utilisation
WO2002013758A2 (fr) * 2000-08-18 2002-02-21 Gencell S.A. Systeme de regulation in vivo de l'expression d'un transgene par inhibition conditionnelle
US6753460B2 (en) * 1998-12-22 2004-06-22 Dow Agrosciences Llc Methods and genetic compositions to limit outcrossing and undesired gene flow in crop plants
WO2006005807A1 (fr) * 2004-07-15 2006-01-19 Unicrop Ltd Utilisation de phytoene synthase pour le controle de l'echappement des transgenes
EP1655364A3 (fr) * 2004-11-05 2006-08-02 BASF Plant Science GmbH Cassettes d'expression pour une expression préférentielle dans les graines.
US7375209B2 (en) 2004-11-05 2008-05-20 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression in plants

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993015213A1 (fr) * 1992-01-24 1993-08-05 Zeneca Limited Regulation de la transcription d'un gene
WO1994003619A2 (fr) * 1992-07-29 1994-02-17 Zeneca Limited Material genetique des vegetaux ameliore
WO1996004393A2 (fr) * 1994-08-01 1996-02-15 Delta And Pine Land Company Regulation de l'expression d'un gene de plante

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993015213A1 (fr) * 1992-01-24 1993-08-05 Zeneca Limited Regulation de la transcription d'un gene
WO1994003619A2 (fr) * 1992-07-29 1994-02-17 Zeneca Limited Material genetique des vegetaux ameliore
WO1996004393A2 (fr) * 1994-08-01 1996-02-15 Delta And Pine Land Company Regulation de l'expression d'un gene de plante

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SMALL G. ET AL.: "Acyl-CoA oxidase contains two targeting sequences each of which can mediate protein import into peroxisomes", THE EMBO JOURNAL, vol. 7, no. 4, April 1988 (1988-04-01), pages 1167 - 1173, XP002041280 *

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0894864A1 (fr) * 1997-07-29 1999-02-03 Axel Dr. Brennicke Gènes codant pour des enzymes de la famille ACDH de plantes; méthodes pour la production de semences ou de plantes transgéniques caractérisées par une teneur améliorée ou une composition modifiée en acides gras et/ou en acides amines
WO1999006578A2 (fr) * 1997-07-30 1999-02-11 Zeneca Limited Procede genetique pour controler la formation de pousses
WO1999006578A3 (fr) * 1997-07-30 1999-04-22 Zeneca Ltd Procede genetique pour controler la formation de pousses
WO2000009708A1 (fr) * 1998-08-17 2000-02-24 Syngenta Limited Constructions d'adn comprenant des sequences de codage de proteases ou des inhibiteurs de celles-ci
WO2000018930A1 (fr) * 1998-09-25 2000-04-06 Syngenta Limited Promoteur de plante
US8124843B2 (en) 1998-12-22 2012-02-28 Dow Agrosciences Llc Methods and genetic compositions to limit outcrossing and undesired gene flow in crop plants
US6753460B2 (en) * 1998-12-22 2004-06-22 Dow Agrosciences Llc Methods and genetic compositions to limit outcrossing and undesired gene flow in crop plants
US7671253B2 (en) 1998-12-22 2010-03-02 Dow Agrosciences Llc Methods and genetic compositions to limit outcrossing and undesired gene flow in crop plants
WO2000075350A2 (fr) * 1999-06-08 2000-12-14 Calgene Llc Sequences d'acide nucleique codant des proteines impliquees dans la beta-oxydation des acides gras et procedes d'utilisation
WO2000075350A3 (fr) * 1999-06-08 2001-11-29 Calgene Llc Sequences d'acide nucleique codant des proteines impliquees dans la beta-oxydation des acides gras et procedes d'utilisation
US6489461B1 (en) 1999-06-08 2002-12-03 Calgene Llc Nucleic acid sequences encoding proteins involved in fatty acid beta-oxidation and methods of use
US7495148B2 (en) 2000-07-14 2009-02-24 Unicrop Ltd Double recoverable block of function
WO2002013758A3 (fr) * 2000-08-18 2002-07-18 Aventis Pharma Sa Systeme de regulation in vivo de l'expression d'un transgene par inhibition conditionnelle
WO2002013758A2 (fr) * 2000-08-18 2002-02-21 Gencell S.A. Systeme de regulation in vivo de l'expression d'un transgene par inhibition conditionnelle
WO2006005807A1 (fr) * 2004-07-15 2006-01-19 Unicrop Ltd Utilisation de phytoene synthase pour le controle de l'echappement des transgenes
US7790950B2 (en) 2004-07-15 2010-09-07 Viktor Kuvshinov Use of phytoene synthase for controlling transgene escape
US7375209B2 (en) 2004-11-05 2008-05-20 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression in plants
EP1655364A3 (fr) * 2004-11-05 2006-08-02 BASF Plant Science GmbH Cassettes d'expression pour une expression préférentielle dans les graines.

Also Published As

Publication number Publication date
AU3139497A (en) 1997-12-09

Similar Documents

Publication Publication Date Title
Huang et al. Activation of gibberellin 2-oxidase 6 decreases active gibberellin levels and creates a dominant semi-dwarf phenotype in rice (Oryza sativa L.)
Dolferus et al. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene
De Bruxelles et al. Abscisic acid induces the alcohol dehydrogenase gene in Arabidopsis
EP1571221A2 (fr) Gènes jouant un ròle dans la tolérance au stress de l'environnement
EP1794303B1 (fr) Modification du developpement et de la morphologie d'une plante
Yang et al. The OsEBP-89 gene of rice encodes a putative EREBP transcription factor and is temporally expressed in developing endosperm and intercalary meristem
US6808926B1 (en) Repressing gene expression in plants
EP1141355B1 (fr) Promoteur de s-adenosyl-l-methionine synthetase et son utilisation pour exprimer des genes transgeniques chez des vegetaux
WO1997044465A1 (fr) Procede de regulation de la germination de graines au moyen de sequences d'acyl-coa oxydase du soja
Erpen et al. Isolation, characterization, and evaluation of three Citrus sinensis-derived constitutive gene promoters
AU2010267655B2 (en) Expression of transcription regulators that provide heat tolerance
AU2008225371B2 (en) Method of expression of foreign gene in plant induced by chemical substance
US20100281580A1 (en) Use of a gene encoding a histidine protein kinase to create drought resistant plants
AU2012260380A1 (en) Plants having enhanced abiotic stress resistance
CA2634173C (fr) Plantes a expression reduite du gene de la proteine phosphatase de type 2c pour resistance renforcee a des agents pathogenes
AU3900200A (en) Banana and melon promoters for expression of transgenes in plants
US6548743B1 (en) Transgenic plants expressing a dual-specificity MAPK phosphatase and uses thereof
Ahmadi et al. The promoter of a metallothionein-like gene from the tropical tree Casuarina glauca is active in both annual dicotyledonous and monocotyledonous plants
WO2004001028A1 (fr) Genes transferase derives des plantes
US20090025100A1 (en) DWF12 and Mutants Thereof
Mineta et al. Localization of MT2a gene promoter expression is different from the site (s) of copper accumulation in the roots of transgenic Arabidopsis thaliana
WO2000012713A1 (fr) Sequence promoteur de plantes et ses utilisations
Luan Rice genes encoding light-harvesting chlorophyll a/b-binding proteins: Molecular characterization of photo-regulated expression

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ VN YU AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 97542744

Format of ref document f/p: F

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase