WO2000017353A1 - Ucp4 - Google Patents

Ucp4 Download PDF

Info

Publication number
WO2000017353A1
WO2000017353A1 PCT/US1999/021194 US9921194W WO0017353A1 WO 2000017353 A1 WO2000017353 A1 WO 2000017353A1 US 9921194 W US9921194 W US 9921194W WO 0017353 A1 WO0017353 A1 WO 0017353A1
Authority
WO
WIPO (PCT)
Prior art keywords
ucp4
dna
polypeptide
sequence
molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1999/021194
Other languages
English (en)
French (fr)
Inventor
Sean Adams
James Pan
Alan Zhong
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genentech Inc
Original Assignee
Genentech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genentech Inc filed Critical Genentech Inc
Priority to JP2000574252A priority Critical patent/JP4709383B2/ja
Priority to DE69937644T priority patent/DE69937644T2/de
Priority to DK99969439T priority patent/DK1115863T3/da
Priority to AU60413/99A priority patent/AU6041399A/en
Priority to EP99969439A priority patent/EP1115863B1/en
Priority to CA2344467A priority patent/CA2344467C/en
Publication of WO2000017353A1 publication Critical patent/WO2000017353A1/en
Anticipated expiration legal-status Critical
Priority to US09/946,374 priority patent/US20030073129A1/en
Priority to US10/006,867 priority patent/US7160985B2/en
Priority to US10/006,856 priority patent/US7538086B2/en
Priority to US10/006,768 priority patent/US6936697B2/en
Priority to US10/007,236 priority patent/US7034123B2/en
Priority to US10/006,041 priority patent/US6951921B2/en
Priority to US10/006,130 priority patent/US7098312B2/en
Priority to US10/006,485 priority patent/US7026448B2/en
Priority to US10/006,746 priority patent/US7026449B2/en
Priority to US10/006,818 priority patent/US20030054406A1/en
Priority to US10/006,063 priority patent/US20030114652A1/en
Priority to US10/006,116 priority patent/US20030082626A1/en
Priority to US10/007,194 priority patent/US7041805B2/en
Priority to US10/006,117 priority patent/US7071304B2/en
Priority to US10/006,172 priority patent/US7081514B2/en
Priority to US10/012,064 priority patent/US6953841B2/en
Priority to US10/012,754 priority patent/US7375184B2/en
Priority to US10/012,752 priority patent/US7026455B2/en
Priority to US10/012,231 priority patent/US6924355B2/en
Priority to US10/011,671 priority patent/US20030096954A1/en
Priority to US10/012,149 priority patent/US7038019B2/en
Priority to US10/012,237 priority patent/US20030191281A1/en
Priority to US10/011,692 priority patent/US20030109672A1/en
Priority to US10/012,753 priority patent/US7488796B2/en
Priority to US10/011,833 priority patent/US6951920B2/en
Priority to US10/012,121 priority patent/US7022817B2/en
Priority to US10/012,754 priority patent/US20030187191A1/en
Priority to US10/012,101 priority patent/US20030187239A1/en
Priority to US10/012,137 priority patent/US20030187189A1/en
Priority to US10/011,795 priority patent/US7012131B2/en
Priority to US10/012,755 priority patent/US20030096955A1/en
Priority to US10/015,822 priority patent/US20030130491A1/en
Priority to US10/013,910 priority patent/US7057018B2/en
Priority to US10/013,911 priority patent/US20030187193A1/en
Priority to US10/013,913 priority patent/US20030083462A1/en
Priority to US10/013,907 priority patent/US20030064925A1/en
Priority to US10/013,430 priority patent/US20030092883A1/en
Priority to US10/013,906 priority patent/US20030191282A1/en
Priority to US10/013,915 priority patent/US20030204053A1/en
Priority to US10/013,909 priority patent/US20030186318A1/en
Priority to US10/015,519 priority patent/US7033785B2/en
Priority to US10/015,653 priority patent/US20030187195A1/en
Priority to US10/015,499 priority patent/US20030065142A1/en
Priority to US10/015,389 priority patent/US6936436B2/en
Priority to US10/015,869 priority patent/US20030073130A1/en
Priority to US10/015,671 priority patent/US6946263B2/en
Priority to US10/015,480 priority patent/US7074912B2/en
Priority to US10/015,393 priority patent/US6951737B2/en
Priority to US10/015,869 priority patent/US7189530B2/en
Priority to US10/015,715 priority patent/US7033786B2/en
Priority to US10/015,385 priority patent/US20030195347A1/en
Priority to US10/015,388 priority patent/US20030191299A1/en
Priority to US10/015,386 priority patent/US7022498B2/en
Priority to US10/015,390 priority patent/US20030216562A1/en
Priority to US10/015,387 priority patent/US20030135034A1/en
Priority to US10/015,391 priority patent/US20030120053A1/en
Priority to US10/017,867 priority patent/US20030180792A1/en
Priority to US10/017,527 priority patent/US20030082628A1/en
Priority to US10/020,063 priority patent/US20030119097A1/en
Priority to US10/017,306 priority patent/US20030170718A1/en
Priority to US10/017,610 priority patent/US20030113795A1/en
Priority to US10/017,407 priority patent/US20030125535A1/en
Priority to US10/063,651 priority patent/US7193057B2/en
Priority to US10/972,317 priority patent/US7208321B2/en
Priority to US11/025,607 priority patent/US20050181478A1/en
Priority to US11/796,725 priority patent/US20090197301A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • the present invention relates generally to the identification and isolation of novel DNA having homology to certain human uncoupling proteins, and to the recombmant production of novel polypeptides, designated herein as "uncoupling protein 4" or "UCP . "
  • UCP1 human uncoupling protein referred to as UCP1 was identified by Nicholls et al .
  • Nicholls et al . showed that the inner membrane of brown fat cell mitochondria was very permeable to proteins, and the investigators traced the observed permeability to a protein, called UCP1, in the mitochondrial membrane.
  • UCP1 by creating such permeability, reduced the number of ATPs that can be made from a food source, thus raising body metabolic rate and generating heat.
  • UCP1 is indeed expressed only m brown adipose tissue [Bouillaud et al . , Proc. Natl. Acad. Sci . , 82:445-448 (1985); Jacobsson et al., J Biol . Chem. , 260:16250-16254 (1985)]. Genetic mapping studies have shown that the human UCP1 gene is located on chromosome 4. [Cassard et al . , J. Cell. Biochem. , 43:255-264 (1990)].
  • UCP2 Another human UCP, referred to as UCPH or UCP2 , has also been described.
  • UCPH UCPH
  • UCP2 Another human UCP, referred to as UCPH or UCP2 .
  • Fleury et al . teach that the UCP2 protein has 59% ammo acid identity to UCP1, and that UCP2 maps to regions of human chromosome 11 which have been linked to hyperinsulmaemia and obesity.
  • UCP2 is expressed m a variety of adult tissues, such as brain and muscle and fat cells. [Gimeno et al . , supra, and Fleury et al . , supra] .
  • UCP3 unlike UCP1 and UCP2 , UCP3 is expressed preferentially in human skeletal muscle, and that the UCP3 gene maps to human chromosome 11, adjacent to the UCP2 gene.
  • thermogenic stimuli such as thyroid hormone, beta3-andrenergic agonists and leptm.
  • a cDNA clone (DNA 77568-1626) has been identified, having certain nomologies to some known human uncoupling proteins, that encodes a novel polypeptide, designated m the present application as "UCP4.”
  • the invention provides an isolated nucleic acid molecule comprising DNA encoding a UCP4 polypeptide.
  • the isolated nucleic acid comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity to (a) a DNA molecule encoding a UCP4 polypeptide comprising the sequence of ammo acid residues from about 1 to about 323, inclusive of Figure 1 (SEQ ID NO:l), or (b) the complement of the DNA molecule of (a) .
  • the invention concerns an isolated nucleic acid molecule encoding a UCP4 polypeptide comprising DNA hybridizing to the complement of the nucleic acid between about nucleotides 40 and about 1011 inclusive, of Figure 2 (SEQ ID NO : 2) .
  • hybridization occurs under stringent hybridization and wash conditions.
  • the invention concerns an isolated nucleic acid molecule comprising DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity to (a) a DNA molecule encoding the same mature polypeptide encoded by the cDNA ATCC Deposit No. 203134, or (b) the complement of the DNA molecule of (a) .
  • the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the cDNA m ATCC Deposit No. 203134.
  • the invention concerns an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity to the sequence of ammo acid residues from about 1 to about 323, inclusive of Figure 1 (SEQ ID NO:l), or the complement of the DNA of (a) .
  • the invention concerns an isolated nucleic acid molecule comprising (a) DNA encoding a polypeptide scoring at least about 80% positives, preferably at least about 85% positives, more preferably at least about 90% positives, most preferably at least about 95% positives when compared with the ammo acid sequence of residues 1 to about 323, inclusive of Figure 1 (SEQ ID NO:l), or (b) the complement of the DNA of (a) .
  • Further embodiments of the invention are directed to fragments of the UCP4 coding sequence, which are sufficiently long to be used as hybridization probes.
  • such fragments contain at least about 20 to about 80 consecutive bases included in the sequence of Figure 2 (SEQ ID NO: 2)
  • such fragments include the N-terminus or the C- erminus of the sequence of Figure 2 (SEQ ID NO: 2) .
  • the invention provides a vector comprising DNA encoding UCP4 or its variants .
  • the vector may comprise any of the isolated nucleic ac d molecules hereinabove defined.
  • a host cell comprising such a vector is also provided.
  • the host cells may be CHO cells, E. coll , or yeast.
  • a process for producing UCP4 polypeptides is further provided and comprises cultunng host cells under conditions suitable for expression of UCP4 and recovering UCP4 from the cell culture.
  • the invention provides isolated UCP4 polypeptide encoded by any of the isolated nucleic acid sequences hereinabove defmed .
  • the invention provides isolated native sequence UCP4 polypeptide, which in one embodiment, includes an ammo acid sequence comprising residues 1 to 323 of Figure 1 (SEQ ID NO:l) .
  • the invention concerns an isolated UCP4 polypeptide, comprising an ammo acid sequence having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity to the sequence of ammo acid residues 1 to about 323, inclusive of Figure 1 (SEQ ID NO:l).
  • the invention concerns an isolated UCP4 polypeptide, comprising an ammo acid sequence scoring at least about 80% positives, preferably at least about 85% positives, more preferably at least about 90% positives, most preferably at least about 95% positives when compared with the ammo acid sequence of residues 1 to 323 of Figure 1 (SEQ ID NO : 1) .
  • the invention concerns an isolated UCP4 polypeptide, comprising the sequence of ammo acid residues 1 to about 323, inclusive of Figure 1 (SEQ ID NO:l), or a fragment thereof sufficient to, for instance, provide a binding site for an ant ⁇ -UCP4 antibody.
  • the UCP4 fragment retains at least one biological activity of a native UCP4 polypeptide .
  • the invention provides a polypeptide produced by d) hybridizing a test DNA molecule under stringent conditions with (a) a DNA molecule encoding a UCP4 polypeptide having the sequence of ammo acid residues from about 1 to about 323, inclusive of Figure 1 (SEQ ID NO: 1) , or (b) the complement of the DNA molecule of (a) , and if the test DNA molecule has at least about an 80% sequence identity, preferably at least about an 85% sequence identity, more preferably at least about a 90% sequence identity, most preferably at least about a 95% sequence identity to (a) or (b) , (n) culturmg a host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (m) recovering the polypeptide from the cell culture.
  • the invention provides chimeric molecules comprising a UCP4 polypeptide fused to a heterologous polypeptide or ammo acid sequence .
  • a chimeric molecule comprises a UCP4 polypeptide fused to an epitope tag sequence or a Fc region of an lmmunoglobulm.
  • the invention provides an antibody which specifically binds to UCP4 polypeptide.
  • the antibody is a monoclonal antibody.
  • the invention concerns agonists and antagonists of a native UCP4 polypeptide.
  • the agonist or antagonist is an ant ⁇ -UCP4 antibody.
  • the invention concerns a method of identifying agonists or antagonists of a native UCP4 polypeptide, comprising contacting the native UCP4 polypeptide with a candidate molecule and monitoring the desired activity.
  • the invention also provides therapeutic methods and diagnostic methods using UCP4.
  • the invention concerns a composition
  • a composition comprising a UCP4 polypeptide, or an agonist or antagonist as hereinabove defined, m combination with a carrier.
  • Figure 1 shows the derived ammo acid sequence of a native sequence UCP4.
  • Figure 2 shows the nucleotide sequence of a cDNA encoding native sequence UCP4.
  • Figure 3 shows an am o acid sequence alignment of UCP4 with other known uncoupling proteins, UCP1 (SEQ ID NO:16), UCP2 (SEQ ID N0:17), and UCP3 (SEQ ID NO: 18).
  • the six putative transmembrane domains are shown and are underlined (and labeled I to VI, respectively) .
  • the asterisks (*) shown below the protein sequence indicate three (3) putative mitochondrial carrier protein motifs.
  • a putative nucleotide binding domain is double underlined.
  • Figures 4A-4H show the results of Northern blot analysis.
  • Human adult tissues and bram tissues (Clontech) , in addition to peripheral blood leukocytes (PBLs) , cancer cells, and fetal tissues, were probed with UCP4 cDNA.
  • PBLs peripheral blood leukocytes
  • the figures illustrate that the UCP4 transcript was detected m human bram tissues, spinal cord, medulla, corpus callosum, and substantia nigra.
  • Figures 5A-5B show the results of m vi tro assays conducted to determine the effects of UCP4 expression on mitochondrial membrane potential.
  • Figures 6A-6F show the results of in vi tro assays conducted to determine the subcellular localization of UCP4.
  • Figure 7 shows a "fromDNA" sequence assembled from selected EST sequences .
  • Figures 8A-8C show the results of m vi tro assays conducted to determine the effect of food consumption on the expression of UCP4 mRNA.
  • Figures 9A-9D show the results of in vi tro assays conducted to determine the effect of fat consumption on the expression of UCP4 mRNA.
  • Figures 10A-10G show the results of m vi tro assays conducted to determine the effect of temperature stress on the expression of UCP4 mRNA.
  • UCP4 polypeptide when used herein encompass native sequence UCP4 and UCP4 variants (which are further defined herein) .
  • the UCP4 may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant and/or synthetic methods .
  • a “native sequence UCP4” comprises a polypeptide having the same ammo acid sequence as a UCP4 derived from nature. Such native sequence UCP4 can be isolated from nature or can be produced by recombinant and/or synthetic means.
  • the term "native sequence UCP4" specifically encompasses naturally-occurring truncated or soluble forms, naturally-occurring variant forms ( e . g. , alternatively spliced forms) and naturally-occurring allelic variants of the UCP4.
  • the native sequence UCP4 is a mature or full-length native sequence UCP4 comprising ammo acids 1 to 323 of Figure 1 (SEQ ID NO:l) .
  • UCP4 variant means anything other than a native sequence UCP4, and includes UCP4 having at least about 80% ammo acid sequence identity with the ammo acid sequence comprising residues 1 to 323 of the UCP4 polypeptide sequence shown m Figure 1 (SEQ ID NO:l).
  • UCP4 variants include, for instance, UCP4 polypeptides wherein one or more ammo acid residues are added, or deleted, at the N- or C-termmus, as well as within one or more internal domains, of the sequence of Figure 1 (SEQ ID NO:l) .
  • a UCP4 variant will have at least about 80% ammo acid sequence identity, more preferably at least about 85% ammo acid sequence identity, even more preferably at least about 90% ammo acid sequence identity, and most preferably at least about 95% sequence identity with the ammo acid sequence comprising residues 1 to 323 of Figure 1 (SEQ ID NO:l) .
  • Percent (%) ammo acid sequence identity with respect to the UCP4 sequences identified herein is defined as the percentage of ammo acid residues m a candidate sequence that are identical with the ammo acid residues m the UCP4 sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • % identity can be determined by WU-BLAST-2, obtained from [Altschul et al . , Methods in Enzymolocry, 266 : 460-480 (1996), http: //blast. ustl/edu/blast/README. html] .
  • WU-BLAST-2 uses several search parameters, most of which are set to the default values.
  • the HSP S and HSP S2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity.
  • a % amino acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the "longer" sequence n the aligned region.
  • the "longer" sequence is the one having the most actual residues m the aligned region (gaps introduced by WU-Blast-2 to maximize the alignment score are ignored) .
  • the % value of positives is determined by the fraction of residues scoring a positive value in the BLOSUM 62 matrix divided by the total number of residues the longer sequence, as defined above .
  • percent (%) nucleic acid sequence identity is defined as the percentage of nucleotides m a candidate sequence that are identical with the nucleotides the UCP4 coding sequence .
  • the identity values can be generated by the BLASTN module of WU-BLAST-2 set to the default parameters, with overlap span and overlap fraction set to 1 and 0.125, respectively.
  • isolated, when used to describe the various polypeptides disclosed herein, means polypeptide that has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other protemaceous or non-protemaceous solutes.
  • the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal or internal ammo ac d sequence by use of a spinning cup sequenator, or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain.
  • Isolated polypeptide includes polypeptide m si tu within recombinant cells, since at least one component of the UCP4 natural environment will not be present Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.
  • An "isolated" nucleic acid molecule encoding a UCP4 polypeptide is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated m the natural source of the UCP4-encodmg nucleic acid.
  • An isolated UCP4- encoding nucleic acid molecule is other than m the form or setting m which it is found nature. Isolated nucleic acid molecules therefore are distinguished from the UCP4 -encoding nucleic acid molecule as it exists m natural cells.
  • an isolated nucleic acid molecule encoding a UCP4 polypeptide includes UCP4 -encoding nucleic acid molecules contained in cells that ordinarily express UCP4 where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells.
  • control sequences refers to DNA sequences necessary for the expression of an operably linked coding sequence m a particular host organism.
  • the control sequences that are suitable for prokaryotes include a promoter, optionally an operator sequence, and a ⁇ bosome binding s te.
  • Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
  • Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
  • DNA for a presequence or secretory leader s operably linked to DNA for a polypeptide if it is expressed as a preprotem that participates in the secretion of the polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence f it affects the transcription of the sequence; or
  • a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • "operably linked” means that the DNA sequences being linked are contiguous, and, m the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligat on at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
  • antibody is used in the broadest sense and specifically covers single ant ⁇ -UCP4 monoclonal antibodies (including agonist, antagonist, and neutralizing antibodies) and ant ⁇ -UCP4 antibody compositions with polyepitopic specificity
  • monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally- occurring mutations that may be present in minor amounts. "Stringency" of hybridization reactions is readily determinable by one of ordinary skill m the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures
  • Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature
  • stringency of hybridization reactions see Ausubel et al .
  • Stringent conditions or “high stringency conditions”, as defined herein, may be identified by those that- (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chlor ⁇ de/0.0015 M sodium c trate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albura ⁇ n/0.1.
  • a denaturing agent such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albura ⁇ n/0.1.
  • Modely stringent conditions may be identified as described by Sambrook et al . , Molecular Cloning- A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent that those described above
  • An example of moderately stringent conditions is overnight incubation at 37 °C m a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate) , 50 mM sodium phosphate (pH 7.6), 5 x Denhardt ' s solution, 10% dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA, followed by washing the filters 1 x SSC at about 37-50 °C
  • the skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.
  • epitope tagged when used herein refers to a chimeric polypeptide comprising a UCP4 polypeptide fused to a "tag polypeptide".
  • the tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough such that it does not interfere with activity of the polypeptide to which it is fused.
  • the tag polypeptide preferably also is fairly unique so that the antibody does not substantially cross-react with other epitopes .
  • Suitable tag polypeptides generally have at least six ammo acid residues and usually between about 8 and 50 am o acid residues (preferably, between about 10 and 20 ammo acid residues) .
  • the term " lmmunoadhesin” designates antibody- like molecules which combine the binding specificity of a heterologous protein (an “adhes ”) with the effector functions of immunoglobulm constant domains.
  • the immunoadhesins comprise a fusion of an ammo acid sequence with the desired binding specificity which is other than the antigen recognition and binding site of an antibody (i.e., is "heterologous"), and an immunoglobulm constant domain sequence.
  • the adhesm part of an lmmunoadhesin molecule typically is a contiguous ammo acid sequence comprising at least the binding site of a receptor or a ligand.
  • the immunoglobulm constant domain sequence m the lmmunoadhesin may be obtained from any immunoglobulm, such as IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.
  • immunoglobulm such as IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.
  • Activity refers to form(s) of UCP4 which retain the biologic and/or lmmunologic activities of native or naturally-occurring UCP4.
  • a preferred activity s the ability to affect mitochondrial membrane potential m a way that results m an up- or down- regulation of metabolic rate and/or heat production.
  • One such activity includes the generation of proton leakage in mitochondrial membrane that results in an increase metabolic rate. The activity may be measured or quantitated m vi tro or m vivo .
  • antagonist is used the broadest sense, and includes any molecule that partially or fully blocks, inhibits, or neutralizes a biological and/or immunological activity of a native UCP4 polypeptide disclosed herein.
  • agonist is used in the broadest sense and includes any molecule that mimics a biological and/or immunological activity of a native UCP4 polypeptide disclosed herein.
  • Suitable agonist or antagonist molecules specifically include agonist or antagonist antibodies or antibody fragments, lmmunoadhesins of UCP4 polypeptides, or fragments or ammo acid sequence variants of native UCP4 polypeptides.
  • Treatment refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) the targeted pathologic condition or disorder.
  • Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those m whom the disorder is to be prevented.
  • Chronic administration refers to administration of the agent (s) in a continuous mode as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time.
  • Intermittent administration is treatment that is not consecutively done without interruption, but rather is cyclic in nature.
  • mammal for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, cats, cows, horses, sheep, pigs, etc. Preferably, the mammal is human.
  • Administration "in combination with” one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration m any order.
  • the present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to m the present application as UCP4.
  • cDNA encoding a UCP4 polypeptide has been identified and isolated, as disclosed m further detail in the Examples below.
  • the protein encoded by DNA 77568-1626 as well as all further native homologues and variants included in the foregoing definition of UCP4 will be referred to as "UCP4," regardless of their origin or mode of preparation.
  • UCP4 a clone DNA 77568-1626 has been deposited with ATCC.
  • nucleotide sequence of the clone can readily be determined by the skilled artisan by sequencing of the deposited clone using routine methods m the art .
  • the predicted ammo acid sequence can be determined from the nucleotide sequence using routine skill.
  • UCP4 herein, Applicants have identified what is believed to be the reading frame best identifiable with the sequence information available at the time of filing. Using the Megalign DNASTAR computer program (and algorithms and parameters m this software set by the manufacturer) (Oxford Molecular
  • UCP4 disclosed m the present application is a newly identified member of the human uncoupling protein family and may possess activity (s) and/or property (s) typical of that protein family, such as the ability to enhance or suppress metabolic rate by affecting mitochondrial membrane potential .
  • UCP4 variants can be prepared.
  • UCP4 variants can be prepared by introducing appropriate nucleotide changes into the UCP4 DNA, and/or by synthesis of the desired UCP4 polypeptide.
  • am o acid changes may alter post-translational processes of the UCP4 , such as changing the number or position of glycosylation sites or altering the membrane anchoring characteristics.
  • Variations m the native full-length sequence UCP4 or m various domains of the UCP4 described herein, can be made, for example, using any of the techniques and guidelines for conservative and non-conservative mutations set forth, for instance, m U.S. Patent No. 5,364,934.
  • Variations may be a substitution, deletion or insertion of one or more codons encoding the UCP4 that results in a change m the ammo ac d sequence of the UCP4 as compared with the native sequence UCP4.
  • the variation is by substitution of at least one am o acid with any other ammo acid in one or more of the domains of the UCP4.
  • Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity may be found by comparing the sequence of the UCP4 with that of homologous known protein molecules and minimizing the number of ammo acid sequence changes made m regions of high homology.
  • Ammo acid substitutions can be the result of replacing one ammo acid with another ammo acid having similar structural and/or chemical properties, such as the replacement of a leucine with a serme, i.e., conservative ammo acid replacements.
  • Insertions or deletions may optionally be m the range of 1 to 5 ammo acids. The variation allowed may be determined by systematically making insertions, deletions or substitutions of ammo acids in the sequence and, if desired, testing the resulting variants for activity m assays known m the art or as described herein.
  • One embodiment of the invention is directed to UCP4 variants which are fragments of the full length UCP4.
  • such fragments retain a desired activity or property of the full length UCP4.
  • the variations can be made using methods known m the art such as oligonucleotide-mediated (site-directed) mutagenesis, alanme scanning, and PCR mutagenesis.
  • Site-directed mutagenesis [Carter et al . , Nucl . Acids Res. , 13:4331 (1986); Zoller et al . , Nucl. Acids Res., 10_:6487 (1987)], cassette mutagenesis [Wells et al . , Gene, 3_4:315 (1985)], restriction selection mutagenesis [Wells et al . , Philos. Trans. R. Soc. London SerA, 317 : 415 (1986)] or other known techniques can be performed on the cloned DNA to produce the UCP4 variant DNA.
  • Scanning ammo acid analysis can also be employed to identify one or more ammo acids along a contiguous sequence
  • preferred scanning ammo acids are relatively small, neutral ammo acids.
  • ammo acids include alanme, glycme, serme, and cyste e.
  • Alanme s typically a preferred scanning ammo acid among this group because it eliminates the side-cham beyond the beta-carbon and is less likely to alter the main-cham conformation of the variant [Cunningham and Wells, Science, 244 : 1081-1085
  • Alanme is also typically preferred because it is the most common am o acid. Further, it is frequently found in both buried and exposed positions [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J.
  • Covalent modifications of UCP4 are included within the scope of this invention.
  • One type of covalent modification includes reacting targeted ammo acid residues of a UCP4 polypeptide with an organic derivatizmg agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the UCP4.
  • Derivatization with bifunctional agents is useful, for instance, for crosslmkmg UCP4 to a water-insoluble support matrix or surface for use m the method for purifying ant ⁇ -UCP4 antibodies, and vice-versa
  • Commonly used crosslmkmg agents include, e . g.
  • 1, 1-b ⁇ s (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters for example, esters with 4-az ⁇ dosal ⁇ cyl ⁇ c acid, homobifunctional lmidoesters, including disuccmimidyl esters such as 3,3'- dithiobis (succ imidylpropionate) , bifunctional maleimides such as bis-N- male ⁇ m ⁇ do-1, 8 -octane and agents such as methyl-3 - [ (p-azidophenyl) dithio] pro- pioimidate .
  • disuccmimidyl esters such as 3,3'- dithiobis (succ imidylpropionate)
  • bifunctional maleimides such as bis-N- male ⁇ m ⁇ do-1, 8 -octane and agents such as methyl-3 - [ (p-azidophenyl) dithio] pro
  • Another type of covalent modification of the UCP4 polypeptide included withm the scope of this invention comprises altering the native glycosylation pattern of the polypeptide.
  • "Altering the native glycosylation pattern” is intended for purposes herein to mean deleting one or more carbohydrate moieties found native sequence UCP4 (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence UCP4.
  • the phrase includes qualitative changes m the glycosylation of the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present .
  • Addition of glycosylation sites to the UCP4 polypeptide may be accomplished by altering the ammo acid sequence
  • the alteration may be made, for example, by the addition of, or substitution by, one or more serme or threonme residues to the native sequence UCP4 (for 0-linked glycosylation sites)
  • the UCP4 ammo acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the UCP4 polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids.
  • Another means of increasing the number of carbohydrate moieties on the UCP4 polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide.
  • UCP4 Another type of covalent modification of UCP4 comprises linking the UCP4 polypeptide to one of a variety of nonprotemaceous polymers, e . g. , polyethylene glycol (PEG) , polypropylene glycol, or polyoxyalkylenes, m the manner set forth in U.S. Patent Nos.
  • the UCP4 of the present invention may also be modified m a way to form a chimeric molecule comprising UCP4 fused to another, heterologous polypeptide or ammo acid sequence.
  • such a chimeric molecule comprises a fusion of the UCP4 with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind.
  • the epitope tag is generally placed at the ammo- or carboxyl- terminus of the UCP4 The presence of such epitope-tagged forms of the UCP4 can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the UCP4 to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag.
  • Various tag polypeptides and their respective antibodies are well known in the art.
  • Examples include poly-histid e (poly-his) or poly-histidme-glycme (poly- his-gly) tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al . , Molecular and Cellular Biology, 5:3610-3616 (1985)], and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al .
  • gD Herpes Simplex virus glycoprotein D
  • tag polypeptides include the Flag- peptide [Hopp et al . , BioTechnology, . 6:1204-1210 (1988)],- the T3 epitope peptide [Martin et al . , Science, 255 : 192-194 (1992)]; an ⁇ -tubulm epitope peptide [Skinner et al . , J. Biol. Chem., 266:15163-15166 (1991)], and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al . , Proc. Natl Acad. Sci. USA, 87:6393-6397 (1990)].
  • the chimeric molecule may comprise a fusion of the UCP4 with an immunoglobulm or a particular region of an immunoglobulm.
  • an immunoglobulm or a particular region of an immunoglobulm.
  • a bivalent form of the chimeric molecule also referred to as an "lmmunoadhesin”
  • a fusion could be to the Fc region of an IgG molecule.
  • the Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of a UCP4 polypeptide m place of at least one variable region within an Ig molecule.
  • the immunoglobulm fusion includes the hinge, CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGl molecule.
  • the immunoglobulm fusion includes the hinge, CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGl molecule.
  • the UCP4 of the invention may also be modified m a way to form a chimeric molecule comprising UCP4 fused to a leucme zipper.
  • leucme zipper polypeptides have been described in the art. See, e.g., Landschulz et al . , Science, 240:1759 (1988); WO 94/10308; Hoppe et al . , FEBS Letters, 344:1991 (1994); Mamatis et al . , Nature, 341:24 (1989).
  • the leucme zipper may be fused at either the 5' or 3 ' end of the UCP4 molecule. D Preparation of UCP4
  • UCP4 sequence or portions thereof, may be produced by direct peptide synthesis using solid-phase techniques [see, e.g., Stewart et al . , Solid-Phase Peptide Synthesis, W.H. Freeman Co., San Francisco, CA (1969); Mer ⁇ field, J Am Chem. Soc. , 85:2149-2154 (1963)] In vitro protein synthesis may be performed using manual techniques or by automation.
  • UCP4 may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length UCP4.
  • DNA encoding UCP4 may be obtained from a cDNA library prepared from tissue believed to possess the UCP4 mRNA and to express it at a detectable level. Accordingly, human UCP4 DNA can be conveniently obtained from a cDNA library prepared from human tissue, such as described in the Examples.
  • the UCP4 -encoding gene may also be obtained from a genomic library or by oligonucleotide synthesis. Libraries can be screened with probes (such as antibodies to the
  • UCP4 or oligonucleotides of at least about 20-80 bases designed to identify the gene of interest or the protein encoded by it. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described in Sambrook et al . , Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) . An alternative means to isolate the gene encoding UCP4 is to use PCR methodology [Sambrook et al , supra , Dieffenbach et al . , PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)] .
  • the oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized.
  • the oligonucleotide is preferably labeled such that t can be detected upon hybridization to DNA the library being screened. Methods of labeling are well known in the art, and include the use of radiolabels like 32 P-labeled ATP, biot ylat on or enzyme labeling. Hybridization conditions, including moderate stringency and high stringency, are provided m Sambrook et al . , supra , and are described above in Section I.
  • Sequences identified m such library screening methods can be compared and aligned to other known sequences deposited and available m public databases such as GenBank or other private sequence databases .
  • Sequence identity (at either the amino acid or nucleotide level) withm defined regions of the molecule or across the full-length sequence can be determined through sequence alignment using publicly available computer software programs (set to default parameters) such as BLAST, BLAST2 , ALIGN, DNAstar, and INHERIT to measure identity or positives for the sequence comparison.
  • Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced ammo acid sequence disclosed herein, and, if necessary, using conventional primer extension procedures as described Sambrook et al . , supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA. 2. Selection and Transformation of Host Cells
  • Host cells are transfected or transformed with expression or cloning vectors described herein for UCP4 production and cultured m conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
  • the culture conditions such as media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation. In general, principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found m Mammalian Cell Biotechnology: a Practical Approach, M. Butler, ed. (IRL Press, 1991) and Sambrook et al., supra .
  • transfection is known to the ordinarily skilled artisan, for example, CaP0 4 and electroporation.
  • transformation is performed using standard techniques appropriate to such cells.
  • the calcium treatment employing calcium chloride, as described Sambrook et al . , supra , or electroporation is generally used for prokaryotes or other cells that contain substantial cell-wall barriers.
  • Infection with Agrobacterium tumefaciens s used for transformation of certain plant cells as described by Shaw et al . , Gene, 23 . : 315 (1983) and WO 89/05859 published 29 June 1989.
  • DNA into cells such as by nuclear micromj ection, electroporation, bacterial protoplast fusion with intact cells, or polycations, e . g. , polybrene, polyornithme, may also be used.
  • polycations e . g. , polybrene, polyornithme.
  • Suitable host cells for cloning or expressing the DNA the vectors herein include prokaryote, yeast, or higher eukaryote cells.
  • Suitable prokaryotes include but are not limited to eubacte ⁇ a, such as Gram-negative or Gram-positive organisms, for example, Enterobacte ⁇ aceae such as E. col .
  • E. coll strains are publicly available, such as E. coll K12 strain MM294 (ATCC 31,446); E. coll X1776 (ATCC 31,537); E. coll strain W3110 (ATCC 27,325) and K5 772 (ATCC 53,635).
  • eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for UCP4-encodmg vectors.
  • Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism.
  • Suitable host cells for the expression of glycosylated UCP4 are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9, as well as plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells.
  • the nucleic acid (e . g. , cDNA or genomic DNA) encoding UCP4 may be inserted into a replicable vector for cloning (amplification of the DNA) or for expression.
  • a replicable vector for cloning (amplification of the DNA) or for expression.
  • the vector may, for example, be in the form of a plasmid, cosmid, viral particle, or phage .
  • the appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures
  • DNA is inserted into an appropriate restriction endonuclease s ⁇ te(s) using techniques known in the art.
  • Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Construction of suitable vectors containing one or more of these components employs standard ligation techniques which are known to the skilled artisan.
  • the UCP4 may be produced recombmantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N- erminus of the mature protein or polypeptide
  • the signal sequence may be a component of the vector, or it may be a part of the UCP4- encodmg DNA that is inserted into the vector.
  • the signal sequence may be a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillmase, lpp , or heat-stable enterotoxm II leaders.
  • yeast secretion the signal sequence may be, e . g.
  • mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders .
  • Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate m one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses
  • the origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2 ⁇ m plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells.
  • Selection genes will typically contain a selection gene, also termed a selectable marker.
  • Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e . g. , ampicillm, neomyc , methotrexate , or tetracyclme , (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e . g. , the gene encoding D-alanme racemase for Bacilli .
  • Suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the
  • UCP4 -encoding nucleic acid such as DHFR or thymidme kmase.
  • An appropriate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77:4216 (1980).
  • a suitable selection gene for use in yeast is the trpl gene present m the yeast plasmid YRp7
  • the trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow m tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85 : 12 (1977) ] .
  • Expression and cloning vectors usually contain a promoter operably linked to the UCP4 -encoding nucleic acid sequence to direct mRNA synthesis. Promoters recognized by a variety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the 3-lactamase and lactose promoter systems [Chang et al . , Nature , 275:615 (1978); Goeddel et al .
  • Suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate k ase [Hitzeman et al . , J. Biol. Chem. , 255:2073 (1980)] or other glycolyt c enzymes [Hess et al., J . Adv . Enzyme Re .
  • yeast promoters which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, lsocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionem, glyceraldehyde-3 -phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described m EP 73,657.
  • UCP4 transcription from vectors mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus , a retrovirus, hepatitis-B virus and Simian Virus 40 (SV40), from heterologous mammalian promoters, e . g. , the actin promoter or an immunoglobulm promoter, and from heat-shock promoters, provided such promoters are compatible w th the host cell systems.
  • viruses such as polyoma virus, fowlpox virus (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus
  • Enhancers are cis-actmg elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription.
  • Many enhancer sequences are now known from mammalian genes (glob , elastase, albumin, ⁇ - fetoprote , and insulin) . Typically, however, one will use an enhancer from a eukaryotic cell virus.
  • Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270) , the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • the enhancer may be spliced into the vector at a position 5' or 3 ' to the UCP4 coding sequence, but is preferably located at a site 5' from the promoter.
  • Expression vectors used in eukaryotic host cells will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs . These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding UCP4.
  • Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA [Thomas, Proc. Natl. Acad. Sc . USA, 27:5201-5205 (1980)], dot blotting (DNA analysis), or m si tu hybridization, using an appropriately labeled probe, based on the sequences provided herein.
  • antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid ⁇ uplexes or DNA-protem duplexes.
  • the antibodies m turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
  • Gene expression may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
  • Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared m any mammal. Conveniently, the antibodies may be prepared against a native sequence UCP4 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to UCP4 DNA and encoding a specific antibody epitope .
  • UCP4 may be recovered from culture medium or from host cell lysates. If membrane-bound, it can be released from the membrane using a suitable detergent solution (e . g. Triton-X 100) or by enzymatic cleavage.
  • a suitable detergent solution e . g. Triton-X 100
  • Cells employed in expression of UCP4 can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents.
  • UCP4 may be desired to purify UCP4 from recombinant cell proteins or polypeptides
  • the following procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column; ethanol precipitation; reverse phase HPLC, cnromatography on silica or on a cation- exchange resin such as DEAE ; chromatofocusmg; SDS-PAGE, ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG; and metal chelatmg columns to bind epitope-tagged forms of the UCP4.
  • UCP4 nucleic acid will also be useful for the preparation of UCP4 polypeptides by the recombinant techniques described herein.
  • the full-length native sequence UCP4 gene (described m Example 1; SEQ ID NO : 2 ) , or fragments thereof, may be used as, among other things, hybridization probes for a cDNA library to isolate the full-length UCP4 gene or to isolate still other genes (for instance, those encoding naturally- occurring variants of UCP4 or UCP4 from other species) which have a desired sequence identity to the UCP4 sequence disclosed m Fig. 1 (SEQ ID NO:l) .
  • the length of the probes will be about 20 to about 80 bases.
  • the hybridization probes may be derived from the nucleotide sequence of SEQ ID NO: 2 or from genomic sequences including promoters, enhancer elements and introns of native sequence UCP4.
  • a screening method w ll comprise isolating the coding region of the UCP4 gene using the known DNA sequence to synthesize a selected probe of about 40 bases.
  • Hybridization probes may be labeled by a variety of labels, including radionucleotides such as P or 3S S, or enzymatic labels such as alkaline phosphatase coupled to the probe via avidm/biotm coupling systems .
  • Labeled probes having a sequence complementary to that of the UCP4 gene of the present invention can be used to screen libraries of human cDNA, genomic DNA or mRNA to determine which members of such libraries the probe hybridizes to. Hybridization techniques are described m further detail in the Examples below.
  • Fragments of UCP4 DNA contemplated by the invention include sequences comprising at least about 20 to 30 consecutive nucleotides of the DNA of SEQ ID NO 2 Preferably, such sequences comprise at least about 50 consecutive nucleotides of the DNA of SEQ ID NO.2.
  • the probes may also be employed m PCR techniques to generate a pool of sequences for identification of closely related UCP4 coding sequences
  • Nucleotide sequences encoding a UCP4 can also be used to construct hybridization probes for mapping the gene which encodes that UCP4 and for the genetic analysis of individuals with genetic disorders.
  • the nucleotide sequences provided herein may be mapped to a chromosome and specific regions of a chromosome using known techniques, such as in si tu hybridization, linkage analysis against known chromosomal markers, and hybridization screening with libraries
  • the UCP4 can be used assays to identify the other proteins or molecules involved the binding interaction. By such methods, inhibitors of the receptor/ligand binding interaction can be identified. Proteins involved m such binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction. Also, the receptor UCP4 can be used to isolate correlative ligand (s) Screening assays can be designed to find lead compounds that mimic the biological activity of a native UCP4 or a receptor for UCP4. Such screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates.
  • Small molecules contemplated include synthetic organic or inorganic compounds.
  • the assays can be performed m a variety of formats, including protem-protem binding assays, biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art
  • transgemc animals e.g., a mouse or rat
  • a transgemc animal is an animal having cells that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g., an embryonic stage.
  • a transgene is a DNA which is integrated into the genome of a cell from which a transgemc animal develops
  • cDNA encoding UCP4 can be used to clone genomic DNA encoding UCP4 in accordance with established techniques and the genomic sequences used to generate transgemc animals that contain cells which express DNA encoding UCP4
  • Methods for generating transgemc animals, particularly animals such as mice or rats, have become conventional in the art and are described, for example, U.S. Patent Nos. 4,736,866 and 4,870,009.
  • particular cells would be targeted for UCP4 transgene incorporation with tissue-specific enhancers.
  • Transgemc animals that include a copy of a transgene encoding UCP4 introduced into the germ line of the animal at an embryonic stage can be used to examine the effect of increased expression of DNA encoding UCP4. Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression or underexpression . In accordance with this facet of the invention, an animal s treated with the reagent and a reduced incidence of the pathological condition, compared to untreated animals bearing the transgene, would indicate a potential therapeutic intervention for the pathological condition.
  • non-human homologues of UCP4 can be used to construct a UCP4 "knock out" animal which has a defective or altered gene encoding UCP4 as a result of homologous recombination between the endogenous gene encoding UCP4 and altered genomic DNA encoding UCP4 introduced into an embryonic cell of the animal.
  • cDNA encoding UCP4 can be used to clone genomic DNA encoding UCP4 m accordance with established techniques. A portion of the genomic DNA encoding UCP4 can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration.
  • flanking DNA typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included the vector [see e.g., Thomas and Capecchi, Cell , . 51:503 (1987) for a description of homologous recombination vectors] .
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombmed with the endogenous DNA are selected [see e.g., Li et al . , Cell, 69:915 (1992)].
  • the selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras [see e.g , Bradley, in Teratocarcinomas and Embryonic Stem Cells : A Practical Approach, E. J. Robertson, ed (IRL, Oxford, 1987), pp. 113-152] .
  • a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal.
  • Progeny harboring the homologously recombmed DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombmed DNA. Knockout animals can be characterized for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the UCP4 polypeptide.
  • Nucleic acid encoding the UCP4 polypeptides may also be used in gene therapy.
  • genes are introduced into cells m order to achieve m vivo synthesis of a tnerapeutically effective genetic product, for example for replacement of a defective gene.
  • Gene therapy includes both conventional gene therapy where a lasting effect is achieved by a single treatment, and the administration of gene therapeutic agents, which involves the one time or repeated administration of a therapeutically effective DNA or mRNA Antisense RNAs and DNAs can be used as therapeutic agents for blocking the expression of certain genes m vivo .
  • oligonucleotides can be imported into cells where they act as inhibitors, despite their low intracellular concentrations caused by their restricted uptake by the cell membrane.
  • the oligonucleotides can be modified to enhance their uptake, e.g. by substituting their negatively charged phosphodiester groups by uncharged groups .
  • nucleic acids there are a variety of techniques available for introducing nucleic acids into viable cells.
  • the techniques vary depending upon whether the nucleic acid is transferred into cultured cells m vitro, or in vivo m the cells of the intended host.
  • Techniques suitable for the transfer of nucleic acid into mammalian cells in vi tro include the use of liposomes, electroporation, micromjection, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, etc.
  • the currently preferred m vivo gene transfer techniques include transfection with viral (typically retroviral) vectors and viral coat prote -liposome mediated transfection (Dzau et al .
  • nucleic acid source with an agent that targets the target cells, such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cell, etc.
  • proteins which bind to a cell surface membrane protein associated with endocytosis may be used for targeting and/or to facilitate uptake, e.g. capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo mternalization m cycling, proteins that target intracellular localization and enhance intracellular half-life.
  • the technique of receptor-mediated endocytosis is described, for example, by Wu et al . , J. Biol. Chem. 262 , 4429-4432 (1987); and Wagner et al . , Proc Natl Acad. Sc . USA 87, 3410- 3414 (1990)
  • Wu et al . J. Biol. Chem. 262 , 4429-4432 (1987
  • Wagner et al . Proc Natl Acad. Sc . USA 87, 3410- 3414 (1990)
  • the UCP4 gene therapy has applications m, for instance, treating metabolic conditions. This can be accomplished, for example, using the techniques described above and by introducing a viral vector containing a UCP4 gene into certain tissues (like muscle or fat) to increase metabolic rate these targeted tissues and thereby elevate energy expenditure .
  • UCP4 Fuel combustion, electron transport, proton pumping and O, consumption (which may be referred to collectively as metabolic rate) are coupled to ATP synthesis.
  • metabolic rate There can be an "inefficiency” m mammals, such that a portion of metabolic rate (m some cases which may be greater than 20%) may be ascribed to H * "leak" back into the matrix space with no ATP synthesis.
  • UCP4 may be involved in catalyzing H + leak, thereby playing a role n energetic inefficiency m vivo . Accordingly, modulating UCP4 activity or quantities (presence) of UCP4 in mammalian tissues (particularly, metabolically important tissues) , may concomitantly modulate H * leak, metabolic rate and heat production.
  • the methods of modulating (either an up-regulat on or down-regulation mode) metabolic rate a mammal has a variety of therapeutic applications, including treatment of obesity and the symptoms associated with stroke, trauma (such as burn trauma), sepsis and infection.
  • the modulation of mitochondrial membrane potential may be used to increase body metabolic rate, thereby enhancing an individual's ability for weight loss.
  • Screening assays may be conducted to identify molecules which can up-regulate expression or activity (such as the uncoupling) of UCP4. The molecules thus identified can then be employed to increase metabolic rate and enhance weight loss.
  • the UCP4 polypeptides are useful in assays for identifying lead compounds for therapeutically active agents that modulate expression or activity of UCP4.
  • Candidate molecules or compounds may be assayed w th the mammals' cells or tissues to determine the effect (s) of the candidate molecule or compound on UCP4 expression or activity.
  • Such screening assays may be amenable to high-throughput screening of chemical libraries, and are particularly suitable for identifying small molecule drug candidates.
  • Small molecules include but are not limited to synthetic organic or inorganic compounds
  • the assays can be performed m a variety of formats, including protem-protem binding assays, biochemical screening assays, immunoassays, cell based assays, etc. Such assay formats are well known the art.
  • a method of conducting a screening assay to identify a molecule which enhances or up- regulates expression of UCP4 comprising the steps of exposing a mammalian cell or tissue sample believed to comprise UCP4 to a candidate molecule and subsequently analyzing expression of UCP4 in said sample.
  • the sample may be further analyzed for mitochondrial membrane potential.
  • the UCP4 is a polypeptide comprising ammo acid residues 1 to 323 of Figure 1 (SEQ ID NO:l).
  • the sample being analyzed may comprise various mammalian cells or tissues, including but not limited to human bram tissue.
  • the candidate molecule employed m the screening assay may be a small molecule comprising a synthetic organic or inorganic compound.
  • the screening assay is conducted to identify a molecule which decreases or down- regulates expression of UCP4.
  • the effect (s) that such candidate molecule may have on the expression and/or activity or UCP4 may be compared to a control or reference sample, such as for instance, expression or activity of UCP4 observed in a like mammal.
  • UCP4 may also be employed m diagnostic methods. For example, the presence or absence of UCP4 , or alternatively over- or under-expression of UCP4 an individual's cells or tissues, can be detected using assays known the art, including those described the Examples below.
  • the invention also provides a method of detecting expression of UCP4 in a mammalian cell or tissue sample, comprising contacting a mammalian cell or tissue sample with a DNA probe and analyzing expression of UCP4 mRNA transcript in said sample.
  • the sample may comprise various mammalian cells or tissues, including but not limited to, human bram tissue
  • the skilled practitioner may use information resulting from such detection assays to assist m predicting metabolic conditions or risk for onset of obesity. If it is determined, for instance, that UCP4 activity m a patient is abnormally high or low, therapy, such as hormone therapy, could be administered to return the UCP4 activity to a physiologically acceptable state.
  • Detection of impaired UCP4 function the mammal may also be used to assist diagnosing impaired neural activity or neural degeneration. It is presently believed UCP4 may be involved m the regulation of bra temperature or metabolic rate that is required for normal bram function (and associated neural activity) It s also presently oelieved that UCP4 may control the generation of reactive oxygen species and therefore contribute to neural degeneration. Molecules identified the screening assays which have been found to suppress UCP4 expression or function may also be employed to treat fever since it is believed that UCP4 is up-regulated during episodes of fever.
  • the present invention further provides ant ⁇ -UCP4 antibodies.
  • exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies.
  • the ant ⁇ -UCP4 antibodies may comprise polyclonal antibodies. Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected m the mammal by multiple subcutaneous or mtrape ⁇ toneal injections.
  • the immunizing agent may include the UCP4 polypeptide or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be lmmunogemc m the mammal being immunized.
  • lmmunogemc proteins examples include but are not limited to keyhole limpet hemocyamn, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor.
  • adjuvants examples include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate) .
  • the immunization protocol may be selected by one skilled m the art without undue experimentation
  • the ant ⁇ -UCP4 antibodies may, alternatively, be monoclonal antibodies.
  • Monoclonal antibodies may be prepared using hyb ⁇ doma methods, such as those described by Kohler and Milste , Nature, 256 : 495 (1975) .
  • a hybridoma method a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
  • the lymphocytes may be immunized m vitro.
  • the immunizing agent will typically include the UCP4 polypeptide or a fusion protein thereof.
  • peripheral blood lymphocytes are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired
  • the lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hyb ⁇ doma cell [Godmg, Monoclonal Antibodies Principles and Practice, Academic Press, (1986) pp. 59-103] .
  • Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed.
  • the hybridoma cells may be cultured m a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
  • a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
  • the parental cells lack the enzyme hypoxanthme guanme phosphoribosyl transferase (HGPRT or HPRT)
  • the culture medium for the hyb ⁇ domas typically will include hypoxanthme, ammopterm, and thymidine ("HAT medium”), which substances prevent the growth of HGPRT- deficient cells.
  • Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are mur e myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection, Manassas, Virginia. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies [Kozbor, J Immunol , 133:3001 (1984); Brodeur et al . , Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63] .
  • the culture medium m which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against UCP4.
  • the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an m vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA) .
  • RIA radioimmunoassay
  • ELISA enzyme-linked immunoabsorbent assay
  • the binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal . Biochem. , 107:220 (1980) .
  • the clones may be subcloned by limiting dilution procedures and grown by standard methods [Godmg, supra] .
  • Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium.
  • the hybridoma cells may be grown m vivo as ascites in a mammal .
  • the monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulm purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography
  • the monoclonal antibodies may also be made by recombinant DNA methods, such as those described m U.S. Patent No. 4,816,567.
  • DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murme antibodies)
  • the hybridoma cells of the invention serve as a preferred source of such DNA.
  • the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulm protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.
  • the DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murme sequences [U.S. Patent No. 4,816,567, Morrison et al . , supra] or by covalently joining to the immunoglobulm coding sequence all or part of the coding sequence for a non-immunoglobulm polypeptide.
  • non-immunoglobulm polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.
  • the antibodies may be monovalent antibodies
  • Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulm light chain and modified heavy chain The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslmkmg. Alternatively, the relevant cysteme residues are substituted with another ammo acid residue or are deleted so as to prevent crosslmkmg.
  • the ant ⁇ -UCP4 antibodies of the invention may further comprise humanized antibodies or human antibodies
  • Humanized forms of non-human (e.g., rsurmej antibodies are chimeric immunoglobulms, immunoglobulm chains or fragments thereof (such as Fv, Fab, Fab 1 , F(ab') 2 or other antigen-b dmg subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulm.
  • Humanized antibodies include human immunoglobulms (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • CDR complementary determining region
  • Fv framework residues of the human immunoglobulm are replaced by corresponding non-human residues.
  • Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor m the imported CDR or framework sequences.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, m which all or substantially all of the CDR regions correspond to those of a non-human immunoglobul and all or substantially all of the FR regions are those of a human immunoglobulm consensus sequence.
  • the humanized antibody optimally also will comprise at least a portion of an immunoglobulm constant region (Fc) , typically that of a human immunoglobulm [Jones et al .
  • a humanized antibody has one or more ammo acid residues introduced into t from a source which is non-human. These non- human ammo acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain Huma zation can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al . , Nature , 332:323-327 (1988); Verhoeyen et al .
  • humanized antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol. , 227:381 (1991); Marks et al . , J. Mol. B ol., 222:581 (1991)].
  • the techniques of Cole et al. and Boerner et al . are also available for the preparation of human monoclonal antibodies (Cole et al . , Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al . , J Immunol . , 147 (1) .86-95 (1991)].
  • human antibodies can be made by introducing of human immunoglobulm loci into transgemc animals, e.g., mice which the endogenous immunoglobulm genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen m humans m all respects, including gene rearrangement, assembly, and antibody repertoire.
  • transgemc animals e.g., mice which the endogenous immunoglobulm genes have been partially or completely inactivated.
  • human antibody production is observed, which closely resembles that seen m humans m all respects, including gene rearrangement, assembly, and antibody repertoire.
  • This approach is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and the following scientific publications: Marks et al . , Bio/Technology 10 , 779-783 (1992); Lonberg et al .
  • Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens.
  • one of the binding specificities is for the UCP4 , the other one s for any other antigen, and preferably for a cell-surface protein or receptor or receptor subumt .
  • bispecific antibodies are known the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulm heavy-chain/light-cha pairs, where the two heavy chains have different specificities [Milstem and Cuello, Nature , 305 : 537-539 (1983)] . Because of the random assortment of immunoglobulm heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed WO 93/08829, published 13 May 1993, and n Traunecker et al . , EMBO J ⁇ , 10:3655-3659 (1991).
  • Antibody variable domains with the desired binding specificities can be fused to immunoglobulm constant domain sequences
  • the fusion preferably is with an immunoglobulm heavy- chain constant domain, comprising at least part of the hinge, CH2 , and CH3 regions. It is preferred to have the first heavy-chain constant region (CHI) containing the site necessary for light-chain binding present at least one of the fusions.
  • CHI first heavy-chain constant region
  • Heteroconjugate antibodies are also within the scope of the present invention Heteroconjugate antibodies are composed of two covalently joined antibodies Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [U.S. Patent No. 4,676,980], and for treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089] . It is contemplated that the antibodies may be prepared m vi tro using known methods in synthetic protein chemistry, including those involving crosslmkmg agents For example, lmmunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond.
  • Suitable reagents for this purpose include immothiolate and methyl-4 -mercaptobutynmidate and those disclosed, for example, m U.S. Patent No. 4,676,980.
  • ant ⁇ -UCP4 antibodies of the invention have various utilities.
  • ant ⁇ -UCP4 antibodies may be used diagnostic assays for UCP4 , e . g. , detecting its expression m specific cells or tissues.
  • diagnostic assay techniques known in the art may be used, such as competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays conducted either heterogeneous or homogeneous phases [Zola, Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc. (1987) pp. 147-158] .
  • the antibodies used m the diagnostic assays can be labeled with a detectable moiety.
  • the detectable moiety should be capable of producing, either directly or indirectly, a detectable signal.
  • the detectable moiety may be a radioisotope , such as H, C, P,
  • a fluorescent or chemilummescent compound such as fluorescem isothiocyanate, rhodamme, or luciferm
  • an enzyme such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase.
  • Any method known m the art for conjugating the antibody to the detectable moiety may be employed, including those methods described by Hunter et al . , Nature , 144 : 945 (1962); David et al . , Biochemistry, 13:1014 (1974); Pain et al . , J. Immunol . Meth , 0:219 (1981), and Nygren, J. H stochem. and Cytochem.
  • Ant ⁇ -UCP4 antibodies also are useful for the affinity purification of UCP4 from recombinant cell culture or natural sources.
  • the antibodies against UCP4 are immobilized on a suitable support, such a Sephadex resin or filter paper, using methods well known m the art.
  • the immobilized antibody then is contacted with a sample containing the UCP4 to be purified, and thereafter the support is washed with a suitable solvent that will remove substantially all the material in the sample except the UCP4 , which is bound to the immobilized antibody. Finally, the support is washed with another suitable solvent that will release the UCP4 from the antibody.
  • GenBank GenBank
  • LIFESEQTM Incyte Pharmaceuticals
  • the search was performed using the computer program BLAST or BLAST2
  • oligonucleotides were synthesized to isolate a clone of the full-length coding sequences for UCP4 by PCR.
  • Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length.
  • the probe sequences are typically 40-55 bp in length.
  • additional oligonucleotides are synthesized when the consensus sequence is greater than about l-1.5kbp.
  • PCR primers (forward and reverse) were synthesized: forward PCR primer CGCGGATCCCGTTATCGTCTTGCGCTACTGC (U401) (SEQ ID NO: 3) reverse PCR primer GCGGAATTCTTAAAATGGACTGACTCCACTCATC (U406) (SEQ ID NO: 4)
  • RNA for construction of the cDNA libraries was isolated from bram tissue.
  • the cDNA libraries used to isolated the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA.
  • the cDNA was primed with oligo dT containing a Notl s te, linked with blunt to Sail hemikmased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned m a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see. Holmes et al . , Science, 253 :1278-1280 (1991)) in the unique Xhol and Notl sites .
  • DNA sequencing of the clone isolated by PCR as described above gave the full-length DNA sequence for UCP4 (designated herein as DNA 77568- 1626 [ Figure 2, SEQ ID NO : 2] and the derived protein sequence for UCP4.
  • UCP4 The entire coding sequence of UCP4 is shown in Figure 2 (SEQ ID NO:2).
  • Clone DNA 77568-1626 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 40-42, and an apparent stop codon at nucleotide positions 1009-1011. (See Figure 2; SEQ ID NO: 2) .
  • the predicted polypeptide precursor is 323 ammo acids long. It is presently believed that UCP4 is a membrane-bound protein and contains at least 6 transmembrane regions. These putative transmembrane regions the UCP4 ammo acid sequence are illustrated in Figure 3.
  • Clone DNA 77568 contained m the pcDNA3 vector (Invitrogen) has been deposited with ATCC and is assigned ATCC deposit no. 203134.
  • UCP4 polypeptide is obtained or obtainable by expressing the molecule encoded by the cDNA insert of the deposited ATCC 203134 vector. Digestion of the deposited ATCC 203134 vector w th BamHI and EcoRI restriction enzymes will yield an approximate 972 plus 34 bp insert
  • the full-length UCP4 protein shown Figure 1 has an estimated molecular weight of about 36,061 daltons and a pi of about 9.28.
  • An alignment of the ammo acid sequence of UCP4 with UCPs 1, 2 and 3 is illustrated Figure 3.
  • UCP1 has enhanced uncoupling activity.
  • UCP4 has a Tyr residue at this position.
  • the following method describes use of a nucleotide sequence encoding UCP4 as a hybridization probe.
  • DNA comprising the coding sequence of full-length or mature UCP4 (as shown n Figure 2, SEQ ID NO : 2 ) is employed as a probe to screen for homologous DNAs (such as those encoding naturally-occurring variants of
  • DNAs is performed under the following high stringency conditions. Hybridization of radiolabeled UCP4 -derived probe to the filters is performed a solution of 50% formamide, 5x SSC, 0.1% SDS , 0.1% sodium pyrophosphate ,
  • This example illustrates preparation of UCP4 by recombinant expression E. coll .
  • the DNA sequence encoding UCP4 (SEQ ID NO : 2 ) is initially amplified using selected PCR primers.
  • the primers should contain restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector.
  • a variety of expression vectors may be employed.
  • An example of a suitable vector is pBR322 (derived from E. coll ; see Bolivar et al . , Gene, 2:95 (1977)) which contains genes for ampicillm and tetracyclme resistance.
  • the vector is digested with restriction enzyme and dephosphorylated.
  • the PCR amplified sequences are then ligated into the vector.
  • the vector will optionally include sequences which encode for an antibiotic resistance gene, a trp promoter, a polyhis leader (including the first six STII codons, polyhis sequence, and enterokmase cleavage site), the UCP4 coding region, lambda transcript onal terminator, and an argU gene.
  • the ligation mixture is then used to transform a selected E. coli strain using the methods described m Sambrook et al , supra . Transformants are identified by their ability to grow on LB plates and antibiotic resistant colonies are then selected. Plasmid DNA can be isolated and confirmed by restriction analysis and DNA sequencing.
  • Selected clones can be grown overnight m liquid culture medium such as LB broth supplemented with antibiotics.
  • the overnight culture may subsequently be used to inoculate a larger scale culture.
  • the cells are then grown to a desired optical density, during which the expression promoter is turned on
  • the cells can be harvested by centrifugation. If no signal sequence is present, and the expressed UCP4 is intracellular, the cell pellet obtained by the centrifugation can be solubilized using various agents known n the art, and the solubilized UCP4 protein can then be purified using a metal chelatmg column under conditions that allow tight binding of the protein. If a signal sequence is present, the expressed UCP4 can be obtained from the cell's pe ⁇ plasm or culture medium Extraction and/or solubilization of the UCP4 polypeptides can be performed using agents and techniques known m the art. (See e.g. U.S. Patents 5,663,304; 5,407,810) EXAMPLE 5
  • This example illustrates preparation of UCP4 by recombinant expression m mammalian cells.
  • the vector, pRK5 (see EP 307,247, published March 15, 1989), is employed as the expression vector.
  • the UCP4 DNA is ligated into pRK5 with selected restriction enzymes to allow insertion of the UCP4 DNA using ligation methods such as described Sambrook et al . , supra .
  • the resulting vector s called pRK5-UCP4.
  • the selected host cells may be 293 cells.
  • Human 293 cells (ATCC CRL 1573) are grown to confluence in tissue culture plates m medium such as DMEM supplemented with fetal calf serum and optionally, nutrient components and/or antibiotics
  • m medium such as DMEM supplemented with fetal calf serum and optionally, nutrient components and/or antibiotics
  • the culture medium is removed and replaced with culture medium (alone) or culture medium containing 200 ⁇ Ci/ml j5 S-cysteme and 200 ⁇ Ci/ml 3j S-meth ⁇ onme .
  • culture medium alone
  • culture medium containing 200 ⁇ Ci/ml j5 S-cysteme and 200 ⁇ Ci/ml 3j S-meth ⁇ onme After a 12 hour incubation, the conditioned medium is collected, concentrated on a spin filter, and loaded onto a 15% SDS gel. The processed gel may be dried and exposed to film for a selected period of time to reveal the presence of UCP4 polypeptide.
  • the cultures containing transfected cells may undergo further incubation ( serum free medium) and the medium is tested m selected bioassays .
  • UCP4 may be introduced into 293 cells transiently using the dextran sulfate method described by Somparyrac et al., Proc. Natl Acad. Sci., 12:7575 (1981). 293 cells are grown to maximal density m a spinner flask and 700 ⁇ g pRK5-UCP4 DNA is added The cells are first concentrated from the spinner flask by centrifugation and washed with PBS.
  • the DNA-dextran precipitate is incubated on the cell pellet for four hours
  • the cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and re-mtroduced into the spinner flask containing tissue culture medium, 5 ⁇ g/ml bovine insulin and 0.1 ⁇ g/ml bovine transfer ⁇ n
  • the conditioned media is cent ⁇ fuged and filtered to remove cells and debris.
  • the sample containing expressed UCP4 can then be concentrated and purified by any selected method, such as dialysis and/or column chromatography.
  • UCP4 can be expressed CHO cells
  • the pRK5-UCP4 can be transfected into CHO cells using known reagents such as CaP0 4 or DEAE-dextran As described above, the cell cultures can be incubated, and the medium replaced with culture medium (alone) or medium containing a radiolabel such as S-methionme. After determining the presence of UCP4 polypeptide, the culture medium may be replaced with serum free medium. Preferably, the cultures are incubated for about 6 days, and then the conditioned medium is harvested The medium containing the expressed UCP4 can then be concentrated and purified by any selected method. Epitope-tagged UCP4 may also be expressed host CHO cells.
  • the UCP4 may be subcloned out of the pRK5 vector.
  • the subclone insert can undergo PCR to fuse m frame with a selected epitope tag such as a poly-his tag into a Baculovirus expression vector
  • the poly-his tagged UCP4 insert can then be subcloned into a SV40 driven vector containing a selection marker such as DHFR for selection of stable clones.
  • the CHO cells can be transfected (as described above) with the SV40 driven vector. Labeling may be performed, as described above, to verify expression.
  • the culture medium containing the expressed poly-His tagged UCP4 can then be concentrated and purified by any selected method, such as by affinity chromatography
  • the UCP4 may be expressed mtracellularly (where no signal sequence is employed) This intracellular expression, and subsequent extraction or solubilization and purification may be performed using techniques and reagents known in the art.
  • yeast expression vectors are constructed for intracellular production or secretion of UCP4 from the ADH2/GAPDH promoter
  • DNA encoding UCP4 and the promoter is inserted into suitable restriction enzyme sites the selected plasmid to direct intracellular expression of UCP4.
  • DNA encoding UCP4 can be cloned into the selected plasmid, together with DNA encoding the ADH2/GAPDH promoter, a native UCP4 signal peptide or other mammalian signal peptide, or, for example, a yeast alpha-factor or mvertase secretory signal/leader sequence, and linker sequences (if needed) for expression of UCP4.
  • the native signal sequence of UCP4 is employed.
  • Yeast cells such as S. cerevisiae yeast strain AB110, can then be transformed with the expression plasmids described above and cultured m selected fermentation media as set forth, for instance, in U.S. Patent Nos. 4,775,662 and 5,010,00.
  • the transformed yeast supernatants can be analyzed by precipitation with 10% t ⁇ chloroacetic acid and separation by SDS-PAGE, followed by stammg of the gels with Coomassie Blue stain.
  • Recombinant UCP4 can subsequently be isolated and purified by removing the yeast cells from the fermentation medium by centrifugation and then concentrating the medium using selected cartridge filters.
  • the concentrate containing UCP4 may further be purified using selected column chromatography resins.
  • the UCP4 may be expressed mtracellularly (where no signal sequence is employed) .
  • the intracellular expression, and subsequent extraction or solubilization and purification may be performed using techniques and reagents known n the art.
  • the following method describes recombinant expression of UCP4 m Baculovirus-infected insect cells.
  • the sequence coding for UCP4 is fused upstream of an epitope tag contained within an expression vector.
  • epitope tags include poly-his tags and immunoglobulm tags (like Fc regions of IgG) .
  • a variety of plasmids may be employed, including plasmids derived from commercially available plasmids such as pVL1393 (Novagen) .
  • the sequence encoding UCP4 or the desired portion of the coding sequence of UCP4 is amplified by PCR with primers complementary to the 5' and 3' regions.
  • the 5' primer may incorporate flanking (selected) restriction enzyme sites.
  • the product is then digested with those selected restriction enzymes and subcloned into the expression vector.
  • the vector may contain the native signal sequence for UCP4 if secretion is desired.
  • baculovirus s generated by co-transfect g the above plasmid and BaculoGold ' " ' ' virus DNA (Pharm gen) into Spodoptera frugiperda (“Sf9”) cells (ATCC CRL 1711) using lipofectm (commercially available from GIBCO-BRL) After 4 - 5 days of incubation at 28°C, the released viruses are harvested and used for further amplifications. Viral infection and protein expression are performed as described by O'Reilley et al . , Baculovirus expression vectors: A Laboratory Manual, Oxford: Oxford University Press (1994)
  • Expressed poly-his tagged UCP4 can then be purified, for example, by Ni + -chelate affinity chromatography as follows. Extracts are prepared from recombinant virus-mfected Sf9 cells as described by Rupert et al., Nature , 362 : 175-179 (1993). Briefly, Sf9 cells are washed, resuspended in so cation buffer (25 mL Hepes, pH 7.9; 12.5 mM MgCl 2 ; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0 4 M KC1), and sonicated twice for 20 seconds on ice.
  • so cation buffer 25 mL Hepes, pH 7.9; 12.5 mM MgCl 2 ; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0 4 M KC1
  • the sonicates are cleared by centrifugation, and the supernatant is diluted
  • 50-fold loading buffer 50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 8.
  • a Ni + -NTA agarose column (commercially available from Qiagen) is prepared with a bed volume of 5 mL, washed with 25 mL of water and equilibrated with 25 mL of loading buffer. The filtered cell extract is loaded onto the column at 0.5 mL per minute. The column is washed to baseline A 280 with loading buffer, at which point fraction collection is started. Next, the column is washed with a secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol, pH 6.0), which elutes nonspecifically bound protein.
  • a secondary wash buffer 50 mM phosphate; 300 mM NaCl, 10% glycerol, pH 6.0
  • the column is developed with a 0 to 500 mM Imidazole gradient in the secondary wash buffer.
  • One mL fractions are collected and analyzed by SDS- PAGE and silver staining or Western blot with Ni + -NTA-conjugated to alkaline phosphatase (Qiagen) .
  • Fractions containing the eluted H ⁇ s 10 -tagged UCP4 are pooled and dialyzed against loading buffer.
  • purification of the IgG tagged (or Fc tagged) UCP4 can be performed using known chromatography techniques, including for instance, Protein A or protein G column chromatography.
  • the expression constructs for cDNA encoding UCP4 with or without a NH 2 -termmal Flag-tag were prepared according to Example 1.
  • Expression constructs for cDNA encoding UCP3 were prepared by first obtaining cDNA encoding human UCP3 from a melanoma cDNA library by PCR.
  • PCR primers (forward and reverse) were synthesized: forward PCR primer GCGAAGCTTGCCATGGTTGGACTGAAGCCTTCAGA (U301) (SEQ ID NO: 7) reverse PCR primer CGCGAATTCTCAAAACGGTGATTCCCGTAACAT (U302) (SEQ ID NO: 8)
  • the expression construct for cDNA encoding UCP3 with a NH 2 - termmal Flag-tag was prepared by the following PCR primers.
  • UCP3 with or without the NH 2 -termmal Flag-tag were cloned into pcDNA3 (pcDNA3UCP3 and pcDNA3Flag-UCP3 ) between Hindlll and EcoRI sites and confirmed by DNA sequencing.
  • Flag-tagged UCP3 and UCP4 expressed in 293 cells were detected by Western blot analysis using anti-Flag M2 monoclonal antibody (Kodak) and ECL detection kit (Pierce) .
  • Mitochondrial membrane potential was analyzed according to methods known the art. [Salviol et al . , FEBS Lett. , 411: 77-82 (1997); Smiley et al . , Proc. Natl. Acad. Sci. USA, 88: 3671-3675 (1991)] . About 24- 36 hours post-transfection, cells were trypsinized, and 1.5 x 10 6 were pelleted by centrifugation.
  • JC-1 carbonylcyanide m-chlorophenylhydrazone ; Sigma
  • CCCP carbonylcyanide m-chlorophenylhydrazone
  • JC-1 is a membrane potential sensitive, fluorescent dye.
  • JC-1 was first prepared as a stock solution in dimethyl sulfoxide (DMSO; Sigma) at a concentration of 5 mg/ml.
  • DMSO dimethyl sulfoxide
  • the stock solution was diluted to lmg/ml with DMSO, and then further diluted to lO ⁇ g/ml with culture medium prewarmed to 37°C and filtered through both .45um and .2um filters to exclude aggregated JC-1.
  • the stained cells were washed and resuspended 1.0ml culture medium
  • the cells resuspended in culture medium were examined by spectrofluorometry (RF5000U Spectrofluorophotometer; SHIMADZU, Japan) .
  • a subset of cells was analyzed by flow cytometry (Coulter EPICS Elite ESP, Hialeah, FL) .
  • excitation was at 488 nm and emission measured at 525 nm and 590 nm.
  • Flow cytometry analysis was performed with an argon laser of single 488 nm as excitation, a filter transmitting 525 ⁇ 20 nm in FL1 channel, and a filter transmitting above 590 nm m FL2 channel. A minimum of 10,000 cells per sample was analyzed.
  • Immunogens that may be employee include purified UCP4 , fusion proteins containing UCP4 , and cells expressing recombinant UCP4 on the cell surface. Selection of the immunogen can be made by the sk_lled artisan without undue experimentation.
  • mice such as Balb/c are immunized with the UCP4 immunogen emulsified in complete Freund ' s adjuvant and injected subcutaneously or mtrape ⁇ toneally in an amount from 1-100 micrograms.
  • the immunogen is emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) and injected into the animal's h nd foot pads.
  • MPL-TDM adjuvant Ribi Immunochemical Research, Hamilton, MT
  • the immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant. Thereafter, for several weeks, the mice may also be boosted with additional immunization injections. Serum samples may be periodically obtained from the mice by retro-orbital bleeding for testing in ELISA assays to detect ant ⁇ -UCP4 antibodies.
  • the animals "positive" for antibodies can be injected with a final intravenous injection of UCP4.
  • the mice Three to four days later, the mice are sacrificed and the spleen cells are harvested.
  • the spleen cells are then fused (using 35% polyethylene glycol) to a selected murme myeloma cell line such as P3X63AgU.l, available from ATCC, No. CRL 1597.
  • the fusions generate hybridoma cells which can then be plated 96 well tissue culture plates containing HAT (hypoxanthme, ammopterm, and thymidme) medium to inhibit proliferation of non-fused cells, myeloma hybrids, and spleen cell hybrids.
  • HAT hyperxanthme, ammopterm, and thymidme
  • hybridoma cells will be screened in an ELISA for reactivity against UCP4. Determination cf "positive" hybridoma cells secreting the desired monoclonal antibodies against UCP4 is within the skill in the art.
  • the positive hybridoma cells can be injected traperitoneally into syngeneic Balb/c mice to produce ascites containing the ant ⁇ -UCP4 monoclonal antibodies
  • the hybridoma cells can be grown in tissue culture flasks or roller bottles. Purification of the monoclonal antibodies produced m the ascites can be accomplished using ammonium sulfate precipitation, followed by gel exclusion chromatography. Alternatively, affinity chromatography based upon binding of antibody to protein A or protein G can be employed.
  • human breast carcinoma MCF7 cells (ATCC HTB 22) were transfected with either pcDNA3Flag- UCP3 (prepared according to Example 8) or pcDNA3Flag-UCP4 (prepared according to Example 1) using FuGene transfection reagent (Boehrmger Mannheim)
  • the transfected cells were fixed in 3% formaldehyde at room temperature for 15 minutes and permeabilized with 1% Tr ⁇ tonX-100 for 15 minutes.
  • the cells were incubated with anti-Flag monoclonal antibody (lO ⁇ g/ml, Kodak) and anti-cytochrome C oxidase antibody (a mitochondrial marker) (3ng/ml) for 20 minutes. The cells were then washed and incubated with Cy3 " -conjugated (donkey anti-mouse, Jackson Laboratories) and FITC- con ugated (donkey anti-rabbit, Jackson Laboratories) secondary antibodies. The cells were then examined by fluorescence microscopy. Figures 6A-6F show that UCP3 and UCP4 were co-localized with the mitochondrial marker.
  • UCP4 has uncoupling activity m situ important to metabolism
  • the amount of UCP4 mRNA produced m a tissue may vary with stresses to metabolism such as fasting, fat consumption, and exposure to temperatures below room temperature .
  • mice this study were fed normal rodent chow (Purina Rodent Chow 5010; Purina, St Louis, MO) and water ad libi tum unless indicated otherwise
  • rodent chow Purina, St Louis, MO
  • water ad libi tum water ad libi tum unless indicated otherwise
  • the type of mouse studied varied depending on the condition used to challenge the metabolism of the mouse studied and will be described below.
  • mice studied were exposed to light 12 hours a day from 6:00 a.m. until 6-00 p.m. at which time they were exposed to dark for the following 12 hours.
  • the mice were sacrificed under C0 2 just prior to tissue harvest, which occurred in the morning between 8 00 and 12-00 a.m. unless specified otherwise.
  • RNA samples were harvested and total tissue RNA was prepared using reagents and protocols from Biotecx Lab, Houston, TX Although a number of tissues were collected from each mouse, the study focused on measuring the abundance of UCP4 mRNA in the bram (because the bra has high UCP4 gene expression) At least 5 mice/treatment were used the studies Quantitative reverse-transc ⁇ ptase polymerase chain reaction (RT-PCR) was used to determine the amount of UCP4 mRNA in the harvested tissues. RT-PCR was performed using mRNA samples. [Held et al . , Genome Research, 6:986- 994 (1996); Gibson et al . , Genome Research, 6:995-1001 (1996)] .
  • UCP4 forward primer: 5'AAT GCC TAT CGC CGA GGA G3 ' (SEQ ID NO:10); reverse primer: 5 ' GTA GGA ACT TGC TCG TCC GG3 ' (SEQ ID NO: 11); probe: 5' (FAM)TGC TCG CGC TCA CGC AGA GAT G (SEQ ID NO: 12) (TAMARA) 3' .
  • mice In a first study, seven-week old male mice (C57BL/6J; Bar Harbor, ME) were studied to evaluate the effect of fasting and eatmg meals on UCP4 mRNA production m the mice studied. The mice were obtained at six weeks of age and at seven weeks were randomly assigned to one of three groups: control mice fed ad lib, mice fasted for 24 hours, and mice fasted for 24 hours and then fed ad lib for 24 hours.
  • mice were sacrificed as described above after ad l b feeding for the first group, after 24 hours of fasting for the second group, and after the 48 hours of first fasting and then ad lib feeding for the third group.
  • the tissues were harvested as described above.
  • Figures 8A to 8C represent means +/- SEM.
  • Figure 8A illustrates the UCP4 mRNA abundance in the bram tissue from mice that were fed ad l b for 24 hours.
  • Figure 8B illustrates the UCP4 mRNA abundance in the bram tissue from mice that fasted.
  • Figure 8C illustrates the UCP4 mRNA abundance in the bram tissue from mice that fasted for 24 hours and then were fed ad lib for 24 hours.
  • mice In a second study, four-week old male mice (A/J or C57BL/6J; Jackson Labs, Bar Harbor, ME) were studied to evaluate the effect of high and low fat diets on UCP4 mRNA production the mice studied.
  • A/J mice have been shown to be "obesity-resistant" on a high fat diet compared to "obesity- prone" C57BL6/J ( see Surwit et al . , supra) . This may be due to a lower metabolic efficiency m the A/J strain—i.e., they apparently put on fewer calories per calories ingested.
  • mice were obtained at four weeks of age and immediately placed on either a low fat diet or high fat diet (Research Diets, Inc., New Brunswick, New Jersey) patterned after those formulated by Surwit et al , Metabolism, 44(5): 645-651 (1995), containing 11% or 58% fat (% calories), respectively. Animals were fed ad lib for approximately three weeks (days 22-23 on diet)
  • Figure 9A illustrates the UCP4 mRNA abundance m bra tissue from A/J mice that were fed a low fat diet
  • Figure 9B illustrates the UCP4 mRNA abundance m bram tissue from A/J mice that were fed a high fat diet
  • Figure 9C illustrates the UCP4 mRNA abundance in bram tissue from C57BL6/J mice that were fed a low fat diet
  • Figure 9D illustrates the UCP4 mRNA abundance m bram tissue from C57BL6/J mice that were fed a high fat diet.
  • mice Male mice (FVB-N, Tacomc, Germantown, New York) were studied to evaluate the effect of exposing the mice to temperature stresses. Typically, cold exposure rodents elicits an increase in metabolic rate. This metabolic increase may be to support a stable body temperature. Yet warm-acclimation, which is defined as chronic exposure to temperatures within the murme thermoneutral zone (approx. 30-35°C) , lowers metabolic rate. [Klaus et al . , Am. J. Physiol., 274 :R287-R293 (1998)].
  • mice in this study were housed two per cage and were randomly assigned to the following groups: a control group (housed at 22°C for 3 weeks) , a warm-acclimated group (housed at 33°C for 3 weeks) , a food- restricted group (housed at 22°C for 3 weeks but given access each day to the average amount of food eaten by warm-acclimated mice the day before) , a cold-challenged group (housed at 22°C for 3 weeks prior to the initiation of exposure to 4°C) .
  • a control group housed at 22°C for 3 weeks
  • a warm-acclimated group housed at 33°C for 3 weeks
  • a food- restricted group housed at 22°C for 3 weeks but given access each day to the average amount of food eaten by warm-acclimated mice the day before
  • a cold-challenged group housed at 22°C for 3 weeks prior to the initiation of exposure to 4°C
  • mice were sacrificed and tissues were harvested at six week of age as described above. Quantitative RT-PCR was performed for the bram tissue according to the methods described above and the amount of UCP4 mRNA produced m the bram was quantified. Statistical differences across the groups were determined using a protected Fisher's least significant difference analysis (L. Ott, An Introduction to Statistical Methods and Data Analysis, 3rd Ed., Boston PWS-Kent Publishing Co., 1988). The data presented in Figures 10A to 10G represent +/- SEM. An asterisk indicates a statistical difference of at least p ⁇ 0.05.
  • Figure 10A illustrates the UCP4 mRNA abundance in the control group of mice.
  • Figures 10B to 10E illustrate the UCP4 mRNA abundance m the group of mice that were cold-challenged for 1, 6, 24, and 48 hours, respectively.
  • Figure 10F illustrates the UCP4 mRNA abundance m the food-restricted group of mice
  • Figure 10G illustrates the UCP4 mRNA abundance in the warm- acclimated group of mice.
  • Figures 10B through 10E all indicate an increase in UCP4 mRNA expression in the cold-challenged mice compared to the control group shown m Figure 10A.
  • Figures 10F and 10G do not show a similar increase in UCP4 mRNA expression for the food-restricted mice and the warm-acclimated mice, respectively, compared to the control group shown n Figure 10A.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Diabetes (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Child & Adolescent Psychology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/US1999/021194 1997-10-29 1999-09-15 Ucp4 Ceased WO2000017353A1 (en)

Priority Applications (72)

Application Number Priority Date Filing Date Title
JP2000574252A JP4709383B2 (ja) 1998-09-22 1999-09-15 Ucp4
DE69937644T DE69937644T2 (de) 1998-09-22 1999-09-15 Ucp4
DK99969439T DK1115863T3 (da) 1998-09-22 1999-09-15 Ucp4
AU60413/99A AU6041399A (en) 1998-09-22 1999-09-15 Ucp4
EP99969439A EP1115863B1 (en) 1998-09-22 1999-09-15 Ucp4
CA2344467A CA2344467C (en) 1998-09-22 1999-09-15 Ucp4
US09/946,374 US20030073129A1 (en) 1998-09-01 2001-09-04 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/006,867 US7160985B2 (en) 1997-10-29 2001-12-06 Pro180 polypeptide
US10/006,856 US7538086B2 (en) 1998-09-01 2001-12-06 PRO1303 polypeptides
US10/006,768 US6936697B2 (en) 1998-09-01 2001-12-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/007,236 US7034123B2 (en) 1998-09-01 2001-12-06 Anti-PRO1347 antibodies
US10/006,041 US6951921B2 (en) 1998-09-01 2001-12-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/006,130 US7098312B2 (en) 1998-09-01 2001-12-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/006,485 US7026448B2 (en) 1998-09-01 2001-12-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/006,746 US7026449B2 (en) 1999-01-05 2001-12-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/006,818 US20030054406A1 (en) 1998-09-01 2001-12-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/006,063 US20030114652A1 (en) 1998-09-01 2001-12-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/006,116 US20030082626A1 (en) 1998-09-01 2001-12-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/007,194 US7041805B2 (en) 1998-09-01 2001-12-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/006,117 US7071304B2 (en) 1998-09-01 2001-12-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/006,172 US7081514B2 (en) 1998-09-01 2001-12-06 PRO1347 polypeptides
US10/012,064 US6953841B2 (en) 1999-01-05 2001-12-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/012,754 US7375184B2 (en) 1998-09-01 2001-12-07 PRO1382 polypeptides
US10/012,752 US7026455B2 (en) 1998-09-01 2001-12-07 Anti-pro 1343 antibodies
US10/012,231 US6924355B2 (en) 1998-09-01 2001-12-07 PRO1343 polypeptides
US10/011,671 US20030096954A1 (en) 1998-09-01 2001-12-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/012,149 US7038019B2 (en) 1998-09-01 2001-12-07 Antibodies to PRO1410
US10/012,237 US20030191281A1 (en) 1998-09-01 2001-12-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/011,692 US20030109672A1 (en) 1998-09-01 2001-12-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/012,753 US7488796B2 (en) 1998-09-01 2001-12-07 PRO1269 polypeptides
US10/011,833 US6951920B2 (en) 1998-09-01 2001-12-07 PRO1340 polypeptides
US10/012,121 US7022817B2 (en) 1998-09-01 2001-12-07 PRO1325 polypeptides
US10/012,754 US20030187191A1 (en) 1998-09-01 2001-12-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/012,101 US20030187239A1 (en) 1998-09-01 2001-12-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/012,137 US20030187189A1 (en) 1998-09-01 2001-12-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/011,795 US7012131B2 (en) 1998-09-01 2001-12-07 Pro1410 polypeptides
US10/012,755 US20030096955A1 (en) 1998-09-01 2001-12-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,822 US20030130491A1 (en) 1998-09-01 2001-12-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,910 US7057018B2 (en) 1999-01-05 2001-12-10 Pro 1474 polypeptides
US10/013,911 US20030187193A1 (en) 1998-09-01 2001-12-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,913 US20030083462A1 (en) 1999-01-05 2001-12-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,907 US20030064925A1 (en) 1998-09-01 2001-12-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,430 US20030092883A1 (en) 1998-09-01 2001-12-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,906 US20030191282A1 (en) 1998-09-01 2001-12-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,915 US20030204053A1 (en) 1998-09-01 2001-12-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,909 US20030186318A1 (en) 1999-01-05 2001-12-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,519 US7033785B2 (en) 1998-09-01 2001-12-11 PRO1347 nucleic acids
US10/015,653 US20030187195A1 (en) 1998-09-01 2001-12-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,499 US20030065142A1 (en) 1998-09-01 2001-12-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,389 US6936436B2 (en) 1998-09-01 2001-12-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,869 US20030073130A1 (en) 1998-09-01 2001-12-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,671 US6946263B2 (en) 1998-09-01 2001-12-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,480 US7074912B2 (en) 1998-09-01 2001-12-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,393 US6951737B2 (en) 1998-09-01 2001-12-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,869 US7189530B2 (en) 1998-09-01 2001-12-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,715 US7033786B2 (en) 1998-09-01 2001-12-12 Pro1340 nucleic acids
US10/015,385 US20030195347A1 (en) 1998-09-01 2001-12-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,388 US20030191299A1 (en) 1998-09-01 2001-12-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,386 US7022498B2 (en) 1998-09-01 2001-12-12 Pro 1325 nucleic acids
US10/015,390 US20030216562A1 (en) 1998-09-01 2001-12-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,387 US20030135034A1 (en) 1998-09-01 2001-12-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/015,391 US20030120053A1 (en) 1998-09-01 2001-12-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,867 US20030180792A1 (en) 1998-09-01 2001-12-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,527 US20030082628A1 (en) 1998-09-01 2001-12-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/020,063 US20030119097A1 (en) 1999-01-05 2001-12-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,306 US20030170718A1 (en) 1998-09-01 2001-12-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,610 US20030113795A1 (en) 1998-09-01 2001-12-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,407 US20030125535A1 (en) 1998-09-01 2001-12-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/063,651 US7193057B2 (en) 1997-10-29 2002-05-07 Antibodies to a polypeptide encoded by a nucleic acid underexpressed in rectal tumor
US10/972,317 US7208321B2 (en) 1998-06-02 2004-10-22 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US11/025,607 US20050181478A1 (en) 1998-09-01 2004-12-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US11/796,725 US20090197301A1 (en) 1998-09-01 2007-04-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US10127998P 1998-09-22 1998-09-22
US60/101,279 1998-09-22
US11422398P 1998-12-30 1998-12-30
US60/114,223 1998-12-30
US12967499P 1999-04-16 1999-04-16
US60/129,674 1999-04-16

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
PCT/US1999/020111 Continuation-In-Part WO2000012708A2 (en) 1997-03-31 1999-09-01 Further pro polypeptides and sequences thereof
US39734299A Continuation 1997-10-29 1999-09-15

Related Child Applications (4)

Application Number Title Priority Date Filing Date
PCT/US1999/020111 Continuation-In-Part WO2000012708A2 (en) 1997-03-31 1999-09-01 Further pro polypeptides and sequences thereof
PCT/US1999/021090 Continuation WO2000015796A2 (en) 1994-09-08 1999-09-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US40329799A Continuation-In-Part 1997-08-26 1999-10-18
PCT/US1999/028313 Continuation-In-Part WO2000032221A2 (en) 1994-09-08 1999-11-30 Promotion or inhibition of angiogenesis and cardiovascularization

Publications (1)

Publication Number Publication Date
WO2000017353A1 true WO2000017353A1 (en) 2000-03-30

Family

ID=27379161

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/021194 Ceased WO2000017353A1 (en) 1997-10-29 1999-09-15 Ucp4

Country Status (10)

Country Link
US (3) US8067229B2 (https=)
EP (1) EP1115863B1 (https=)
JP (1) JP4709383B2 (https=)
AU (1) AU6041399A (https=)
CA (1) CA2344467C (https=)
DE (1) DE69937644T2 (https=)
DK (1) DK1115863T3 (https=)
ES (1) ES2297947T3 (https=)
PT (1) PT1115863E (https=)
WO (1) WO2000017353A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002036829A3 (en) * 2000-11-01 2003-03-13 Agy Therapeutics Inc Methods of diagnosing, preventing and treating neurological disorders and neuronal injuries

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998031396A1 (en) * 1997-01-15 1998-07-23 Duke University Respiration uncoupling protein

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4775662A (en) 1983-03-07 1988-10-04 Smithkline Beckman Corporation Leukotriene antagonists
US5010010A (en) 1986-10-22 1991-04-23 Selmer-Sande, A.S. Production of human parathyroid hormone from microorganisms
IL87737A (en) 1987-09-11 1993-08-18 Genentech Inc Method for culturing polypeptide factor dependent vertebrate recombinant cells
US5663304A (en) 1993-08-20 1997-09-02 Genentech, Inc. Refolding of misfolded insulin-like growth factor-I
US5407810A (en) 1993-08-20 1995-04-18 Genentech, Inc. Aqueous multiple-phase isolation of polypeptide
CA2219361C (en) * 1995-04-27 2012-02-28 Abgenix, Inc. Human antibodies derived from immunized xenomice
US7001742B1 (en) * 1997-05-20 2006-02-21 Merck & Co., Inc. Human uncoupling protein 3
JP2002502240A (ja) 1997-05-20 2002-01-22 メルク エンド カンパニー インコーポレーテッド ヒト脱共役タンパク質3
NZ531664A (en) * 1998-09-01 2005-07-29 Genentech Inc Pro1317 polypeptides and sequences thereof with homology to the semaphorin B glycoprotein family
US7488796B2 (en) 1998-09-01 2009-02-10 Genentech, Inc. PRO1269 polypeptides

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998031396A1 (en) * 1997-01-15 1998-07-23 Duke University Respiration uncoupling protein

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GONG ET AL.: "Uncoupling Protein-3 Is a Mediator of Thermogenesis Regulated by Thyroid Hormone, Beta3-Adrenergic Agonists, and Leptin.", J. BIOL. CHEM., vol. 272, no. 39, 26 September 1997 (1997-09-26), pages 24129 - 24132, XP002075965 *
LIU ET AL.: "Uncoupling protein-3: a muscle-specific gene upregulated by leptin in ob/ob mice.", GENE, vol. 207, 19 January 1998 (1998-01-19), pages 1 - 7, XP004108878 *
MAO ET AL.: "UCP4, a novel brain-specific mitochondrial protein that reduces membrane potential in mammalian cells.", FEBS LETT., vol. 443, 29 January 1999 (1999-01-29), pages 326 - 330, XP002126480 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002036829A3 (en) * 2000-11-01 2003-03-13 Agy Therapeutics Inc Methods of diagnosing, preventing and treating neurological disorders and neuronal injuries
US6670138B2 (en) 2000-11-01 2003-12-30 Agy Therapeutics, Inc. Method of diagnosing ischemic stroke via UCP-2 detection

Also Published As

Publication number Publication date
US20120041176A1 (en) 2012-02-16
US20130066052A1 (en) 2013-03-14
EP1115863A1 (en) 2001-07-18
US8067229B2 (en) 2011-11-29
JP4709383B2 (ja) 2011-06-22
CA2344467A1 (en) 2000-03-30
US8648174B2 (en) 2014-02-11
US8313927B2 (en) 2012-11-20
EP1115863B1 (en) 2007-11-28
PT1115863E (pt) 2008-03-07
US20060068439A1 (en) 2006-03-30
AU6041399A (en) 2000-04-10
DE69937644T2 (de) 2008-10-30
JP2002526075A (ja) 2002-08-20
DE69937644D1 (en) 2008-01-10
DK1115863T3 (da) 2008-03-31
CA2344467C (en) 2011-01-25
ES2297947T3 (es) 2008-05-01

Similar Documents

Publication Publication Date Title
EP1490386B1 (en) Novel polypeptide and nucleic acids encoding the same
CA2311640A1 (en) Polypeptides and nucleic acids encoding the same
PT1887014E (pt) Homëlogos de toll humana
US8313927B2 (en) Ucp4
KR20010085816A (ko) 면역 관련 질환 치료용 조성물 및 치료 방법
EP1135496B1 (en) Ucp5
US7342102B2 (en) Uncoupling protein 5 (UCP5)
EP1241179B1 (en) Human protein having in vitro antiproliferative activity
EP1659131B1 (en) Polypeptides and nucleic acids encoding the same
ES2222959T3 (es) Polipeptidos pro241 y acido nucleico codificante de los mismos.
US20020086368A1 (en) Human toll homologues
EP1209168B1 (en) PRO243 polypeptides and nucleic acids encoding the same
AU2003200204C9 (en) Novel PRO792 polypeptides and nucleic acids encoding same
EP1241180A2 (en) Human A33 antigen-like protein and nucleic acids encoding it
EP1820859A2 (en) Methods and compositions for inhibiting neoplastic cell growth
US20020052019A1 (en) Human toll homologue
JP2002533062A5 (https=)
EP1249491A2 (en) Human very long chain acyl-CoA synthase (VLCAS)-like protein and nucleic acids encoding it

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2344467

Country of ref document: CA

Ref country code: CA

Ref document number: 2344467

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 574252

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1999969439

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999969439

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 1999969439

Country of ref document: EP