WO2000005388A1 - Gene der dead box proteinfamilie, deren expressionsprodukte und verwendung - Google Patents

Gene der dead box proteinfamilie, deren expressionsprodukte und verwendung Download PDF

Info

Publication number
WO2000005388A1
WO2000005388A1 PCT/EP1999/004892 EP9904892W WO0005388A1 WO 2000005388 A1 WO2000005388 A1 WO 2000005388A1 EP 9904892 W EP9904892 W EP 9904892W WO 0005388 A1 WO0005388 A1 WO 0005388A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
polypeptide
nucleic acids
rna
seq
Prior art date
Application number
PCT/EP1999/004892
Other languages
English (en)
French (fr)
Inventor
Karin Bohnet
Christoph Hüls
Stefan Müllner
Original Assignee
Aventis Research & Technologies Gmbh & Co. Kg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aventis Research & Technologies Gmbh & Co. Kg filed Critical Aventis Research & Technologies Gmbh & Co. Kg
Priority to AU50365/99A priority Critical patent/AU757920B2/en
Priority to CA002335646A priority patent/CA2335646A1/en
Priority to EP99934671A priority patent/EP1098985A1/de
Priority to JP2000561334A priority patent/JP2002524029A/ja
Publication of WO2000005388A1 publication Critical patent/WO2000005388A1/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates to the provision of new nucleic acids from ciliates coding for expression products, preferably RNA helicases from the DEAD box protein family, and to the use thereof.
  • the modulation of the RNA structure has an essential function in cellular processes such as in pre-mRNA splicing, in RNA transport or in protein translation, since the cellular RNA is present in the cell in different secondary and tertiary structures and, in addition, a large number of RNA-binding proteins ensure further structuring of the RNA. On this
  • Modulation processes include Proteins from the family of the so-called DEAD protein family are involved.
  • the members of this protein superfamily which contain as a characteristic a series of homologous protein sequences, so-called “protein boxes”, are named as motifs after the highly conserved tetrapeptide Asp-Glu-Ala-Asp, in the single-letter code DEAD.
  • This protein superfamily includes, in particular, RNA helicases.
  • the characteristic protein sequences of the DEAD proteins are highly conserved in evolution (see FIG. 1).
  • the DEAD super family is divided into different subfamilies, which are named according to their sequence motif DEAD, DEAH or DExH subfamily. All family members have an ATP binding and RNA binding function as well as an ATP hydrolysis function and mostly an RNA helicase function (FIG. 2).
  • the various members of the DEAD box protein family are characterized by a conserved region that comprises approximately 300 amino acids and is flanked by non-conserved amino acid sequences of varying lengths (Schmid SR, Lindner P., Mol Cell Biol 1991 11: 3463-3471).
  • homology boxes within the conserved region are the so-called homology boxes (synonymously preserved motifs), one of which is the "DEAD box”.
  • the homology boxes give the members of the DEAD box family not only structural but also functional similarity. Taking into account the homology boxes (see figure 2) DEAD box proteins are putative ATP-dependent RNA helicases, which are involved in a large number of cellular processes and are associated with the change in the secondary structure of RNA molecules (Fuller-Pace FV Trends Cell Biol.
  • RNA helicases corresponding to the DEAD homology boxes in cellular processes, preferably in the context of protein biosynthesis, allow these enzymes to be used in a targeted manner with regard to pharmaceutical, agricultural or biotechnical and analytical applications.
  • helicases are mostly essential enzymes, specific inhibition of these enzymes can kill the pathogen (bacteria, fungus, parasite / protozoan, virus). According to Missel et al. in certain protozoa (Trypanosoma, Leishmania, Crithidia), switching off the gene for a DEAD box protein leads to reduced growth (Missel A., Souza AE, Norskau G, Goringer HU, Mol Cell Biol 1997 17: 4895-903).
  • helicases control protein translation, mitosis and DNA repair (Thelu J, Burnod J, Bracchi V, Ambroise-Thomas P, DNA Cell Biol 1994 13: 1109-1115). Helicases are essential for the initiation of translation, in the spliceosome, in the cell cycle and ribosome assembly in yeast. So z. B. the DEAD box protein ROK1 essential for yeast viability, for pre-rRNA processing, and for mitotic growth.
  • RNA viruses whose genomes are sequenced code for at least one putative helicase.
  • examples are NS3 of the hepatitis C virus, helicases of the human coronavirus and the adeno-associated virus, vaccinia virus helicase (Kadare G., Haenni AL, J Virol 1997: 2583-2590)
  • Possible roles for viral helicases are (i) proof reading in replication (ii) initiation of transcription by unraveling the RNA and prevention of loop formation behind the RNA polymerase (iii) initiation Translation:
  • the helicase of the vaccinia virus is essential for the life cycle of the virus and is nucleic acid specific.
  • DEAD box proteins are also described in association with diseases.
  • the ampiification of a specific gene in cancer cells is related to the fact that a DEAD box protein is co-amplified with N-myc, which indicates a role of this protein in the degeneration of
  • Helicase are related to Werner syndrome - early aging - (Yu C, Oshima J., Wijsman E.M., Nakura J. et al., Arn J Hum Genet 1997 60: 330-
  • a connection between defective DNA repair and a mutation in the helica domain of the XNP / ATR-X gene is also known: 149-155).
  • helicases from plants are of great interest.
  • Some DEAD box proteins from plants are now known (Lorkovic ZJ, Herrmann RG, Oelmüller R., Mol Cell Biol 1997 17: 2257-2265 and Aulaub et al., Gene 1997 199 (1-2): 241-253) . Structurally, these proteins are similar to the DEAD box proteins from non-plant organisms, but form a subgroup (Fig. 3).
  • Figure 3 shows the phylogenetic relationship of different elFA4, one of the best characterized members of the DEAD box protein family, from different organisms. The vegetable proteins are much more closely related to each other than to elF4A from animal eukaryotes.
  • An application of interest for agricultural production is the stimulation of the activity of plant-specific RNA helicases to increase the protein expression of economically relevant proteins.
  • You can either stimulate plant-specific helicases (e.g. by overexpression) or plant-like helicases can be heterologously expressed in useful plants.
  • nucleic acids which preferably code for RNA helicases.
  • RNA helicases which are preferably obtained from ciliates, particularly preferably Tetrahymena thermophila.
  • the nucleic acids according to the invention code for expression products which come from the family of DEAD box proteins and thus also for RNA helicases.
  • Expression products preferably proteins from the DEAD protein superfamily in the sense of this invention, are those which have conserved motifs, of which a conserved motif contains the amino acid sequence DEAD.
  • the proteins preferably contain an RNA helicase and ATP ase activity.
  • the present invention therefore relates to nucleic acids coding for RNA helicases, with a nucleic acid sequence according to SEQ ID No. 13 or SEQ ID No. 15 or a functional variant thereof, and parts thereof with at least 8 nucleotides, preferably with at least 15 or 20 nucleotides, in particular with at least 100 nucleotides, especially with at least 300 nucleotides (hereinafter referred to as “nucleic acids according to the invention”).
  • the nucleic acid according to the invention with the nucleic acid sequence according to SEQ ID No. 13 (hereinafter “Hc1”) codes for an amino acid sequence according to SEQ ID No. 14.
  • the nucleic acid according to the invention with the nucleic acid sequence according to SEQ ID No. 15 (hereinafter “Hc2”) codes for an amino acid sequence according to SEQ ID No. 16.
  • nucleic acids according to the invention in E. coli resulted in an expression product which shows enzymatic activities similar to those of an RNA helicase. Further experiments according to the present invention confirmed that the nucleic acid is a nucleic acid which codes for an RNA helicase, in particular due to the presence of the characteristic homology boxes as described in SEQ ID No. 14 and SEQ ID No. 16, which are shown in Figure 1.
  • the nucleic acid according to the invention is a DNA or RNA, preferably a double-stranded DNA, and in particular a DNA with a nucleic acid sequence coding for RNA helicases.
  • the term “functional variant” means a nucleic acid that is functionally related to RNA helicases with the described homology boxes.
  • variants means nucleic acids which have a homology, in particular a sequence identity of approximately 60%, preferably approximately 75%, in particular approximately 90% and above all approximately 95 % exhibit.
  • the parts of the nucleic acid according to the invention can be used, for example
  • nucleic acid of at least approx. 8 nucleotides is suitable as an antisense nucleic acid
  • a nucleic acid of at least approx. 15 nucleotides as a primer in the PCR method is suitable as an antisense nucleic acid
  • a nucleic acid of at least approx. 20 nucleotides for the identification of further variants is suitable as a probe.
  • nucleic acids according to the invention can be used to construct complementary or antisense nucleic acids which hybridize with Hc1 or Hc2 itself or with related nucleic acids.
  • the introduction of the complementary or antisense nucleic acid into the target cell prevents the expression of related RNA helicases or related expression products.
  • Anti-sense nucleic acids which can be obtained from the nucleic acids according to the invention can therefore be used for the specific regulation of gene expression.
  • Either the target cell can be transfected with the anti-gene using known methods, which is then transcribed in the cell, or antisense RNA or DNA synthesized in vitro is introduced into the target cell via microinjection. It is known that gene expression can be inhibited by anti-sense RNA which is complementary to the coding region of the Target mRNA is.
  • the duplex strand formed from mRNA and anti-sense RNA is amenable to rapid degradation by RNAsen.
  • the nucleic acid according to the invention contains one or more non-coding sequences and / or a poly (A) sequence.
  • the non-coding sequences are, for example
  • Intron sequences or regulatory sequences such as promoter or enhancer sequences, for the controlled expression of the expression products, preferably of RNA helicases.
  • the nucleic acid according to the invention is therefore contained in a vector, preferably in an expression vector or vector which is active in gene therapy.
  • the expression vectors can be, for example, prokaryotic or eukaryotic expression vectors.
  • prokaryotic expression vectors for expression in E. coli are, for example, the T7 expression vector pGM10 or pGEX-4T-1 GST (Pharmacia Biotech), which codes for an N-terminal Met-Ala-His6 tag, which expresses an advantageous purification of the Proteins enabled on a Ni 2+ NTA column.
  • suitable eukaryotic expression vectors for expression in Saccharomyces cerevisiae are the vectors p426Met25 or p426GAL1 (Mumberg et al. (1994) Nucl.
  • the expression vectors also contain suitable regulatory sequences for the host cell, such as the trp promoter for expression in E. coli (see, for example, EP-B1-0154133) in E. coli, the ADH-2 promoter for expression in yeasts (Rüssel et al. (1983), J. Biol. Chem.
  • the baculovirus polyhedrin promoter for expression in insect cells see, for example, EP-B1-0127839) or the early SV40 promoter or LTR promoters, for example from MMTV (Mouse Mammary Tumor Virus; Lee et al. (1981) Nature, 214, 228).
  • MMTV Mammary Tumor Virus
  • the recombinant proteins obtained in this way are purified using suitable methods (e.g. affinity chromatography, HPLC, FPLC) and brought into solution (guanidine, urea).
  • suitable methods e.g. affinity chromatography, HPLC, FPLC
  • guanidine, urea guanidine, urea
  • the characterization of the proteins and the determination of the enzyme activity is carried out using established tests (RNA binding, ATPase activity, helicase activity).
  • virus vectors preferably adenovirus vectors, in particular replication-deficient adenovirus vectors, or adeno-associated virus vectors, e.g. B. a
  • Adeno-associated virus vector consisting exclusively of two inserted terminal repeat sequences (ITR).
  • Suitable adenovirus vectors are described, for example, in McGrory, W.ü. et al. (1988) Virol. 163, 614; Gluzman, Y. et al. (1982) in "Eukaryotic Viral Vectors” (Gluzman, Y. ed.) 187, Cold Spring Harbor Press, Cold Spring Habor, New York; Chroboczek, J. et al. (1992) Virol. 186, 280; Karlsson, S et al. (1986) EMBO J .. 5, 2377 or WO95 / 00655.
  • Suitable adeno-associated virus vectors are described, for example, in Muzyczka, N. (1992) Curr. Top. Microbiol. Immunol. 158, 97; W095 / 23867; Samulski, R.J. (1989) J. Virol, 63, 3822; WO95 / 23867; Chiorini, J.A. et al. (1995) Human Gene Therapy 6, 1531 or Kotin, R.M. (1994) Human Gene Therapy 5, 793.
  • Vectors with gene therapy effects can also be obtained by complexing the nucleic acid according to the invention with liposomes.
  • Lipid mixtures such as those of Feigner, PL et al. (1987) Proc. Natl. Acad. Sei, United States 84, 7413; Behr, JP et al. (1989) Proc. Natl. Acad. Be. USA 86, 6982; Feigner, JH et al. (1994) J. Biol. Chem. 269, 2550 or Gao, X. & Huang, L (1991) Biochim. Biophys. Acta 1189, 195.
  • the DNA is ionically bound to the surface of the liposomes in such a ratio that a positive net charge remains and the DNA is completely complexed by the liposomes.
  • nucleic acids according to the invention can be chemically described, for example, in SEQ ID no. 13 and SEQ ID No. 15 disclosed sequence or using the SEQ ID No. 14 and SEQ ID No. 16 disclosed peptide sequence using the genetic code z. B. can be synthesized by the phosphotriester method (see e.g. Uhlman, E. & Peyman, A. (1990) Chemical Reviews, 90, 543, No. 4).
  • nucleic acids according to the invention itself and variants is isolation from a suitable gene bank using a suitable probe (see, for example, Sambrook, J. et al. (1989) Moiecular Cloning. A laboratory manual. 2nd Edition, Cold Spring Harbor , New York).
  • Suitable as a probe are, for example, single-stranded DNA fragments with a length of approximately 100 to 1000 nucleotides, preferably with a length of approximately 200 to 500 nucleotides, in particular with a length of approximately 300 to 400 nucleotides, the sequence of which is based on the nucleic acid sequence Figures 4 and 6 can be derived.
  • Another object of the invention is the use of the nucleic acids according to the invention for specifically influencing protein biosynthesis.
  • Protein biosynthesis b) a faster degradation by the degradasome and thus a reduced protein biosynthesis.
  • Inhibition of helicase activity can Inhibit degradation by the degradasome and lead to reduced protein biosynthesis.
  • the basis for this is the finding that important biosynthetic processes can be regulated in a targeted manner by the selective inhibition or activation of helicases.
  • nucleic acids are expressed recombinantly in suitable target organisms as described.
  • the nucleic acids according to the invention are an excellent model for various eukaryotic RNA helicases, preferably from humans and parasites (FIG. 3A).
  • the genetic relationship of Hc1 to relevant eukaryotic helicases is close enough to draw conclusions about the structure and function of other eukaryotic helicases (e.g. human) from experiments with Hc1.
  • Figure 3A shows the genetic relationship of some helicases from different organisms compared to Hc1.
  • the great structural similarity between Hc1 and mammalian helicases from humans and mice and the great structural difference between Hc1 and known viral helicases is particularly surprising.
  • the nucleic acids according to the invention preferably Hc2 have proven to be an excellent model for various eukaryotic RNA helicases, preferably from plants.
  • FIG. 3B shows the genetic relationship of some RNA helicases from different organisms in comparison to Hc2.
  • the great structural similarity between Hc2 and RNA helicases from plants is particularly surprising.
  • the recombinant expression of Hc2 enables the use of this new enzyme as a model for research into plant helicases in particular, their structure and function, and for the development of suitable inhibitors or activators of these important enzymes.
  • Another object of the invention is therefore the targeted heterologous expression - by means of overexpression according to known methods - of the nucleic acids according to the invention, preferably Hc2, in suitable crop plants for the potential increase in the biosynthesis of relevant proteins.
  • the nucleic acids according to the invention can be introduced into plants using recombinant DNA technologies.
  • the introduction of the foreign gene with the aid of Agrobacterium tumefaciens can be used as a method.
  • the foreign gene is introduced into the bacterial genome in a known manner.
  • the genes of the bacterium, including the foreign gene are stably integrated into the genome of the plant (Chiiton M.D. et al., Cell 1977 11: 263, Barton K.A. et al., Cell 1983 32: 1033).
  • This method is preferably used for the transformation of dicotelydones.
  • the known methods such as calcium phosphate precipitation, PEG treatment, electroporation, or a can be used to transform monocotelydones
  • Another object of the invention is the use of nucleic acids as selection markers in molecular biology.
  • Conventionally used selection markers are antibiotics.
  • Molecular biologically modified organisms carry a gene that confers resistance to an antibiotic. The organisms are grown in a medium containing antibiotics, so that only the carriers of the resistance gene can develop.
  • helica genes can be used as “resistance genes”. It has been shown (Müilner et al, patent application DPA 19545126.0) that the overexpression of a helica gene in mouse cells gives these cells tolerance to an otherwise toxic substance, leflunomide.
  • nucleic acids as selection markers in molecular biology
  • a suitable vector such as described
  • the nucleic acids according to the invention are to be introduced into cells and selected with a suitable substance, such as leflunomide), against which the cells are tolerant by overexpression of the helicase.
  • Another object of the present invention are also
  • polypeptides and polypeptide fragments which encode Hc1 and Hc2 themselves, with amino acid sequences according to SEQ ID No. 14 and SEQ ID No. 16 or a functional variant thereof, and parts thereof with at least six amino acids, preferably with at least 12 amino acids, in particular with at least 65 amino acids and especially with 257 amino acids Hc1 and 255 amino acids Hc2 (hereinafter referred to as “inventive polypeptides”) 6-12, preferably about 8 amino acid long polypeptide contain an epitope which, after coupling to a support, is used to produce specific poly- or monoclonal antibodies (see, for example, US Pat. No. 5,656,435). Polypeptides with a length of at least about 65 amino acids can also be used directly without carriers for the production of poly- or monoclonal antibodies.
  • RNA helicase activity RNA helicase activity
  • this also includes polypeptides, the one
  • Sequence homology in particular a sequence identity of approx. 70%, preferably of approx. 80%, in particular of approx. 90%, especially of approx. 95% to the polypeptides with the amino acid sequences according to FIGS. 5 and 7. Furthermore, this also includes deletion of the polypeptide in the range from about 1-60, preferably from about 1-30, in particular from about 1-15, especially from about 1-5 amino acids.
  • This also includes fusion proteins which contain the inventive polypeptides described above, the Fusion proteins themselves already have the function of an RNA helicase or can only get the specific function after the fusion portion has been split off. Above all, this includes fusion proteins with a proportion of in particular non-human sequences of about 1 to 200, preferably about 1 to 150, in particular about 1 to 100, especially about 1 to 50 amino acids. Examples of non-human
  • Peptide sequences are prokaryotic peptide sequences, e.g. from the E. coli galactosidase or a so-called histidine tag, e.g. a Met-Ala-His6 tag.
  • a fusion protein with a so-called histidine tag is particularly advantageous for purifying the expressed protein via columns containing metal ions, for example via a Ni2 + -NTA column.
  • NTA stands for the chelator "nitrilotriacetic acid” (Qiagen GmbH, Hilden).
  • the parts of the polypeptide according to the invention represent, for example, epitopes that can be specifically recognized by antibodies.
  • polypeptides according to the invention are a member of the so-called DEAD super protein family.
  • Figure 1 shows the conserved motifs which are characteristic of this class of RNA helicases. All of these motifs are highly conserved within the family and are also found in the polypeptides according to the invention.
  • polypeptide according to the invention is obtained, for example, by expression of the nucleic acid according to the invention in a suitable expression system, as already described above, according to the method generally known to the person skilled in the art
  • Another object of the present invention therefore relates to a method for producing a polypeptide according to the invention, wherein a nucleic acid according to the invention is expressed in a suitable host cell and optionally isolated.
  • the parts of the polypeptide mentioned can also be synthesized with the aid of classic peptide synthesis (Merrifield technique). You are suitable in particular for the production of antisera, with the aid of which suitable gene expression banks can be searched in order to arrive at further functional variants of the polypeptide according to the invention.
  • Another object of the present invention also relates to antibodies which react specifically with the polypeptide according to the invention, the above-mentioned parts of the polypeptide either being themselves immunogenic or by coupling to suitable carriers, such as e.g. bovine serum albumin, immunogenic or can be increased in their immunogenicity.
  • suitable carriers such as e.g. bovine serum albumin
  • the antibodies are either polyclonal or monoclonal.
  • the preparation which is also an object of the present invention, is carried out, for example, by generally known methods by immunizing a mammal, for example a rabbit, with the polypeptide according to the invention or the parts thereof, optionally in the presence of e.g. Freund's adjuvant and / or aluminum hydroxide gels (see e.g. Diamond, B.A. et al. (1981) The New England Journal of Medicine, 1344).
  • the polyclonal antibodies produced in the animal due to an immunological reaction can then be easily isolated from the blood by generally known methods and z. B. clean over column chromatography.
  • Monoclonal antibodies can be produced, for example, by the known method from Winter & Milstein (Winter, G. & Milstein, C. (1991) Nature, 349, 293).
  • Another object of the present invention is also a medicament which contains a nucleic acid or a polypeptide according to the invention and optionally suitable additives or auxiliaries and a method for producing a medicament for the treatment of cancer, autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's Disease, allergies, especially neurodermatitis, type I allergies or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or to influence cell metabolism, in particular in immunosuppression, especially in transplants and / or hereditary diseases, in particular Werner syndrome, Bloom syndrome, Xeroderma pigmentosa, connective tissue diseases, in which a nucleic acid according to the invention, for example a so-called antisense nucleic acid , or a polypeptide according to the invention is formulated with pharmaceutically acceptable additives and / or auxiliaries.
  • autoimmune diseases in particular multiple sclerosis or rheumatoid arthritis,
  • a drug which contains the nucleic acid according to the invention in naked form or in the form of one of the above-described gene therapy-effective vectors or in a form complexed with liposomes is particularly suitable for gene therapy use in humans.
  • Suitable additives and / or auxiliary substances are, for. B. a physiological saline, stabilizers, proteinase inhibitors, nuclease inhibitors etc.
  • Another object of the present invention is also a diagnostic agent containing the nucleic acids according to the invention, the polypeptides according to the invention or antibodies according to the invention and optionally suitable additives and / or auxiliaries and a method for producing a
  • Diagnostic agent for the diagnosis of cancer autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, in particular neurodermatitis, type I allergies or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or for Analysis of the cell metabolism, in particular the immune status, especially in the case of transplants and / or for analysis of hereditary diseases, in particular Werner syndrome, Bloom syndrome, Xeroderma pigmentosa, connective tissue diseases, in which a nucleic acid according to the invention, a polypeptide according to the invention or antibodies according to the invention with suitable additives or auxiliary materials are added.
  • a diagnostic agent based on the Polymerase chain reaction PCR diagnostics, for example according to EP-0200362
  • a Northern blot can be produced. These tests are based on the specific hybridization of the nucleic acid according to the invention with the complementary counter strand, usually the corresponding mRNA.
  • the nucleic acid according to the invention can also be modified here, as described, for example, in EP0063879.
  • a DNA fragment according to the invention is preferably labeled using suitable reagents, for example radioactive with ⁇ -P32-dATP or non-radioactive with biotin, according to generally known methods and incubated with isolated RNA, which was preferably bound to suitable membranes made of cellulose or nylon, for example .
  • RNA it is also advantageous to separate the isolated RNA prior to hybridization and binding to a membrane, for example by means of agarose gel electrophoresis. With the same amount of RNA examined from each tissue sample, the amount of mRNA that was specifically labeled by the probe can thus be determined.
  • Another diagnostic agent contains the polypeptide according to the invention or the immunogenic parts thereof described in more detail above.
  • the polypeptide or parts thereof which are preferably attached to a solid phase, e.g. B. from nitrocellulose or nylon, for example, with the body fluid to be examined z. As blood, are brought into contact in vitro, for example with
  • the antibody-peptide complex can then be detected, for example, using labeled anti-human IgG or anti-human IgM antibodies.
  • the label is, for example, an enzyme, such as peroxidase, that catalyzes a color reaction. The presence and the amount of autoimmune antibodies present can thus be easily and quickly detected via the color reaction.
  • Another diagnostic agent contains the antibodies according to the invention themselves. With the aid of these antibodies, for example, a tissue sample from humans can be easily and quickly examined to determine whether the polypeptide in question is present.
  • the antibodies according to the invention are labeled, for example, with an enzyme, as already described above.
  • the specific one Antibody-peptide complex can be detected easily and just as quickly via an enzymatic color reaction.
  • Another object of the present invention also relates to a test for the identification of functional interactors, such as e.g. Inhibitors or stimulators containing a nucleic acid according to the invention, a polypeptide according to the invention or the antibodies according to the invention and, if appropriate, suitable additives and / or auxiliaries.
  • functional interactors such as e.g. Inhibitors or stimulators containing a nucleic acid according to the invention, a polypeptide according to the invention or the antibodies according to the invention and, if appropriate, suitable additives and / or auxiliaries.
  • a suitable test for identifying functional interactors is e.g. B. the so-called "two-hybrid system" (Fields, S. & Sternglanz, R. (1994) Trends in Genetics, 10, 286).
  • a cell for example a yeast cell
  • one or more expression vectors or transfected which express a fusion protein which contains the polypeptide according to the invention and a DNA binding domain of a known protein, for example from Gal4 or LexA from E. coli, and / or express a fusion protein which contains an unknown polypeptide and a transcription activation domain, for example of Gal4, herpesvirus VP16 or B42, and the cell also contains a reporter gene, for example the LacZ gene from E.
  • the unknown polypeptide is encoded, for example, by a DNA fragment that comes from a gene bank, for example from a human gene bank immediately produced a cDNA library using the expression vectors described in yeast so that the test can be carried out immediately thereafter.
  • the nucleic acid according to the invention is cloned in a functional unit to the nucleic acid coding for the lexA-DNA binding domain, so that a fusion protein from the polypeptide according to the invention and the LexA-DNA binding domain is expressed in the transformed yeast.
  • cDNA fragments from one Cloned cDNA library in functional unit to the nucleic acid coding for the Gal4 transcription activation domain, so that a fusion protein from an unknown polypeptide and the Gal4 transcription activation domain is expressed in the transformed yeast.
  • the yeast transformed with both expression vectors, which is for example Leu2- additionally contains a nucleic acid which codes for Leu2 and is controlled by the LexA promoter / operator.
  • the Gal4 transcription activation domain binds to the LexA promoter / operator via the LexA-DNA binding domain, whereby the latter is activated and the Leu2 gene is expressed.
  • the Leu2 yeast can grow on minimal medium that does not contain leucine.
  • the activation of the transcription can be demonstrated by the formation of blue or green fluorescent colonies.
  • the blue or fluorescent staining can also be done easily quantify in the spectrophotometer eg at 585 nM in the event of a blue color.
  • expression gene banks can be easily and quickly searched for polypeptides that interact with the polypeptides according to the invention.
  • the new polypeptides found can then be isolated and further characterized.
  • the present invention is therefore not only intended for a method for finding polypeptide-like interactors, but also extends to a method for finding substances which are identical to those described above Protein-protein complex can interact.
  • Such peptide-like as well as chemical interactors are therefore referred to in the context of the present invention as functional interactors which can have an inhibiting or a stimulating effect.
  • Figure 1 shows schematically the conserved areas (homology boxes) of the proteins from the DEAD protein superfamily. The numbers between the areas indicate the distances in amino acids between the homoboxes.
  • Figure 2 schematically describes the conserved areas and their known functions of the expressed proteins according to Guer Pace, F.V. (1994) supra.
  • FIGS. 3A and 3B describe the phylogenetic trees of Hc1 and Hc2 and establish the evolutionary relationships. These figures were created with the program: Lasergene (module MegAlign 3.1.7) from the company: DNASTAR Inc .; using the Clustal algorithm (Higgins D.G, Sharp P.M., CABIOS (1989), Vol. 5, no.2, 151-153).
  • SEQ ID No. 13 shows the nucleic acid sequence of Hc1.
  • SEQ ID No. 14 shows the amino acid sequence corresponding to SEQ No. 13th
  • SEQ ID No. 15 shows the nucleic acid sequence of Hc2.
  • SEQ ID No. 16 shows the amino acid sequence corresponding to SEQ No. 15.
  • the practical work that has led to the present invention is mainly based on established, known methods of microbiology, molecular biology and recombinant DNA technology.
  • Tetrahymena thermophila, strain B1868IV was inoculated in PPYS medium (10 g / l proteose peptone no.3 DIFCO, 1 g / l yeast extract DIFCO, 10 mg sodium citrate, 24.3 mg FeCI 3 ) in a 500 ml flask (100,000 cells / ml PPYS) and incubated for 2-3 days at 25 ° C and 100-150 rpm, up to a cell density of approx. 1 million / ml.
  • PPYS medium 10 g / l proteose peptone no.3 DIFCO, 1 g / l yeast extract DIFCO, 10 mg sodium citrate, 24.3 mg FeCI 3
  • RNA pellet is obtained by centrifugation (10 min, 10,000xg, 4 ° C). The pellet is washed two more times, dried and taken up in DEPC water. After a 10-15 minute incubation at 55-60 ° C the RNA can be stored at -80 ° C. From the total RNA, mRNA is purified using oligo (dT) -sepharose (Clontech mRNA Separator Kit # K1040-2) Example 3: Preparation of cDNA
  • PCR polymerase chain reaction
  • PCR program was 5 min 95 ° C, 95 ° C / 37s - 50 ° C / 37s - 72 ° C / 37s - 30 cycles.
  • Example 5 Cloning and sequencing of the fragments After PCR, the PCR product is separated on a 1% agarose gel. The specific fragments are cut out and purified using the QIAGEN Gel Extraction Kit. The purified fragments are used directly for cloning (Invitrogen Original TA Cloning Kit # K2000-01). Positive clones are grown in shake culture and the plasmid DNA is purified using the QIAGEN Maxi Prep Kit. Sequencing is performed using the AbiPrism Model 377 automated sequencer.
  • Hc1 and Hc2 are cloned into a suitable vector, preferably pGEX-4T-1 GST fusion vector (Pharmacia Biotech).
  • a suitable vector preferably pGEX-4T-1 GST fusion vector (Pharmacia Biotech).
  • Hc1 and Hc2 are prepared from Tetrahymena thermophila cDNA using suitable primers using PCR.
  • a standard PCR approach contains 10 mM Tris-HCl, pH 8.3, 50mM KCI, 1.5mM MgCl2, 0.001% gelatin, 75 ⁇ M dNTP, 0.3ng of each primer, 0.5 ⁇ l cDNA, 0.5U Taq polymerase.
  • the primers (2A) 5 ' ATAAGAATGCGGCCGCTGTTCTACCGATTCTGTGAATATA 3 ' (3A) 5 ' CGCGGATCCTC ACT GGT TCG GGT AAG ACT GCT ACT TTC TCT 3 were used to amplify the fragment Hc1, and the primers TACTACATAATAATAATCATAATAATAAGAATAATCATAAGAATAATCATAAGAATAATCATAAGAATAATCAGAATAAGAATAAGAATAATCAGAATAAGAATAAGAATAATCAGAATAAGAATCAGAATAAGAAT (3) (TAGGATAAGAATCATAAGAAT) were used to amplify the fragment Hc2 '(8A) 5' ATAAGAATGCGGCCGCGTTCTACCGATTCTGTGGACATAG 3 'used.
  • Primer (2A) contains a NotI interface, (3A) a BamHI interface, (7A) an EcoRI and (8A) a NotI interface.
  • the PCR program was 5 min 95 ° C, 95 ° C / 37s - 50 ° C / 37s - 72 ° C / 37s - 30 cycles.
  • the fragments to be cloned are purified using a 1% agarose gel (QIAgen gel extraction kit) and the ends to be cloned are prepared by digestion with NotI and BamHI (Hc1) or EcoRI and Notl (Hc2).
  • the vector pGEX-4T-1 is also prepared by digestion with Notl and BamHI (Hc1) or EcoRI and Notl (Hc2).
  • the vector and insert are ligated overnight at 16 ° C., the ligation batches are used to transform competent TOP10F '(Invitrogen) E.coli cells. Positive clones are picked and used for protein expression.
  • the construct pGEX-Hd or pGEX-Hc2 allows the translation of a fusion protein consisting of 257 amino acids (28.3 kDa) from Hc1 or 255 amino acids (28.1 kDa) from Hc2 and glutathione-S-transferase (24 kDa).
  • the fusion protein contains all homology boxes (DEAD, SAT, ...) which distinguish the members of the protein family.
  • an overnight culture is induced with IPTG and the fusion protein from the supernatant is purified in a batch process with glutathione Sepharose 4B or via a glutathione Sepharose 4B column.
  • the glutathione-S-transferase is cleaved with thrombin.
  • z. B 100 ug GST fusion protein with a unit of thrombin proteinase in 1x PBS at 22 ° C for 16 hours.
  • the gene product from Hc1 or Hc2 is separated off by gel filtration, e.g. B. with a Superdex 200 HR 10/30 column (Pharmacia Biotech). Biorad's Gel Filtration Chromatography Standard (Ref. 151-1901) can be used as a standard.
  • Example 6 ATPase activity
  • the reaction mixture for measuring the ATPase activity contains 150 mM NaCI, 5 mM KCI, 1.5 mM MgCI2, 20 mM Hepes / KOH, pH 7, 1 mM dithiothreitol, 1 mM PMSF, 10 ⁇ M ATP and 0.2 ⁇ l 32P-ATP in one Total volume of 50 ⁇ l.
  • the reaction mixture is heated to 37 ° C. and Hc1 or Hc2 is added. After 30 min at 37 ° C., the reaction is stopped by adding 400 ⁇ l of 7% activated carbon in 50 mM HCl and 5 mM H3P04.
  • the samples are mixed and centrifuged at 13,000 rpm for 15 min. The radioactivity released is measured with a scintillation counter in the supernatant.
  • the helicase activity of Hc1 or Hc2 can be followed by dissociation of double-stranded RNA.
  • the substrate can be any RNA oligomer that is labeled on a strand, e.g. with 32P.
  • the reaction mixture contains 32P-labeled helicase substrate, Hc1 or Hc2 in various concentrations, 2 mM ATP, 5 mM dithiothreitol and 50 ⁇ g bovine serum albumin in 20 mM Tris-HCl.
  • the reaction is carried out at 37 ° C for 30 min and stopped by heating.
  • reaction mixture is applied to a 16 cm X 18 cm 12% non-denaturing polyacryamide gel and separated at a constant current of 25 mA.
  • the gel is dried under vacuum and exposed (e.g. Kodak RPXRP-5 film, -70 ° C).
  • Homologs can be used as antisense strands.
  • a plasmid is constructed which carries the desired antisense sequence, as well as Selection markers, eg neomycin, a promoter which controls the expression of the antisense RNA and RNA-stabilizing sequences.
  • Selection markers eg neomycin
  • the transcribed sequences are transcribed in the cell and the transcript hybridizes with the target DNA.
  • sequences synthesized in vitro can also be brought into the cell by microinjection.
  • oligonucleotides are also conceivable. These can either be produced synthetically or generated by restriction digestion of Hc1, Hc2 or homologues.
  • the oligonucleotides must be highly pure. This is achieved by lyophilizing 2-5 times. Pure oligonucleotides are e.g. B. added in HEPES buffered saline, pH 7.4.
  • Example 9 Gene probe for finding new members of the DEAD box protein family.
  • the fragments Hc1 and Hc2 are used to isolate new DEAD box proteins from suitable organisms.
  • the specific gene fragments are amplified using the polymerase chain reaction (PCR) and simultaneously labeled with digoxigenin, according to Boehringer Mannheim PCR DIG Probe Synthesis Kit # 1636 090. Plasmid DNA of the cloned fragments Hc1 or Hc2 is used as a template .
  • a PCR approach contains Expand TM High Fidelity Buffer (Boehringer Mannheim # 1636 090), 200 uM dATP, 200 uM dGTP, 200 uM dCTP, 130 uM dTTP, 70 uM DIG-11-dUTP, 0.3 ng of each primer, 100 pg Plasmid DNA, 2.6 U Taq polymerase.
  • the primers were used to amplify the Hc1 fragment
  • the PCR program was 5 min 95 ° C, 95 ° C / 37s - 50 ° C / 37s - 72 ° C / 37s - 30 cycles.
  • the PCR reaction mixture containing the labeled fragments is used directly for hybridization experiments.
  • the PCR product is denatured for 10 min at 95 ° C and mixed with the hybridization solution DIG Easy Hyb (Boehringer Mannheim Ref. 1603558) (conc. 2 ⁇ l / ml). With this hybridization solution, cDNA banks of suitable organisms are screened at low stringency (hybridization temperature 30-50 ° C.).
  • Recombinantly expressed protein is purified by a suitable method and used to work in a suitable organism, e.g. B. rat upper rabbit to generate polyclonal antibodies.
  • a suitable organism e.g. B. rat upper rabbit to generate polyclonal antibodies.
  • the fusion protein z. B. first purified via glutathione Sepharose and then via SDS-PAGE. The band containing the fusion protein is cut out of the gel, ground and z. B. injected a rabbit or a rat.
  • the antiserum obtained is passed through an IgG column, which elutes antibodies at low pH in 1 M Tris-HCl pH 8.
  • the antibodies are dialyzed against 25 mM HEPES pH 7.9, 12 mM MgCl 2, 0.5 mM EDTA, 2 mM dithiothreitol, 17% glycerol, 100 mM KCI.
  • Example 11 Use of the Antibodies to Isolate New DEAD Box Proteins
  • the antibodies obtained as described in the previous section are used to isolate new DEAD box proteins from suitable organisms.
  • the antibodies are covalently coupled to a suitable matrix, for example Sephadex G50 (Pharmacia).
  • Biorad columns 1.5 x 10 cm or 2.5 x 10 cm are packed with the Sephadex and equilibrated with 20 ml buffer A (0.05 M Tris-HCl, 0.15 M NaCI, 0.005 M EDTA, 0.1% NP40, pH 8.0).
  • 3.0 g of Protein A-Sepharose Beads (Pharmacia CL-4B) are added to the column. Let stand at 4 ° C overnight.
  • the antibody solution is placed on the column and allowed to drip through at 4 ° C. at a flow rate of -100 ml / h. Then the column is washed several times: with 250 ml buffer A (plus 0.5% NP40), then with 125 ml 0.1 M borate buffer, pH 9.0, then with 125 ml borate buffer pH ⁇ .O, then with 125 ml 0.2 M triethanolamine, pH 8.2.
  • the Fc region of the antibody is coupled to the protein A-Sepharose via cross-linking.
  • the column is washed again, once with buffer B (0.15 M Tris-HCl, 0.15 M NaCI, 1 mM EDTA pH 8.0, 10% glycerol, 10% NP-40), once with buffer C (0.05 M Tris-HCl, 0.5 M LiC-1 , 1 mM EDTA, pH 8.0, 10% glycerol), and once with buffer D (0.01 M pipes, 5 mM NaCl, 1 mM EDTA, pH 8.0, 10% glycerol).
  • the uncrosslinked antibody is eluted with citrate buffer.
  • the column is stored with borate buffer, pH 8.0 with 0.02% Na N3.
  • cell lysate of suitable organisms is placed on the antibody column.
  • the column is washed several times and the bound proteins with a suitable buffer, e.g. Glycine, pH 3, eluted in Tris-HCl, pH 8.
  • the gene fragments Hc1 and Hc2 can be heterologously expressed in useful plants.
  • the gene transfer can be mediated, for example, via Agrobacterium tumefacians.
  • a typical A. tumefaciens vector (Ti plasmid) contains an origin of replication (Ori-Agro) which allows replication in Agrobacterium, an origin of replication Ori-E. coli, which ensures the functional replication in E. coli, several resistance genes, e.g. B. against kanamycin and spectinomycin, insertion sites for the introduction of the foreign gene and directed T-DNA
  • A. tumefaciens is transformed with the Ti plasmid.
  • leaf disks are punched out and placed in a flat dish (petri dish).
  • a solution of recombinant agrobacteria is then added and, after a few minutes, the leaf disks are transferred to a medium with nutrient cells (eg filter paper). Wounded cells on the edges of the leaf disks release factors that lead to infection of the plant cells by the agrobacterium.
  • the leaf disks are transferred to a shoot-stimulating medium which contains an antibiotic which kills the agrobacteria (for example cefotaxime) and for 2-3 weeks cultured. The shoots are transferred to a root-inducing medium and planted in soil after another 2-3 weeks.
  • Example 13 Diagnostic probes The Hc1 or Hc2 gene fragments or homologous gene fragments or parts thereof
  • Containing homology boxes can be used as diagnostic probes.
  • the DNA fragments are immobilized on a suitable matrix (e.g.
  • a patient's mRNA is purified and reverse transcribed, e.g. with MMLV reverse transcriptase, 2 h at 37 ° C, transcribed into cDNA.
  • the cDNA is labeled, e.g. with 32P or digoxigenin.
  • the cDNA is in a suitable hybridization buffer, e.g. DIG EasyHyb
  • the gene fragments Hc1 and Hc2 can be used as selection markers in molecular biology. It has been shown that overexpression of an RNA helicase in mouse cells makes it tolerant of the substance leflunomide (Müllner patent).
  • an expression vector is constructed which contains Hc1 or Hc2 and a gene to be expressed.
  • the gene to be expressed can lie next to or between the helicase gene. Suitable host cells are transformed with the vector (e.g. cloning into a pGEX vector and introduction into E. coli). If the gene to be expressed lies next to the Hc gene, the transformants become tolerant to leflunomide if the vector is successfully introduced.
  • the success of the ligation must be e.g. B. Check via blue-white screening. If the gene to be expressed is in the Hc gene, the Hc gene is destroyed if the ligation is successful and the transformants lose their tolerance to leflunomide if the vector is successfully introduced.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Rheumatology (AREA)
  • General Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Neurology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Neurosurgery (AREA)
  • Transplantation (AREA)
  • Dermatology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Psychiatry (AREA)
  • Pain & Pain Management (AREA)
  • Obesity (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Hematology (AREA)

Abstract

Neue Gene der Dead Box Proteinfamilie, deren Expressionsprodukte und Verwendung. Die vorliegende Erfindung beschreibt die Bereitstellung zweier neuer Nukleinsäuren - Hc1 und Hc2 - die homolog zu bekannten DEAD-Box-Proteinen, korrespondiernd mit RNA-Helikasen sind und aus Ciliaten gewonnen werden können. Die Erfindung beschreibt weiterhin das Einbringen der neuen Nukleinsäuren über rekombinante DNA-Technologien in geeignete Zielzellen und deren Verwendung für die Regulation der Transkription und der Translation. Die Erfindung beschreibt weiterhin die Transkription in vitro oder in vivo der neuen Nukleinsäuren zur Herstellung neuer Proteine, sowie deren Verwendung in Therapie, Diagnostik.

Description

GENE DER DEAD BOX PROTEINFAMILIE, DEREN EXPRESSIONSPRODUKTE UND VERWENDUNG
Beschreibung
Die vorliegende Erfindung betrifft die Bereitstellung neuer Nukleinsäuren aus Ciliaten kodierend für Expressionsprodukte, vorzugsweise RNA-Helikasen aus der Familie der DEAD-Box-Proteine sowie deren Verwendung.
Die Modulation der RNA-Struktur hat eine essentielle Funktion in zellulären Vorgängen wie z.B. beim prä-mRNA-Spleißen, beim RNA-Transport oder bei der Proteintranslation, da die zelluläre RNA in der Zelle in unterschiedlichen Sekundär- und Tertiärstrukturen vorliegt und daneben eine Vielzahl von RNA-bindender Proteine für eine weitere Strukturierung der RNA sorgt. An diesen
Modulationsvorgängen sind u.a. Proteine aus der Familie der sogenannten DEAD- Proteinfamilie beteiligt. Die Mitglieder dieser Proteinsuperfamilie, die als Charakteristikum eine Reihe homologer Proteinsequenzen, sogenannte „Proteinboxen" enthalten, sind nach dem hochkonservierten Tetrapeptid Asp-Glu- Ala-Asp, im Einbuchstabencode DEAD, als Motiv benannt. Zu dieser Proteinsuperfamilie gehören insbesondere RNA-Helicasen.
Die charakteristischen Proteinsequenzen der DEAD-Proteine sind in der Evolution hochkonserviert (Vgl. Figur 1).
Die DEAD-Superfamiiie gliedert sich in verschiedene Unterfamilien, die nach ihrem Sequenzmotiv DEAD-, DEAH- oder DExH-Unterfamilie genannt werden. Alle Familienmitglieder besitzen eine ATP-Binde- und RNA-Bindefunktion sowie eine ATP-Hydrolyse- und zumeist eine RNA-Helicasefunktion (Fig. 2). Die verschiedenen Mitglieder der DEAD-Box-Protein-Familie zeichnen sich aus durch eine konservierte Region, die ca. 300 Aminosäuren umfaßt und von nichtkonservierten Aminosäuresequenzen variierender Länge flankiert wird (Schmid S.R., Lindner P., Mol Cell Biol 1991 11 : 3463-3471).
Innerhalb der konservierten Region liegen die sogenannten Homologieboxen (synonym konservierte Motive), wovon eine die „DEAD-Box" ist. Die Homologieboxen verleihen den Mitgliedern der DEAD-Box-Familie nicht nur strukturelle sondern auch funktionelle Ähnlichkeit. Unter Berücksichtigung der Homologieboxen (siehe Figur 2) sind DEAD-Box Proteine putative ATP-abhängige RNA-Helikasen, die an einer Vielzahl zellulärer Prozesse beteiligt und mit der Veränderung der Sekundärstruktur von RNA-Molekülen in Zusammenhang stehen (Fuller-Pace F.V. Trends Cell Biol. 19944:271-274, Pause A., Sonenberg N., Curr Opin Struct Biol 1993 3:953-959). Helikase-abhängige Prozesse sind ebenfalls beschrieben worden für: Initiation der Translation, nukleares und mitochondriales RNA-Spleißing, mRNA-Transport, Ribosom- und Spleißosom-Assembly, mRNA- Stabilisierung und mRNA Abbau (lost I., Dreyfus M., Nature 1994 372:193-196).
Die Funktionen der RNA-Helikasen korrespondierend mit den DEAD- Homologieboxen in zellulären Prozessen, vorzugsweise im Rahmen der Proteinbiosynthese, erlauben diese Enzyme gezielt einzusetzen im Hinblick auf pharmazeutische, landwirtschaftliche oder biotechnische und analytische Anwendungen.
Wichtige pharmazeutische Anwendungen sind die Entwicklung von Substanzen, die spezifisch bakterielle, parasitäre, virale oder aus pathogenen Pilzen stammende Helikasen hemmen, jedoch keine Hemmwirkung auf menschliche Helikasen haben. Da Helikasen zumeist essentielle Enzyme sind, kann man durch spezifische Hemmung dieser Enzyme eine Abtötung des Pathogens (Bakterium, Pilz, Parasit/Protozoe, Virus) erreichen. Nach Missel et al. führt bei bestimmten Protozoen (Trypanosoma, Leishmania, Crithidia) das Ausschalten des Gens für ein DEAD-Box-Protein zu verringertem Wachstum (Missel A., Souza A.E., Norskau G, Goringer H.U., Mol Cell Biol 1997 17:4895-903). Im Malariaerreger Plasmodium falsiparum kontrollieren Helikasen die Protein-Translation, Mitose sowie DNA Reparatur (Thelu J, Burnod J, Bracchi V, Ambroise-Thomas P, DNA Cell Biol 1994 13: 1109-1115). Helikasen sind essentiell für die Initiation der Translation, im Spleißosom, im Zellzyklus und Ribosomen Zusammenbau in Hefe. So ist z. B. das DEAD-Box-Protein ROK1 essentiell für die Lebensfähigkeit von Hefe, für das prä-rRNA-Processing, und für mitotisches Wachstum. Ausschalten von ROK1 blockiert 18S rRNA Synthese (Venema J., Bousquet-Antonelli C, Gelugne J.P., Caizegues-Ferrer M., Tollervey, Mol Cell Biol 1997 17: 3398-3407).
Ca. 80% aller „positive-stranded" RNA Viren deren Genome sequenziert sind, kodieren für mindestens eine putative Helikase. Beispiele sind NS3 des Hepatitis C Virus, Helikasen des menschlichen Coronavirus und des Adeno-associated Virus, Vaccinia Virus Helikase (Kadare G., Haenni A.L., J Virol 1997: 2583-2590). Mögliche Rollen für virale Helikasen sind (i) Proof-reading bei der Replikation (ii) Initiation der Transkription durch Aufwinden der RNA und Verhinderung von Loop-Bildung hinter der RNA Polymerase (iii) Initiation der Translation. Die Helikase des Vaccinia Virus ist essentiell für den Lebenszyklus des Virus und Nukleinsäure-spezifisch.
Es gibt Hinweise darauf, daß zumindest einige Helikasen sehr spezifisch aktivierbar sind. So brauchen z. B. DpbA aus E. coli (Fuller-Pace F.V, Nicol S.M., Reid A.D., Lane D.P., EMBO J 1993 12:3619-3626) und Slt22 aus Hefe (Xu D., Nouraini S., Field D., Tang S.J., Friesen J.D., Nature 1996 381 : 709-716) spezifische RNA- Liganden zur Aktivierung.
Des weiteren werden DEAD-Box-Proteine in Assoziation mit Krankheiten beschrieben. Die Ampiifizierung eines spezifischen Gens in Krebszellen (N-myc) steht in Verbindung mit der Tatsache, daß ein DEAD-Box-Protein mit N-myc co- amplifiziert wird, welches auf eine Rolle dieses Proteins in der Entartung von
Krebszellen hinweist (George R.E., Kenyon R.M., McGuckin A.G., Malcolm A.J.,
Pearson A.D., Lunec J., Oncogene 1996 12: 1583-7). Mutationen einer RNA-
Helikase stehen im Zusammenhang mit dem Werner-Syndrom - frühzeitige Alterung - (Yu C, Oshima J., Wijsman E.M., Nakura J. et al., Arn J Hum Genet 1997 60: 330-
»
341) und mit Xeroderma pigmentosum (Kobayashi T., Kuraoka I., Sailo M., Nakatsu Y., Tanaka A. et al., Huma Mut 1997 9: 322-331 ). Weiterhin ist ein möglicher Zusammenhang zwischen DEAD-Box-Proteinen und Bindegewebskrankheiten postuliert worden (Valdez B.C., Henning D., Perlaky L, Busch R.K., Busch H., Biochem Biophis Res Commun 1997 234: 335-340). Bekannt ist außerdem ein Zusammenhang zwischen defekter DNA Reparatur und einer Mutation in der Helikasedomäne des XNP/ATR-X Gens (Villard L, Lossi AM, Cardoso C, Proud V, Chiaroni P, Colleaux L, Schwartz C, Fontes M Genomics 1997 43: 149-155).
Zusätzlich zu Helikasen aus Menschen oder aus diversen Krankheitserregern sind auch Helikasen aus Pflanzen von größtem Interesse. Einige DEAD-Box-Proteine aus Pflanzen sind mittlerweile bekannt (Lorkovic Z.J., Herrmann R.G., Oelmüller R., Mol Cell Biol 1997 17: 2257-2265 und Aubourg et al., Gene 1997 199(1-2): 241- 253). Strukturell sind diese Proteine den DEAD-Box-Proteinen aus nicht pflanzlichen Organismen zwar ähnlich, bilden jedoch ein Untergruppe (Fig.3). Fig.3 zeigt die phylogenetische Verwandschaft verschiedender elFA4, eines der am besten charakterisierten Mitglieder der DEAD-Box-Protein-Familie, aus verschiedenen Organismen. Die pflanzlichen Proteine sind untereinander wesentlich näher verwandt als mit elF4A aus tierischen Eukaryonten. Eine für die landwirtschaftliche Produktion interessante Anwendung ist die Stimulation der Aktivität Pflanzenspezifischer RNA-Helikasen zur Steigerung der Proteinexpression wirtschaftlich relevanter Proteine. Dabei kann man entweder Pflanzen-eigene Helikasen stimulieren (z.B. durch Überexpression) oder Pflanzen-ähnliche Helikasen heterolog in Nutzpflanzen exprimieren.
Daher ist die Aufgabe der vorliegenden Erfindung, neue Nukleinsäuren bereitzustellen, die vorzugsweise für RNA-Helikasen kodieren.
Die Aufgabe wir dadurch gelöst, daß Nukleinsäuren kodierend für RNA-Helikasen bereitgestellt werden, welche vorzugsweise aus Ciliaten, besonders bevorzugt Tetrahymena thermophila, gewonnen werden. Die erfindungsgemäßen Nukleinsäuren kodieren für Expressionsprodukte, welche aus der Familie der DEAD- Box-Proteine stammen und somit auch für RNA-Helikasen. Expressionsprodukte, vorzugsweise Proteine aus der DEAD-Proteinsuperfamilie im Sinne dieser Erfindung sind solche, die konservierte Motive besitzen, worunter ein konserviertes Motiv die Aminosäurereihenfolge DEAD enthält. Vorzugsweise enthalten die Proteine eine RNA-Helicase- und ATP-ase-Aktivität.
Ein Gegenstand der vorliegenden Erfindung sind daher Nukleinsäuren kodierend für RNA Helikasen, mit einer Nukleinsäuresequenz gemäß SEQ ID No. 13 oder SEQ ID No. 15 oder eine funktioneile Variante davon, und Teile davon mit mindestens 8 Nukleotiden, vorzugsweise mit mindestens 15 oder 20 Nukleotiden, insbesondere mit mindestens 100 Nukleotiden, vor allem mit mindestens 300 Nukleotiden (nachfolgend „erfindungsgemäße Nukleinsäuren" genannt).
Die erfindungsgemäße Nukleinsäure mit der Nukleinsäuresequenz gemäß SEQ ID No. 13 (im folgendem „Hc1") kodiert für eine Aminosäurensequenz gemäß SEQ ID No. 14.
Die erfindungsgemäße Nukleinsäure mit der Nukleinsäuresequenz gemäß SEQ ID No. 15 (im folgendem „Hc2") kodiert für eine Aminosäurensequenz gemäß SEQ ID No. 16.
Die Expression der erfindungsgemäßen Nukleinsäuren in E. coli führte zu einem Expressionsprodukt, welches ähnliche enzymatische Aktivitäten wie die einer RNA Helikase zeigt. Weitere Experimente gemäß der vorliegenden Erfindung bestätigten, daß es sich bei der Nukleinsäure um eine Nukleinsäure handelt, die für eine RNA- Helikase kodiert, insbesondere aufgrund des Vorliegens der charakteristischen Homologieboxen, wie in SEQ ID No. 14 und SEQ ID No. 16, die in Figur 1 wiedergegeben sind.
In einer bevorzugten Ausführungsform ist die erfindungsgemäße Nukleinsäure eine DNA oder RNA, vorzugsweise eine doppelsträngige DNA, und insbesondere eine DNA mit einer Nukleinsäuresequenz kodierend für RNA-Helikasen. Unter dem Begriff „funktionelle Variante" versteht man gemäß der vorliegenden Erfindung eine Nukleinsäure, die funktioneil mit RNA Helikasen mit den beschriebenenen Homologieboxen verwandt ist.
Im weiteren Sinne versteht man unter dem Begriff „Varianten" gemäß der vorliegenden Erfindung Nukleinsäuren, die eine Homologie, insbesondere eine Sequenzidentität von ca. 60%, vorzugsweise von ca. 75%, insbesondere von ca. 90% und vor allem von ca. 95% aufweisen.
Die Teile der erfindungsgemäßen Nukleinsäure können beispielsweise zur
Herstellung einzelner Epitope, als Sonden zur Identifizierung weiterer funktioneller Varianten oder als Antisense-Nukleinsäuren verwendet werden. Beispielsweise eignet sich eine Nukleinsäure aus mindestens ca. 8 Nukleotiden als Antisense- Nukleinsäure, eine Nukleinsäure aus mindestens ca. 15 Nukleotiden als Primer beim PCR-Verfahren, eine Nukleinsäure aus mindestens ca. 20 Nukleotiden für die Identifizierung weiterer Varianten und eine Nukleinsäure aus mindestens ca. 100 Nukleotiden als Sonde.
Insbesondere können die erfindungsgemäßen Nukleinsäuren verwendet werden, um komplementäre bzw. Antisense Nukleinsäuren zu konstruieren, die mit Hc1 oder Hc2 selbst oder mit verwandten Nukleinsäuren hybridisieren. Das Einbringen der komplementären bzw. Antisense Nukleinsäurein die Zielzelle verhindert die Expression verwandter RNA-Helikasen, oder verwandter Expressionsprodukte.
Anti-Sense Nukleinsäuren, welche aus den erfindungsgemäßen Nukleinsäuren erhältlich sind, können daher zur spezifischen Regulation der Genexpression verwendet werden. Dabei kann entweder die Zielzelle mit dem Anti-Gen nach bekannten Methoden transfiziert werden, welces dann in der Zelle transkribiert wird oder in vitro synthetisierte Antisense-RNA oder DNA wird über Mikroinjektion in die Zielzelle eingebracht. Es ist bekannt daß Genexpression inhibiert werden kann durch Anti-Sense-RNA die komplementär zum kodierenden Bereich der Ziel-mRNA ist. Der aus mRNA und Anti-Sense-RNA gebildete Duplexstrang ist dem schnellen Abbau durch RNAsen zugänglich.
Die Hemmung von Transkription und Translation durch die dargelegte Antisense- Technik wurde auch erfolgreich in Pflanzenzellen durchgeführt (van der Krol A.R. et al. Nature 1988 333: 866).
In einer weiteren bevorzugten Ausführungsform enthält die erfindungsgemäße Nukleinsäure eine oder mehrere nicht-kodierende Sequenzen und / oder eine Poly(A)-Sequenz. Die nicht-kodierenden Sequenzen sind beispielsweise
Intronsequenzen oder regulatorische Sequenzen, wie Promotor- oder Enhancer- Sequenzen, zur kontrollierten Expression der Expressionsprodukte vorzugsweise von RNA-Helikasen.
In einer weiteren Ausführungsform ist die erfindungsgemäße Nukleinsäure daher in einem Vektor, vorzugsweise in einem Expressionsvektor oder gentherapeutisch wirksamen Vektor enthalten.
Die Expressionsvektoren können beispielsweise prokaryotische oder eukaryotische Expressionsvektoren sein. Beispiele für prokaryotische Expressionsvektoren sind für die Expression in E. coli z.B. der T7 Expressionsvektor pGM10 oder pGEX-4T-1 GST (Pharmacia Biotech), welcher für einen N-terminalen Met-Ala-His6-Tag kodiert, der eine vorteilhafte Reinigung des exprimierten Proteins über eine Ni2+-NTA-Säule ermöglicht. Als eukaryotische Expressionsvektoren für die Expression in Saccharomyces cerevisiae eignen sich z.B. die Vektoren p426Met25 oder p426GAL1 (Mumberg et al. (1994) Nucl. Acids Res., 22, 5767), für die Expression in Insektenzellen z.B. Baculovirus-Vektoren wie in EP-B1-0127839 oder EP-B1- 0549721 offenbart, und für die Expression in Säugerzellen z.B. SV40-Vektoren, welche allgemein erhältlich sind. Im allgemeinen enthalten die Expressionsvektoren auch für die Wirtszelle geeignete regulatorische Sequenzen, wie z.B. den trp-Promotor für die Expression in E. coli (s. z.B. EP-B1-0154133) in E. coli, den ADH-2-Promotor für die Expression in Hefen (Rüssel et al. (1983), J. Biol. Chem. 258, 2674), den Baculovirus-Polyhedrin- Promotor für die Expression in Insektenzellen (s. z.B. EP-B1-0127839) oder den frühen SV40-Promotor oder LTR-Promotoren z.B. von MMTV (Mouse Mammary Tumour Virus; Lee et al. (1981) Nature, 214, 228).
Die so gewonnenen rekombinanten Proteinen werden mit geeigneten Methoden aufgereinigt (z.B. Affinitätschromatographie, HPLC, FPLC) und in Lösung gebracht (Guanidin, Harnstoff). Die Charakterisierung der Proteinen und die Bestimmung der Enzymaktivität erfolgt mit Hilfe etablierter Tests (RNA-Bindung, ATPase-Aktivität, Helikase-Aktivität).
Beispiele von gentherapeutisch wirksamen Vektoren sind Virusvektoren, vorzugsweise Adenovirusvektoren, insbesondere replikationsdefiziente Adenovirusvektoren, oder Adenoassoziierte Virusvektoren, z. B. ein
Adenoassoziierter Virusvektor, der ausschließlich aus zwei insertierten terminalen Wiederholungssequenzen (ITR) besteht.
Geeignete Adenovirusvektoren sind beispielsweise in McGrory, W.ü. et al. (1988) Virol. 163, 614; Gluzman, Y. et al. (1982) in „Eukaryotic Viral Vectors" (Gluzman, Y. ed.) 187, Cold Spring Harbor Press, Cold Spring Habor, New York; Chroboczek, J. et al. (1992) Virol. 186, 280; Karlsson, S. et al. (1986) EMBO J.. 5, 2377 oder WO95/00655 beschrieben.
Geeignete Adeno-assoziierte Virusvektoren sind beispielsweise in Muzyczka, N. (1992) Curr. Top. Microbiol. Immunol. 158, 97; W095/23867; Samulski, R.J. (1989) J. Virol, 63, 3822; WO95/23867; Chiorini, J.A. et al. (1995) Human Gene Therapy 6, 1531 oder Kotin, R.M. (1994) Human Gene Therapy 5, 793 beschrieben.
Gentherapeutisch wirksame Vektoren lassen sich auch dadurch erhalten, daß man die erfindungsgemäße Nukleinsäure mit Liposomen komplexiert. Hierzu eignen sich Lipidmischungen wie bei Feigner, P.L. et al. (1987) Proc. Natl. Acad. Sei, USA 84, 7413; Behr, J.P. et al. (1989) Proc. Natl. Acad. Sei. USA 86, 6982; Feigner, J.H. et al. (1994) J. Biol. Chem. 269, 2550 oder Gao, X. & Huang, L (1991) Biochim. Biophys. Acta 1189, 195 beschrieben. Bei der Herstellung der Liposomen wird die DNA ionisch auf der Oberfläche der Liposomen gebunden, und zwar in einem solchen Verhältnis, daß eine positive Nettoladung verbleibt und die DNA vollständig von den Liposomen komplexiert wird.
Die erfindungsgemäßen Nukleinsäuren können beispielsweise chemisch anhand der in SEQ ID No. 13 und SEQ ID No. 15 offenbarten Sequenz oder anhand der in SEQ ID No. 14 und SEQ ID No. 16 offenbarten Peptidsequenz unter Heranziehen des genetischen Codes z. B. nach der Phosphotriester-Methode synthetisiert werden (s. z.B. Uhlman, E. & Peyman, A. (1990) Chemical Reviews, 90, 543, No. 4).
Eine weitere Möglichkeit, die erfindungsgemäßen Nukleinsäuren selbst und Varianten zu erhalten, ist die Isolierung aus einer geeigneten Genbank, anhand einer geeigneten Sonde (s. z.B. Sambrook, J. et al. (1989) Moiecular Cloning. A laboratory manual. 2nd Edition, Cold Spring Harbor, New York). Als Sonde eignen sich beispielsweise einzelsträngige DNA-Fragmente mit einer Länge von ca. 100 bis 1000 Nucleotiden, vorzugsweise mit einer Länge von ca. 200 bis 500 Nucleotiden, insbesondere mit einer Länge von ca. 300 bis 400 Nucleotiden, deren Sequenz aus der Nukleinsäuresequenz gemäß Figur 4 und 6 abgeleitet werden kann.
Ein weiterer Gegenstand der Erfindung ist die Verwendung der erfindungsgemäßen Nukleinsäuren zur spezifischen Beeinflussung der Proteinbiosynthese.
Experimente zeigen, daß eine gesteigerte Helikase-Aktivität zu einer verstärkten Aufwindung der Ziel-RNA führt. Hierdurch wird die Ziel-RNA zugänglich für Bindungspartner, wie Proteine, insbesondere Enzyme oder Enzymkomplexe für die ribosomaie Translation oder für den Abbau durch das Degradasom. Daraus folgt, je nach Ziel-RNA a) eine gesteigerte Translation und daher eine gesteigerte
Proteinbiosynthese b) ein schnellerer Abbau durch das Degradasom und somit eine verringerte Proteinbiosynthese. Eine Hemmung der Helikase-Aktivität kann den Abbau durch das Degradasom hemmen und zu einer verminderten Proteinbiosynthese führen. Grundlage hierfür ist die Erkenntnis, daß durch die selektive Hemmung oder Aktivierung von Helikasen wichtige biosynthetische Prozesse gezielt reguliert werden können.
Die Nukleinsäuren werden hierzu rekombinant in geeigneten Zielorganismen wie beschrieben exprimiert.
Die erfindungsgemäßen Nukleinsäuren, vorzugsweise Hc1 , sind ein hervorragendes Modell für diverse eukaryontische RNA-Helikasen, vorzugsweise aus Menschen und Parasiten (Figur 3A). Die genetische Verwandtschaft von Hc1 zu relevanten eukaryontischen Helikasen ist eng genug, um von Versuchen mit Hc1 Rückschlüsse auf Struktur und Funktion anderer eukaryontischer Helikasen (z.B. menschlichen) zu ziehen. Figur 3A zeigt die genetische Verwandtschaft einiger Helikasen aus verschiedenen Organismen im Vergleich zu Hc1. Besonders überraschend ist die große strukturelle Ähnlichkeit zwischen Hc1 und Säugetierhelikasen aus Mensch und Maus und der große strukturelle Unterschied zwischen Hc1 und bekannten viralen Helikasen.
Aufgrund phyiogenetischer Untersuchungen gemäß Figur 3B erweist sich die erfindungsgemäßen Nukleinsäuren, vorzugsweise Hc2, als ein hervorragendes Modell für diverse eukaryontische RNA-Helikasen, vorzugsweise aus Pflanzen. Figur 3B zeigt die genetische Verwandtschaft einiger RNA Helikasen aus verschiedenen Organismen im Vergleich zu Hc2. Besonders überraschend ist die große strukturelle Ähnlichkeit zwischen Hc2 und RNA Helikasen aus Pflanzen. Die rekombinante Expression von Hc2 ermöglicht die Nutzung dieses neuen Enzyms als Modell zur Erforschung insbesonderer pflanzlicher Helikasen, deren Struktur und Funktion, sowie zur Entwicklung geeigneter Inhibitoren bzw. Aktivatoren diese wichtigen Enzyme. So wurde für PRH75 aus Spinat postuliert, daß dieses Enzym ein sehr spezifischen RNA-Liganden braucht, um aktiv zu sein (Lorkovic Z.J., Herrmann R.G., Oelmüller R., Mol Cell Biol 17(4): 2257-2265 (1997)). Ein weiterer Gegenstand der Erfindung ist daher die gezielte heterologe Expression - mittels Überexpression nach bekannten Methoden - der erfindungsgemäßen Nukleinsäuren, vorzugsweise Hc2, in geeigneten Nutzpflanzen zur potentiellen Steigerung der Biosynthese relevanter Proteine.
Die erfindungsgemäßen Nukleinsäuren, vorzugsweise Hc2, können über rekombinante DNA-Technologien in Pflanzen eingebracht werden. Als Methode kann das Einschleusen des Fremdgens mit Hilfe von Agrobakterium tumefaciens benutzt werden. Hierbei wird das Fremdgen in des Genom der Bakteriums in bekannter Weise eingebracht. Bei Infektion der Zielpflanze werden die Gene des Bakteriums inklusive des Fremdgens stabil in das Genom der Pflanze integriert (Chiiton M.D. et al., Cell 1977 11 :263, Barton K.A. et al., Cell 1983 32: 1033). Diese Methode wird vorzugsweise für die Transformation von Dikotelydonen eingesetzt. Zur Transformation von Monokotelydonen können die bekannten Methoden wie Kalziumphosphat- Präzipitation, PEG Behandlung, Elektroporation, oder eine
Kombination dieser Methoden eingesetzt werden (Potrykus I. et al., Mol Gen Genet
1985 199:183; Lorz H. et al., Mol Gen Genet 1985 199: 178; Fromm M et al. Nature
1986 319:791 ; Uchimiya H. et al., Mol Gen Genet 1986 204: 204). Möglich ist auch ein Einbringen der Fremd-DNA in die Pflanzenzelle mit Hilfe der sogenannten Gene- Gun (Klein T.M. et al. Nature 1987 327: 70).
Eine weiterer Gegenstand der Erfindung ist die Verwendung der Nukleinsäuren als Selektionsmarker in der Molekularbiologie. Konventionell verwendete Selektionsmarker sind Antibiotika. Molekularbiologisch veränderte Organismen tragen ein Gen, das Resistenz gegen ein Antibiotikum verleiht. Die Organismen werden in Antibiotika-haltigem Medium angezogen, so daß sich nur die Träger des Resistenzgens entwickeln können. Analog kann man Helikasegene als „Resistenzgene" verwenden. Es wurde gezeigt (Müilner et al, Patentanmeldung DPA 19545126.0), daß die Überexpression eines Helikasegens bei Mauszellen diesen Zellen Toleranz gegenüber einer sonst toxischen Substanz, Leflunomid, verleiht. Es ist somit möglich, die erfindungsgemäßen Nukleinsäuren als Selektionsmarker in der Molekularbiologie einzusetzen, wobei mit einem geeigneten Vektor, wie beschrieben, die erfindungsgemäße Nukleinsäuren in Zellen einzuschleusen sind und mit einer geeigneten Substanz, wie Leflunomid), gegen die die Zellen durch Überexpression der Helikase tolerant sind, zu selektionieren.
Ein weiterer Gegenstand der vorliegenden Erfindung sind auch die
Expressionsprodukte, vorzugsweise Polypeptide und Polypeptidfragmente (die Hc1 und Hc2 kodieren) selbst, mit Aminosäuresequenzen gemäß SEQ ID No. 14 und SEQ ID No. 16 oder einer funktionellen Variante davon, und Teile davon mit mindestens sechs Aminosäuren, vorzugsweise mit mindestens 12 Aminosäuren, insbesondere mit mindestens 65 Aminosäuren und vor allem mit 257 Aminosäuren Hc1 und 255 Aminosäuren Hc2 (nachfolgend „erfindungsgemäße Polypeptide" genannt). Beispielsweise kann ein ca. 6-12, vorzugsweise ca. 8 Aminosäurenlanges Polypeptid ein Epitop enthalten, das nach Kopplung an einen Träger zur Herstellung von spezifischen poly- oder monoklonalen Antikörper dient (siehe hierzu z. B. US 5,656,435). Polypeptide mit einer Länge von mindestens ca. 65 Aminosäuren können auch direkt ohne Träger zur Herstellung von poly- oder monoklonalen Antikörper dienen.
Unter dem Begriff „funktioneile Variante" im Sinne der vorliegenden Erfindung versteht man Polypeptide, die funktionell mit den erfindungsgemäßen Peptiden verwandt sind, d.h. eine RNA-Helikaseaktivität aufweisen. Unter Varianten versteht man auch allelische Varianten oder Polypeptide, die von anderen Zellen bzw. Gewebe abstammen.
Im weiteren Sinne versteht man darunter auch Polypeptide, die eine
Sequenzhomologie, insbesondere eine Sequenzidentität von ca. 70%, vorzugsweise von ca. 80%, insbesondere von ca. 90%, vor allem von ca. 95% zu den Polypeptiden mit den Aminosäuresequenzen gemäß Figur 5 und 7 haben. Ferner zählen hierzu auch Deletion des Polypeptids im Bereich von ca. 1 - 60, vorzugsweise von ca. 1 - 30, insbesondere von ca. 1 - 15, vor allem von ca. 1 - 5 Aminosäuren. Hierzu zählen hierzu auch Fusionsproteine, die die oben beschriebenen erfindungsgemäßen Polypeptide enthalten, wobei die Fusionsproteine selbst bereits die Funktion einer RNA-Helikase haben oder erst nach Abspaltung des Fusionsanteils die spezifische Funktion bekommen können. Vor allem zählen hierzu Fusionsproteine mit einem Anteil von insbesondere nichthumanen Sequenzen von ca. 1 - 200, vorzugsweise ca. 1 - 150, insbesondere ca. 1 - 100, vor allem ca. 1 - 50 Aminosäuren. Beispiele von nicht-humanen
Peptidsequenzen sind prokaryotische Peptidsequenzen, z.B. aus der Galactosidase von E. coli oder ein sogenannter Histidin-Tag, z.B. ein Met-Ala-His6-Tag. Ein Fusionsprotein mit einem sogenannten Histidin-Tag eignet sich besonders vorteilhaft zur Reinigung des exprimierten Proteins über Metallionen-haltige Säulen, beispielsweise über eine Ni2+-NTA-Säule. „NTA" steht für den Chelator „nitrilotriacetic acid" (Qiagen GmbH, Hilden).
Die Teile des erfindungsgemäßen Polypeptids repräsentieren beispielsweise Epitope, die spezifisch von Antikörpern erkannt werden können.
Durch Vergleich mit bekannten Helikasen wurde gefunden, daß die erfindungsgemäßen Polypeptide ein Mitglied der sogenannten DEAD- Superproteinfamilie ist. Figur 1 zeigt die konservierten Motive, die für diese Klasse von RNA-Helikasen charakteristisch sind. All diese Motive sind innerhalb der Familie hoch konserviert und werden auch in den erfindungsgemäßen Polypeptiden gefunden.
Das erfindungsgemäße Polypeptid wird beispielsweise durch Expression der erfindungsgemäßen Nukleinsäure in einem geeigneten Expressionssystem, wie oben bereits beschrieben, nach dem für den Fachmann allgemein bekannten
Methoden hergestellt. Ein weiterer Gegenstand der vorliegenden Erfindung bezieht sich daher auf ein Verfahren zur Herstellung eines erfindungsgemäßen Polypeptids, wobei eine erfindungsgemäße Nukleinsäure in einer geeigneten Wirtszelle exprimiert und gegebenenfalls isoliert wird.
Insbesondere die genannten Teile des Polypeptids können auch mit Hilfe der klassischen Peptidsynthese (Merrifield-Technik) synthetisiert werden. Sie eignen sich insbesondere zur Gewinnung von Antiseren, mit deren Hilfe geeignete Genexpressionsbanken durchsucht werden können, um so zu weiteren funktionelien Varianten des erfindungsgemäßen Polypeptids zu gelangen.
Ein anderer Gegenstand der vorliegenden Erfindung bezieht sich auch auf Antikörper, die mit dem erfindungsgemäßen Polypeptid spezifisch reagieren, wobei die oben genannten Teile des Polypeptids entweder selbst immunogen sind oder durch Koppelung an geeignete Träger, wie z.B. bovines Serumalbumin, immunogen gemacht bzw. in ihrer Immunogenität gesteigert werden können.
Die Antikörper sind entweder polyklonal oder monoklonal. Die Herstellung, die auch einen Gegenstand der vorliegenden Erfindung darstellt, erfolgt beispielsweise nach allgemein bekannten Methoden durch Immunisieren eines Säugetiers, beispielsweise eines Kaninchens, mit dem erfindungsgemäßen Polypeptid oder den genannten Teilen davon, gegebenenfalls in Anwesenheit von z.B. Freund's Adjuvant und / oder Aluminiumhydroxidgelen (s. z.B. Diamond, B.A. et al. (1981) The New England Journal of Medicine, 1344). Die im Tier aufgrund einer immunologischen Reaktion entstandenen polyklonalen Antikörper lassen sich anschließend nach allgemein bekannten Methoden leicht aus dem Blut isolieren und z. B. über Säulenchromatographie reinigen.
Monoklonale Antikörper können beispielsweise nach der bekannten Methode von Winter & Milstein (Winter, G. & Milstein, C. (1991) Nature, 349, 293) hergestellt werden.
Ein weiterer Gegenstand der vorliegenden Erfindung ist auch ein Arzneimittel, das eine erfindungsgemäße Nukleinsäure oder ein erfindungsgemäßes Polypeptid und gegebenenfalls geeignete Zusatz- oder Hilfsstoffe enthält und ein Verfahren zur Herstellung eines Arzneimittels zur Behandlung von Krebs, Autoimmunkrankheiten, insbesondere Multiple Sklerose oder Rheumatoide Arthritis, Alzheimer-Krankheit, Allergien, insbesondere Neurodermitis, Typ I Allergien oder Typ IV Allergien, Arthrose, Atherosklerose, Osteoporose, akute und chronische Infektionskrankheiten und / oder Diabetis und /oder zur Beeinflussung des Zellmetabolismus, insbesondere bei der Immunsuppression, vor allem bei Transplantationen und / oder Erbkrankheiten, insbesondere Werner Syndrom, Bloom Syndrom, Xeroderma pigmentosa, Bindegewebskrankheiten, bei dem eine erfindungsgemäße Nukleinsäure, beispielsweise eine sogenannten Antisense-Nukleinsäure, oder ein erfindungsgemäßes Polypeptid mit pharmazeutisch annehmbaren Zusatz- und / oder Hilfsstoffen formuliert wird.
Für die gentherapeutische Anwendung beim Menschen ist vor allem ein Arzneimittel geeignet, das die erfindungsgemäße Nukleinsäure in nackter Form oder in Form eines der oben beschriebenen gentherapeutisch wirksamen Vektoren oder in mit Liposomen komplexierter Form enthält.
Als geeignete Zusatz- und / oder Hilfsstoffe eignen sich z. B. eine physiologische Kochsalzlösung, Stabilisatoren, Proteinaseinhibitoren, Nukleaseinhibitoren etc.
Ein weiterer Gegenstand der vorliegenden Erfindung ist auch ein Diagnostikum enthaltend die erfindungsgemäßen Nukleinsäuren, die erfindungsgemäßen Polypeptide oder erfindungsgemäße Antikörper und gegebenenfalls geeignete Zusatz- und / oder Hilfsstoffe und ein Verfahren zur Herstellung eines
Diagnostikums zur Diagnose von Krebs, Autoimmunkrankheiten, insbesondere Multiple Sklerose oder Rheumatoide Arthritis, Alzheimer-Krankheit, Allergien, insbesondere Neurodermitis, Typ I Allergien oder Typ IV Allergien, Arthrose, Atherosklerose, Osteoporose, akute und chronische Infektionskrankheiten und / oder Diabetis und / oder zur Analyse des Zellmetabolismus, insbesondere des Immunstatus, vor allem bei Transplantationen und / oder zur Analyse von Erbkrankheiten, insbesondere Werner Syndrom, Bloom Syndrom, Xeroderma pigmentosa, Bindegewebskrankheiten, bei dem eine erfindungsgemäße Nukleinsäure, ein erfindungsgemäßes Polypeptid oder erfindungsgemäße Antikörper mit geeigneten Zusatz- und / oder Hilfsstoffen versetzt werden. Beispielsweise können gemäß der vorliegenden Erfindung anhand der erfindungsgemäßen Nukleinsäure ein Diagnostikum auf der Basis der Polymerasekettenreaktion (PCR-Diagnostik, z.B. gemäß EP-0200362) oder eines Northern Blots hergestellt werden. Diese Tests beruhen auf der spezifischen Hybridisierung der erfindungsgemäßen Nukleinsäure mit dem komplementären Gegenstrang üblicherweise der entsprechenden mRNA. Die erfindungsgemäße Nukleinsäure kann hierbei auch modifiziert sein, wie z.B. in EP0063879 beschrieben. Vorzugsweise wird ein erfindungsgemäßes DNA-Fragment mittels geeigneter Reagenzien, z.B. radioaktiv mit α-P32-dATP oder nicht-radioaktiv mit Biotin, nach allgemein bekannten Methoden markiert und mit isolierter RNA, die vorzugsweise an geeignete Membranen aus z.B. Zellulose oder Nylon gebunden wurde, inkubiert. Zudem ist es vorteilhaft, die isolierte RNA vor der Hybridisierung und Bindung an eine Membran der Größe nach, z.B. mittels Agarose- Gelelektrophorese, aufzutrennen. Bei gleicher Menge an untersuchter RNA aus jeder Gewebeprobe kann somit die Menge an mRNA bestimmt werden, die spezifisch durch die Sonde markiert wurde.
Ein weiteres Diagnostikum enthält das erfindungsgemäße Polypeptid bzw. die oben näher beschriebenen immunogenen Teile davon. Das Polypeptid bzw. Teile davon, die vorzugsweise an eine Festphase, z. B. aus Nitrocellulose oder Nylon, gebunden sind, können beispielsweise mit der zu untersuchenden Körperflüssigkeit z. B. Blut, in vitro in Berührung gebracht werden, um so beispielsweise mit
Autoimmunantikörper reagieren zu können. Der Antikörper-Peptid-Komplex kann anschließend beispielsweise anhand markierter Antihuman-IgG- oder Antihuman- IgM-Antikörper nachgewiesen werden. Bei der Markierung handelt es sich beispielsweise um ein Enzym, wie Peroxidase, das eine Farbreaktion katalysiert. Die Anwesenheit und die Menge an anwesenden Autoimmunantikörpern kann somit über die Farbreaktion leicht und schnell nachgewiesen werden.
Ein anderes Diagnostikum enthält die erfindungsgemäßen Antikörper selbst. Mit Hilfe dieser Antikörper kann beispielsweise eine Gewebeprobe des Menschen leicht und schnell dahingehend untersucht werden, ob das betreffende Polypeptid vorhanden ist. In diesem Fall sind die erfindungsgemäßen Antikörper beispielsweise mit einem Enzym, wie oben bereits beschrieben, markiert. Der spezifische Antikörper-Peptid-Komplex kann dadurch leicht und ebenso schnell über eine enzymatische Farbreaktion nachgewiesen werden.
Ein anderer Gegenstand der vorliegenden Erfindung betrifft auch einen Test zur Identifizierung funktioneller Interaktoren, wie z.B. Inhibitoren oder Stimulatoren, enthaltend eine erfindungsgemäße Nukleinsäure, ein erfindungsgemäßes Polypeptid oder die erfindungsgemäßen Antikörper und gegebenenfalls geeignete Zusatz- und / oder Hilfsstoffe.
Ein geeigneter Test zur Identifizierung funktioneller Interaktoren ist z. B. das sogenannte „Two-Hybrid System" (Fields, S. & Sternglanz, R. (1994) Trends in Genetics, 10, 286). Bei diesem Test wird eine Zelle, beispielsweise eine Hefezelle, mit einem oder mehreren Expressionsvektoren transformiert oder transfiziert, die ein Fusionsprotein exprimieren, das das erfindungsgemäße Polypeptid und eine DNA- Bindedomäne eines bekannten Proteins, beispielsweise von Gal4 oder LexA aus E. coli, enthält und / oder ein Fusionsprotein exprimieren, das ein unbekanntes Polypeptid und eine Transkriptions-Aktivierungsdomäne, beispielsweise von Gal4, Herpesvirus VP16 oder B42, enthält. Zudem enthält die Zelle ein Reportergen, beispielsweise das LacZ-Gen aus E. coli, „Green Fluorescence Protein" oder die Aminosäure-Biosynthesegene der Hefe His3 oder Leu2, das durch reguiatorische Sequenzen, wie z.B. den lexA-Promotor/Operator oder durch eine sogenannte „Upstream Activation Sequence" (UAS) der Hefe kontrolliert wird. Das unbekannte Polypeptid wird beispielsweise durch ein DNA-Fragment kodiert, das aus einer Genbank, beispielsweise aus einer humanen Genbank, stammt. Üblicherweise wird gleich eine cDNA-Genbank mit Hilfe der beschriebenen Expressionsvektoren in Hefe hergestellt, so daß der Test unmittelbar danach durchgeführt werden kann.
Beispielsweise wird in einem Hefe-Expressionsvektor die erfindungsgemäße Nukleinsäure in funktioneller Einheit an die Nukleinsäure kodierend für die lexA- DNA-Bindedomäne kloniert, so daß ein Fusionsprotein aus dem erfindungsgemäßen Polypeptid und der LexA-DNA-Bindedomäne in der transformierten Hefe exprimiert wird. In einem anderen Hefe-Expressionsvektor werden cDNA-Fragmente aus einer cDNA-Genbank in funktioneller Einheit an die Nukleinsäure kodierend für die Gal4- Transkriptions-Aktivierungsdomäne kloniert, so daß ein Fusionsprotein aus einem unbekannten Polypeptid und der Gal4-Transkriptions-Aktivierungsdomäne in der transformierten Hefe exprimiert wird. Die mit beiden Expressionsvektoren transformierte Hefe, die beispielsweise Leu2- ist, enthält zusätzlich eine Nukleinsäure, die für Leu2 kodiert, und durch den LexA-Promotor/Operator kontrolliert wird. Im Falle einer funktionelien Interaktion zwischen dem erfindungsgemäßen Polypeptid und dem unbekannten Polypeptid bindet die Gal4- Transkriptions-Aktivierungsdomäne über die LexA-DNA-Bindedomäne an den LexA- Promotor/Operator, wodurch dieser aktiviert und das Leu2-Gen exprimiert wird. Dies hat zur Folge, daß die Leu2- Hefe auf Minimalmedium, das kein Leucin enthält, wachsen kann.
Bei Verwendung des LacZ- bzw. „Green Fluorescence Protein"-Reportergens anstelle eines Aminosäure-Biosynthesegens kann die Aktivierung der Transkription dadurch nachgewiesen werden, daß sich blau- bzw. grün-fluoreszierende Kolonien bilden. Die Blau- bzw. Fluoreszenzfärbung läßt sich aber auch leicht im Spectrophotometer z.B. bei 585 nM im Falle einer Blaufärbung quantifizieren.
Auf diese Weise können Expressionsgenbanken leicht und schnell auf Polypeptide durchsucht werden, die mit den erfindungsgemäßen Polypeptiden interagieren. Anschließend können die gefundenen neuen Polypeptide isoliert und weiter charakterisiert werden.
Eine weitere Anwendungsmöglichkeit des „Two-Hybrid-Systems" ist die
Beeinflussung der Interaktion zwischen dem erfindungsgemäßen Polypeptid und einem bekannten oder unbekannten Polypeptid durch weitere Substanzen, wie z. B. chemische Verbindungen. Auf diese Weise lassen sich auch leicht neue wertvolle chemisch synthetisierbare Wirkstoffe auffinden, die als Therapeutikum eingesetzt werden können. Die vorliegende Erfindung ist daher nicht nur auf ein Verfahren zum Auffinden von polypeptidartigen Interaktoren bestimmt, sondern erstreckt sich auch auf ein Verfahren zum Auffinden von Substanzen, die mit dem oben beschriebenen Protein-Protein-Komplex interagieren können. Derartige peptidartige, wie auch chemische Interaktoren werden daher im Sinne der vorliegenden Erfindung als funktionelle Interaktoren bezeichnet, die eine inhibierende oder eine stimulierende Wirkung haben können.
Beschreibung der Figuren und der wichtigen Sequenzen.
Figur 1 zeigt schematisch die konservierten Bereiche (Homologieboxen) der Proteine aus der DEAD-Proteinsuperfamilie. Die Zahlen zwischen den Bereichen geben die Abstände in Aminosäuren zwischen den Homoboxen an.
Figur 2 beschreibt schematisch die konservierten Bereiche und deren bekannten Funktionen der exprimierten Proteine nach Füller Pace, F.V. (1994), supra.
Figur 3A und 3B beschreiben die phylogenetischen Bäume von Hc1 und Hc2 und stellt die evolutionäre Bezüge her. Die Erstellung dieser Figuren erfolgte mit dem Programm: Lasergene (Modul MegAlign 3.1.7) der Firma: DNASTAR Inc.; mit Hilfe des Clustal- Algorithmus (Higgins D.G, Sharp P.M., CABIOS (1989), Vol. 5, no.2, 151-153).
SEQ ID No. 13 zeigt die Nukleinsäuresequenz von Hc1.
SEQ ID No. 14 zeigt die korrespondierende Aminosäuresequenz zu SEQ No. 13.
SEQ ID No. 15 zeigt die Nukleinsäuresequenz von Hc2.
SEQ ID No. 16 zeigt die korrespondierende Aminosäuresequenz zu SEQ No. 15. Die nachfolgenden Beispiele dienen zur näheren Erläuterung der Erfindung, ohne dieselbe auf in den Beispielen beschriebenen Produkte und Ausführungsformen einzuschränken.
Beispiele
Die praktische Arbeiten, die zur der vorliegenden Erfindung geführt haben, basieren in der Hauptsache auf etablierte, bekannte Methoden der Mikrobiologie, der Molekularbiologie und rekombinanter DNA Technologie.
Beispiel 1 : Kultur von Tetrahymena thermophila
Tetrahymena thermophila, Stamm B1868IV, wurde in PPYS-Medium (10 g/l Proteose Pepton Nr.3 DIFCO, 1 g/l Hefeextrakt DIFCO, 10 mg Natriumeitrat, 24,3 mg FeCI3) im 500 ml Kolben angeimpft (100.000 Zellen/ml PPYS) und 2-3 Tage bei 25°C und 100-150 rpm inkubiert, bis zu einer Zelldichte von ca. 1 Mio/ml.
Beispiel 2 : Isolierung der mRNA
Aus 200 ml Schüttelkultur von Tetrahymena thermophila, Stamm B1868IV wurde nach Chomczynski & Sacchi, (1987) Gesamt-RNA isoliert. Dazu wurden ca. 2 Mio Zellen in Gegenwart von Guanidin Thiocyanat / Sarkosyl / beta-Mercaptoethanol lysiert. Nach Zugabe von Natriumacetat und Chloroform/Isoamylalkohol/Phenol (25:24:1) wird gut gemischt, 15 min auf Eis inkubiert und danach 20 min bei 10.000xg, 4°C zentrifugiert. Die wässrige Phase wird mit 1 Volumen Isopropanol versetzt und mindestens 30 min bei -20°C stehen gelassen. Das RNA Pellet wird durch Zentrifugation gewonnen (10 min, 10.000xg, 4°C). Das Pellet wird noch zweimal gewaschen, getrocknet und in DEPC-Wasser aufgenommen. Nach einer 10 - 15minütigen Inkubation bei 55-60°C kann die RNA bei -80°C aufgehoben werden. Aus der Gesamt-RNA wird über Oligo(dT)-Sepharose (Clontech mRNA Separator Kit #K1040-2) mRNA aufgereinigt Beispiel 3 : Herstellung von cDNA
Die mRNA wurde nach CLONTECH in cDNA überschrieben (CapFinder™ PCR cDNA Library Construction Kit #K1051-1).
Beispiel 4: Amplifizierung spezifische Gen-Fragmente
Spezifische Gen-Fragmente wurden mit Hilfe der Polymerase-Ketten-Reaktion (PCR) amplifiziert. Ein Standard-PCR-Ansatz enthält 10 mM Tris-HCI, pH 8.3, 50 mM KCI, 1.5 mM MgCI2, 0.001 % Gelatine, 75 μM dNTP, 0.3 ng von jedem Primer, 0,5 μl cDNA, 0,5 U Taq Polymerase. Zur Amplifizierung des Fragmentes Hc1 wurden die Primer
(2) 5'-GTTCTACCnATTCTGTG-3' und
(3) 5'-ACnGGTTCnGGTAAGAC-3' verwendet, zur Amplifizierung des Fragmentes Hc2 wurden die Primer
(4) 5'-ATAGAATTCCCnACnAGAGAAnTnGCT-3' und (8) 5'-ATAGGATCCGTTCTACCnATTCTGTG-3' verwendet, wobei n ein beliebiges Nukleotid ist. Das PCR-Programm war 5 min 95°C, 95°C/37s - 50°C/37s - 72°C/37s - 30 Zyklen.
Beispiel 5: Klonierung und Sequenzierung der Fragmente Nach PCR wird das PCR-Produkt auf 1%igem Agarosegel aufgetrennt. Die spezifischen Fragmente werden ausgeschnitten und mit QIAGEN Gel Extraction Kit aufgereinigt. Die gereinigten Fragmente werden direkt zur Klonierung eingesetzt (Invitrogen Original TA Cloning Kit #K2000-01). Positive Klone werden in Schüttelkultur vermehrt und die Plasmid-DNA mit QIAGEN Maxi-Prep-Kit aufgereinigt. Sequenziert wird mit Automated Sequenzer AbiPrism Model 377.
Rekombinante Expression
Die Genfragmente Hc1 bzw. Hc2 werden in einen geeigneten Vektor kloniert, vorzugsweise pGEX-4T-1 GST-Fusionsvektor (Pharmacia Biotech). Dazu werden Hc1 und Hc2 mit geeigneten Primern über PCR aus Tetrahymena thermophila cDNA hergestellt. Ein Standard-PCR-Ansatz enthält 10 mM Tris-HCI, pH 8.3, 50 mM KCI, 1.5 mM MgCI2, 0.001% Gelatine, 75 μM dNTP, 0.3 ng von jedem Primer, 0,5 μl cDNA, 0,5 U Taq Polymerase. Zur Amplifizierung des Fragmentes Hc1 wurden die Primer (2A) 5' ATAAGAATGCGGCCGCTGTTCTACCGATTCTGTGAATATA 3' (3A) 5 ' CGCGGATCCTC ACT GGT TCG GGT AAG ACT GCT ACT TTC TCT 3 verwendet, zur Amplifizierung des Fragmentes Hc2 wurden die Primer (7A) 5' TATAGAATTCCCCACTAGAGAACTCGCTATGCAAATCGAA 3' (8A) 5' ATAAGAATGCGGCCGCGTTCTACCGATTCTGTGGACATAG 3' verwendet. Primer (2A) enthält eine Notl-Schnittstelle, (3A) eine BamHI- Schnittstelle, (7A) eine EcoRI- und (8A) ein Notl-Schnittstelle. Das PCR-Programm war 5 min 95°C, 95°C/37s - 50°C/37s - 72°C/37s - 30 Zyklen.
Die zu klonierenden Fragmente werden über ein 1 %iges Agarosegel aufgereinigt (QIAgen Gelextraktion Kit) und die zu klonierenden Enden durch Verdau mit Notl und BamHI (Hc1 ) bzw. EcoRI und Notl (Hc2) vorbereitet. Der Vektor pGEX-4T-1 wird ebenfalls durch Verdau mit Notl und BamHI (Hc1) bzw. EcoRI und Notl (Hc2) vorbereitet. Vektor und Insert werden über Nacht bei 16°C ligiert, die Ligationsansätze werden zur Transformation von kompetenten TOP10F' (Invitrogen) E.coli Zellen eingesetzt. Positive Klone werden gepickt und zur Proteinexpression verwendet. Das Konstrukt pGEX-Hd bzw. pGEX-Hc2 erlaubt die Translation eines Fusionsproteins bestehend aus 257 Aminosäuren (28,3 kDa) von Hc1 bzw. 255 Aminosäuren (28,1 kDa) von Hc2 und Glutathion-S-Transferase (24 kDa) . Das Fusionsprotein enthält alle Homologieboxen (DEAD, SAT,...) welche die Mitglieder der Proteinfamilie auszeichnen. Zur rekombinanten Proteinexpression wird eine Übernacht-Kultur mit IPTG induziert und das Fusionsprotein aus dem Überstand im Batchverfahren mit Glutathion Sepharose 4B oder über eine Glutathion Sepharose 4B Säule aufgereinigt. Die Glutathion-S-Transferase wird mit Thrombin gespalten. Dazu werden z. B. 100 μg GST-Fusionprotein mit einer Einheit Thrombin Proteinase in 1x PBS bei 22°C für 16 Std. inkubiert. Das Genprodukt von Hc1 bzw. Hc2 wird über Gelfiltration abgetrennt, z. B. mit einer Superdex 200 HR 10/30 Säule (Pharmacia Biotech). Als Standard kann der Gel Filtration Chromatography Standard von Biorad (Ref. 151-1901) verwendet werden. Beispiel 6 : ATPase Aktivität
Die Aktivität wird bestimmt wie in der Literatur beschrieben, z.B. nach Jaramillo et al., Mol Cell Biol 1991 11 :5992; Rozen et al., Mol Cell Biol 1990 10: 1134, Ladomery M. et al. Nucl. Acid Res. 1997, 25:965-973 oder Dong F. et al. Proc. Natl. Acad. Sei. USA 1996, 93: 14456-14461 oder Patent PCT/US97/01614. Nachfolgend wird ein konkretes Beispiel beschrieben. Die Reaktionsmischung zur Messung der ATPase Aktivität enthält 150 mM NaCI, 5 mM KCI, 1.5 mM MgCI2, 20 mM Hepes/KOH, pH 7, 1 mM Dithiothreitol, 1 mM PMSF, 10 μM ATP und 0,2 μl 32P-ATP in einem Gesamtvolumen von 50 μl. Die Reaktionsmischung wird auf 37 °C erwärmt und Hc1 bzw. Hc2 wird dazugegeben. Nach 30 min bei 37 °C wird die Reaktion durch Zugabe von 400 μl 7% Aktivkohle in 50 mM HCI und 5 mM H3P04 gestoppt. Die Proben werden gemischt, und 15 min bei 13.000 Upm zentrifugiert. Die freigesetzte Radioaktivität wird mit einem Scintillationszähler im Überstand gemessen.
Beispiel 7 : Helikaseaktivität
Die Helikase-Aktivität von Hc1 bzw. Hc2 kann mittels Dissoziation doppelsträngiger RNA verfolgt werden. Das Substrat kann ein beliebiges RNA-Oligomer sein, das an einem Strang markiert ist, z.B. mit 32P. Die Reaktionsmischung enthält in einem 10 μl Ansatz 32P-markiertes Helikasesubstrat, Hc1 bzw. Hc2 in verschiedenen Konzentrationen, 2 mM ATP, 5 mM Dithiothreitol und 50 μg bovines Serum Albumin in 20 mM Tris-HCI. Die Reaktion wird bei 37°C über 30 min durchgeführt und durch Erhitzen gestoppt.
Die Reaktionsmischung wird auf ein 16 cm X 18 cm 12% nicht-denaturierendes Polyacryamidgel aufgetragen und bei konstanter Stromstärke von 25 mA aufgetrennt. Das Gel wird unter Vakuum getrocknet und exponiert (z.B. Kodak RPXRP-5 Film, -70°C).
Beispiel 8 : Antisense
Die RNA-Gegenstränge der DNA-Fragmente Hc1 , Hc2 oder von DNA-Sequenzen die homolog zu Hc1 oder Hc2 sind oder Teilsequenzen von Hc1 , Hc2 oder
Homologen können als Antisense-Stränge eingesetzt werden. Üblicherweise wird ein Plasmid konstruiert, welches die gewünschte Antisense-Sequenz trägt, sowie Selektionsmarker, z.B. Neomycin, einen Promotor der die Expression der Antisense- RNA kontrolliert und RNA-stabilisierende Sequenzen. Die transizierten Sequenzen werden in der Zelle transkribiert und das Transkript hybridisiert mit der Ziel-DNA. Andererseits können in vitro synthetisierte Sequenzen auch durch Mikroinjektion in die Zelle gebracht werden.
Denkbar ist auch der Einsatz von Oligonukleotiden. Diese können entweder synthetisch hergestellt oder durch Restriktionsverdau von Hc1 , Hc2 oder Homologen generiert werden. Die Oligonukleotide müssen hochrein sein. Dies erreicht man durch 2 - 5 maliges Lyophilisieren. Reine Oligonukleotide werden z. B. in HEPES gepufferter Saline, pH 7,4 aufgenommen.
Beispiel 9 : Gensonde zum Auffinden neuer Mitglieder der DEAD-Box-Protein- Familie Die Fragmente Hc1 und Hc2 werden benutzt, um aus geeigneten Organismen neue DEAD-Box-Proteine zu isolieren. Dazu werden die spezifischen Gen-Fragmente mit Hilfe der Polymerase-Ketten-Reaktion (PCR) amplifiziert und gleichzeitig mit Digoxigenin markiert, nach Boehringer Mannheim PCR DIG Probe Synthesis Kit #1636 090. Als Template dient Plasmid-DNA der klonierten Fragmente Hc1 bzw. Hc2. Ein PCR-Ansatz enthält Expand™ High Fidelity Puffer (Boehringer Mannheim #1636 090), 200 μM dATP, 200 μM dGTP, 200 μM dCTP, 130 μM dTTP, 70 μM DIG-11-dUTP, 0.3 ng von jedem Primer, 100 pg Plasmid-DNA, 2,6 U Taq Polymerase.
Zur Amplifizierung des Fragmentes Hc1 wurden die Primer
(2) 5'-GTTCTACCnATTCTGTG-3' und
(3) 5'-ACnGGTTCnGGTAAGAC-3' verwendet, zur Amplifizierung des Fragmentes Hc2 wurden die Primer
(4) 5'-ATAGAATTCCCnACnAGAGAAnTnGCT-3' und (8) 5'-ATAGGATCCGTTCTACCnATTCTGTG-3' verwendet.
Das PCR-Programm war 5 min 95°C, 95°C/37s - 50°C/37s - 72°C/37s - 30 Zyklen. Das PCR-Reaktionsgemisch, das die markierten Fragmente enthält, wird direkt für Hybridisierungsversuche eingesetzt. Dazu wird das PCR-Produkt 10 min bei 95°C denaturiert und mit der Hybridisierungslösung DIG Easy Hyb (Boehringer Mannheim Ref. 1603558) versetzt (Konz. 2 μl/ml). Mit dieser Hybridsierungslösung werden cDNA-Banken geeigneter Organismen bei niedriger Stringenz (Hybridisierungstemperatur 30 - 50 °C) gescreent.
Beispiel 10: Antikörper
Rekombinant exprimiertes Protein wird nach einer geeigneten Methode aufgereinigt und dazu benutzt, um in einem geeigneten Organismus, z. B. Ratte ober Kaninchen, polyklonale Antikörper zu generieren. Dazu wird das Fusionsprotein z. B. zunächst über Glutathion Sepharose und dann über SDS-PAGE aufgereinigt. Die Bande, die das Fusionsprotein enthält wird aus dem Gel ausgeschnitten, zermahlen und z. B. einem Kaninchen oder einer Ratte eingespritzt. Das erhaltenen Antiserum wird über eine IgG Säule gegeben, die Antikörper bei niedrigem pH in 1 M Tris-HCI pH 8 eluiert. Die Antikörper werden gegen 25 mM HEPES pH 7.9, 12 mM MgCI2, 0,5 mM EDTA, 2 mM Dithiothreitol, 17% Glycerin, 100 mM KCI dialysiert.
Beispiel 11 : Einsatz der Antikörper zum Isolieren neuer DEAD-Box-Proteine Die wie im vorstehenden Abschnitt beschrieben erhaltenen Antikörper werden dazu verwendet aus geeigneten Orgnismen neue DEAD-Box Proteine zu isolieren. Dazu werden die Antikörper kovalent an eine geeignete Matrix gekoppelt, z.B. Sephadex G50 (Pharmacia). Mit dem Sephadex werden z.B. Biorad Säulen 1.5 x 10 cm oder 2.5 x 10 cm gepackt und mit 20 ml Puffer A (0.05 M Tris-HCI, 0.15 M NaCI, 0.005 M EDTA, 0.1% NP40, pH 8.0) equilibriert. Danach werden 3.0 g Protein A-Sepharose Beads (Pharmacia CL-4B) auf die Säule gegeben. Über Nacht bei 4°C stehen lassen. Die Antikörperlösung wird auf die Säule gegeben und bei 4°C mit einer Flußrate von -100 ml/h durchtropfen gelassen. Danach wird die Säule mehrmals gewaschen: mit 250 ml Puffer A (plus 0.5%NP40), danach mit 125 ml 0.1 M Borat Puffer, pH 9.0, danach mit 125 ml Borate Puffer pHδ.O , danach mit 125 ml 0.2 M Triethanolamine, pH 8.2. Über Cross-Iinking wird die Fc-Region des Antikörpers an die Protein A-Sepharose gekoppelt. Danach wird die Säule nochmals gewaschen, und zwar einmal mit Puffer B (0.15 M Tris-HCI, 0.15 M NaCI,1 mM EDTA pH 8.0, 10% Glycerol, 10 % NP-40), einmal mit Puffer C (0.05 M Tris-HCI, 0.5 M LiC-1,1 mM EDTA, pH 8.0, 10% Glycerol), und einmal mit Puffer D (0.01 M Pipes, 5 mM NaCI, 1 mM EDTA, pH 8.0, 10% Glycerol). Der nicht gecrosslinkte Antikörper wird mit Citratpuffer eluiert. Gelagert wird die Säule mit Borate Puffer, pH 8.0 mit 0.02% Na N3.
Um neue DEAD-Box Proteine zu isolieren wird Zelllysat geeigneter Organismen auf die Antikörpersäule gegeben. Die Säule wird mehrmals gewaschen und die gebundenen Proteine mit einem geeigneten Puffer, z.B. Glycin, pH 3, in Tris-HCI, pH 8, eluiert.
Beispiel 12 : Überexpression in Nutz-Pflanzen
Die Genfragmente Hc1 und Hc2 können heterolog in Nutzpflanzen exprimiert werden. Der Gentransfer kann beispielsweise über Agrobacterium tumefacians vermittelt werden. Ein typischer A. tumefaciens Vektor (Ti-Plasmid) enthält einen Replikationsursprung (Ori-Agro), der die Replikation in Agrobakterium erlaubt, einen Replikationsursprung Ori-E. coli, der die funktioneile Replikation in E. coli gewährleistet, mehrere Resistenzgene , z. B. gegen Kanamycin und Spectinomycin, Insertionsstellen für das Einbringen des Fremdgens und gerichtete T-DNA
Randsequenzen, die beim Gentransfer die Erkennung von Anfang und Ende des Fremdgens gewährleisten. Mit dem Ti-Plasmid wird A. tumefaciens transformiert.
Zur Infizierung der Nutzpflanze werden von dieser Blattscheiben gestanzt, die in eine flache Schale (Petrischale) gelegt werden. Anschließend fügt man eine Lösung von rekombinanten Agrobakterien hinzu und überführt nach einigen Minuten die Blattscheiben auf ein Medium mit Nährzellen (z.B. Filterpapier). Verwundete Zellen an den Rändern der Blattscheiben setzen Faktoren frei, die zur Infektion der Pflanzenzellen durch das Agrobakterium führen. Nach 2-3 Tagen werden die Blattscheiben auf ein sproßstimulierendes Medium, das ein Antibiotikum enthält, welches die Agrobakterien abtötet (z. B. Cefotaxim), überführt und 2-3 Wochen kultiviert. Die Sprosse werden auf ein wurzelinduzierendes Medium transferiert und nach weiteren 2-3 Wochen in Erde eingepflanzt.
Beispiel 13: Diagnostische Sonden Die Genfragmente Hc1 oder Hc2 oder homologe Genfragmente oder Teile davon
(Länge mindestens 20 Basenpaare), die die für RNA-Helikasen charakteristischen
Homologieboxen enthalten, können als diagnostische Sonden eingesetzt werden.
Dazu werden die DNA-Fragmente auf einer geeigneten Matrix immobilisiert (z. B.
Nylonmembran, Chip). Die mRNA eines Patienten wird aufgereinigt und über reverse Transkription, z.B. mit MMLV Reverser Transkriptase, 2 h bei 37°C, in cDNA umgeschrieben. Gleichzeitig wird die cDNA markiert, z.B. mit 32P oder Digoxigenin.
Die cDNA wird in einem geeigneten Hybridisierungspuffer, z.B. DIG EasyHyb
(Boehringer Mannheim Ref. 1603558) verdünnt und mit der immobilisierten DNA bei stringenten Bedingungen hybridisiert.
Beispiel 14: Selektionsmarker
Die Genfragmente Hc1 und Hc2 können als Selektionsmarker in der Molekularbiologie eingesetzt werden. Es wurde gezeigt, daß die Überexpression einer RNA-Helikase in Mauszellen, diese tolerant gegen die Substanz Leflunomid macht (Müllner-Patent). Um Hc1 oder Hc2 als Selektionsmarker zu verwenden, wird ein Expressionsvektor konstruiert, die Hc1 oder Hc2 enthält und ein zu exprimierendes Gen. Dabei kann das zu exprimierende Gen neben dem Helikase- Gen liegen oder dazuwischen. Mit dem Vektor werden geeignete Wirtszellen transformiert (z.B. Klonierung in einen pGEX-Vektor und Einschleusen in E. coli). Liegt das zu exprimierende Gen neben dem Hc-Gen werden die Transformanden bei erfolgreicher Einschleusung des Vektors tolerant gegen Leflunomid. Den Erfolg der Ligation muß man z. B. über Blue-White-Screening überprüfen. Liegt das zu exprimierende Gen in dem Hc-Gen wird das Hc-Gen bei erfolgreicher Ligation zerstört und die Transformanden verlieren bei erfolgreicher Einschleusung des Vektors ihre Toleranz gegen Leflunomid.

Claims

Patentansprüche
1. Nukleinsäure kodierend für eine RNA-Helikase mit einer Aminosäuresequenz gemäß SEQ ID No. 13 oder eine funktionelle Variante davon, und Teile davon mit mindestens 8 Nukleotiden, wobei SEQ ID No. 13 Teil des Anspruchs ist.
2. Nukleinsäure kodierend für eine RNA-Helikase mit einer Aminosäuresequenz gemäß SEQ ID No. 15 oder eine funktionelle Variante davon, und Teile davon mit mindestens 8 Nukleotiden, wobei SEQ ID No. 15 Teil des Anspruchs ist.
3. Nukleinsäuren nach Anspruch 1 und 2, dadurch gekennzeichnet, daß die Nukleinsäuren eine DNA oder RNA, vorzugsweise eine doppelsträngige DNA ist.
4. Nukleinsäuren nach Anspruch 1 bis 3 erhältlich aus Ciliaten.
5. Nukleinsäuren nach Anspruch 4 erhältlich aus Tetrahymena thermophila.
6. DNA und RNA-Antisensestrang erhältlich aus Nukleinsäuren gemäß Anspruch 1 bis 5.
7. Nukleinsäure nach einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, daß die Nukleinsäure in einem Vektor, vorzugsweise in einem Expressionsvektor oder gentherapeutisch wirksamen Vektor, enthalten ist.
8. Verfahren zur Herstellung einer Nukleinsäure nach einem der Ansprüche 1-6, dadurch gekennzeichnet, daß die Nukleinsäure chemisch synthetisiert oder anhand einer Sonde aus einer Genbank isoliert wird.
9. Polypeptid mit einer Aminosäuresequenz gemäß SEQ ID No. 14 oder eine funktionelle Variante davon, und Teile davon mit mindestens 6 Aminosäuren.
10. Polypeptid mit einer Aminosäuresequenz gemäß SEQ ID No. 16 oder eine funktionelle Variante davon, und Teile davon mit mindestens 6 Aminosäuren.
11. Verfahren zur Herstellung eines Polypeptids gemäß Anspruch 9 oder 10, dadurch gekennzeichnet, daß eine Nukleinsäure gemäß einem der Ansprüche 1 bis 6 in einer geeigneten Wirtszelle exprimiert wird.
12. Antikörper gegen ein Polypeptid gemäß Anspruch 9 oder 10.
13. Verfahren zur Herstellung eines Antikörpers gemäß Anspruch 12, dadurch gekennzeichnet, daß ein Säugetier mit einem Polypeptid gemäß Anspruch 9 oder 10 immunisiert und gegebenenfalls die entstandenen Antikörper isoliert werden.
14. Arzneimittel enthaltend eine Nukleinsäure gemäß einem der Ansprüche 1 bis 6 oder ein Polypeptid gemäß Anspruch 9 oder 10 und gegebenenfalls pharmazeutisch annehmbare Zusatz- und / oder Hilfsstoffe.
15. Verfahren zur Herstellung eines Arzneimitteis zur Behandlung von Krebs, Autoimmunkrankheiten, insbesondere Multiple Sklerose oder Rheumatoide
Arthritis, Alzheimer-Krankheit, Allergien, insbesondere Neurodermitis, Typ I Allergien oder Typ IV Allergien, Arthrose, Atherosklerose, Osteoporose, akute und chronische Infektionskrankheiten und/oder Diabetis und / oder zur Beeinflussung des Zeilmetabolismus, insbesondere bei der Immunsuppression, vor allem bei Transplantationen und/oder Erbkrankheiten, insbesondere Werner
Syndrom, Bloom Syndrom, Xeroderma pigmentosa, Bindegewebskrankheiten, dadurch gekennzeichnet, daß eine Nukleinsäure gemäß einem der Ansprüche 1 -6 oder ein Polypeptid gemäß Anspruch 9 oder 10 oder Antikörper gemäß Anspruch 12 mit einem pharmazeutisch annehmbaren Zusatz- und / oder Hilfsstoff formuliert wird.
16. Diagnostikum enthaltend eine Nukleinsäure gemäß einem der Ansprüche 1-6 oder ein Polypeptid gemäß Anspruch 9 oder 10 oder Antikörper gemäß Anspruch 12 und gegebenenfalls geeignete Zusatz- und / oder Hilfsstoffe.
17. Verfahren zur Herstellung eines Diagnostikums zur Diagnose von Krebs,
Autoimmunkrankheiten, insbesondere Multiple Sklerose oder Rheumatoide Arthritis, Alzheimer-Krankheit, Allergien, insbesondere Neurodermitis, Typ I Allergien oder Typ IV Allergien, Arthrose, Atherosklerose, Osteoporose, akute und chronische Infektionskrankheiten und / oder Diabetis und/oder zur Analyse des Zellmetabolismus, insbesondere des Immunstatus, vor allem bei
Transplantationen und / oder zur Analyse von Erbkrankheiten, insbesondere Werner Syndrom, Bloom Syndrom, Xeroderma pigmentosa, Bindegewebskrankheiten, dadurch gekennzeichnet, daß eine Nukleinsäure gemäß einem der Ansprüche 1 - 6 oder ein Polypeptid gemäß Anspruch 9 oder 10 oder Antikörper gemäß Anspruch 12 mit einem pharmazeutisch annehmbaren Träger versetzt wird.
18. Test zur Identifizierung von funktionelien Interaktoren enthaltend eine Nukleinsäure gemäß einem der Ansprüche 1 - 6 oder ein Polypeptid gemäß Anspruch 9 oder 10 oder Antikörper gemäß Anspruch 12 und gegebenenfalls geeignete Zusatz- und / oder Hilfsstoffe.
19. Verwendung einer Nukleinsäure gemäß einem der Ansprüche 1 - 6 oder eines Polypeptids gemäß Anspruch 9 oder 10 zur Identifizierung funktioneller Interaktoren.
20. Verwendung einer Nukleinsäure gemäß einem der Ansprüche 1 - 6 zum Auffinden von Varianten der RNA-Helikase, dadurch gekennzeichnet, daß eine Genbank mit der genannten Nukleinsäure abgesucht und die gefundene Variante isoliert wird.
21. Verwendung der Nukleinsäuren gemäß einem der Ansprüche 1 - 6 oder eines Polypeptids gemäß Anspruch 9 oder 10 zur Beeinflussung der Proteinbiosynthese.
22. Verwendung der Nukleinsäuren und Polypeptide gemäß Anspruch 21 zur
Hemmung der Degradation der mRNA und / oder Stimulation der Degradation der mRNA und / oder Stabilisierung von mRNA.
23. Verwendung der Nukleinsäuren und Polypeptide nach Anspruch 21 zur heterologen Expression in Nutzpflanzen.
24. Verwendung der Nukleinsäuren gemäß einem der Ansprüche 1 - 6 oder eines Polypeptids gemäß Anspruch 9 oder 10 als Selektionsmarker in der Molekularbiologie.
PCT/EP1999/004892 1998-07-22 1999-07-10 Gene der dead box proteinfamilie, deren expressionsprodukte und verwendung WO2000005388A1 (de)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU50365/99A AU757920B2 (en) 1998-07-22 1999-07-10 Genes of the dead box protein family, their expression products and use
CA002335646A CA2335646A1 (en) 1998-07-22 1999-07-10 Genes of the dead box protein family, their expression products and use
EP99934671A EP1098985A1 (de) 1998-07-22 1999-07-10 Gene der dead box proteinfamilie, deren expressionsprodukte und verwendung
JP2000561334A JP2002524029A (ja) 1998-07-22 1999-07-10 Ｄｅａｄボックスタンパク質ファミリーの遺伝子、その発現産物および使用

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE19832783.8 1998-07-22
DE19832783 1998-07-22

Publications (1)

Publication Number Publication Date
WO2000005388A1 true WO2000005388A1 (de) 2000-02-03

Family

ID=7874812

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1999/004892 WO2000005388A1 (de) 1998-07-22 1999-07-10 Gene der dead box proteinfamilie, deren expressionsprodukte und verwendung

Country Status (5)

Country Link
EP (1) EP1098985A1 (de)
JP (1) JP2002524029A (de)
AU (1) AU757920B2 (de)
CA (1) CA2335646A1 (de)
WO (1) WO2000005388A1 (de)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001072971A1 (fr) * 2000-03-27 2001-10-04 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, arn helicase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001075027A2 (fr) * 2000-03-24 2001-10-11 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001096534A1 (fr) * 2000-05-19 2001-12-20 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, arn helicase humaine 11 atp-dependante, et polynucleotide codant ce polypeptide

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19545126A1 (de) * 1995-12-04 1997-06-05 Hoechst Ag ATP- und Nukleinsäure-bindendes Protein mit Helikase-Eigenschaften

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19545126A1 (de) * 1995-12-04 1997-06-05 Hoechst Ag ATP- und Nukleinsäure-bindendes Protein mit Helikase-Eigenschaften

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
"A. thaliana mRNA for eucaryotic translation initaiation factor 4A-2", EMBL SEQUENCE DATABASE, 20 November 1992 (1992-11-20), Cambridge, UK, XP002121701 *
"Human DEAD-box protein p72", EMBL SEQUENCE DATABASE, 5 October 1996 (1996-10-05), Cambridge, UK, XP002121700 *
"N. plumbaginifolia NeIF-4A2 mRNA for nicotiana eucaryotic translation initiation factor 4A", EMBL SEQUENCE DATABASE, 24 October 1991 (1991-10-24), Cambridge, UK, XP002121702 *
"Schizosaccharomyces pombe p68 protein; p68 gene; RNA helicase", EMBL SEQUENCE DATABASE, 19 April 1991 (1991-04-19), Cambridge, UK, XP002121699 *
A.M. METZ ET AL.: "Sequences for two cDNAs encoding Arabisopsis thaliana eucaryotic protein synthesis initiation factor 4A", GENE, vol. 120, 1992, ELSEVIER SCIENCE PUBLISHERS,B.V.,AMSTERDAM,NL;, pages 313 - 314 *
G.M. LAMM ET AL.: "p72: a human nuclear DEAD box protein highly related to p68", NUCLEIC ACIDS RESEARCH, vol. 24, no. 19, 1996, IRL PRESS LIMITED,OXFORD,ENGLAND, pages 3739 - 3747 *
G.W. OWTTRIM ET AL.: "Divergent genes for translation initiation factor eIF-4A are coordinately expressed in tobacco", NUCLEIC ACIDS RESEARCH, vol. 19, no. 20, 1991, IRL PRESS LIMITED,OXFORD,ENGLAND, pages 5491 - 5496 *
R.D. IGGO ET AL.: "p68 RNA helicase: Identification of a nucleolar form and cloning of related genes containing a conserved intron in yeasts", MOL. CELL. BIOL., vol. 11, no. 3, March 1991 (1991-03-01), ASM WASHINGTON, DC,US, pages 1326 - 1333 *
S.P. MARGOSSIAN AND R.A. BUTOW: "RNA turnover and the control of mitochondrial gene expression", TRENDS IN BIOCHEMICAL SCIENCES, vol. 21, no. 10, October 1996 (1996-10-01), ELSEVIER, AMSTERDAM, NL, pages 392 - 396, XP002121704 *
Z.J. LORKOVIC ET AL.: "PRH75, a new nucleus-localized member of the DEAD-box protein family from higher plants", MOL. CELL. BIOL., vol. 17, no. 4, April 1997 (1997-04-01), ASM WASHINGTON, DC,US, pages 2257 - 2265, XP002121703 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001075027A2 (fr) * 2000-03-24 2001-10-11 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001075027A3 (fr) * 2000-03-24 2002-02-21 Shanghai Biowindow Gene Dev Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001072971A1 (fr) * 2000-03-27 2001-10-04 Shanghai Biowindow Gene Development Inc. Nouveau polypeptide, arn helicase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001096534A1 (fr) * 2000-05-19 2001-12-20 Biowindow Gene Development Inc. Shanghai Nouveau polypeptide, arn helicase humaine 11 atp-dependante, et polynucleotide codant ce polypeptide

Also Published As

Publication number Publication date
EP1098985A1 (de) 2001-05-16
AU757920B2 (en) 2003-03-13
CA2335646A1 (en) 2000-02-03
JP2002524029A (ja) 2002-08-06
AU5036599A (en) 2000-02-14

Similar Documents

Publication Publication Date Title
DE3751338T2 (de) Verfahren zum verleihen bei pflanzen eines widerstands gegen krankheiten und pest sowie neue gene in pflanzen die hierfür kodieren.
DE69634671T2 (de) Mit Nima interagierende Proteine
TWI327067B (en) Antifungal protein and usage thereof
Chen et al. Three newly identified peptides from Bacillus megaterium strongly inhibit the growth and aflatoxin B1 production of Aspergillus flavus
Reichmann et al. The histone deacetylase Hda1 from Ustilago maydis is essential for teliospore development
CN110484539B (zh) 一种调控德国小蠊性信息素合成的基因、基因片段、对应的dsRNA及其制备方法与应用
YOURNO Externally Suppressive+ 1 “Glycine” Frameshift: Possible Quadruplet Isomers for Glycine and Proline
DE60025544T2 (de) Protein, das die Spaltung von Beta-Carotin katalysiert
WO2000005388A1 (de) Gene der dead box proteinfamilie, deren expressionsprodukte und verwendung
DE3686786T2 (de) Menschliche proteine des chinolinesterase-typs und ihre herstellung.
DE3884853T2 (de) Angiogenininhibitoren.
WO1998024916A1 (de) Neue calpaine, ihre herstellung und verwendung
EP1727829B9 (de) Hyphenspezifische zellwandproteine von candida
EP1161535B1 (de) Rna polymerase i transkriptionsfaktor tif-ia
DE19930959A1 (de) Neue Antimycotika und Fungizide, Verfahren zu deren Herstellung und Verwendung
DE60126026T2 (de) PROTEIN MIT HäMOLYTISCHER AKTIVITäT UND DIESES PROTEIN KODIERENDE GEN
US5770717A (en) Nucleic acid encoding a stress-responsive subunit of human RNA polymerase II
WO2005078116A1 (fr) Methode permettant d'isoler de peptides antibacteriens et peptides isoles
CN106167524B (zh) 来源于东方蜜蜂的赛卡品肽
King The phosphite responsive transcriptome of Phytophthora cinnamomi
KR20210069015A (ko) 크립토코커스 네오포만스의 독성을 조절하는 신규 유전자 및 이의 용도
KR20230002766A (ko) 내분비 교란물질 수용체에 상호작용하는 핵산 및 그의 이용
EP1084234A2 (de) Humane deadenylierende nuclease, ihre herstellung und verwendung
DE10045123A1 (de) Das C. albicans TEC1 GEN(CaTEC1) und das kodierte Tec1p Protein
DE19831382A1 (de) Humanes m¶3¶G-cap-spezifisches Kernimportrezeptorprotein mit einer neuen Domänenstruktur, dessen Herstellung und Verwendung

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA IN JP KR US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1999934671

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2335646

Country of ref document: CA

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 561334

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 50365/99

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 09743494

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1999934671

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: CA

WWG Wipo information: grant in national office

Ref document number: 50365/99

Country of ref document: AU

WWW Wipo information: withdrawn in national office

Ref document number: 1999934671

Country of ref document: EP