WO2000004176A1 - Process to collect metabolites from modified nectar by insects - Google Patents
Process to collect metabolites from modified nectar by insects Download PDFInfo
- Publication number
- WO2000004176A1 WO2000004176A1 PCT/NL1999/000453 NL9900453W WO0004176A1 WO 2000004176 A1 WO2000004176 A1 WO 2000004176A1 NL 9900453 W NL9900453 W NL 9900453W WO 0004176 A1 WO0004176 A1 WO 0004176A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- nectar
- plants
- protein
- plant
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/823—Reproductive tissue-specific promoters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/823—Reproductive tissue-specific promoters
- C12N15/8231—Male-specific, e.g. anther, tapetum, pollen
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
Definitions
- the present invention relates to isolated, purified DNA sequences which can act as promoters in eukaryotic cells. More specifically, the present invention is related to such DNA sequences which act as promoters to express genes in nectaries of plants.
- the present invention also relates to chimerical gene constructs comprising a structural or a synthetic gene under the control of a promoter that effects expression of said genes in nectaries.
- This invention also relates to a process for producing metabolites in honey by allowing insects, preferably bees, to collect and process nectar from plants that excrete said metabolites in nectar or other exudates. Further, this invention relates to plant cells, plants or derivatives therefrom, that express the said chimerical gene.
- nectar secreting organs or tissues that can be located inside (floral) or outside (extrafloral) the flower.
- the main component of nectar is sugar, the variation between nectars of flowers from different species mainly being the concentration and ratio of glucose, fructose and sucrose (Baker and Baker, 1982) .
- varying amounts of polysaccharides, lipids, organic acids, volatiles, minerals, phosphates, alkaloids, amino acids and proteins have been detected (Baker and Baker, 1982).
- the nectaries Being a specialised sink organ, the nectaries are supplied with sucrose by phloem unloading (Davis et al . , 1985, Hagitzer and Fahn, 1992).
- Nectar is secreted from secretory cells via the cell membrane (eccrine secretion) or via the Golgi and endoplas atic reticulum vesicles (granulocrine secretion) . Research on the molecular regulation of nectary development and nectary biochemistry has not been reported.
- the main function of floral nectar is to reward pollinating insects. Insects collect nectar to meet their short-term energy requirements. Colony-living honeybees process large quantities of nectar into honey, which is stored in honeycombs of the beehive and is used as food supply during the winter period. Within the bee colony different classes of worker bees cooperate in the honey production process. Foraging bees collect pollen and nectar from the flowers and bring it to the hive. On returning to the hive they give most of it up to household bees. Pollen is used as a protein source, especially to feed the brood. Adult nurse and worker bees use little protein, their capacity to digest proteins being very low (Crailsheim et al . , 1993).
- Honey processing takes place by repeated swallowing and bringing up of the nectar from the honey stomach. In the first process 15% of the water content is lost. This semi- processed nectar is temporarily stored in a honeycomb cell and taken out later for further processing. The final process includes filtering the honey to discard small particles like pollen grains. Sugar metabolising enzymes (invertase, amylase) are added and the honey is concentrated to an average water content of 20%. Most nectars and honeys only contain traces of protein ( ⁇ 0.2%). However, Calluna vulgaris (heather) honey can contain up to 1.8% protein, giving it thixotropic properties (Butler, 1962) . It is known that bees add enzymes like invertase to nectar during the honey processing.
- sugar metabolising enzymes invertase, amylase
- heather honey contains two unique proteins that originate from floral nectar of heather. Based on these results a production system for proteins in nectar and honey was estab- lished.
- Honey A substance that contains approximately 80% sugar and varying amounts of other components and that is produced by insects, preferably bees, that collect and process nectar from floral or extrafloral nectaries, from honeydew, other plant exudates or artificial sugar solutions.
- MADS box gene a gene coding for a transcription factor having a region of 56 amino acids which is homologous to a similar region in the Arabidopsis AGAMOUS protein and Antirrhinum DEFICIENS protein. This region is called the 'MADS box' . At least 50% of the amino acids in this region should be identical to the amino acid composition in the MADS boxes of AGAMOUS and/or DEFICIENS.
- Nectary secretory organ or secretory tissue of plants, located in the flowers (floral nectaries) or outside the flower (extrafloral nectaries) that excrete nectar.
- Nectar sugar containing fluid that is secreted by nectaries. Nectar can also contain substances like minerals, amino acids, proteins, organic acids, volatiles, alkaloids etc .
- Recombinant protein the gene product of a recombinant DNA molecule .
- Recombinant DNA molecule A DNA molecule in which sequences which are not naturally contiguous have been placed next to each other by in vitro manipulations.
- Promoter The DNA region, usually upstream to the coding sequence of a gene, which binds RNA polymerase and directs the enzyme to the correct transcriptional start site.
- the present invention provides a method to produce metabolites, preferably recombinant proteins in honey, which is manufactured by insects, preferably honeybees, that collect floral nectar of transgenic plants.
- Harvesting of honey is very simple and purification of the protein is very straight forward and requires no advanced purification steps.
- To give an estimation of the protein yield in a crop like rapeseed we suggest an average protein production of 2% in honey, as has been found in honey of heather. If one hectare of rapeseed yields 100-500 kilo honey in one season, a yield of 2 to 10 kilo protein can be obtained.
- the present invention provides a method to collect metabolites from honey that is derived from non- transgenic plants that secrete these metabolites in nectar.
- This invention provides a gene from petunia, NECl , that is highly expressed in the nectaries of petunia and weakly expressed in the stamens. It also provides another gene from petunia, FBP15 , that encodes a MADS box protein and which is specifically expressed in the nectaries of petunia. Further, it provides the isolated DNA sequences of the promoters of the NECl and the FBP15 genes. Furthermore, this invention provides an isolated DNA sequence expressed in nectaries encoding a signal peptide that is translation- ally fused to a germin-like protein (Lane et al . , 1993, Dumas et al .
- this invention provides an isolated DNA sequence which encodes a protein indicated NECl and having the amino acid sequence given in SEQ ID NO : 1 of the sequence listing hereafter or homologs of NECl.
- a homolog of NECl is predominantly expressed in nectaries and/or has at least 60% homology with the amino acid sequence given in SEQ ID NO:l.
- this invention provides an isolated DNA sequence which encodes a protein indicated FBP15 and having the amino acid sequence given in SEQ ID NO : 2 of the sequence listing hereafter or a homolog of FBP15.
- a homolog of FBP15 is specifically expressed in nectaries and belonging to the MADS box family.
- a homolog is also a gene sequence that has at least 80% homology within the
- this invention provides the characterisation and the isolation of a DNA sequence which encodes a signal peptide indicated "CVSP" (Calluna vulgaris signal peptide) , wherein the information contained in the DNA sequence permits, upon translational fusion with a DNA sequence encoding a protein that is expressed in nectaries, targeting of the protein to nectar.
- CVSP Common vulgaris signal peptide
- the DNA sequences of the invention can also be characterised in that they comprise the NECl gene and the FBP15 gene having the nucleotide sequences given in SEQ ID NO : 4 and SEQ ID NO : 5 respectively, or a functionally homologous gene or an essentially identical nucleotide sequence or part thereof or derivatives thereof which are derived from said sequences by insertion, deletion or substitution of one or more nucleotides, said derived nucleotide sequences being obtainable by hybridisation with the nucleotide sequences given in SEQ ID NO : 4 and 5 respectively.
- DNA sequences of the invention can also be characterised in that they comprise signal sequence CVSP having the nucleotide sequence given in SEQ ID NO : 6 , or an essentially identical nucleotide sequence or part thereof or derivatives thereof which are derived from said sequences by insertion, deletion or substitution of one or more nucleotides.
- this invention provides an isolated DNA sequence from the promoter region upstream of a nectary-specific expressed sequence, which nectary-specific expressed sequence encodes a protein comprising the amino acid sequence given in SEQ ID NO : 1 , or a homologous protein.
- this invention provides an isolated DNA sequence from the promoter region upstream of a nectary- specific expressed sequence, which nectary-specific expres- sed sequence encodes a protein comprising the amino acid sequence given in SEQ ID NO : 2 , or a homologous protein.
- the invention provides a protein encoded by any of the above defined DNA sequences. Further, the invention provides processes of producing transgenic plants exhibiting excretion of recombinant proteins in nectar, the expression of the chimerical genes and the targeting of the recombinant proteins being under the control of promoter sequences and a signal sequence as described in this invention. Still further, the invention provides processes of producing transgenic plants that produce recombinant proteins in nectar, the expression of the chimerical genes being under the control of promoter regions upstream of other genes that are expressed in nectaries. Still further, the invention provides processes of producing transgenic plants that produce recombinant proteins in nectar, the expression of these proteins being under the control of any signal peptide that affects targeting of a protein in nectar.
- the invention provides recombinant double stranded DNA molecules comprising expression cassettes to be used in the above process. Further, the invention provides transgenic bacteria, transgenic plants producing recombinant proteins in nectar, and also plant cells, tissue culture, plant parts or progeny plants derived from said transgenic plants. Finally, the invention provides a process to produce recombinant gene products in honey, produced by bees that collect nectar from transgenic plants and process this nectar into honey.
- Figure 1 shows a polyacrylamide gel with PCR products after Differential Display mRNA amplification.
- PCR reactions were performed with the oligo-dT primer T12MG in combination with 5 different random primers Apll-AP15 on cDNA samples of pistils without nectaries (two independent samples) , nectaries (two independent samples) , leaves and a mixture of sepals (s) , petals (p) and stamens (a) .
- Bold arrow depicts the cloned fragment DD18.
- Figure 2 is the DNA sequence of the Differential Display RT-PCR clone DD18a.
- the primers prat 122 and prat 119 that were used for 5' RACE PCR reactions are underlined.
- Figure 3 is the DNA sequence of clone RC8, obtained by RACE PCR with gene specific primers prat 122 and prat 119 (Fig. 2) in combination with adapter primers.
- Primer prat 129 (underlined) is used in the next step together with primer prat 122 to amplify the coding region of the NECl cDNA.
- Figure 4 is the full length sequence of NECl cDNA.
- the translation start (ATG) and translation stop (TAA) are depicted bold.
- Figure 5 shows the expression of NECl (A) and FBP15 (B) in wild type petunia plants (line W115) as determined by Northern blot analysis.
- Blot A contains total RNA, while blot B is enriched for mRNA.
- For blot A the Hindlll/EcoRI fragment of pDD18a was used as a probe.
- FIG. 6 Expression of NECl by in situ localisation of NECl transcripts (A) and activity of the NECl promoter in the nectaries (B) and the stamen (C) as shown by GUS expression driven by the NECl promoter.
- the GUS assay used for the stamens was incubated overnight without modificati- ons to prevent diffusion (example 8) .
- the GUS assay for the nectaries was incubated for 5 hrs, using an assay mixture to prevent diffusion (example 8).
- For in situ localisation longitudinal sections of flowers of Petunia hybrida were hybridised with digoxigenin- labeled antisense NECl RNA
- Figure 7 is the DNA sequence from the promoter region upstream of a sequence encoding the NECl protein. Underlined is the translation start of NECl cDNA.
- Figure 8 depicts a schematic presentation of the T-DNA region between the borders of the binary vector pBNEPl, containing the NECl promoter ( Figure 7), the GUS reporter gene and the nos terminator in pBINPLUS . This vector was used to generate transgenic plants to study the expression of the NECl promoter.
- Figure 9 shows the SDS-PAGE separation of proteins that are present in commercial honey samples from different flowers.
- M marker, lane 1: wattle bark, lane 2: flower mixture, lane 3: heather, lane 4: clover, lane 5: rapeseed.
- Figure 10 shows the SDS-PAGE separation of proteins that are present in commercial honey samples of rapeseed (RH2x, RHIOx) and heather (HH2x, HHlOx) and of nectar samples of rapeseed (RN2x, RNlOx) and heather (HN2x, HNlOx) .
- M molecular weight marker. Two (2x) or ten (lOx) fold diluti- ons were used.
- Figure 11 shows the SDS-PAGE separation of proteins present in dilutions of the sugar/BSA feeding solution (A) and of honey from bees that had collected the sugar/BSA solution (B) .
- M marker
- Figure 12 shows the sequence homology of the N-terminal protein sequence of CVH29, a unique protein present in heather honey and nectar, with a germin-like protein GER1 from a gene bank homology search (BLAST) .
- Figure 13 shows the deduced DNA sequence of the N-terminal protein sequence of CVH29.
- the degenerated primers prat 176 and prat 177 are underlined (A) .
- the DNA sequence of the PCR product obtained with prat 176 and prat 177 performed on genomic DNA of heather is shown in B.
- the gene-specific primers prat 207 and prat 206 used to perform 5 ' RACE PCR reactions on cDNA from heather flowers are underlined.
- Figure 14 shows the DNA sequence of four independent clones obtained by 5 ' RACE PCR with prat 207 and prat 206 on cDNA of heather flowers.
- the ATG translation start of the putative signal sequence is boxed.
- the end of the putative signal sequence and the start of the mature protein are indicated by arrows.
- Figure 15 is the sequence of the synthetically produced DNA molecule encoding the signal sequence CVSP (boxed) with linkers.
- Figure 16 is the schematic representation of the plasmid pCVl . Not all restriction sites are indicated.
- Figure 17 is the schematic representation of the plasmid pCV2. Not all restriction sites are indicated.
- Figure 18 is the schematic representation of the plasmid pCV3. Not all restriction sites are indicated.
- Figure 19 is the DNA sequence of the full length cDNA of FBP15.
- the translation start (ATG) and translation stop (TAA) are boxed.
- the MAD-box and K-box region are underlined.
- This invention provides processes of producing transgenic plants that produce recombinant proteins in nectaries and nectar that is collected by foraging honeybees. This invention gives evidence that honeybees process protein containing nectar into honey that contains the unaltered protein in a concentrated form. Subsequently, the desired protein can be purified from the honey.
- a translational fusion of an isolated DNA sequence from a promoter region upstream of a sequence encoding a protein that is expressed in nectaries with a sequence encoding the recombinant protein has to be carried out.
- the isolated DNA sequence from a promoter region is upstream of a sequence that is specifically or highly expressed in nectaries.
- the invention relates to a DNA sequence isolated from Petunia hybrida that encodes a protein indicated NECl or a homologous protein or part thereof.
- a homologous protein has at least 65% homology with the amino acid sequence given in SEQ ID NO : 1.
- the cDNA sequence of the NECl gene is given in Fig. 4 and in SEQ ID NO : 4.
- the deduced amino acid sequence of the NECl gene is given in SEQ ID NO : 1.
- the NECl gene shows strong expression in the nectaries and in a very localised region of the anther filaments of Petunia hybri da .
- the deduced amino acid sequence of NECl predicts a membrane bound protein.
- the precise function of the gene has not been elucidated yet, but considering the phenotype of transgenic plants that ectopically express NECl in the leaves, a role in sugar metabolism of NECl is apparent.
- the present invention also relates to homologous DNA sequences that can be isolated from other organisms, preferably plants, using standard methods and the already known DNA sequence of the NECl gene. More precisely, it is also possible to use DNA sequences which have a high degree of homology to the DNA sequence of the NECl gene, but which are not completely identical, in the process according to the invention. The use of sequences having homologies between 85 and 100 % is to be preferred. DNA sequences can also be used which result from the sequence shown in SEQ ID NO: 4 by insertion, deletion or substitution of one or more nucleotides. This includes naturally occurring variations or variations introduced through targeted mutagenesis or recombination. The DNA sequence shown in SEQ ID NO : 4 can also be produced by using DNA synthesis techniques.
- the invention also relates to a DNA sequence isolated from Petunia hybrida that encodes a MADS box protein indicated FBP15 or a homologous protein or part thereof.
- the cDNA sequence of FBP15 is given in SEQ ID NO : 5.
- FBP15 shows exclusively expression in the nectaries of Petunia nyjbrida.
- the function of FBP15 is unknown.
- the present invention also relates to homologous DNA sequences that can be isolated from other organisms, preferably plants, using standard methods and the already known DNA sequence of FBP15. More precisely, it is also possible to use DNA sequences which have a high degree of homology to the DNA sequence of FBP15, but which are not completely identical, in the process according to the invention.
- sequences having homologies between 85 and 100 % is to be preferred.
- DNA sequences can also be used which result from the sequence shown in SEQ ID NO : 5 by insertion, deletion or substitution of one or more nucleotides. This includes naturally occurring variations or variations introduced through targeted mutagenesis or recombination.
- the DNA sequence shown in SEQ ID NO : 5 can also be produced by using current DNA synthesis techniques.
- this invention provides an isolated DNA sequence from the promoter region upstream of a nectary-specific expressed sequence, which nectary-specific expressed sequence encodes a protein comprising the amino acid sequence given in SEQ ID NO : 1 , or a homologous protein that is expressed in nectaries. Furthermore, this invention provides an isolated DNA sequence from the promoter region upstream of an isolated DNA sequence from the promoter region upstream of a nectary-specific expressed sequence, which nectary specific sequence encodes a protein compri-
- SUBST1TUTE SHEET (RULE 26) sing the amino acid sequence given in SEQ ID NO : 2 , or a homologous protein that is expressed in nectaries.
- this invention provides an isolated DNA sequence from the promoter region upstream of a nectary- specific expressed sequence, which nectary-specific expressed sequence has : a) a nucleotide sequence given in SEQ ID NO : 4 , or b) a nucleotide sequence obtainable by hybridisation with the nucleotide sequence of (a) or with a fragment of (a) .
- this invention provides an isolated DNA sequence from the promoter region upstream of a nectary-specific expressed sequence, obtained from a plant of Petunia hybrida , the sequence consisting essentially of the sequence given in SEQ ID NO : 7 , or a functional fragment thereof having promoter activity.
- the invention provides an isolated DNA sequence from the promoter region upstream of a nectary- specific expressed sequence, which nectary-specific expressed sequence has : a) a nucleotide sequence given in SEQ ID NO : 5 , or b) a nucleotide sequence obtainable by hybridisation with the nucleotide sequence of (a) or with a fragment of (a) .
- this invention provides an isolated DNA sequence from the promoter region upstream of a nectary-specific expressed sequence, obtained from a plant of Petunia hybrida , the sequence consisting essentially of the sequence given in SEQ ID NO : 8 , or a functional fragment thereof having promoter activity.
- this invention provides an isolated DNA sequence comprising the coding region for a signal peptide, wherein the information contained in the DNA sequence permits, upon translational fusion with a DNA sequence encoding a protein that is expressed in nectaries, targeting of the protein to nectar.
- the DNA sequence comprises the nucleotide sequence given in SEQ ID NO : 6 obtained from a plant of Calluna vulgaris, or a nucleotide sequence obtai- nable by hybridisation with the nucleotide sequence given in SEQ ID NO : 6.
- sequences having homologies between 95 and 100 % is to be preferred.
- DNA sequences can also be used which result from the sequence shown in SEQ ID NO: 6 by insertion, deletion or substitution of one or more nucleotides. This includes naturally occurring variations or variations introduced through targeted mutagenesis or recombination.
- the DNA sequence shown in SEQ ID NO : 6 can also be produced by using DNA synthesis techniques.
- the signal peptide CVSP was isolated from nectar of Calluna vulgaris flowers and from honey processed by honeybees that collected the nectar.
- the function of CVSP in heather nectaries is to target the germin-like protein to nectar.
- the DNA sequence CVSP can also be used to target other proteins to nectar in plant species.
- a subject of the present invention is the use of DNA sequences for producing recombinant proteins in nectar of plants, wherein the protein is produced in nectaries and targeted to nectar, and wherein expression in nectaries is achieved by using a DNA sequence consisting of the promoter region upstream of a DNA sequence that is expressed in nectaries, and wherein secretion in nectar is achieved by using a DNA sequence that encodes a signal sequence that targets the recombinant protein to nectar.
- the present invention relates to processes wherein a recombinant protein is expressed in other plant tissues than the nectaries and wherein the biochemical composition of nectar is changed as a consequence of the recombinant gene expression.
- the present invention also relates to processes wherein a recombinant protein is expressed in nectaries of a transgenic plant, wherein the biochemical composition of nectar or the nectar secretion is changed as a consequence of this protein expression.
- the recombinant protein is an enzyme that interferes with the sugar metabolism in nectaries .
- a recombinant protein in nectaries and nectar is achieved by integrating into the genome of the plants a recombinant double-stranded DNA molecule comprising an expression cassette having the following constitu- ents and expressing it: i) a promoter functional in nectaries of plants, ii) a DNA sequence encoding a protein which is fused to the promoter, iii) a DNA sequence encoding a signal peptide that targets the recombinant protein to nectar, which is translationally fused to the DNA sequence encoding the recombinant protein, and optionally iv) a signal sequence functional in plants for the transcription termination and polyadenylation of an RNA molecule.
- Such DNA molecules are also subject of the invention.
- the present invention provides an example of such a DNA molecule that contains the described expression cassettes in the form of plasmid pCV3 (Fig. 18), which comprises the promoter region of the NECl gene from petunia, the signal sequence CVSP from heather, the coding region of the reporter gene GUS and the NOS terminator.
- plasmid pCV3 Fig. 18
- any promoter that is active in the nectaries of plants can be used as promoter.
- the promoter is to ensure that the chosen gene is expressed in nectaries.
- any signal sequence that targets the expressed protein to nectar can be used as a signal sequence.
- the signal sequence is to ensure that the protein is excreted in nectar.
- any sequence that encodes a recombinant protein in nectaries can be used in the present invention.
- the subject of this invention relates to DNA sequences that encode proteins to be used for pharmaceutical purposes.
- proteins for other purposes e.g. enzymes for biotests or antioxidants for food additives.
- DNA sequences that encode proteins that modify the nectar composition or the sink strength of nectaries can be used to use DNA sequences that encode proteins that modify the nectar composition or the sink strength of nectaries . This means that the recombinant protein interferes with metabolic pathways in the necta- ries, resulting in changed levels of compounds that are already present in nectar, or the formation of new compounds in nectar.
- the present invention also relates to expression cassettes that contain the above mentioned DNA sequen- ces, except for a signal sequence.
- the recombinant protein is then only expressed in the nectaries, but not targeted to the nectar. Consequently, the expression of the recombinant protein in the nectaries can still affect nectar composition.
- the present invention also relates to expression cassettes that contain DNA sequences coding for a protein that is expressed in other tissues than the nectaries. The expression of the recombinant protein affects changes in the biochemical composition of nectar or in nectar secretion.
- the present invention also relates to non-transge- nic plants that produce metabolites in nectar that can be harvested and purified from honey that is produced by honeybees that collect this nectar.
- these metabolites are alkaloids, terpines, amino acids, proteins, pigments and volatiles.
- a preferred embodiment of the process discussed above provides that the expression cassette is transformed to a plant species that produces nectar.
- the recombinant protein is produced in nectar of plants that are visited by honeybees that collect the nectar.
- Honeybees collect floral as well as extrafloral nectar.
- the present invention relates to plants that produce recombinant proteins in floral or extrafloral nectar.
- the present invention also relates to plants that produce recombinant proteins in other plant organs, said plant organs producing an exudate that is collected by insects, preferably bees, and processed into honey.
- a particularly preferred embodiment of the present invention are plants that can be grown under controlled conditions. Controlled conditions are greenhouses or field facilities where transgenic plants can be grown according to the safety rules that are required. Preferably, the controlled conditions are such that bee colonies that perform normal foraging behaviour can be maintained in the same compart- ment during the flowering period.
- Preferred plants originate from the Brassicaceae family, in particular Brassica napus .
- the NECl cDNA was isolated using the mRNA Differential Display system (Gen under Corporation, Brookline USA) .
- the isolation of total RNA from nectaries, sepals, petals, stamens and pistils from open flowers and from young leaves of Petunia hybrida was done according to Verwoerd et al .
- RNA MessageCleanTM Two independent RNA isolations were performed on nectaries as well as on pistils. A DNase treatment was carried out on each RNA sample, using the RNA MessageCleanTM
- Reamplification of the fragment was carried out using the oligo-dT primer T12MG and the arbritary primer AP15. After electrophoresis, the PCR product was extracted from the agarose gel by freezing the isolated fragment in liquid nitrogen, followed by centrifugation. DNA was precipitated by adding 1/10 volume 1% HAc, 0. IM MgCl 2 and 2.5 volume of 96% ethanol to the supernatant. The pellet was dissolved in 10 ⁇ l TE buffer. The fragment, now called DD18a, was cloned into a PMOSBlue T-vector (RPN 1719, Amersham Little Chalfont UK) giving the vector pDD18a.
- PMOSBlue T-vector RPN 1719, Amersham Little Chalfont UK
- the nucleotide sequence of this 3' cDNA clone was determined by the dideoxynucleotide chain termination method (ABI PRISMTM Ready Reaction DyeDeoxyTM Terminator Cycle Sequencing Kit, P/N 402078, Perkin Elmer) and is shown in Figure 2.
- the DNA fragment has a length of 460 nucleotides.
- the missing 5' part of the cDNA was isolated using the Marathon TM cDNA Amplification Kit of Clontech (catalog K1802-1) and following the procedure as described in the manual. Briefly, Poly A+ RNA was isolated from nectaries of Petunia hybrida flowers.
- the nucleotide sequence of prat 119 is: 5'- ccttctccatggactgcaatgcg- ' 3 .
- a fragment of +850 bp was obtained that hybridised with clone DD18a.
- the fragment, now called RC8 was extracted from the gel, purified and cloned into a PMOSBlue T-vector as described above.
- the sequence is shown in Figure 3.
- the combined (overlapping) sequences of clones DD18a and RC8 are shown in Figure 4, comprising the full length cDNA of a gene called NECl hereafter.
- the NECl clone has a length of 1205 nucleotides and encodes for a polypeptide of 265 amino acid residues. Based on the deduced amino acid sequence, high homology was found with a cDNA that is associated with Rhizobium- induced nodule development in the legume Medicago trunculata (MtN3, gene bank number: gnl/PID/e274341) . The percentages of identity and similarity are 47% and 72% respectively. Analysis of the predicted protein, using the CAOS/CAMM programme (Protein analysis 1991, Genetics Computer Group inc., Wisconsin USA), shows that the putative protein structure resembles membrane proteins, having six evenly spaced hydrophobic loops that traverse the cell membrane.
- NECl a signal sequence is predicted at the N-terminus, while the C-terminus is highly hydrophilic. Highest homology with MtN3 is found in the N-terminal signal sequence, the first two membrane-spanning loops and the last two membrane-spanning loops. The C-terminal hydrophilic part shows the lowest homology (28% identity, 30% similarity) . The function of NECl has not yet been determined.
- Petunia MADS box cDNA clones were isolated from a cDNA library made from nectaries of Petunia hybrida flowers.
- the cDNA library was constructed using the lambda ZAP cloning vector (Stratagene, La Jolla USA, catalog nr. 200400- 200402) .
- the library was screened under low stringency hybridisation conditions with a mixed probe comprising the MADS box regions of Floral binding protein gene FBP2, FBP6 and pMADS3 (Angenent et al . , 1993, 1994, Tsuchimoto 1993).
- the hybridizing phage plaques were purified using standard techniques.
- E.coli clones which contain a double- stranded Bluescript SK- plasmid with the cDNA insertion between the EcoRI and Xhol cleavage site of he polylinker were generated.
- Cross- hybridisation of the purified clones revealed 3 independent clones that did not cross hybridise with previously isolated FBP cDNA' s and which were designated FBP15, FBP16 and FBP17.
- the nucleotide sequence of FBP15 was determined by the dideoxynucleotide-mediated chain termination method and is depicted in SEQ ID NO : 5.
- the FBP15 cDNA clone has a length of 1157 nucleotides and encodes a peptide of 222 amino acid residues. All characteristics of a MADS box protein are present in FBP15 : a N-terminal located MADS box region which shows a high degree of similarity with other MADS box proteins, and a K-box in the middle of the protein with an alpha helical structure. FBP15 is most similar to the tobacco MADS box protein NAG1, which is an Agamous homolog and expressed in whorl 3 and 4 (Huang et al . , 1996, Mizukami et al . , 1996).
- FBP15 was determined by standard Northern blot hybridisation experiments. A DNA fragment comprising the complete cDNA of FBP15 was used as a probe. High stringency hybridisation and washing conditions were used. Using 10 ⁇ g of total RNA from various petunia tissues, expression of FBP15 was only detectable in nectaries. Using 10 ⁇ g of mRNA from various tissues, prepared by using the kit and protocol of the Quickprep Micro mRNA Purification Kit (Pharmacia Biotech) , expression of FBP15 was only detectable in nectaries as shown in Figure 5B. The expression in the ovary and nectaries was determined by in situ hybridisation using a DIG labelled antisense RNA probe corresponding to the full length cDNA of FBP15.
- RNA transcripts were made using T7 RNA polymerase.
- a standard protocol for in situ hybridisation was used as described by Canas et al . , 1994.
- a hybridizing signal was observed evenly strong in all cells of the nectary tissue.
- the R ⁇ A expression of NECl was determined by standard Northern blot hybridisation experiments. A DNA fragment comprising the complete sequence of the Differential Display clone DD18 ( Figure 2) was used as a probe. Using 10 ⁇ g of total RNA from various petunia tissues, strong expression of NECl was detectable in nectaries and weak expression in anthers. No expression was detectable in other floral organs, in leaves or in roots ( Figure 5A) . The expression in the ovary and nectaries was determined by in situ hybridisation using a DIG labelled antisense RNA probe corresponding to the nucleotides 79 to 1036 of NECl cDNA, comprising the coding region and part of the 3 ' untranslated region.
- a clone containing this sequence was obtained by PCR on adapter-ligated cDNA, using two gene- specific primers prat 122 and prat 129 ( Figure 4) .
- the nucleotide sequence of prat 122 is: 5 ' -gtgggaaggctatgctaca- agc-3'", comprising the nucleotides 1015 to 1036 of the NECl cDNA.
- the nucleotide sequence of prat 129 is: 5'- gqqatccatqqcqcaattacgtqctqatq-3 ' , comprising the nucleotides 79 to 100 of the NECl cDNA.
- the gene-specific region of the primers is underlined.
- the primer contains an extra BamHI and Ncol site at the 5 'end.
- a PCR fragment of 958 nucleotides was obtained and cloned into a PMOSBlue vector. The fragment was subcloned in a vector containing the T7 promoter and in vitro antisense RNA transcripts were made using T7 RNA polymerase.
- a standard protocol for in situ hybridisation was used as described by Canas et al . , 1994. Strong hybridizing signals were observed in the outer cell layers of the nectaries ( Figure 6A)
- the promoter fragment of NECl was cloned using the genome walker protocol (PT3042-1) and kit as provided by Clontech Laboraties. Briefly, genomic DNA from Petunia hybrida was digested with 5 different blunt cutting restriction enzymes. GenomeWalker adapters were ligated and PCR reactions were carried out on each GenomeWalker "library” with a gene specific, reversed primer prat 148 and the adapter primer from the kit (API) .
- the nucleotide sequence of prat 148 is: 5 ' -ccaagaaggccaaatatgaaagac-3 ' comprising the nucleotides 105 to 128 of the NECl cDNA ( Figure 4) .
- PCR products were subjected to a second round of PCR, using the nested adapter primer AP2 and the nested gene specific, reversed primer prat 149.
- the nucleotide sequence of prat 149 is: 5' -aagtcatcagcacgtaattgcgcc-3 ' , comprising the nucleotides 81 to 104 of the NECl cDNA.
- a 2 kb fragment was isolated from the Stul library, which was cloned in the PMOSBlue T-vector, yielding the construct pMA5-10.
- Figure 7 shows the DNA sequence of the NECl promoter in the construct pMA5-10, including the translation start of NECl cDNA.
- Example 6 shows the DNA sequence of the NECl promoter in the construct pMA5-10, including the translation start of NECl cDNA.
- PCR reaction was performed on pMA5-10 (example 5) , using the forward vector primer U19 of pMOSBlue and the gene- specific primer prat 169.
- the nucleotide sequence of prat 169 is:
- the gene-specific region is underlined.
- the primer contains an Ncol and Bglll restriction site at the 3' end.
- the PCR product was digested with Kpnl and Ncol and ligated into a pBluescript- derived vector (pM04) that contains the NTM19 promoter
- Agrobacterium strain LBA4404 transformants were used to transform Petunia hybrida using leaf discs as described by
- GUS /3-glucuronidase activity
- the germin-like protein CVH29 is excreted in heather nectar it was expected that part of the cDNA encodes a signal sequence.
- degenerated primers were designed.
- a PCR reaction performed on genomic DNA of heather yielded a 99 bp DNA fragment.
- a PCR reaction was performed, using the adapter primer API and the gene- specific primer prat 207.
- the PCR product was used for a second PCR, using adapter primer AP2 and the nested gene-specific primer prat 206.
- a single fragment of around 300 nucleotides was obtained and cloned in a PMOSBlue T-vector.
- Four clones were sequenced.
- Figure 14 shows that three clones were identical and one clone had two different nucleotides in the untranslated 5' region.
- a putative signal sequence of 17 amino acids was identified between the ATG start codon and the first codon of the mature protein CVH29 that was identical in all four clones.
- the nucleotide sequence of the putative signal sequence (SEQ ID NO: 6) is:
- a PCR reaction was carried out on pMA5-10 (example 5) using the forward primer prat 247 and the reversed primer prat 248 (Fig. 7) .
- Prat 247 contains an extra Pstl restriction site.
- the Ndel restriction site of prat 248 coincides with the ATG translation start of NECl .
- the nucleotide sequence of prat 247 is: 5 ' -ggctgcaggagtgttctttgatagaatg-3 '
- the nucleotide sequence of prat 248 is: 5'-cgcca- tatgtttttttatggaagccc-3 '
- Gene-specific regions are underlined.
- a 1,8 kb promoter fragment was obtained and cloned into a pMOSBlue vector, yielding the plasmid p ⁇ ECP .
- a D ⁇ A molecule encoding the signal sequence CVSP as depicted in SEQ ID NO: 6 was produced by synthesis and subsequent annealing of two oligo molecules prat 245 and prat 246.
- the sequence of prat 245 is: 5 ' tatgttccttccaattcttttcactatttct- cttcttttctcttctcatgcttctqttcttqattttc 3
- the sequence of prat 246 is: 5 ' gatccgaaatcaagaacagaagcatgagaagaagagaaaagaa- gagaaatagtgaaaagaattggaaggaaca ' 3.
- the region encoding the signal sequence CVSP is underlined.
- the linkers were extended with the coding region for the first five amino acids of the mature germin-like protein (Fig. 13).
- the codon usage of the signal peptide sequence was optimised for Arabidop- sis.
- 2 extra amino acids were linked in frame to the mature protein.
- the resulting DNA molecule is shown in Figure 15. The fragment was ligated into a Ndel/BamHl cut PMOSBlue vector, yielding the plasmid pCVSP.
- pNECP was digested with Ndel and Pstl to release the NECl promoter fragment which was cloned into the Pstl/Ndel cut pCVSP, yielding the plasmid pCVl .
- a schematic representation of pCVl is given in Figure 16.
- a 250 bp long fragment containing the NOS terminator sequence was obtained by PCR, using the forward primer prat 251 and the reversed primer prat 252 on DNA of pRAP 33, which is a pUC 19 derived plasmid.
- Prat 251 adds a Sad and Xhol site
- prat 252 adds a Smal and EcoRI site.
- the sequence of prat 251 is: 5 ' -gggagctcgagtcgttcaaa- catttggcaataaag-3 ' .
- prat 252 The sequence of prat 252 is: 5'-cgaatt- cccgqqatctaqtaacataqatqacac-3 ' .
- the NOST-specific regions are underlined.
- the PCR product was cloned into pCR-ScriptTM Amp SK(+) Cloning Kit (Catalog 21188-21190, Stratagene La Jolla USA) , yielding the plasmid pCR-NOST.
- pCR-NOST was digested with Sacl and EcoRI and the resulting fragment was cloned into the pUC 19 (ClonTech) , derived plasmid pUCAP yielding the plasmid pCVNOS .
- the plasmid pGUSN358 was purchased from Clontech (catalog 6030-1) containing the reporter gene GUS in pUC 119, modified to destroy the N-linked glycosylation site within the 1.814 Kb GUS coding sequence.
- a PCR reaction was carried out with gene-specific primers prat 249 and prat 250, yielding a fragment that contains the GUS gene coding region and a BamHI restriction site at the 5 ' end and a Sacl restriction site at the 3 'end.
- the sequence of prat 249 is: 5' -ccqqatccatqttacgtcctqtaqaacc-3 ' .
- prat 250 The sequence of prat 250 is: 5' -qqqagctcccaccqaqqctqtaq-3 ' .
- the GUS specific regions are underlined.
- the PCR fragment was digested with BamHI and Sacl and ligated into the BamHI/Sa- cl cut plasmid pCVNOS , yielding the plasmid pCV2.
- a schematic representation of pCV2 is given in Figure 17.
- pCVl is digested with Pstl and BamHI and the resulting fragment is cloned into the Pstl/BamHI cut plasmid pCV2 , yielding the plasmid pCV3.
- a schematic representation of pCV3 is given in Figure 18.
- pCV3 is digested with Ascl and Smal and the resulting fragment is cloned into a derivative of the binary plasmid pBIN, yielding the binary plasmid pBCV3.
- pBCV3 was transferred from Escherichia coli to the AgroJacteriu-T? tumefaciens strain LBA4404 and C58pMP90 by electroporation. The transformed Agrobacterium strain was used to transform Arabidopsis and petunia.
- GUS activity in nectar of transgenic plants was measured according to the method as described by Jefferson et al . , (1987). Briefly, the assay was carried out by measuring the amount of methyl umbelli- ferone (MU) produced by GUS fluorometrically by emission of light of 455 nm. The absolute emission was corrected for artificial quenching using an internal standard of InM MU (Angenent et al . , 1993).
- MU methyl umbelli- ferone
- Twohundred and fifty transgenic plants that each produce recombinant protein in nectar were grown in a greenhouse of 25 square meters.
- the facilities were adjusted according to the safety rules according to European law, including safety measures to prevent in- or outflow of insects.
- the purified promoter fragment was ligated into a pWP90 derived vector, upstream of the BARNASE-BARSTAR bacterial operon construct (Hartley, 1988) .
- the construct contains a 35SCaMV terminator of polyA signal cauliflower mosaic virus terminator sequence downstream of the BARNASE-BARSTAR operon.
- the resulting plasmid pWP126 was digested with Kpnl/ Xhol to release the NECl-promoter/BARNASE-BARSTAR/CamVpolyA fragment and this fragment was ligated into a pBIN-derived vector pBIN Plus.
- the recombinant vector was transferred via Agrobacterium tumefaciens (LBA4404) to petunia variety W115. Transgenic petunia plants were selected with flowers without nectaries or underdeveloped nectaries.
- promoters are less specific than can be concluded based on promoter/GUS expression is concluded. Because the bacterial BARNASE is highly cytotoxic at very low concentrations it can be preferred to protect other plant tissues by expression of a ribonuclease inhibitor gene under the control of a weak, constitutive promoter (e.g. NOS promoter) or a tissue-specific promoter that is not active in the tissues where cell ablation is to be achieved (Mariani et al., 1992, Beals et al . , 1997).
- a weak, constitutive promoter e.g. NOS promoter
- tissue-specific promoter that is not active in the tissues where cell ablation is to be achieved
- MADS box genes regulate floral meristem and floral organ identity. Ectopic expression of MADS box genes can change the developmental fate of floral organs or cells. Transgenic petunia plants ectopically expressing FBP11, an ovule- specific MADS box gene, develop ovule-like structures on sepals and petals ( Colombo et al . , 1995) .
- FBP15 is a nectary-specific MADS box gene, involved in the molecular regulation of nectary development. In petunia nectaries develop at the base of the carpel. Ectopic expression of FBP15 in petunia may result in the development of nectaries on other organs of the flower or on vegetative parts of the plant. An example is given of a gene construct that, when transformed to a plant, results in ectopic expression of FBP15 .
- FBP15 was amplified using a 5' primer that hybridises with FBP15 sequences just upstream of the ATG translation start site and a 3' primer that hybridises with FBP15 sequences just downstream the translation stop site.
- the 5 'primer contains a Ncol recognition site
- the 3 'primer contains a BamHI recognition site.
- the amplified FBP15 fragment was inserted as a BamHI/NcoI fragment into the binary vector pCP031.
- This binary vector was derived from pPCV708, as described by Florack et al .
- the chimerical gene construct was transferred via Agrobacterium GV3101 to petunia variety W115, using the transformation method as described in example 7. Transgenic petunia plants were selected that show ectopic nectary development .
- PCR primers were designed that hybridise with the cDNA of an invertase gene cloned from Solanum tuberosum .
- the 5' primer 5 ' -AAGGACTTTAGAGAGACCCGACCACTGCTGG-3 ' and the 3' primer 5 ' -AAATGTCTTTGATGCATAATATTTCCCATAATC-3 ' were used for a PCR reaction on genomic DNA of petunia to yield a fragment of around 420 bp .
- the fragment was sequenced and cloned into a pMOSBlue vector to used as a probe to screen a petunia nectary-specific cDNA library.
- Hybridizing phage plaques were purified and cDNAs were retrieved by in vivo excision as described in example 2.
- the expression of the cDNA' s was determined by Northern blotting as described in example 3 and the sequence of a nectary-specific invertase was determined as described in example 2.
- the invertase gene was amplified using a 5' primer that hybridises with sequences just upstream of the ATG translation start site and a 3' primer that hybridises with sequences just downstream of the translation stop site. Extra restriction enzyme recognition sites were generated to allow cloning of the cDNA in sense (overexpression) or antisense direction into the binary vector pCP031 as described in example 18.
- the chimerical gene constructs are transferred via Agrobacterium GV3101 to petunia variety W115, using the transformation method as described in example 7. Transgenic petunia plants were selected that exhibit modified sugar composition in nectar.
- a DNA which is the NECl gene or a homologous gene is introduced into a plant cell, the said DNA being induced by promoter elements controlling the expression of the introduced DNA in such a way that transcription produces sense RNA.
- Plants were regenerated from the transgenic cells as described in example 7. Plants that ectopically express the NECl gene exhibited modified leaf morphology and modified sugar composition. Furthermore, plants that ectopically express the NECl gene showed a delay in flowering time.
- Petal and stamen formation in petunia is regulated by the homeotic gene fbpl . Plant J. 4, 101- 112.
- Leu Arg Val Gin lie Gly Asn Leu Gin Asn Ser Asn Arg Asn Met Leu 100 105 110
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Pregnancy & Childbirth (AREA)
- Reproductive Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Jellies, Jams, And Syrups (AREA)
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
IL14091199A IL140911A0 (en) | 1998-07-16 | 1999-07-15 | Process to collect metabolites from modified nectar by insects |
NZ509813A NZ509813A (en) | 1998-07-16 | 1999-07-15 | Process to collect metabolites from modified nectar by insects |
AU50706/99A AU772119B2 (en) | 1998-07-16 | 1999-07-15 | Process to collect metabolites from modified nectar by insects |
CA002333897A CA2333897A1 (en) | 1998-07-16 | 1999-07-15 | Process to collect metabolites from modified nectar by insects |
JP2000560273A JP2002520064A (ja) | 1998-07-16 | 1999-07-15 | 昆虫による修飾された花蜜からの代謝産物を収集する方法 |
EP99935173A EP1097229A1 (en) | 1998-07-16 | 1999-07-15 | Process to collect metabolites from modified nectar by insects |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP98202375A EP0974667A1 (en) | 1998-07-16 | 1998-07-16 | Process to collect metabolites from modified nectar by insects |
EP98202375.6 | 1998-12-14 | ||
EP98204215.2 | 1998-12-14 | ||
EP98204215 | 1998-12-14 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2000004176A1 true WO2000004176A1 (en) | 2000-01-27 |
Family
ID=26150536
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/NL1999/000453 WO2000004176A1 (en) | 1998-07-16 | 1999-07-15 | Process to collect metabolites from modified nectar by insects |
Country Status (7)
Country | Link |
---|---|
EP (1) | EP1097229A1 (xx) |
JP (1) | JP2002520064A (xx) |
AU (1) | AU772119B2 (xx) |
CA (1) | CA2333897A1 (xx) |
IL (1) | IL140911A0 (xx) |
NZ (1) | NZ509813A (xx) |
WO (1) | WO2000004176A1 (xx) |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004082373A1 (ja) * | 2003-03-17 | 2004-09-30 | Kikuji Yamaguchi | 蜂蜜、新規蜂蜜組成物およびその製造方法 |
WO2011021171A1 (en) * | 2009-08-21 | 2011-02-24 | Beeologics, Llc | Preventing and curing beneficial insect diseases via plant transcribed molecules |
US8022274B2 (en) | 1998-09-22 | 2011-09-20 | Mendel Biotechnology, Inc. | Plant tolerance to low water, low nitrogen and cold |
US8097712B2 (en) | 2007-11-07 | 2012-01-17 | Beelogics Inc. | Compositions for conferring tolerance to viral disease in social insects, and the use thereof |
US8822426B2 (en) | 2009-05-05 | 2014-09-02 | Beeologics Inc. | Prevention and treatment of nosema disease in bees |
US8962584B2 (en) | 2009-10-14 | 2015-02-24 | Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd. | Compositions for controlling Varroa mites in bees |
EP2971004A4 (en) * | 2013-03-13 | 2016-12-07 | Carnegie Inst Of Washington | PROCESS FOR MODULATING PLANT SEA AND NECTAR CONTENT |
US10378012B2 (en) | 2014-07-29 | 2019-08-13 | Monsanto Technology Llc | Compositions and methods for controlling insect pests |
US10597676B2 (en) | 2013-07-19 | 2020-03-24 | Monsanto Technology Llc | Compositions and methods for controlling Leptinotarsa |
US10968449B2 (en) | 2015-01-22 | 2021-04-06 | Monsanto Technology Llc | Compositions and methods for controlling Leptinotarsa |
US11091770B2 (en) | 2014-04-01 | 2021-08-17 | Monsanto Technology Llc | Compositions and methods for controlling insect pests |
-
1999
- 1999-07-15 CA CA002333897A patent/CA2333897A1/en not_active Abandoned
- 1999-07-15 EP EP99935173A patent/EP1097229A1/en not_active Withdrawn
- 1999-07-15 NZ NZ509813A patent/NZ509813A/en unknown
- 1999-07-15 AU AU50706/99A patent/AU772119B2/en not_active Ceased
- 1999-07-15 IL IL14091199A patent/IL140911A0/xx unknown
- 1999-07-15 WO PCT/NL1999/000453 patent/WO2000004176A1/en not_active Application Discontinuation
- 1999-07-15 JP JP2000560273A patent/JP2002520064A/ja active Pending
Non-Patent Citations (9)
Title |
---|
ANGENENT, G.C., ET AL.: "petal and stamen formation in petunia is regulated by the homeotic gene fbp1", THE PLANT JOURNAL, vol. 4, no. 1, 1993, pages 101 - 112, XP002094416 * |
GOODALL, I., ET AL.: "contribution of high-performance liquid chromatographic analysis of carbohydrates to authenticity testing of honey", JOURNAL OF CHROMATOGRAPHY, vol. 706, 1995, pages 353 - 359, XP004038886 * |
KATER, M.M., ET AL.: "multiple AGAMOUS homologs from cucumber and petunia differ in their ability to induce reproductive organ fate", THE PLANT CELL, vol. 10, February 1998 (1998-02-01), pages 171 - 182, XP002094414 * |
NEWMAN, T., ET AL.: "genes galore: a summary of methods for assessing results from large-scale partial sequencing of anonymous Arabidopsis cDNA clones", EMBL SEQUENCE DATA LIBRARY, 20 January 1996 (1996-01-20), heidelberg, germany, XP002094419 * |
NEWMAN, T., ET AL.: "genes galore: a summary of methods for assessing results from large-scale partial sequencing of anonymous Arabidopsis cDNA clones", EMBL SEQUENCE DATA LIBRARY, 3 February 1995 (1995-02-03), heidelberg, germany, XP002094420 * |
TANG, X., ET AL.: "pistil-specific and ethylene-regulated expression of 1-aminocycopropane-1-carboxylate oxidase genes in petunia flowers", THE PLANT CELL, vol. 6, 1994, pages 1227 - 1239, XP002094418 * |
THOMA,S., ET AL.: "tissue-specific expression of a gene encoding a cell wall-localized lipid transfer protein from Arabidopsis", PLANT PHYSIOLOGY, vol. 105, 1994, pages 35 - 45, XP002094417 * |
TSUCHIMOTO, S., ET AL.: "ectopic expression of pMADS3 in transgenic petunia phenocopies the petunia blind mutant", THE PLANT CELL, vol. 5, August 1993 (1993-08-01), pages 843 - 853, XP002094415 * |
WILKINSON, J., ET AL.: "pollen as a vector in the dispersal of transgene products", JOURNAL OF EXPERIMENTAL BOTANY, vol. 45, 1994, pages 42, XP002094992 * |
Cited By (18)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8022274B2 (en) | 1998-09-22 | 2011-09-20 | Mendel Biotechnology, Inc. | Plant tolerance to low water, low nitrogen and cold |
WO2004082373A1 (ja) * | 2003-03-17 | 2004-09-30 | Kikuji Yamaguchi | 蜂蜜、新規蜂蜜組成物およびその製造方法 |
US8097712B2 (en) | 2007-11-07 | 2012-01-17 | Beelogics Inc. | Compositions for conferring tolerance to viral disease in social insects, and the use thereof |
US8507457B2 (en) | 2007-11-07 | 2013-08-13 | Beeologics Inc. | Compositions for conferring tolerance to viral disease in social insects, and the use thereof |
US10888579B2 (en) | 2007-11-07 | 2021-01-12 | Beeologics Inc. | Compositions for conferring tolerance to viral disease in social insects, and the use thereof |
US8822426B2 (en) | 2009-05-05 | 2014-09-02 | Beeologics Inc. | Prevention and treatment of nosema disease in bees |
US9932579B2 (en) | 2009-05-05 | 2018-04-03 | Beeologics Inc | Prevention and treatment of Nosema disease in bees |
WO2011021171A1 (en) * | 2009-08-21 | 2011-02-24 | Beeologics, Llc | Preventing and curing beneficial insect diseases via plant transcribed molecules |
US9662348B2 (en) | 2009-10-14 | 2017-05-30 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Compositions for controlling Varroa mites in bees |
US10801028B2 (en) | 2009-10-14 | 2020-10-13 | Beeologics Inc. | Compositions for controlling Varroa mites in bees |
US8962584B2 (en) | 2009-10-14 | 2015-02-24 | Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd. | Compositions for controlling Varroa mites in bees |
EP2971004A4 (en) * | 2013-03-13 | 2016-12-07 | Carnegie Inst Of Washington | PROCESS FOR MODULATING PLANT SEA AND NECTAR CONTENT |
US10597676B2 (en) | 2013-07-19 | 2020-03-24 | Monsanto Technology Llc | Compositions and methods for controlling Leptinotarsa |
US11377667B2 (en) | 2013-07-19 | 2022-07-05 | Monsanto Technology Llc | Compositions and methods for controlling Leptinotarsa |
US11091770B2 (en) | 2014-04-01 | 2021-08-17 | Monsanto Technology Llc | Compositions and methods for controlling insect pests |
US10378012B2 (en) | 2014-07-29 | 2019-08-13 | Monsanto Technology Llc | Compositions and methods for controlling insect pests |
US11124792B2 (en) | 2014-07-29 | 2021-09-21 | Monsanto Technology Llc | Compositions and methods for controlling insect pests |
US10968449B2 (en) | 2015-01-22 | 2021-04-06 | Monsanto Technology Llc | Compositions and methods for controlling Leptinotarsa |
Also Published As
Publication number | Publication date |
---|---|
CA2333897A1 (en) | 2000-01-27 |
NZ509813A (en) | 2004-01-30 |
AU772119B2 (en) | 2004-04-08 |
IL140911A0 (en) | 2002-02-10 |
AU5070699A (en) | 2000-02-07 |
JP2002520064A (ja) | 2002-07-09 |
EP1097229A1 (en) | 2001-05-09 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
ES2270227T3 (es) | Promotor met-1 del maiz. | |
JP2001086987A (ja) | 植物遺伝子組立て体 | |
JP2000507808A (ja) | 植物における鱗翅目制御のための修飾バチルス・サーリンジェンシス遺伝子 | |
JP2011101653A (ja) | 植物において導入遺伝子を発現するための方法および組成物 | |
CA2105592A1 (en) | Male-sterile plants, method for obtaining male-sterile plants and recombinant dna for use therein | |
CA2099125C (en) | Tapetum-specific promoters from brassicaceae spp | |
US8420797B2 (en) | Ubiquitin promoter and methods of use | |
JP2008502358A (ja) | 転写因子のshineクレードおよびその使用 | |
US20030106089A1 (en) | Cotton fiber transcriptional factors | |
HU228694B1 (en) | Nucleotide sequences mediating male fertility and method of using same | |
CA2375535C (en) | Use of the bnm3 transcriptional activator to control plant embryogenesis and regeneration processes | |
AU772119B2 (en) | Process to collect metabolites from modified nectar by insects | |
EP0642524A1 (en) | Systemin | |
WO1999000501A1 (en) | Materials and methods relating to a plant regulatory protein | |
JP2002522079A (ja) | 遺伝子スイッチ | |
EP0974667A1 (en) | Process to collect metabolites from modified nectar by insects | |
KR100455621B1 (ko) | 화분 특이적 징크 핑거 전사 인자 유전자의 사용에 의한화분 임성의 저하방법 | |
US5861542A (en) | Gene controlling floral development and apical dominance in plants | |
CA2381330A1 (en) | Male sterile plants | |
US20040093633A1 (en) | Plant resistance gene | |
CN112321693B (zh) | 小麦TaCCT1-6A蛋白在调控作物抽穗期中的应用 | |
KR100455620B1 (ko) | 벽판-특이적 아연 핑거 전사 인자 유전자를 이용한 화분수정률의 감소 방법 | |
JP2001145430A (ja) | 花粉特異的ジンクフィンガー転写因子の遺伝子を用いて花粉稔性を低下させる方法 | |
CN113717977A (zh) | 甘蓝型油菜组织特异型p8启动子及其在制备转基因油菜中的应用 | |
Suen | Tapetum and pollen interaction in the anthers of maize and barley |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
ENP | Entry into the national phase |
Ref document number: 2333897 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 140911 Country of ref document: IL Ref document number: 1999935173 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 509813 Country of ref document: NZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2001/01339 Country of ref document: ZA Ref document number: 200101339 Country of ref document: ZA Ref document number: 50706/99 Country of ref document: AU |
|
WWP | Wipo information: published in national office |
Ref document number: 1999935173 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09743885 Country of ref document: US |
|
WWG | Wipo information: grant in national office |
Ref document number: 50706/99 Country of ref document: AU |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1999935173 Country of ref document: EP |