WO2000009145A1 - Traitement de tumeurs au moyen d'oligonucleotides agissant sur le recepteur du facteur de croissance insulunoide i - Google Patents

Traitement de tumeurs au moyen d'oligonucleotides agissant sur le recepteur du facteur de croissance insulunoide i Download PDF

Info

Publication number
WO2000009145A1
WO2000009145A1 PCT/US1999/018306 US9918306W WO0009145A1 WO 2000009145 A1 WO2000009145 A1 WO 2000009145A1 US 9918306 W US9918306 W US 9918306W WO 0009145 A1 WO0009145 A1 WO 0009145A1
Authority
WO
WIPO (PCT)
Prior art keywords
tumor
cells
igf
cell
human
Prior art date
Application number
PCT/US1999/018306
Other languages
English (en)
Inventor
David W. Andrews
Renato L. Baserga
Mariana Resnicoff
David Abraham
Original Assignee
Thomas Jefferson University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Thomas Jefferson University filed Critical Thomas Jefferson University
Priority to AU54798/99A priority Critical patent/AU5479899A/en
Priority to CA002339858A priority patent/CA2339858A1/fr
Priority to JP2000564647A priority patent/JP2002522506A/ja
Priority to EP99941078A priority patent/EP1105150A1/fr
Publication of WO2000009145A1 publication Critical patent/WO2000009145A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001103—Receptors for growth factors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/13—Tumour cells, irrespective of tissue of origin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K2035/126—Immunoprotecting barriers, e.g. jackets, diffusion chambers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5152—Tumor cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5156—Animal cells expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates

Definitions

  • the present application is directed to inducing resistance to or regression of tumor growth in humans using implanted diffusion chambers containing tumor cells treated with oligonucleotides directed to IGF-IR.
  • Traditional methods of treating tumors in mammals include procedures such as, for example, surgical removal of the tumor, injection or implantation of toxic treatments or syngeneic tissue samples, chemotherapy, and irradiation.
  • the ultimate goal of each of these procedures is to reduce the growth of existing tumors, preferably abrogating tumor growth to the point of complete regression, and/or to induce resistance to future tumor growth.
  • These procedures have numerous effects on tumor cells, as well as on non-tumor cells. Tumors and other neoplastic tissues are known to undergo apoptosis spontaneously or in response to treatment.
  • Examples include several types of leukemia, non- Hodgkin's lymphoma, prostate tumor, pancreatic cancer, basal and squamous cell carcinoma, mammary tumor, breast cancer, and fat pad sarcoma.
  • Several anti-cancer drugs have been shown to induce apoptosis in target cells. Buttyan, et al., Mol. Cell. Biol., 1989, 9, 3473- 3481 ; Kaufmann, Cancer Res., 1989, 49, 5870-5878; and Barry, et al, Biochem. Pharmacol, 1990, 40, 2353-2362, all of which are incorporated herein by reference in their entirety.
  • Certain mildly adverse conditions can result in the injured cell dying by programmed cell death, including hyperthermia, hypothermia, ischemia, and exposure to irradiation, toxins, and chemicals. It should be noted that many of these treatments will also result in necrosis at higher doses, suggesting that mild injury to a cell might induce cell suicide, perhaps to prevent the inheritance of a mutation, while exposure to severe conditions leads directly to cell death by necrosis. However, the death process is difficult to observe due to the rapidity of the process and the reduced amount of inflammation. For these reasons, quantification of apoptosis is often difficult.
  • a method of measuring the duration of the histologically visible stages of apoptosis (3 hours in normal rat liver) and a formula by which to calculate the cell loss rate by apoptosis is set forth by Bursch, et al, Carcinogenesis, 1990, 11, 847-853.
  • IGF-I and PDGF
  • IGF-I and PDGF
  • Baserga The Biology of Cell Reproduction, Harvard University Press, Cambridge, MA, 1985.
  • the injected cells were suspected of undergoing apoptosis or, at any rate, some form of cell death.
  • Dying cells are very difficult to demonstrate, because dying cells, especially in vivo, disappear very rapidly, and one is left with nothing to examine.
  • IGF-IR insulin growth factor-IR
  • IGF-I Goldring, etal, Crit. Rev. Eukaryot. GeneExpr., 1991, 1, 301-326 andBaserga, eta , Crit. Rev. Eukaryot.
  • IGF-I RNA a vector expressing an antisense RNA to the IGF-I RNA
  • the IGF autocrine or paracrine loop is also involved in the growth promoting effect of other growth factors, hormones (for instance, growth hormone and estrogens), and oncogenes like SV40 T antigen and c-myb, and in tumor suppression, as in the case of WT1. Baserga, et al, 1994, supra. Inducing resistance to tumor growth is also disclosed in, for example, U.S. Patent No. 5,714,170, which is incorporated herein by reference in its entirety. A review of the role of IGF-IR in tumors is provided in Baserga et al, Vitamins and Hormones, 1997, 53, 65-98, which is incorporated herein by reference in its entirety.
  • testing agents such as, for example, growth factors and growth factor receptors for their ability to maintain or suppress transformed phenotypes remains difficult. In order to obtain an accurate account of the tumor suppressive ability, testing should be performed in vivo.
  • the present invention provides a method of inducing resistance to or regression of tumor growth with markedly reduced side effects to the patient.
  • the present invention is directed to a method of inducing resistance to tumor growth in a human comprising contacting a tumor cell in vitro or ex vivo with an oligonucleotide complementary to IGF-IR, and implanting a diffusion chamber containing the treated tumor cell into the rectus sheath of the human for a therapeutically effective time, thereby inducing resistance to tumor growth.
  • the present invention is also directed to a method of inducing regression of a tumor in a human comprising contacting a tumor cell in vitro or ex vivo with an oligonucleotide complementary to IGF-IR, and implanting a diffusion chamber containing the treated tumor cell into the rectus sheath of the human for a therapeutically effective time, thereby inducing regression of the tumor.
  • FIGURES Figure 1 shows a table summarizing the patients enrolled in the clinical trial.
  • Figure 2 is a Western blot immunostained with a polyclonal antibody anti-IGF-
  • FIG. 3 Patient 1 + LR 4437-002 A (IGF-IR antisense oligonucleotide) at 1 mg; 4: Patient 1 + LR 4437-002A at 2 mg; 5: C6 rat glioblastoma cells; 6: T98G human glioblastoma cells; 7: Patient 8 before treatment; 8: Patient 8 + LR 4437-002A at 2 mg; 9: T98G human glioblastoma cells; 10: Patient 9 before treatment; 11 : Patient 9 + LR 4437-002A at 2 mg; 12: Patient 10 before treatment; 13: Patient 10 + LR 4437-002A at 2 mg; and 14: T98G human glioblastoma cells.
  • Figures 3 A and 3B show a table showing post-treatment analysis of the patients enrolled in the clinical trial.
  • Figure 4 shows MRI scans of test case (Patient 1, a-c) and case control (d-f) of patients originally diagnosed with malignant glioma originating in the dominant left temporal lobe undergoing lobectomy and radiation therapy with failure and progression into the deep gray matter and ipsilateral frontal lobe.
  • pathology revealed viable tumor without evidence of radiation necrosis in both case (time 0).
  • the test case received image- guided re-resection and IGF-IR antisense treatment and the case control received image- guided re-resection and GLIADEL® implantation. Numbers in white ovals represent time in weeks after treatment.
  • Figure 5 shows MRI scans of test case (Patient 7, a-c) and case control (d-f) of patients originally diagnosed with malignant glioma originating in the dominant left posterior temporal-parietal region, both with mild receptive aphasias, undergoing resection and radiation therapy with failure and progression into the ipsilateral deep gray matter and frontal lobe.
  • pathology revealed viable tumor without evidence of radiation necrosis in both case (time 0).
  • the test case received image-guided re-resection and IGF-IR antisense treatment and the case control received image-guided re-resection and GLIADEL® implantation. Numbers in white ovals represent time in weeks after treatment.
  • the present invention is directed, in part, to methods of inducing resistance to tumor growth, or inducing regression of a tumor, in a human comprising treating a tumor cell in vitro or ex vivo with a pro-apoptotic agent, placing the treated tumor cells in a diffusion chamber thereby producing a tumor cell-containing diffusion chamber, and inserting or implanting the tumor cell-containing diffusion chamber into the rectus sheath of the human for a therapeutically effective time thereby inducing resistance to tumor growth or inducing regression of the tumor.
  • An important advantage of the present invention is that toxic treatments to the tumor cells such as, for example, treatment with irradiation or chemotherapeutic compounds, are performed in vitro or ex vivo thereby eliminating toxicity to the patient.
  • tumor cells can be placed into culture in a diffusion chamber and the chamber directly implanted into the patient, thus eliminating the possibility of physical spreading of the tumor cells which can be associated with direct injection of tumor cells into a patient.
  • Human tumors which are treatable with the methods of the present invention can be primary or secondary, benign, malignant, metastatic, or micrometastatic tumors in a human patient.
  • a human patient is an individual who is diagnosed with cancer, an individual who has been diagnosed as having cancer and who is now cancer-free, or an individual who is suspected of having cancer.
  • Tumors treatable with the methods of the present invention include, but are not limited to, melanoma, prostate, ovary, mammary, pancreatic, lungs, colon, and smooth muscle tumors, as well as cells from glioblastoma, bone marrow stem cells, hematopoietic cells, osteoblasts, epithelial cells, fibroblasts, as well as any other tumor cells which undergo apoptosis and induce resistance to or regression of tumor cells.
  • tumor cell(s), tumor cell(s), and “cancer cell(s),” as applied to cells which are within a diffusion chamber, are used interchangeably throughout the present application and include, but are not limited to, autografts, allografts, syngeneic, non-syngeneic and xenografts as well as cells derived therefrom.
  • Tumor cells include any type of cell which upon apoptosis induces resistance to tumor growth or induces regression of a tumor including, but not limited to, naturally-occurring tumor cells or tumor cell lines.
  • Tumor cells include, but are not limited to, melanoma, prostate, ovary, mammary, pancreatic, lungs, colon, and smooth muscle tumors, as well as cells from glioblastoma, bone marrow stem cells, hematopoietic cells, osteoblasts, epithelial cells, fibroblasts, as well as any other tumor cells which undergo apoptosis and induce resistance to or regression of tumor cells.
  • Tumor cell lines include, but are not limited to, C6 rat glioblastoma cell line, FO-1 human melanoma cell line, B A 1112 rat rhabdomyosarcoma cell line, B 1792-F 10 mouse melanoma, B 16 mouse melanoma, and CaOV-3 human ovarian carcinoma.
  • Tumorous tissue, tumors, or tumor cells can also be excised from the human patient in which the diffusion chamber will be inserted or from another source which has been cultured in vitro.
  • Tumor cells used in the methods of the present invention are cultured in vitro or ex vivo in a medium supplemented with a pro-apoptotic agent and subsequently transferred to a diffusion chamber.
  • the tumor cells can be initially cultured in a diffusion chamber and treated with the pro-apoptotic agent therein.
  • the diffusion chamber contains tumor cells which are derived from the same type of tumor to which resistance or regression is induced.
  • the tumor cells are placed in a diffusion chamber are of a different type than the tumor to which resistance or regression is induced.
  • the tumor cells are cultured in vitro or ex vivo and are supplemented with a pro-apoptotic agent for a period of time, preferably 3 to 48 hours, more preferably 24 hours. Prior to culture in vitro or ex vivo, the tumor cells can be gently dissociated with trypsin and subsequently washed prior to implanting in a human.
  • Pro-apoptotic agents which supplement the culture medium of the tumor cells in vitro or ex vivo are preferably agents which induce cell death in vivo.
  • a pro-apoptotic agent for purposes of the present invention, is an agent which causes death of the tumor cells in the diffusion chamber in vivo such that the cell death has a tumor growth inhibiting effect or tumor regression effect, i.e., a resistant effect or regression effect, on a tumor or tumors or tumor cells in the human in which the diffusion chamber is implanted.
  • Such pro-apoptotic agents include, but are not limited to, nucleic acid molecules, proteins or peptides, non-protein or non-polynucleotide compounds, and physical conditions.
  • the pro-apoptotic agents used in the methods of the present invention induce cell death, or apoptosis, of the tumor cells in the diffusion chamber in vivo or ex vivo.
  • Apoptosis for purposes of the present invention, is defined as cell death and includes, but is not limited to, regression of primary and metastatic tumors.
  • Apoptosis is a programmed cell death which is a widespread phenomenon that plays a crucial role in the myriad of physiological and pathological processes. Necrosis, in contrast, is an accidental cell death which is the cell's response to a variety of harmful conditions and toxic substances.
  • Apoptosis morphologically distinct from necrosis, is a spontaneous form of cell death that occurs in many different tissues under various conditions. This type of cell death typically occurs in scattered cells and progresses so rapidly it is difficult to observe.
  • Pro-apoptotic agents, or apoptosis-inducing agents, which induce apoptosis of tumor cells in vivo include, for example, nucleic acid molecules.
  • the nucleic acid molecule is an oligonucleotide directed against DNA or RNA of a growth factor or growth factor receptor, such as, for example, IGF-IR.
  • the oligonucleotide is directed against DNA or RNA of IGF-IR.
  • the oligonucleotide can be directed to any portion of IGF-IR DNA or RNA.
  • the nucleotide sequence of the oligonucleotide includes, but is not limited to, nucleotide sequences complementary to codons 1-309 of IGF-IR (SEQ ID NO:l), comprising either RNA or DNA.
  • the antisense ohgonucleotides can also comprise nucleotide sequences complementary to portions of codons 1 -309.
  • mismatches within the nucleotide sequence of the oligonucleotide complementary to codons 1 to 309 are also within the scope of the invention.
  • oligonucleotide complementary to nucleotides -29 to -24 of the IGF-IR signal sequence (SEQ ID NO:2) comprising DNA or RNA is also within the scope of the present invention.
  • the signal sequence of IGF-IR is a 30 amino acid sequence. Contemplated by this definition are ohgonucleotides complementary to the 30 amino acid signal sequence. Alternatively, fragments of ohgonucleotides within SEQ ID NO:2 are also contemplated.
  • Additional ohgonucleotides of the invention include, but are not limited to, ohgonucleotides comprising the following nucleotide sequences: GGACCCTCCTCCGGAGCC (SEQ ID NO:3), CCGGAGCCAGACTTCAT (SEQ ID NO:4), CTGCTCCTCCTCTAGGATGA (SEQ ID NO:5), CCCTCCTCCGGAGCC (SEQ ID NO:6), TACTTCAGACCGAGGCC (SEQ ID NO:7), CCGAGGCCTCCTCCCAGG (SEQ ID NO:8), and TCCTCCGGAGCCAGACTT (SEQ ID NO:9).
  • the ohgonucleotides of the invention can comprise from about 10 to about 50 nucleotides, more preferably from about 14 to about 25 nucleotides, and more preferably from about 17 to about 20 nucleotides.
  • the nucleic acid molecule is a vector which produces an oligonucleotide directed against DNA or RNA of a growth factor or growth factor receptor such as, for example, SEQ ID Numbers 1 -9.
  • the nucleic acid molecule complementary to a portion of IGF-IR RNA or DNA is inserted into an appropriate delivery vehicle, such as, for example, an expression plasmid, cosmid, YAC vector, and the like.
  • an appropriate delivery vehicle such as, for example, an expression plasmid, cosmid, YAC vector, and the like.
  • Almost any delivery vehicle can be used for introducing nucleic acids into tumor cells.
  • Recombinant nucleic acid molecules include, for example, plasmid DNA vectors, cDNA-containing liposomes, artificial viruses, nanoparticles, and the like. It is also contemplated that vectors expressing the ohgonucleotides can be injected directly into the tumor cells.
  • the regulatory elements of the recombinant nucleic acid molecules of the invention are capable of directing expression in mammalian tumor cells, preferably human tumor cells.
  • the regulatory elements include a promoter and a polyadenylation signal.
  • other elements such as a Kozak region, may also be included in the recombinant nucleic acid molecule.
  • polyadenylation signals useful to practice the present invention include, but are not limited to, SV40 polyadenylation signals and LTR polyadenylation signals.
  • the SV40 polyadenylation signal which is in pCEP4 plasmid (Invitrogen, San Diego, CA), referred to as the SV40 polyadenylation signal can be used.
  • the promoters useful in constructing the recombinant nucleic acid molecules of the invention may be constitutive or inducible.
  • a constitutive promoter is expressed under all conditions of cell growth.
  • Exemplary constitutive promoters include the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, ⁇ -actin, human myosin, human hemoglobin, human muscle creatine, and others.
  • viral promoters function constitutively in eukaryotic cells, and include, but are not limited to, the early and late promoters of SV40, the Mouse Mammary Tumor Virus (MMTV) promoter, the long terminal repeats (LTRs) of Maloney leukemia virus, Human Immunodeficiency Virus (HIV), Cytomegalovirus (CMV) immediate early promoter, Epstein Barr Virus (EB V), Rous Sarcoma Virus (RS V), and other retroviruses, and the thymidine kinase promoter of herpes simplex virus.
  • LTRs long terminal repeats of Maloney leukemia virus
  • HBV Human Immunodeficiency Virus
  • CMV Cytomegalovirus
  • EB V Epstein Barr Virus
  • RS V Rous Sarcoma Virus
  • thymidine kinase promoter of herpes simplex virus include, but are not limited to, the early and late promoters of SV40, the Mouse
  • Inducible promoters are expressed in the presence of an inducing agent.
  • the metallothionein promoter is induced to promote (increase) transcription in the presence of certain metal ions, and the Drosophila HSP70 promoter.
  • Other inducible promoters are known to those of ordinary skill in the art.
  • Recombinant nucleic acid molecules comprising ohgonucleotides of the invention can be introduced into a tumor cell or "contacted" by a tumor cell by, for example, transfection or transduction procedures.
  • Transfection refers to the acquisition by a cell of new genetic material by incorporation of added nucleic acid molecules. Transfection can occur by physical or chemical methods. Many transfection techniques are known to those of ordinary skill in the art including: calcium phosphate DNA co-precipitation; DEAE-dextran DNA transfection; electroporation; naked plasmid adsorption, and cationic liposome-mediated transfection.
  • Transduction refers to the process of transferring nucleic acid into a cell using a DNA or RNA virus.
  • Suitable viral vectors for use as transducing agents include, but are not limited to, retroviral vectors, adeno associated viral vectors, vaccinia viruses, and Semliki Forest virus vectors.
  • recombinant vectors comprising ohgonucleotides directed to DNA or RNA of IGF-IR, which are described, for example, in Resnicoff, et al. (1994a, 1994b, supra), both of which are incorporated herein by reference, are used.
  • plasmid HSP/IGF-IR AS expresses an antisense transcript 309 bp in length directed to IGF-IR RNA, under the control of a Drosophila HSP70 promoter.
  • hepatitis B polyadenylation signal sequence and a neomycin-resistance gene under the control of the SV40 promoter are present at the 3' termini of the 309 bp IGF-IR fragment.
  • One skilled in the art can readily prepare additional vectors producing any of the ohgonucleotides of the invention described herein.
  • the pro-apoptotic agents comprise proteins or peptides such as, for example, associated dominant negative mutants of IGF-IR and MHC class I peptides.
  • Dominant negative mutants of IGF-IR include, for example, soluble IGF-IR, described in D'Ambrosio, et al, Cancer Res., 1996, 56, 4013-4020, incorporated herein by reference, and myristylated C-terminus of IGF-IR (MyCF).
  • MHC class I associated peptides include, for example, Tyr-Leu-Glu-Pro-Gly-Pro-Val-Thr-Ala (SEQ ID NO: 10) recognized by melanoma-specific CTL lines (Cox, etal, Science, 1994, 264, 716- 719), Leu-Leu- Asp-Gly-Thr-Ala-Thr-Leu-Arg-Leu (SEQ ID NO: 11) derived from gp 100 and involved in regression of human melanoma (Kawakami, et al, Proc. Natl. Acad. Sci.
  • inverted D-amino acid analogs of the above-identified peptides such as Ala-Thr-Val-Pro-Gly-Pro-Glu-Leu-Tyr (SEQ ID NO: 13) and Leu-Arg-Leu-Thr-Ala-Thr-Gly- Asp-Leu-Leu (SEQ ID NO: 14), are also active. Amino acid substitutions are also contemplated by the present invention.
  • the peptides of the present invention can be made synthetically as is well known to those skilled in the art.
  • the pro-apoptotic agents comprise non- protein or non-polynucleotide compounds such as, for example, chemotherapeutic compounds or synthetic chemical compounds.
  • chemotherapeutic compounds include, for example, etoposide, cisplatin, camptothecin, and tumor necrosis factor alpha (TNF- ⁇ ).
  • the pro-apoptotic agents comprise physical conditions such as, for example, hyperthermia, hypothermia, ischemia, and ionizing irradiation.
  • the condition is defined for purposes of the present invention as an agent, an apoptosis-inducing agent.
  • Therapeutically effective doses of the pro-apoptotic agents or apoptotic- inducing agents will be about that of the drugs alone; dosages will be set with regard to weight, and clinical condition of the patient.
  • the proportional ratio of active ingredient to culture medium will naturally depend on the chemical nature, solubility, and stability of the compounds, as well as the dosage contemplated.
  • the culture medium is also pharmaceutically acceptable.
  • the apoptosis-inducing agents of the invention can be used alone or in combination with other apoptosis-inducing agents.
  • the present invention employs the use of a diffusion chamber, in which the cells are contained.
  • Cells are impermeable to a filter fitted on the diffusion chamber; they cannot leave or enter the chamber.
  • the filter on the diffusion chamber has pores in the size range of about 0.25 ⁇ m or smaller, preferably about 0.1 ⁇ m in diameter.
  • Lange, et al, J. Immunol, 1994, 153, 205-211 and Lanza, et al, Transplantation, 1994, 57, 1371-1375 both of which are incorporated herein by reference in their entirety. Accordingly, cell death or apoptosis, can be quantitatively determined.
  • the use of a diffusion chamber can be extended to other cell lines, even non-syngeneic, and even from different species, because of the rapidity with which cell death occurs, about 24 hours, well before any immune reaction could be established.
  • Diffusion chambers useful in the present invention include any chamber which does not allow passage of cells between the chamber and the patient in which it is implanted, however, permits interchange and passage of factors between the chamber and the patient.
  • the chamber can allow for multiple and sequential sampling of the contents, without contamination and without harming the patient, therefore significantly reducing the number of implantation procedures performed on the patient.
  • a preferred diffusion chamber is described in, for example, U.S. Patent No. 5,714,170.
  • a representative diffusion chamber comprises a chamber barrel having two ends, a first end and a second end.
  • the barrel may be comprised of one or more rings secured together by non-toxic means.
  • the chamber is fitted at each end with a filter, a first filter and a second filter.
  • the filters are porous to factors such that the factors may pass between the chamber and the patient.
  • the filter pores size can be about 0.25 ⁇ m or smaller, preferably about 0.1 ⁇ m.
  • the filters can be made of plastic, teflon, polyester, or any inert material which is strong, flexible and able to withstand chemical treatments.
  • the filters can be secured in position with rubber gaskets which may also provide a tighter seal.
  • On the barrel portion of the chamber an opening is provided which can be covered by a cap which is accessed from outside of the patient's body once the chamber is implanted, thus allowing the diffusion chamber to be refilled.
  • the cap can be a screw-on type of self-sealing rubber and fitted to the opening.
  • Sampling of the chamber contents can be performed by accessing the opening by removing the cap on the outside of the patient's body and inserting an ordinary needle and syringe.
  • the chamber can be made of any substance, such as and not limited to plastic, teflon, lucite, titanium, or any inert material which is non- toxic to and well tolerated by humans.
  • the chambers should be able to survive sterilization.
  • Diffusion chambers are preferably constructed from 14 mm Lucite rings with 0.1 ⁇ m pore-sized hydrophilic Durapore membranes (Millipore, Bedford, MA).
  • the diffusion chambers are preferably sterilized with ethylene oxide prior to use.
  • Tumor cells can be placed in a diffusion chamber in varying amounts.
  • about 1 x 10 4 to about 5 x 10 6 cells can be placed in the diffusion chamber.
  • about 1 x 10 5 to about 1.5 x 10 6 cells can be placed in the diffusion chamber.
  • about 5 x 10 5 to 1 x 10 6 cells are placed in the chamber.
  • about 1 x 10 6 cells are placed in the diffusion chamber.
  • the cells are placed in the diffusion chamber containing media. It is contemplated that any media known to those skilled in the art that supports the growth of cancer cells and which is compatible with a human can be used.
  • the diffusion chamber can be implanted in a human in the following non- limiting ways: subcutaneously, intraperitoneally, intracranially, or into the rectus sheath, for example. Most preferably, the diffusion chamber(s) is implanted into an acceptor site of the body having good lymphatic drainage and/or vascular supply such as the rectus sheath. The chamber can be removed about 24 to about 30 hours after implantation, if desired. Alternatively, a refillable chamber can be employed such that the diffusion chamber can be re-used for treatments and emptied following treatments. In addition, a plurality of diffusion chambers, preferably between five and 20, can be used in a single patient.
  • a clinically proven surgical procedure for carrying out the invention in humans involves implantation of diffusion chambers containing the tumor cells treated with the pro- apoptotic agent, such as IGF-IR antisense oligonucleotide, as a suspension.
  • a preferred procedure involves several surgical and/or in vitro tissue processing objectives: 1) harvesting viable tumor tissue, free of fibrinogen and necrosis, from a tumor bed for ex-vivo tumor cell treatment with the IGF-IR antisense oligonucleotide; 2) avoiding excessive or unacceptable operative morbidity, specifically post-operative neurologic deficit related to the procedure; 3) using image-directed tissue selection to achieve these first two objectives; 4) using image- directed surgical resection to maximize the resection of tumor and to minimize residual tumor burden, thereby minimizing any inflammatory process related to either autologous tumor rejection or related to a direct and cytotoxic effect on tumor cells in the post-implantation period; 5) selecting and creating an autologous acceptor site for the generation of the biological response; 6) processing human tissue explant
  • glioma human brain tumors known as glioma.
  • Certain tumors such as brainstem glioma, or deep, and/or multiple brain metastases, are surgically inaccessible and no tissue can be safely harvested in these patients.
  • homologous (human but not host) cell lines, xenographic (non-human) established cell lines, or homologous human primary cell cultures can be utilized as a source to induce the resistance to or regression of tumor growth.
  • the prophylactic use of low molecular weight heparin is recommended to carry out the present invention.
  • the following examples are illustrative but are not meant to be limiting of the invention.
  • Diffusion chambers comprising either autologous implants of harvested tumor cells or established autologous, homologous, or xenographic cell lines treated with antisense IGF-IR ohgonucleotides are implanted into a human in order to induce resistance to or regression of tumor growth. All such tumor cells have been treated with IGF-IR antisense ohgonucleotides ex vivo.
  • Use of IGF-IR antisense is made to target the IGF-IR in host tumor cell explants in vitro and to commit the tumor cells to undergo apoptosis in vivo.
  • the targeted pre-treated cells are committed to undergo apoptosis in vivo and subsequently generate biological response modifiers which induce resistance to or regression of tumor growth.
  • a preferred embodiment comprises a combination method involving in vitro followed by in vivo procedures.
  • this method targets IGF-IR in tumor cells in vitro.
  • Tumor cells with decreased levels of IGF-IR are encapsulated in the diffusion chambers and implanted in vivo in the patient (i.e. subcutaneously, within the rectus sheath, intracranially, or in any other host location considered acceptable for implantation).
  • Cells with decreased levels of IGF-IR undergo apoptosis in the diffusion chambers and release diffusible biological response modifiers which are believed to cause the elimination of human malignant brain tumors in the host patient.
  • One of two surgical protocols is preferably utilized to carry out the present invention with respect to primary and metastatic brain tumors.
  • a craniotomy is employed for tumor resection and autologous cell implantation.
  • Another protocol utilizes no craniotomy but requires the implantation of autologous cell lines, homologous cell lines, or xenographic cell lines in patients.
  • autologous tissue is harvested utilizing a surgical method for glioma.
  • Viable tumor tissue is harvested from the tumor bed (target between 0.5 to 2 grams; a minimum of 500 mg is usually adequate) for ex vivo tumor cell treatment with IGF-IR antisense DNA. It is an objective of this protocol to avoid excessive or unacceptable operative morbidity, specifically post-operative neurologic deficit related to the procedure.
  • Image- directed tissue selection is utilized to achieve viable tumor tissue harvest and to avoid excessive or unacceptable operative morbidity.
  • Surgical resection is also image-directed to maximize tumor resection, to minimize residual tumor burden, and to minimize subsequent inflammatory effects related to autologous tumor rejection in the post-transplantation period.
  • An autologous acceptor site is selected, such that the acceptor site is appropriate for implantation of the diffusion chamber and for the diffusion of the biological modifier.
  • Human tissue explants are processed in vitro to generate the desired biological response upon re- implantation of the autologous treated tumor cells.
  • the re-implantation protocol is designed to generate the biological response modifier trigger in humans.
  • the patient is first prepared for craniotomy with placement of fiducial coordinates on the scalp. These fiducials will serve as surface registration points for MRI- based intra-operative image guidance.
  • the patient is then taken to the MRI scanner where gadolinium is infused, and image sets in all three orthogonal planes are obtained. The obtained image sets are suitable for the intra-operative image guidance computer software to be utilized in the operating room.
  • Use of gadolinium or similar contrast agents serves to create a tissue plane marker where viable acceptor tumor tissue cells are located.
  • the image- directed localization of a viable tumor plane is key to a successful cell harvest for processing.
  • Prophylactic antibiotics are infused intravenously, as are agents to minimize cerebral edema, including steroids and mannitol with lasix.
  • the head is immobilized in three-point head pin fixation and the infrared LED reference block is applied to the head pin fixation device with attention to the orientation of the reference block to the infrared camera.
  • the reference block is positioned for both an unobstructed link to the camera and for sufficient distance from the operative field for unobstructed operative access.
  • a frameless viewing wand is then registered to the scalp fiducials until an acceptable ( ⁇ 1.5 mm) registration error is obtained.
  • the fiducial markers are removed and 40 scalp points are registered to ensure accurate registration over the entire operative field.
  • the registration is checked on the computer screen by moving the wand over the scalp in all three orthogonal planes.
  • a preferred site for implantation e.g. the abdomen
  • a preferred mode would include an incision just superolateral to the umbilicus.
  • Other sites, designated above, would also be acceptable.
  • a four centimeter transverse incision is made with a #10 blade after infiltration with 1% Lidocaine.
  • the wound edge is retracted with a self-retaining retractor to minimize tissue margin disruption during pocket preparation. Sharp dissection with Metzenbaum scissors is performed, and the rectus sheath is exposed, with careful attention to hemostasis with electrocautery.
  • the rectus sheath is incised parallel to the skin incision, thereby exposing the rectus abdominus muscle.
  • a series of interconnected pockets are established utilizing blunt finger dissection in the cephalad and caudal extent of the wound between the rectus muscle and the sheath to allow subsequent implantation of up to 10 diffusion chambers, with each chamber measuring 1.8 cm in diameter.
  • the wound is copiously irrigated with Bacitracin solution in normal saline, is closed in a single layer with a running 3-0 Nylon suture, and is appropriately dressed.
  • the craniotomy is performed using the wand to define an accurate scalp and bone flap, if necessary, and standard sterile technique is utilized to prepare the operative field for surgery.
  • the scalp is incised with a #10 scalpel blade and the scalp reflected with towel clips.
  • the bone plate is removed, if necessary, with a combination of an acorn Midas Rex dissecting tool followed by the B-1 dissector with footplate. Pre-existing bone plates are removed as appropriate.
  • four peripheral bone fiducials are made with the B- 1 dissector to serve as registration points for the viewing wand during tumor resection.
  • the dura is then opened, preferably in a cruciate fashion, utilizing a #15 scalpel blade and Gerald forceps, thereby exposing the cortical surface.
  • Tumor sample resection then proceeds utilizing intra-operative image guidance.
  • the computer monitor displays on a split screen each orthogonal plane, as well as a fourth view which features an axis at right angles to the viewing wand.
  • Cortisectomy is performed with bipolar electrocautery and a #9 or #11 Frazier sucker, utilizing the wand at each point to direct accurate sampling of the tumor bed.
  • the viable tumor bed margin is featured on the monitor as an area of contrast enhancement.
  • viable tumor tissue is registered and judged clinically to be acceptable for oligonucleotide pre-treatment (reducing harvest of necrotic debris, inflammatory reaction, and fibrinogen)
  • bayoneted tumor forceps are utilized to harvest tissue for frozen section histopathological confirmation.
  • viable neoplastic tissue is confirmed, preferably a minimum of 500 mg of tumor tissue is harvested. Every effort is made to harvest viable tissue free of clot and necrotic debris to improve the success of subsequent effective disaggregation and viable cell plating.
  • the resection cavity is inspected for any residual bleeding. Bleeding is controlled first with thrombin-soaked cotton balls. Subsequently bleeding is controlled with bipolar electrocautery. When adequate hemostasis is achieved, the resection cavity is lined with thrombin-soaked surgicel. The dura is closed with 4-0 interrupted and running sutures, and the bone plate is re-affixed with a titanium plating system. The scalp is closed in two layers: the galea with 2-0 vicryl interrupted buried sutures and the scalp with either 3-0 nylon or staples.
  • Tumor tissue samples from the operating room are immediately sent for ex vivo processing. Under sterile conditions, the viable tumor margin tissue is gently disaggregated first with a scalpel. Disaggregation is completed with collagenase and protease treatment.
  • Single cell suspension is obtained after passage through a series of gradually decreasing internal diameter needles. Finally, the cells are washed and plated in culture medium supplemented with 10% serum (e.g. fetal calf or fetal bovine).
  • serum e.g. fetal calf or fetal bovine
  • the cells are allowed to attach for four to six hours.
  • the cells are carefully washed and treated with up to 2 mg of IGF-IR antisense oligonucleotide in a final volume of 20 ml of serum-free medium to avoid exposure to nucleases present in the serum.
  • the oligonucleotide treatment ranges from a minimum of six hours to a maximum often hours.
  • the oligonucleotide treatment dose has been established for lxl 0 7 cells. Proportionately more oligonucleotide can be utilized for more cells. For example, up to 3.6 mg of IGF-IR is used in 36 ml of serum- free medium for 18 million cells.
  • the cells are harvested and washed carefully.
  • the cells are re-suspended in phosphate-buffered saline (calcium and magnesium- free), and they are placed in the diffusion chambers to a volume of 200 ⁇ l/chamber and a density of 1 X 10 6 cells/chamber. This volume/concentration relationship is important to avoid cell death due to hypoxia.
  • the chambers are irradiated with 5 Gy just prior to implantation to comply with FDA regulations. Another preferred embodiment does not include irradiation.
  • the chambers consist of small Lucite rings measuring 1.4 cm in outer diameter and 0.8 cm in height, with a hydrophilic membrane at each end. The membranes have a 0.1 ⁇ m exclusion limit which impedes the exit or entry of intact cells and allows the diffusion of soluble factors.
  • the abdominal acceptor site is prepared for diffusion chamber implantation.
  • the timing of this procedure relative to the harvest of the autologous tumor cells is non-obvious and critical.
  • Tumor cells with a targeted IGF-IR are committed to undergo apoptosis under anchorage-independent conditions, such as those in vivo.
  • a time window of an hour has been established between harvest of tumor cells and implantation of diffusion chambers.
  • the time window between cell harvest and re-implantation of the autologous treated tumor cells, which generate the biological signal, preferably should not exceed one hour in order for the peak of the triggering process to occur in vivo.
  • the cell harvest and re-implantation of pre-treated cells is performed within as small a time window as possible.
  • the patient is prepared for the procedure; the patient is sedated with 10 mg of Versed, and 1 g of Ancef antibiotic is infused for wound infection prophylaxis.
  • the previously prepared abdominal acceptor site is exposed using standard sterile technique, and 0.5%) Sensorcaine is injected into the abdominal incision. Utilizing Metzenbaum scissors, the acceptor site is opened, thereby exposing the rectus sheath which was incised the previous day. Excessive residual bleeding or presence of fibrinous exudate is to be avoided as fibrin may interfere with signal generation and thereby reduce the effectiveness of the procedure. Care is taken once again to control any source of hemorrhage, however small, with a portable heat cautery unit.
  • any residual fibrin material is removed with copious irrigation with a Bacitracin solution in normal saline.
  • the biological dosimetry includes implantation of 1 x 10 6 cells/chamber in 10 chambers for a maximum of 1 x 10 7 cells.
  • the diffusion chambers are implanted so the broad membrane side is flat against the rectus abdominus muscle in all cases.
  • the orientation of the chambers is critical to biologically effective transmission of the triggering signal.
  • this mode which includes the rectus abdominus muscle as an acceptor site, is important because the lymphatic drainage of this area proceeds via the inguinal lymph nodes to the peri- aortic nodes, which, in turn, drain into the thoracic duct.
  • This pathway of drainage permits diffusible substances derived from the transduced cells to encounter peripheral lymphoid tissue via regional lymph nodes, which are approximately three centimeters from the implantation site.
  • the rectus sheath is re-approximated with 2-0 vicryl interrupted sutures to secure the diffusion chambers in the flat orientation.
  • the acceptor site is closed with a running 3-0 nylon interlocking suture and is appropriately dressed.
  • the patient is prepared for the procedure of surgical removal of the diffusion chambers.
  • the patient is sedated with 10 mg of Versed, and 1 g of Ancef antibiotic is infused for wound infection prophylaxis.
  • the previously prepared abdominal acceptor site is exposed and prepared with standard sterile procedure.
  • the site is draped, and 0.5% Sensorcaine is injected into the abdominal incision.
  • Metzenbaum scissors Utilizing Metzenbaum scissors, the wound is opened, thereby exposing the rectus sheath which was loosely approximated at bedside the previous day.
  • the sterile diffusion chambers are retrieved from the rectus sheath pockets and taken back to the laboratory where they are carefully examined. Specifically, the integrity of the membrane is inspected, and the contents of each chamber are noted for the presence of fibrinogen.
  • the volume recovered from each chamber is determined, and this volume should be same as the original recorded volume.
  • the cellular contents of each chamber are carefully examined, and the rate of viable cell recovery is quantitated.
  • the rectus sheath is reapproximated with 2-0 vicryl interrupted sutures, and the superficial fascia is reapproximated with 2-0 vicryl interrupted horizontal mattress sutures.
  • the skin is reapproximated with an interrupted vertical mattress suture utilizing 3-0 Nylon, and the wound is then appropriately dressed.
  • Example 2 Implantation Of Autologous Cell Lines, Homologous Cell Lines, Or Xenographic Cell Lines
  • Surgical candidates for this protocol are not candidates for craniotomy for tumor removal.
  • An example of patients in this group would include patients with brainstem gliomas - tumors often diagnosed radiographically without biopsy due to the dangerous location of these tumors.
  • the surgical paradigm utilized is the same as that described for days two and three.
  • an appropriate cell line is selected and pre-treated according to the same specifications for the freshly harvested autologous samples.
  • the in vitro incubation period and dose of oligonucleotide will also remain the same as for the harvested autologous samples described in detail above.
  • Routine vital signs and serial neurologic examinations proceed as per routine with standard post- craniotomy patients.
  • MRI scans with and without gadolinium are performed at the first and second post-operative weeks and at each month thereafter.
  • Image guided craniotomy (1) is performed to resect tumor.
  • the tumor is removed and placed in phosphate-buffered saline (2).
  • tumor tissue is transferred to a petri dish, where the tumor is comminuted into fine pieces with scalpels (3).
  • Disaggregation is continued by enzymatic digestion and single cells are plated in a T-25 tissue culture flask; after 4-6 hours, once the cells have attached, they are incubated with 2 mg of antisense DNA to the IGF-IR in a final volume of 20ml of serum- free medium for a minimum of six hours (4).
  • cells are detached and transferred to a 15ml conical tube for several washes (5).
  • the cells are encapsulated in diffusion chambers (6).
  • the cells encapsulated in the diffusion chambers are irradiated with 5 Gy of radiation (7).
  • Cells encapsulated in diffusion chambers are surgically implanted into the rectus sheath of a patient (8), and apoptosis occurs in vivo within 20 hours.
  • the chambers are removed from the patient's rectus sheath, and the wound is permanently closed (9).
  • the chambers are opened, and the cells are recovered (9).
  • the cells are transferred to an Eppendorf tube (10).
  • cells are washed (11), and the cells recovered from the diffusion chambers are analyzed for viability by trypan blue exclusion and they are quantitated in a hemocytometer (12).
  • Day 1 of the procedure The details of Day 1 of the procedure are as follows. Tumor tissue from the operating room is transported in a 50 cc conical tube to a BL-2 facility. In the BL-2 facility, the tumor is washed to eliminate red blood cells, and it is transferred to a petri dish and finely minced with scalpels in PBS (1). Cells are transferred to a 15ml tube and washed in PBS (2). Then, cells are transferred to a petri dish and dissociated with repeated cycles of enzymatic digestion (3). Next, cells are transferred to a 15ml conical tube and washed (4). The cells are plated in a T-25 tissue culture flask and allowed to attach (5).
  • IGF-IR antisense DNA is added to the incubation medium of 2 mg of IGF-IR antisense DNA in a final volume of 20ml of serum- free medium for a minimum of six hours.
  • cells are detached with trypsin; and the cells are transferred to a 15ml conical tube and washed carefully (1).
  • the effect of trypsin is stopped by adding medium supplemented with 10% serum; 10 6 cells suspended in 200 ⁇ l are loaded in each diffusion chamber, and the diffusion chambers are then irradiated with 5 Gy of radiation (2).
  • diffusion chambers are harvested from thepatient's abdomen. Each diffusion chamber is opened and cell contents are removed with an Eppendorf pipette (1).
  • Cells are then transferred to a 1ml Eppendorf tube and washed (2). The cells are counted in a hemocytometer (3). Cells recovered from the diffusion chambers are re-plated into a T-25 tissue culture flask to assess viability (4).
  • IGF-IR levels in the treated cells dropped to ⁇ 10%) as determined by Western blotting. Following 24 hour implantation, less than 2%> of the antisense treated cells could be recovered. At follow-up, 6 out of 10 evaluable patients revealed partial or complete radiographic and clinical responses. When compassionate re-treatment responses were included, 8 treatment responses were observed. Other than deep venous thrombosis in the first four patients, no other treatment-related side-effects were noted.
  • tumor tissue was confirmed by frozen section, and sent to a BL-2 facility for subsequent disaggregation and treatment.
  • Tumor samples were gently disaggregated first with a scalpel and then by enzymatic digestion under sterile conditions.
  • Cells were plated in compete culture medium (DMEM supplemented with 10%) fetal bovine serum, penicillin, streptomycin, and glutamine). When the cells attached, they were carefully washed and shifted to serum-free medium (DMEM supplemented with 1 ⁇ M ferrous sulfate and 0. 1%> BSA fraction V, and treated with an IGF-IR antisense oligonucleotide.
  • DMEM serum-free medium
  • GGACCCTCCTCCGGAGCC 18-mer phosphorothioate oligodeoxynucleotide (GGACCCTCCTCCGGAGCC; SEQ ID NO:3) targeting the IGF-IR RNA and starting 6 nucleotides downstream from the initiating methionine was used.
  • This antisense oligodeoxynucleotide was synthesized by Lynx Therapeutics (Hayward, California), Lot #LR4437-002A, the same Lot as previously described. After a minimum six hour incubation with a dose of 2 mg antisense/10 7 cells, the cells were harvested, carefully washed with PBS, calcium and magnesium- free, and placed in the diffusion chambers at a density of 10 6 cells/200 ⁇ l/ chamber.
  • the chambers are small Lucite rings (1.4 cm in diameter with a 0. Im pore-sized hydrophilic membrane at each end. They allow the passage of soluble factors (such as nutrients or peptides) impeding the exit or entry of intact cells.
  • the abdominal acceptor site was opened at bedside for diffusion chamber implantation.
  • a time window was selected so that tumor cells treated ex vivo with IGF-IR antisense oligodeoxynucleotide were detached, encapsulated in the chambers and non-lethally irradiated (5 Gy) at the same time the acceptor site was opened.
  • the rectus sheath pockets were exposed and up to 10 sterile diffusion chambers were implanted.
  • the diffusion chambers were retrieved from the rectus sheath pockets and the wound closed.
  • the chambers were transported to a BL-2 facility for analysis after recovery. Post-implantation surveillance included serial clinical and MRI examination.
  • the specificity of the antisense oligodeoxynucleotide targeting was determined by ruling out effects on the expression of other tyrosine kinase receptors at the cell surface, such as the focal adhesion kinase (see Figure 2, lower panel).
  • Integrity of the diffusion chambers was determined by measuring the volume before and after implantation. The volume originally loaded in each chamber was 200 ml and the volume recovered from each of the 146 implanted chambers was 198 ⁇ 2 ml. Cell recovery, determined after 24 hour implantation of the diffusion chambers, was ⁇ 2%> of the original cell number implanted. Meticulous microscopic analysis of the cells recovered from the chambers showed that only tumor cells (and mostly non- viable as indicated by trypan blue staining) could be recovered. No other cell types including lymphocytes, monocytes, macrophages, or dendritic cells could be identified. Also, the presence of GFAP-positive cells (a marker for glioma cells) in samples obtained from the abdominal acceptor site was ruled out.
  • GFAP-positive cells a marker for glioma cells
  • a regimen of DVT prophylaxis was established in all subsequent patients.
  • a three month regimen of enoxaparin prophylaxis was initiated which involved a daily 40 mg subcutaneous injection.
  • Non-invasive doppler studies were performed immediately before and after the completion of a 12 week course of enoxaparin treatment.
  • MRI scans were obtained within 48 hours to document residual tumor at treatment inception. Progression, regression or stability of disease was determined by changes in the assessment of seven image characteristics between serial studies including: (1) local mass effect; (2) size of T2-weighted abnormality (e.g. edema, tumor, radiation change); (3) size of the enhancing area; (4) characteristics of the enhancement (e.g. progression or regression of nodularity); (5) intensity of enhancing area; (6) invasion of the deep white matter tracts; and (7) distal progression.
  • T2-weighted abnormality e.g. edema, tumor, radiation change
  • size of the enhancing area e.g. edema, tumor, radiation change
  • characteristics of the enhancement e.g. progression or regression of nodularity
  • Radiographic evaluation was performed by assessing changes in any of these characteristics when comparable images from serial studies were evaluated. Each imaging characteristic was rated as increased, decreased, or without change. In all cases, MRI comparisons were performed for each patient by one neuroradiologist. The first comparison evaluated changes between an MRI study performed immediately following treatment and a follow-up examination performed approximately 4 weeks after initiation of therapy. Subsequent comparisons evaluated changes at two month intervals and later at three month intervals. Serial clinical examinations were independently performed by a neurosurgeon and a neurologist. Performance status was assessed according to the Karnofsky performance scale (KPS).
  • KPS Karnofsky performance scale
  • Complete response improvement in all assessable imaging characteristics between serial studies to either complete resolution or to a stable image with features consistent with post-operative and/or radiation changes, with improvement or stability of neurological and general physical examinations, off corticosteroid medication, for at least one month.
  • partial response improvement in two or more of assessable imaging characteristics, with improvement or stability of neurological and physical examinations, and a stable or decreasing corticosteroid dose, for at least one month.
  • stable disease no significant change in the imaging characteristics between serial studies with improvement or stability of neurological and physical examinations, and a stable or decreasing corticosteroid dose, for at least one month.
  • progressive disease An increase in the imaging characteristics between serial studies with deterioration of neurological and physical examinations, and with a stable or increasing corticosteroid dose.
  • DVT deep venous thrombosis
  • Treatment Response Clinical and Radiographic Observations
  • the patient had clinical improvement with return to all pre-morbid activities which corresponded to the radiographic improvement.
  • This patient succumbed to recurrent disease in the contralateral right frontopolar region and an autopsy has active tumor at the site of recurrence but only scattered tumor cells at the primary site.
  • compassionate retreatment was granted by the FDA and the IRB. After re-treatment, further radiographic loss of nodular enhancement remote from surgical resection occurred in all three with either clinical improvement or stabilization.
  • Treatment Response Histopathologic Observations Residual viable tumor cells were identified in all post-mortem examinations and in all post-therapy surgical biopsies. Individual cases were observed where the original tumor site either lost endothelial cell proliferation (Patient 1), tumor cell number and pleomorphism (Patient 7), or acquired extensive areas of necrosis (Patient 8 after re- treatment). Microthrombi limited only to tumor-associated blood vessels were identified in 6 of 10 cases for which post-therapy tissue was available. Also, varying degrees of tumor perivascular lymphocytic infiltration were identified in four cases in which no lymphocytic infiltrates were observed in pre-treatment tumor. In brain sections without identifiable tumor cells, inflammation, vasculitis, hemorrhage, necrosis, demyelination, or vessel thrombosis was not identified.
  • this treatment appears to yield an extraordinary therapeutic advantage as a biologic treatment of glioma.
  • the responses described herein were obtained when the antisense-treated tumor cells were encapsulated in diffusion chambers constructed with 0.1 m pore-sized hydrophilic membranes. This exclusion limit excludes cells and suggests that soluble factors released by the antisense-treated cells could be responsible for triggering these responses.
  • lymphocytic infiltrates A number of studies have documented lymphocytic infiltrates (LI) as a fairly common histologic feature of gliomas, but few have assessed LI as a possible response to treatment.
  • histologic specimens from 28 documented cases of LI were reviewed for LI variations in successive biopsies obtained before and after intervening treatments such as radiation therapy.
  • Sixteen of 17 cases revealed absence of LI at initial biopsy with continued absence through all subsequent biopsies.
  • the much higher frequency of newly identified LI in post-treatment tumor tissues suggests a treatment-related effect when compared to results in this study.
  • Previous studies have found a favorable correlation between perivascular LI and prognosis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Mycology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Developmental Biology & Embryology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un procédé permettant d'induire une résistance à la croissance tumorale ou une régression de la croissance tumorale. Ce procédé consiste à prendre des cellules tumorales et à les mettre en culture in vitro ou ex vivo avec en supplément un agent proapoptotique pendant un certain temps. Le procédé consiste ensuite à transférer ces cellules tumorales dans une chambre de diffusion, produisant ainsi une chambre contenant les cellules. Le procédé consiste enfin à introduire chez l'homme cette chambre pendant une période de traitement suffisante, ce qui induit une résistance à la croissance tumorale ou une régression de la croissance tumorale.
PCT/US1999/018306 1998-08-13 1999-08-13 Traitement de tumeurs au moyen d'oligonucleotides agissant sur le recepteur du facteur de croissance insulunoide i WO2000009145A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU54798/99A AU5479899A (en) 1998-08-13 1999-08-13 Treatment of tumors with oligonucleotides directed to insulin-like growth factor-i receptor
CA002339858A CA2339858A1 (fr) 1998-08-13 1999-08-13 Traitement de tumeurs au moyen d'oligonucleotides agissant sur le recepteur du facteur de croissance insulunoide i
JP2000564647A JP2002522506A (ja) 1998-08-13 1999-08-13 インスリン様増殖因子−ｉ受容体に向けられるオリゴヌクレオチドを用いた腫瘍の処置
EP99941078A EP1105150A1 (fr) 1998-08-13 1999-08-13 Traitement de tumeurs au moyen d'oligonucleotides agissant sur le recepteur du facteur de croissance insulunoide i

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US9635498P 1998-08-13 1998-08-13
US11359998P 1998-12-24 1998-12-24
US60/096,354 1998-12-24
US60/113,599 1998-12-24

Publications (1)

Publication Number Publication Date
WO2000009145A1 true WO2000009145A1 (fr) 2000-02-24

Family

ID=26791616

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/018306 WO2000009145A1 (fr) 1998-08-13 1999-08-13 Traitement de tumeurs au moyen d'oligonucleotides agissant sur le recepteur du facteur de croissance insulunoide i

Country Status (5)

Country Link
EP (1) EP1105150A1 (fr)
JP (1) JP2002522506A (fr)
AU (1) AU5479899A (fr)
CA (1) CA2339858A1 (fr)
WO (1) WO2000009145A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7326699B2 (en) 2001-05-14 2008-02-05 Novartis Ag 4-Amino-5-phenyl-7-cyclobutyl-pyrrolo(2,3-d)pyrimidine derivatives
EP3280806A4 (fr) * 2015-04-10 2018-12-05 Thomas Jefferson University Procédés et compositions de traitement de cancers et d'amélioration de l'immunité thérapeutique par réduction sélective des monocytes m2 immunomodulateurs
JP2020517631A (ja) * 2017-04-19 2020-06-18 バイオ−パス ホールディングス， インコーポレイテッド Ｉｇｆ−１ｒ阻害のためのｐ−エトキシ核酸
US11801259B2 (en) 2017-03-09 2023-10-31 Thomas Jefferson University Methods and compositions for treating cancers using antisense

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996014746A1 (fr) * 1994-11-16 1996-05-23 Thomas Jefferson University Procede pour induire une resistance a la croissance tumorale
WO1997018241A1 (fr) * 1995-11-14 1997-05-22 Thomas Jefferson University Methode pour provoquer une resistance a la croissance de tumeurs au moyen d'un recepteur de igf-1 soluble
WO1997037010A1 (fr) * 1996-04-01 1997-10-09 Apoptosis Technology, Inc. Domaines a activite de survie du recepteur du facteur i de croissance de type insulinique (igf-ir) et techniques d'utilisation
WO1999023259A1 (fr) * 1997-11-04 1999-05-14 Inex Pharmaceutical Corporation Composes antisens du recepteur du facteur de croissance de substances apparentees a l'insuline 1

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996014746A1 (fr) * 1994-11-16 1996-05-23 Thomas Jefferson University Procede pour induire une resistance a la croissance tumorale
WO1997018241A1 (fr) * 1995-11-14 1997-05-22 Thomas Jefferson University Methode pour provoquer une resistance a la croissance de tumeurs au moyen d'un recepteur de igf-1 soluble
WO1997037010A1 (fr) * 1996-04-01 1997-10-09 Apoptosis Technology, Inc. Domaines a activite de survie du recepteur du facteur i de croissance de type insulinique (igf-ir) et techniques d'utilisation
WO1999023259A1 (fr) * 1997-11-04 1999-05-14 Inex Pharmaceutical Corporation Composes antisens du recepteur du facteur de croissance de substances apparentees a l'insuline 1

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
RESNICOFF M ET AL: "Regression of C6 rat brain tumors by cells expressing an antisense insulin -like growth factor I receptor RNA.", JOURNAL OF EXPERIMENTAL THERAPEUTICS AND ONCOLOGY, (1996 NOV), vol. 1, no. 6, pages 385 - 389, XP002124516 *
RESNICOFF M. ET AL: "The insulin -like growth factor I receptor protects tumor cells from apoptosis in vivo.", CANCER RESEARCH, vol. 55, no. 11, 1995, pages 2463 - 2469, XP002124515 *
RESNICOFF M: "Antitumor effects elicited by antisense-mediated downregulation of the insulin -like growth factor I receptor (review).", INT J MOL MED, (1998 MAY), vol. 1, no. 5, pages 883 - 888, XP002124514 *
RESNICOFF, M. (1) ET AL: "Antitumor effects elicited by antisense-mediated downregulation of the IGF-1 receptor: From the bench to the bedside.", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL MEETING, (MARCH, 1999) VOL. 40, PP. 729. MEETING INFO.: 90TH ANNUAL MEETING OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH PHILADELPHIA, PENNSYLVANIA, USA APRIL 10-14, 1999, AACR, XP002124517 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7326699B2 (en) 2001-05-14 2008-02-05 Novartis Ag 4-Amino-5-phenyl-7-cyclobutyl-pyrrolo(2,3-d)pyrimidine derivatives
EP3280806A4 (fr) * 2015-04-10 2018-12-05 Thomas Jefferson University Procédés et compositions de traitement de cancers et d'amélioration de l'immunité thérapeutique par réduction sélective des monocytes m2 immunomodulateurs
US10265339B2 (en) 2015-04-10 2019-04-23 Thomas Jefferson University Methods and compositions for treating cancers and enhancing therapeutic immunity by selectively reducing immunomodulatory M2 monocytes
US11077133B2 (en) 2015-04-10 2021-08-03 Thomas Jefferson University Methods and compositions for treating cancers and enhancing therapeutic immunity by selectively reducing immunomodulatory M2 monocytes
US11801259B2 (en) 2017-03-09 2023-10-31 Thomas Jefferson University Methods and compositions for treating cancers using antisense
JP2020517631A (ja) * 2017-04-19 2020-06-18 バイオ−パス ホールディングス， インコーポレイテッド Ｉｇｆ−１ｒ阻害のためのｐ−エトキシ核酸
JP7186721B2 (ja) 2017-04-19 2022-12-09 バイオ－パス ホールディングス， インコーポレイテッド Ｉｇｆ－１ｒ阻害のためのｐ－エトキシ核酸

Also Published As

Publication number Publication date
EP1105150A1 (fr) 2001-06-13
CA2339858A1 (fr) 2000-02-24
JP2002522506A (ja) 2002-07-23
AU5479899A (en) 2000-03-06

Similar Documents

Publication Publication Date Title
Bennett et al. Inhibition of vascular smooth muscle cell proliferation in vitro and in vivo by c-myc antisense oligodeoxynucleotides.
US7235534B2 (en) Antisense strategy to modulate estrogen receptor response (ER α and/or ER β )
EP1729788B1 (fr) Traitement de la restenose a l'aide de cellules souches mesenchymateuses
CN107106564A (zh) 用于治疗与kras突变相关的恶性肿瘤的方法和组合物
US20200197432A1 (en) Methods And Compositions For Controlling Cardiac Fibrosis And Remodeling
US6506415B2 (en) Method of inducing resistance to tumor growth
US6541036B1 (en) Treatment of tumors with oligonucleotides directed to insulin-like growth factor-I receptors (IGF-IR)
JP2001504487A (ja) インスリン様生長因子１型受容体（ｉｇｆ―１ｒ）アンチセンスオリゴヌクレオチド処理乳癌細胞組成物
WO2011031299A1 (fr) Injections intrapéricardiques
EP1105150A1 (fr) Traitement de tumeurs au moyen d'oligonucleotides agissant sur le recepteur du facteur de croissance insulunoide i
Zhao et al. Soluble factor (s) from bone marrow cells can rescue lethally irradiated mice by protecting endogenous hematopoietic stem cells
US20020164624A1 (en) VEGF-D expression in brain cancer
CA2660661A1 (fr) Cellules de population laterale intervenant dans la reparation cardiaque
CN106456771A (zh) 用于抗lyst免疫调节的组合物和方法
WO2009052211A1 (fr) Compositions et procédés permettant d'améliorer la lymphangiogenèse
CN115381949A (zh) 靶向抑制色素上皮衍生因子在促进肝脏再生及改善肝损伤中的应用
JP4170421B2 (ja) 増殖性臓器疾患治療・改善剤
KR20110132908A (ko) Ｔｌｅ1 억제제를 유효성분으로 함유하는 활액막 육종 예방 및 치료용 약학적 조성물
KR20230031285A (ko) 레티노이드와 암 치료제의 병용 요법이 효과적인 암 환자를 선별하는 방법 및 레티노이드와 암 치료제의 병용 의약
Zhang et al. Rac1+ cells distributed in accordance with CD 133+ cells in glioblastomas and the elevated invasiveness of CD 133+ glioma cells with higher Rac1 activity
CN112957475B (zh) 一种预防和或治疗肿瘤的组合物及应用
CN112057471B (zh) 间充质干细胞的制药用途
JP2003527096A (ja) Ｃ−ｍｙｃアンチセンス処理した造血幹細胞組成物および方法
CN117323334A (zh) Nhe1抑制剂在制备防治多发性骨髓瘤的药物中的应用
Frankel et al. Antisense oligonucleotide—induced inhibition of adrenocorticotropic hormone release from cultured human corticotrophs

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 54798/99

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2339858

Country of ref document: CA

Ref country code: CA

Ref document number: 2339858

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1999941078

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1999941078

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1999941078

Country of ref document: EP