WO1999067395A1 - Famille de sequences nucleiques et de sequences proteiques deduites presentant des motifs retroviraux endogenes humains, et leurs applications - Google Patents

Famille de sequences nucleiques et de sequences proteiques deduites presentant des motifs retroviraux endogenes humains, et leurs applications Download PDF

Info

Publication number
WO1999067395A1
WO1999067395A1 PCT/FR1999/001513 FR9901513W WO9967395A1 WO 1999067395 A1 WO1999067395 A1 WO 1999067395A1 FR 9901513 W FR9901513 W FR 9901513W WO 9967395 A1 WO9967395 A1 WO 9967395A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequences
seq
sequence
herv
nucleotides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/FR1999/001513
Other languages
English (en)
French (fr)
Inventor
Patrick M. Alliel
Jean-Pierre Perin
François Rieger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut National de la Sante et de la Recherche Medicale INSERM
Original Assignee
Institut National de la Sante et de la Recherche Medicale INSERM
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut National de la Sante et de la Recherche Medicale INSERM filed Critical Institut National de la Sante et de la Recherche Medicale INSERM
Priority to AU43751/99A priority Critical patent/AU4375199A/en
Priority to CA2331923A priority patent/CA2331923C/fr
Priority to JP2000556036A priority patent/JP2002518051A/ja
Priority to DE69939114T priority patent/DE69939114D1/de
Priority to US09/719,554 priority patent/US6919438B1/en
Priority to EP99926538A priority patent/EP1090122B1/fr
Publication of WO1999067395A1 publication Critical patent/WO1999067395A1/fr
Anticipated expiration legal-status Critical
Priority to US11/028,539 priority patent/US7534439B2/en
Priority to US12/336,813 priority patent/US20090263783A1/en
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983Viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4713Autoimmune diseases, e.g. Insulin-dependent diabetes mellitus, multiple sclerosis, rheumathoid arthritis, systemic lupus erythematosus; Autoantigens
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/702Specific hybridization probes for retroviruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/10022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to a new family of nucleic sequences and of deduced protein sequences, which have complete or partial endogenous human endogenous retroviral motifs, as well as flanking or adjacent sequences of said sequences, and controlled by these latter: modification of the expression or alteration of the polyadenylation structure.
  • alternative splicing
  • flanking sequences 10 native Certainly of said flanking sequences.
  • the invention also relates to the detection and / or the use of said nucleic acid sequences and said corresponding protein sequences, as part of diagnostic, prophylactic and therapeutic, in particular for neuropathological autoimmune component such as multiple sclerosis .
  • the invention also relates to obtaining antisense double-stranded and single-stranded nucleic acid probes of ribozymes capable of modulating viral replication (TR Cech, Science, 1987, 236, 1532-1539; RH Symons. Take Biochem. Sci., 1989. 14, 445-450) of the corresponding recombinant molecules, and associated antibodies.
  • Retroviruses are viruses which replicate only using the reverse route of conventional genetic information processing. This process, called reverse transcription, is mediated by a DNA dependent RNA polymerase or reverse transcriptase, encoded by the pol gene. Retroviruses also code for at least two additional genes.
  • the gag gene codes for backbone, matrix, nucleocapsid and capsid proteins.
  • the env gene codes for envelope glycoproteins.
  • the retroviral transcription is regulated by promoter regions or * "enhancers", located in highly repeated regions or LTR (Long Terminal Repeat) and which are present at both ends of the retroviral genome.
  • the polymerase When a cell is infected, the polymerase makes a DNA copy of the RNA genome; this copy can then s integrate into the human genome.
  • Retroviruses can infect germ cells or early stage embryos; under these conditions, they can integrate the germ line and be transmitted by vertical Mendelian transmission, which constitutes the closest relationship between a host and its parasite.
  • These endogenous viruses can degenerate over generations of the host organism and lose their original properties. However, some of them may retain all or part of their properties or the properties of the component patterns, or acquire new functional properties with an advantage for the host organism, which would explain the preservation of their sequence.
  • Retroviral sequences or HERVs represent an important part of the human genome. These retroviral regions come in several forms: - complete endogenous retroviral structures associating gag, pol and env motifs, flanked by repeated nucleic sequences, which show a significant analogy with the LTR-gag-pol-env-LTR structure of infectious retroviruses ,
  • retro-transposons are deprived of their env domain and retroposons do not have the env and LTR regions.
  • the class I families show sequence homology with mammalian type C retroviruses; include the ERI superfamily, close to the MuLV virus (murine leukemia virus) and the BaEV virus (baboon endogenous virus).
  • the class II families have a sequence homology with type B mammalian retroviruses such as MMTV (mouse mammary tumor virus) or type D retroviruses such as SRV (squirrel monkey retrovirus).
  • HRES-1 HERVs which exceptionally exhibit partial homology with HTLV-1 (RTVL-H) or primate viruses; HRES-1, for example, exhibits sequence homology with HTLVs.
  • the subject of the present invention is a purified nucleic acid fragment, characterized in that it comprises all or part of a sequence coding for a human endogenous retroviral sequence, which has at least retroviral motifs of the env type, corresponding to the sequence SEQ ID NO: l or a sequence having a level of homology with said sequence SEQ ID NO: l greater than or equal to 80% over more than 190 nucleotides or greater than or equal to 70% over more than 600 nucleotides for the domains type approx.
  • homologous sequence is understood to mean both a sequence which has full or partial identity with the sequence SEQ ID NO: l above and a sequence which has partial similarity with said sequence SEQ ID NO: l.
  • said fragment has both retroviral motifs corresponding to an env domain and corresponding to the sequence SEQ ID NO: 1 and retroviral motifs corresponding to a gag domain and corresponding to the sequence SEQ ID NO: 2 or to a sequence exhibiting a level of homology greater than or equal to 80% over more than 190 nucleotides or greater than or equal to 70% over more than 600 nucleotides for the env type domains and a level of homology greater than or equal to 90% over 700 nucleotides or higher or equal to 70% over more than 1200 nucleotides for the gag type domains, which motifs have no insertion or deletion of more than 200 nucleotides.
  • Said fragments constitute a new family of endogenous human retroviral sequences (family HERV-7q) which has a sequence homology with the MSRV retroviruses, as described in International Application WO 97/06260; said fragments according to the present invention have:
  • an env type motif (positions 6965 nt - 9550 nt in the sequence SEQ ID NO: 3 or in FIG. 1) which contains a long open reading frame of 1620 nucleotides (positions 7874-9493 of the sequence ID NO: 3 and Figure 1), encoding a novel protein sequence of 540 amino acids called enverin ( Figure 4 and SEQ ID NO: 26) and fragment underlined in Figure 18. It is found within the field of this transmembrane domain env, a CKS-25 / CKS-17 peptide motif (FIG. 5), recognized to exhibit immunosuppressive functions on the host lymphocyte cells (M. Mitani et al. 1987, Proc. Natl. Acad. Sci.
  • a zinc finger domain HX 3 - HX 22 - 33 CX 2 C (Kulkolski et al., 1992, Mol. Cell Biol. 12. 2331-2338), which is found in integrase type domains is identified in another reading frame. This particular env domain marks the characteristic of new endogenous retroviral patterns.
  • positions 3118-4198 of SEQ ID NO: 3 has been identified by analogies with known gag domains. We find, for example, the major homology region QX 3 EX 7 R (Bout et al., 1997, J. Virol, 71, 5652-5657). The nucleic acid binding pattern located in the C-terminal position, is identified in another reading frame (Covey et al., 1986, Nucleic Acids Res., 14, 623-633). Upstream of the gag domain, a motif of 182 nucleotides repeated twice is detected (FIG. 1).
  • the pol area has conventional consensus of a retrovirus pol region at the protease domains, reverse transcriptase and RNase H is found in the near pol consensus motif LLDTGA (Weber et al .. 1988, Science, 243, 928 -931).
  • the motifs D and AF, LPQ and SP, and YVDD are found in 3 ° respectively. 4th and 5th homology boxes.
  • the YTDGSS and TDS motifs are present in the RNAse H region,
  • gag and pol regions could be considered to be contiguous with a passage from the gag region to the pol region by an offset of the reading frame.
  • the present invention encompasses the sequences belonging to the HERV-7q family as defined above (presence of the sequence SEQ ID NO: 1 or of a homologous sequence or presence of both the sequences SEQ ID NO: 1 and SEQ ID NO: 2) and in particular the sequences SEQ ID NO: 3-22, 28 and 61; it also includes the complementary nucleic sequences and the reverse sequences complementary to the preceding sequences as well as the fragments originating from the coding regions of the preceding sequences corresponding to a sliding frame greater than or equal to 14 nucleotides or their complementary sequences. (SEQ ID NO: 37-57, 59-60 and 121-122). These different fragments can advantageously be used as primers or as probes (reagents A); they s hy bridle specifically under high stringency conditions to a sequence of the HERV-7q family.
  • fragments there may be mentioned, preferably the following fragments: a fragment of 182 nucleotides repeated twice, located upstream of the gag domain at positions 2502-2611 / 2613-2865 of SEQ ID NO: 3; Primers and probes specific to the sas region
  • GIF primer, sense located in the upstream region of the gag domain of HERV-7q: 5 'GGACCATAGAGGACACTCCAGGACTA 3' (SEQ ID NO: 37);
  • an antisense G1R primer located in the 3 'terminal region of gag domain: 5 'CCTCAGTCCTGCTGCTGGATCATCT 3' (SEQ ID NO: 38)
  • E1F-E1R The 2529 nt fragment amplified by the pair of primers E1F-E1R, is used to generate the probes capable of hybridizing the various PCR amplification products.
  • E2F primer meaning: (SEQ ID NO: 47)
  • E3F primer meaning: (SEQ ID NO: 49) 5 'GCAATACTACATACACAACCAACTCCCAA 3' - an E3R primer, anti-sense: (SEQ ID NO: 50)
  • E6F primer meaning: (SEQ ID NO: 54) 5 'AGCCC AAGATGC AGTCC AAGACTAAGAT 3'
  • E5R primer (SEQ ID NO: 55) 5'GCGTAGTAGAGGTTGTGCAGCTGAGAT 3 '
  • oligonucleotides are designed to be able to generate a sense primer and an antisense primer by shifting the sequence of the reference primer from 1 to 7 nucleotides to the 5 'side or to the 3 ' side: the modification of the sequence may cause the primer size to change from 1 to 7 nucleotides depending on the case.
  • the primers chosen can be optimized as the case may be by shortening or lengthening them from 1 to 9 nucleotides.
  • hybridization, cloning, subcloning, procurement, preparation and analysis of nucleic acids, peptides and anti-body, sequencing of nucleic acids and of peptides, hybridisation in situ and immunohistochemistry are carried out under the conditions described in the following works:
  • antibodies I &II DNA cloning I, II, III; Nucleic acid and protein sequence analysis; Nucleic acid hybridization; Nucleic acid sequencing; Oligonucleotide synthesis; Protein purification applications; Protein purification methods; Protein sequencing; Transcription and translation; Gels electrophoresis of nucleic acids; Gels electrophoresis of proteins; Genome analysis; HPLC of macromolecules; Human genetic diseases Microcomputing in biology; Molecular neurobiology; Mutagenicity testing; Essential molecular biology I & II.
  • the human endogenous retroviral sequence located on the long arm of chromosome 7 corresponds to the sequence HERV-7q; it has 10.5 kb (fig. 1 and 2) and meets the criteria previously defined.
  • FIG. 7 shows the comparison of the nucleic alignments of the respective gag domains of HERV-7q and HERV-TcR (sequence HG12, SEQ ID NO: 19).
  • chromosome 6 SEQ ID NO: 5 and 6
  • - HE4 chromosome X (SEQ ID NO: 7)
  • - HE5 chromosome X q22 (SEQ ID NO: 8)
  • - HE6 and HG6 chromosome 1 q23.3-q24.3 (SEQ ID NO: 9 and 10), - HE7: chromosome 7 pl5 (SEQ ID NO: l 1),
  • chromosome 19 SEQ ID NO: 12 and 13).
  • - HE10 chromosome X ql3.1-21.1 (SEQ ID NO: 15), - HEU and HGl l: chromosome 7 q21-22 (SEQ ID NO: 16 and 17).
  • HERV-TcR chromosome 14 ql 1.2 (SEQ ID NO: 18 and l9)
  • the present invention also encompasses fragments coding and non-coding for all or part of the enverin comprising at least 14 nucleotides and in particular the fragments encoding the C-terminal part of enverin, either from the amino acid 291, either from the amino acid 321, from the first methionine.
  • fragments include in particular a critical zone where two insertions of 12 nucleotides have been characterized:
  • sequence A a first insertion was identified (sequence A), in individuals from 2 groups (patients and controls). This insertion located between amino acids 487 and 488, allows the insertion of the VLQM tetrapeptide.
  • a comparative analysis shows that this insertion is identified in a homologous region located in the HE13 sequence, belonging to the HERV-7q family. Amplification of the HE13 type sequence could indicate that there is an alteration in the HERV-7q envinine sequence, which would favor amplification of the sequence contained in HE13. This observation also makes it possible to use this insertion as a specific element for amplifying HE13 type sequences.
  • a second insertion (sequence B) has been identified in a patient with MS. The 12 nucleotide insertion is located at amino acid 495 and codes for the tetrapeptide MQSM. It is remarkable to note that this insertion is also identified in a homologous region located in HE13.
  • Sequence A TAAACTACAAATGGTTCTTCAAATGGAGCCCA (SEQ ID NO: 59)
  • Sequence B GATGCAGTCCAAGATGCAGTCCATGACTAAGA (SEQ ID NO: 60).
  • the alignments of the env (fig. 8) and gag (fig. 9) domains explain the levels of homology observed between the sequences described above and the homologous sequences in HERV-7q.
  • the analogies can extend to flanking retroviral patterns.
  • transcripts belonging to some of the members of this family are mainly expressed in tissues of fetal or placental origin.
  • Polypeptide sequences generated by these transcripts can therefore be potentially produced and biological functions or activities can be envisaged, by analogy with biologically active polypeptides of viral or retroviral origin; for example, peptide motifs of the CKS-17 type (Haraguchi et al, PNAS, 1995, 92, 5568-5571) (fig. 5) or CKS-25 (Huang S. S and Huang JS, J. Biol. Chem. 1998, 273, 4815-4818), which exhibit immunomodulatory functions on the host lymphocyte cells.
  • the observed sequence differences and possible normal or pathological modifications, in particular, are at the origin of a modulation of the function.
  • HERV-7q represents the paradigm of the new family of human endogenous retroviral sequences or endogenous retroviral motifs.
  • HERV-7q and some of the endogenous retroviral sequences belonging to its family present a pol type domain analogous to pol type retroviral sequences such as for example the pol region identified in the MSRV retrovirus associated with multiple sclerosis and described by H. Perron et al. (1997, Proc. Natl. Acad. Sci. USA, 94, 7583-7588; PCT International Application WO 97/06260).
  • sequences according to the present invention are distinguished from the exogenous infectious retroviral sequences analogous to MSRV previously described in that the gag and env sequences according to the invention are significantly different according to the criteria previously defined and according to certain specific characteristics, by example the long open reading frame of the env domain of HERV-7q; they would be able to make it possible to sign a pathology when they present insertions, deletions, shifts of reading frame or mutations.
  • the differences observed between human sequences of the HERV-7q type which are isolated from individuals reputed to be normal and the sequences derived from certain samples of pathological origin, are not randomly distributed.
  • gag region originating from infectious retroviral particles (EMBL accession number: A60168, A60200, A60201, A60171 ).
  • gag sequence of HERV-7q (fig. 9)
  • two nonsense codons in HERV-7q are replaced by an arginine codon in A60200, which makes it possible to obtain a deduced sequence of 109 amino acids for HERV-7q and of 166 amino acids for A60200.
  • the basic changes therefore make it possible to extend the reading frame and potentially code for larger polypeptide structures (FIG. 10).
  • an env-like sequence from infectious retroviral particles has significant analogy with the env domain of HERV-7q ( Figure 11).
  • These marked analogies between exogenous and endogenous retroviral sequences could be the cause of the initiation or aggravation of certain pathological processes, in particular certain autoimmune diseases, such as multiple sclerosis.
  • some of the endogenous retroviral sequences described in the invention are located near or in regions reputed to have a susceptibility for multiple sclerosis: for example HERV-7q and the region 7q21-22 of chromosome 7 , similarly for HE12 and HG12 in HERV-TcR and the region of the gene coding for the alpha and delta chains of T-cell receptor, HE2 and chromosome 17, or HE3, HE 13 and HG3 and chromosome 6, for example, the sequences HE1 1 and HG1 1, around the region 7q 21-22 or alternatively HE4, HE5, HE6 , HE9, HE 10 or HG10 on the X chromosome. These sequences would therefore be able to provide means of localization or identification of the predisposition genes.
  • FIG. 11 shows extended homologies between the HERV-7q sequence with an exogenous retroviral sequence (EMBL accession number: A60170).
  • Human endogenous retroviral sequences belonging to the HERV-7q family can protect against environmental stresses or be of benefit to the individual. This beneficial effect could be one of the possible reasons for the selection pressure exerted on some of these sequences and for the potentially functional character of the deduced protein structures identified: for example the long open reading frame capable of coding for a new protein and corresponding to the domain approx of HERV-7q.
  • Human endogenous retroviral sequences belonging to the HERV-7q family could be associated, for example, with pathologies related to cancer-related processes, neuropathologies with an autoimmune component or any other pathological process in association or not with endogenous or exogenous viruses or retroviruses. Their action could relate to the declaration, the aggravation, the modification of the calendar of appearance or even the protection against the disease.
  • autoimmune pathologies such as, for example, lupus, Sjôgren's syndrome, rheumatoid arthritis, multiple sclerosis, etc.
  • retroviral patterns identified and the patterns found in retroviral structures characterized in patients with autoimmune pathologies such as multiple sclerosis: for example fragments of the gag domain (recently available data banks) from infectious retroviral particles or the complete pol domain sequence corresponding to the MSRV virus associated with multiple sclerosis.
  • gag domain fragments of the gag domain (recently available data banks) from infectious retroviral particles or the complete pol domain sequence corresponding to the MSRV virus associated with multiple sclerosis.
  • These retroviral motifs have significant analogies with the endogenous homologous sequences of the HERV-7q type, which makes it possible to envisage a direct or indirect association with pathological processes. including multiple sclerosis, whether or not in association with MSRV.
  • the present invention further encompasses the use of sequences associated with sequences of the HERV-7q family for the detection and / or prognosis of various autoimmune diseases (neuropathologies, in particular); these sequences encode part or all of a factor, the function, regulation / deregulation or alteration (polyadenylation, alternative splicing) is associated with the expression or normal or pathological regulation / deregulation patterns belonging to the HERV-7q family and correspond to transcripts or cDNAs of nucleotide sequences coding for genes located in flanking regions or flanking retroviral sequences of the HERV-7q family.
  • flanking region means any region located nearby (included in or including) an endogenous retroviral sequence belonging to the HERV-7q family, as defined above, up to and including the genes immediately contiguous and / or located at a distance cannot exceed 120 kb.
  • flanking sequences and their fragments, especially those underlined or in italics in Figures 14-16, 22-26. are defined below:
  • RH7 an endogenous retroviral sequence called RH7 is identified (SEQ ID NO: 62 and FIG. 22); this sequence is located 5 ′ from the HERV-7q sequence; in FIG. 22, the part in italics corresponds to the start of the HERV-7q sequence; the RH7 sequence is underlined: two putative polyadenylation sites are in bold.
  • This sequence SEQ ID NO: 62 has significant homology, over 6 kb, with endogenous retroviral sequences of the RGH type (FIG. 13). Sequences belonging to this family s' especially expressed in patients with rheumatoid arthritis (Nakagawa et al., (1997) Arthritis.
  • the present invention also includes fragments of the sequence SEQ ID NO: 62, comprising between 14 and 50 nucleotides (use as primers), preferably between 14 and 25 nucleotides or at least 25 nucleotides (use as probe), which fragments present the following characteristics: the 4 nucleotides of the 3 ′ end are different from the corresponding motifs of the sequence RGH2 (bottom sequence in FIG. 13, accession to GenBank: D110 18).
  • PEXl peroxisomal ATPase gene
  • PEXl in association with PEX6 is responsible for the import of peroxisomal proteins and the stabilization of the PEX5 receptor.
  • a disturbance / alteration affecting PEXl is responsible for various neuropathological as Zellweger syndrome, neonatal adrenoleukodystrophy and infantile Refsum disease (Reuber et al. (1997) Nature Genet, 17, 445- 448).
  • peroxisomes are associated with the metabolism of fatty acids, in particular by ⁇ -oxidation processes.
  • An alteration of the gene identified in the RAM75 sequence or of its expression, by modification of the function of the 5 'and 3' regulatory regions or even by modification of splices or polyadenylation processes, in particular under the influence of neighboring retroviral motifs, would be able to disrupt the expression or structure of ATPase and therefore disrupt one of the peroxisomal functions, in particular the metabolism of lipids, in particular myelin, with consequences for certain pathologies, including neuropathologies, such as multiple sclerosis; the underlined parts (figure 14) correspond to the 24 coding exons.
  • the present invention also includes the fragments of the sequence
  • SEQ ID NO: 63 included in the 24 coding exons mentioned above and comprising at least 14 nucleotides.
  • nucleotide sequence RAV73 is identified, where tag sequences and potential exons capable of produce one or more polypeptide sequences; the invention also includes fragments of this sequence SEQ ID NO: 64 included in the tag sequences and the potential exons as they appear (underlined parts) in FIG. 15, which fragments contain at least 14 nucleotides.
  • RBP3 nucleotide sequence RBP3 (SEQ ID NO: 65 and Figure 23). which covers the 3 'end of the gene coding for a transcription factor of the family Blimp-1 (SEQ ID NO: 119 and FIG. 25), a protein of 789 amino acids which is a repressor of the expression of the gene interferon-beta (Keller and Maniatis, Genes Dev., (1991), 5, 868-879), which is already associated with certain malignant pathologies (Mock et al., Genomics, (1996), 37, 24-28) , and which could play a role in the differentiation and pathogenesis of B cells.
  • Blimp-1 acts in particular on B cells, the contribution of which is known in inflammatory processes associated with multiple sclerosis.
  • Blimp-1 is capable of blocking the viral induction of the INF ⁇ promoter, the ability of which to reduce the frequency of relapses and the progression of the lesion in patients with MS is known.
  • a disturbance in the expression or structure of Blimp-1, in relation to a retroviral element of the HERV-7q type, is consequently associated with neuropathologies or with diseases of an autoimmune nature, such as multiple sclerosis;
  • this RBP3 nucleotide sequence (SEQ ID NO: 65) contains nucleotide motifs identified in the nucleic sequence coding for the Blimp-1 gene; the invention also includes the detection of the mRNA sequences of the protein Blimp-1 (SEQ ID NO: 11-19). - the endogenous HERV-7q retroviral sequence. containing HE3 and HG3.
  • apoptotic process is located in the HI3 region corresponding to an intron extending over more than 46 kb (SEQ ID NO: 66), a gene which may encode the analog of APS ( Figure 24), a protein of 275 amino acids specific for apoptosis, overexpressed in different cells in culture after initiation of an apoptotic process (Hammond et al., FEBS Lett., (1998), 425, 391- 395).
  • the intron is located at amino acid 231 of APS.
  • the end of HE3 is more than 12 kb from the 5 ' end of the intron, while HG3 is located more than 28 kb from the 3' end of the intron.
  • Apoptotic processes are associated with multiple sclerosis.
  • nucleic region containing HE3, HG3, HI3 and RBP3 is localized at the level of the short arm of chromosome 6, at 6p21, which is a proposed region of susceptibility to multiple sclerosis (The Multiple Sclerosis Genetic Group, Nature Genêt., (1996), 13, 469-472).
  • sequences of HERV-7q type and the flanking sequences and the importance of establishing an expression profile including one or more of the above sequences to establish a differential diagnosis of a neuropathology is even more of it is observed that the sequences HG12 and HE 12 are located in an intronic region of the gene coding for the alpha and delta subunits of the T cell receptors.
  • the T cell receptors are involved. involved in immune regulation processes and their influence has been proposed in the case of autoimmune diseases, including multiple sclerosis.
  • the invention also relates to the transcripts generated from the above sequences and those optionally having modifications with reference sequences described in the invention when they are expressed in some patients.
  • the control systems of protein expression retrovirus HERV-7q which are present in type LTR patterns could influence the expression of genes in the chromosomal neighborhood near or far and induce character disturbances immunological and / or neurological.
  • the endogenous retroviral sequence HERV-TcR is found in the immediate vicinity of the genes for the alpha and delta subunits of the T cell receptor described above. LTR-like motifs could also code for superantigens (Acha-Orbea and Palmer, 1991, Immunol Today, 12, 356-361).
  • retroviral proteins of the HERV-7q or related type could be involved in phenomena of cytotoxicity or superantchairnicity, such as for example those resulting from the long open reading frame identified in the domain env ( Figure 4).
  • LTX is described, a sequence comparable to that of an LTR of HERV-7q (SEQ ID NO: 67 and FIG. 16), and which is at the heart of an intron of more than 49 kb, but 2 kb from the 5 ′ donor site, the FMR2 gene associated with the X-fragile and coding for a protein of 1311 amino acids (FIG. 26).
  • LTR modulates alternative splicing (Kapitonov and Jurka, (1999), J. Mol.
  • retroviral motifs originating from defective regions are capable of presenting biological functions: for example, the envelope protein pl5E derived from defective retroviral motifs, has anti-inflammatory and immunosuppressive activity (Snyderman and Ciancolo , 1984, Immunol.
  • motifs from the gag, env and LTR type domains can be associated with a particular function or can contribute to the normal or pathological function of the flanking domains as defined above (SEQ ID NO: 62-67). Recombinations with an element of exogenous origin, retroviral or not. may give rise to the production of nucleic or protein motifs which could either protect, or trigger, or promote or aggravate a pathology. Likewise, a retro-viral structure containing endogenous retroviral elements according to the invention would be capable of causing a pathological process after passing through an exogenous transient cycle then reintegration into a sensitive or critical region of the human genome.
  • HERV-7q or of elements induced by patterns belonging to the HERV-7q family, with original patterns or induced in an exogenous manner would be able to trigger, or aggravate a pathological process, or on the contrary to favor a protection or partial remission or total and final healing.
  • the detection made possible of HERV-7q type domains suggests possible applications both at the prophylactic, prognostic and diagnostic level: for example immunological or gene amplification approaches making it possible to compare normal individuals serving as reference with patients would be able to promote screening, improving early detection of disease onset and / or monitor a disease in people who may be a susceptibility or reporting sickness or in individuals considered normal, according to current clinical criteria.
  • nucleic acid probes and immunoassays specific are able to facilitate the identification and detection of abnormally expressed units under conditions associated with cancer, or neuropathological conditions in particular autoimmune, first row of which multiple sclerosis.
  • the present invention also relates to hybrid nucleic sequences, characterized in that they comprise sequences or motifs belonging to the family of HERV-7q, or of elements induced by motifs belonging to the family of HERV-7q , with original or exogenously induced motifs (exogenous retroviral sequences); such hybrid sequences are likely to be able to initiate, or aggravate a pathological process, or on the contrary to promote protection or partial remission or total and final healing.
  • the subject of the present invention is also a diagnostic reagent for the differential detection of complete or partial human endogenous nucleic acid sequences, presenting retroviral motifs, selected from the sequences SEQ ID NO: 1 and / or SEQ ID NO: 2, characterized in that that it is selected from the group constituted by the sequences SEQ ID NO: 1-22, 28.
  • the complementary nucleic sequences and the reverse sequences complementary to the preceding sequences by the fragments nucleotides capable of defining or identifying the sequences SEQ ID NO.T and or SEQ ID NO: 2 and any flanking sequence or overlapping them as well as by the fragments originating from the coding regions of the sequences SEQ ID NO: 1-22 and 61, corresponding to a sliding frame greater than or equal to 14 nucleotides or their complementary sequences, optionally labeled with an appropriate marker as well as by the sequences such as defined in Figures 18-21.
  • sequences of the nucleic, ribonucleic and oligonucleotide probes used will be chosen in the env and gag regions or their flanking regions: for example the oligonucleotides primers for HERV-7q, will be chosen in the regions located between nucleotides 3065 and 4390, the nucleotides 6965 and 9550 or nucleotides 2502-2865 of SEQ ID NO: 3, as well as in any adjacent sequence (upstream or downstream) capable of allowing specific amplification (figure
  • radioactive isotopes examples include radioactive isotopes, enzymes, fluorochromes, chemical markers (biotin). haptens (digoxygenin) and appropriate antibodies or base analogs.
  • enzymes include fluorochromes, enzymes, fluorochromes, chemical markers (biotin).
  • haptens digoxygenin
  • appropriate antibodies or base analogs Preferably:
  • - said reagent is selected from the sequences SEQ ID NO: 37-57 and is suitable for use as a primer.
  • - said reagent is selected from the following sequences: a 1505 nt fragment amplified by the pair of primers SEQ ID NO: 37 and SEQ ID NO: 38 (primers GIF and G1R), a 2529 nt fragment amplified by the couple d primers SEQ ID NO: 45 and SEQ ID NO: 46 (primers E1F and E1R), a fragment of 182 nucleotides repeated twice, located upstream of the gag domain at positions 2502-2611 / 2613-2865, fragments coding or not -codants for all or part of the envin, comprising at least 14 nucleotides and in particular the fragments coding for the C-terminal part of the envin, either from amino acid 291, or from amino acid 321, counting from the first methionine, and is suitable for use as a probe.
  • the subject of the present invention is also a method of rapid and differential detection of endogenous retroviral nucleic acid sequences of the env or env and gag type, of their normal or pathological variants, by gene hybridization and / or amplification, carried out from a biological sample. , which method is characterized in that it comprises:
  • step (a) may include: * prior to step (a): a step of preparing the tissue or the biological fluid concerns,
  • a step of comparing the nucleic acid sequences obtained in said biological sample with the endogenous human retroviral sequences according to the invention by any appropriate means and in particular by sequencing. Southern blot, restriction cleavage, SSCP or any other method making it possible to identify an insertion or a deletion or even a simple mutation between the different sequences compared.
  • the endogenous human retroviral sequences according to the invention are thus compared with the nucleic sequences present in the biological sample to be analyzed and allow the detection of homologous sequences of patients suffering from pathologies, likely to involve a modification of their genome.
  • said gene comparisons are carried out using genomic DNA obtained from control individuals and from patients.
  • a conventional gene amplification by PCR is carried out using primers 5 '-direction and 3' flanking -antisens or including the area to be studied (zone env or gag region).
  • sequences of the nucleic, ribonucleic and oligonucleotide probes used are chosen from the env and gag regions or their flanking regions: for example the oligonucleotides primers for HERV-7q, will be chosen from the regions located between nucleotides 3065 and 4390 and nucleotides 6965 and 9550, as well as in any adjacent sequence (upstream or downstream) capable of allowing specific amplification ( Figure 1), as specified above. They are preferably selected from the group consisting of a 1505 nt fragment amplified by the pair of primers SEQ
  • the gene amplification step is carried out in particular using one of the following gene amplification techniques: amplification by the replicase Q ⁇ -, PCR, LCR, ERA, CPR or SDA.
  • the present invention also relates to chimeric sequences, characterized in that they consist of a fragment of 17 to 40 nucleotides of a flanking sequence as defined above associated with an endogenous retroviral motif of the HERV-7q type comprising between 17 and 40 nucleotides. as defined above.
  • the present invention also relates to a method for detecting transcripts, as defined above, characterized in that it comprises:
  • the present invention also relates to a method for detecting and / or evaluating an over-expression / under-expression or a modification of at least one of the sequences or fragments of endogenous retroviral sequences of HERV-7q type and / or their associated flanking sequences, characterized in that it comprises:
  • DNA sequences being sequences or fragments of endogenous retroviral sequences of HERV-7q type and / or their flanking sequences, as defined above, constituted by the transcripts and cDNA genomic sequences, which code for all or part of a factor, including the function, regulation / deregulation or the alteration is associated with normal or pathological expression or with the regulation / deregulation of motifs belonging to said HERV-7q family, these sequences corresponding to nucleotide sequences coding for genes located in flanking regions located upstream and / or downstream of a retroviral sequence of said HERV-7q family and of which one end can be at a distance exceeding 120 kb, and / or a chimeric sequence as defined above.
  • - hybridization of said support with at least one suitably labeled probe obtained, for example, by retrotransposition of a mixture of RNA from cells, tissues or body fluids from control deemed normal, of ethnic populations different, from patients with pathologies often associated with an expression of retrovirus. like tumor processes, or like autoimmune diseases, and
  • said transcript or cDNA is selected from the group consisting of sequences SEQ ID NO: 62-67 and 119 and their fragments corresponding to a sliding frame greater than or equal to 14 nucleotides or their complementary sequences.
  • said support also comprises any endogenous or exogenous retroviral sequence.
  • microarrays (Bowtell (1999), Nature Genet., 21, 25- 32), is used to evaluate the change in the expression of all or part of some of the sequences of retroviral origin type HERV 7q and flanking sequences. Briefly, DNA from clones, PCR products obtained from genomic DNA, RT-PCR products from transcripts or even specific oligonucleotide sequences, are deposited on a support, such as for example a nylon filter , a glass slide or their equivalent. The deposited nucleic acid sequences cover the various retroviral domains described above, as well as the contiguous sequences and the flanking genes.
  • Hybridization is carried out using a probe obtained, for example, by rperitranspo- sition of a mixture of RNA from cells, tissues or body fluids from control deemed normal, population members different ethnic groups, from patients suffering from pathologies often associated with an expression of retroviruses, such as tumor processes, or autoimmune diseases, including multiple sclerosis.
  • nucleic acid probe is adequately labeled, in order to allow subsequent detection, such as for example by fluorescence or by an equivalent method.
  • bi- or even multicolored probes makes it possible to specify the concerted expression of several genes in parallel, while benefiting from more precise normalization.
  • the acquisition of the results is carried out automatically, such as for example by a laser scanning system or its equivalent.
  • Two types of DNA chips are designed, on the one hand chips presenting an exhaustive set of sequences, and on the other hand specific DNA chips allowing targeting on a more specific application.
  • a critical sequence in that it contains a difference relating to a deletion or even a mutation is detected using specific oligonucleotides (Wang et al., (1998), Science, 280, 1077-1082 ).
  • the polymorphism associated with a base or with a mutation is detected using four oligonucleotides having one of the four sequence possibilities at the level of a base (A, CG or T): for each point difference the 4 oligonucleotides are deposited and hybridization intensities are compared.
  • alternative splicing is detected using DNA corresponding to a single effective or putative exon: the gene is therefore analyzed exon by exon.
  • DNA chips also relate, by extension, to any endogenous or exogenous retroviral sequence, such as for example ERV-9, ERV-K, ERV-L, ERV-H, ERV-4, ERV-6, ERV-8, ERV- 10, ERV-15, ERV-16, ERV- 17, ERV-18, ERV-21, ERV-24, ERV-33, ERV-34, ERV-36, ERV-40, ERV-42, ERV- MLN, ERV-FRD, ERV-FTD ...), as well as all the putative exon sequences (identified by the existence of tag sequences and corresponding transcripts) or effective, and which are located on either side up to a distance of 120 kb from endogenous retroviral sequences of the HERV-7q type.
  • endogenous retroviral sequence such as for example ERV-9, ERV-K, ERV-L, ERV-H,
  • the comparative study is carried out between a control sample and the test sample, from a prophylactic, diagnostic or therapeutic perspective, such as for example: early detection of a modification of the expression of one of the sequences, in a cell , a tissue or an organism, the identification of a sequence associated with a susceptibility or any pathology, the monitoring of the evolution of the pathology, or even the monitoring of a treatment and the evaluation of its effectiveness.
  • the interest of the method makes it possible, more generally, to take stock of the variations observed in an individual, which in a way constitutes an identity card, which facilitates an approach epidemiological allowing to establish new correlations between a particular profile observed and a pathology, apart from any a priori concerning this pathology.
  • the present invention also relates to a kit for detecting and / or evaluating an autoimmune disease and in particular neuropathologies with autoimmune etiology, characterized in that it comprises, in addition to the buffers necessary for the implementation methods as defined above:
  • - reagents B consisting of transcripts and cDNAs of genomic sequences, which code for all or part of a factor, whose function, regulation / deregulation or alteration is associated with normal or pathological expression or regulation / deregulation of motifs belonging to said HERV-7q family, these sequences corresponding to nucleotide sequences coding for genes located in flanking regions located upstream and / or downstream of a retroviral sequence of said HERV-7q family including one of the ends cannot be at a distance exceeding 120 kb, which reagents are preferably fixed on an appropriate support.
  • said reagents B are selected from the group consisting of the sequences SEQ ID NO: 62-67 and 119 and their fragments corresponding to a sliding frame greater than or equal to 14 nucleotides or their complementary sequences, as well as the sequences represented in FIGS. 13-17, 22- 26.
  • the present invention also relates to translation products, characterized in that they are coded by a nucleotide sequence as defined above.
  • a subject of the present invention is also a peptide, characterized in that it is capable of being expressed using a nucleotide sequence selected from the group consisting of the sequences SEQ ID NO: 1-22, 28 and 61, as defined above, according to the combinations offered by the use of different possible reading frames (see also figures 18-21).
  • Said peptide also includes the peptides or polypeptides derived comprising between 5 and 540 amino acids (SEQ ID NO: 23-36 and SEQ ID NO: 58 and their fragments of at least 5 amino acids) and in particular a fragment of 538 amino acids, starting at the first mehionine of the sequence SEQ ID NO: 26 (enverine).
  • said peptides are in particular selected from the sequences SEQ ID NO: 23-36, 58, in particular the sequence SEQ ID NO: 26 and its C-terminal fragments. either from amino acid 291, or from amino acid 321, starting from the first methionine.
  • said peptides are obtained from the nucleic sequences as defined above, in which at least one nonsense codon can be replaced by a codon coding for one of the following amino acids: Phe (F), Leu (L), Ser (S), Tyr (Y), Cys (C), Trp (W), Gin (Q), Arg (R), Lys (K), Glu (E) or Gly (G).
  • the invention thus encompasses the deduced peptides or the deduced proteins corresponding to all or part of the nucleic acid sequences described in the invention, and possibly exhibiting modifications with the reference sequences described in the invention, when they are expressed in some patients.
  • the invention encompasses the complete or partial sequences obtained according to the 3 sense reading frames and the 3 reverse and complementary reading frames, (see figures 18-21)
  • the analysis of the structure of the env domain of HERV-7q, called enverine, made it possible to successively highlight: - an N-terminal signal peptide (region 1-21) and two transmembrane domains (region 320- 340; 455-477), responsible for interactions with protein or lipid membrane motifs,
  • the peptides according to the invention containing these patterns may advantageously serve as antagonists by inhibiting the binding of TGF- ⁇ on their natural receptors.
  • glycosylation of the envelope proteins of retroviruses seems to be directly associated with their functional properties, for example by influencing the number of determinants available in T-cells or by promoting the recognition of antigens by T-cells. Glycosylation could play a role in the declaration or extension of a pathology with autoimmune incidence. Glycosylations are necessary to maintain the conformation of certain epitopes, in particular when producing a recombinant envelope protein at the end of the development of a diagnostic reagent and to promote the effectiveness of a possible vaccine. . Positions 171, 210. 216, 236, 244, 283 and 411. Randomly expected number: 3.2
  • Prenylation is an essential mechanism for binding to the cell membrane and for targeting certain proteins. This targeting process could be essential for the development of therapeutic agents specific capable of interfering in the production and regulation of traffic in cellular complexes involving proteins involved in cell interactions, growth and movements. Positions 188 and 290. Randomly expected number: 1.8
  • This Table I indicates an estimation of the dissociation half-life of an envin peptide with an allele of the HLA class I system (the Parker coefficient tables: J. Immunol, (1994), 152, 163- 175).
  • the location indicates the position of the first amino acid of the peptides tested in the sequence of the envin.
  • the letter code is used for the amino acid sequence. Scores around 500 or more than 500 were retained.
  • a peptide capable of fixing a particular class I molecule is therefore able to function as a T-cell epitope.
  • the present invention also includes fragments 399-471 and 244-271 of the envin which advantageously group together several epitopes of high affinity for different haplotypes of the HLA class I system.
  • the use of all or part of these polypeptides is consequently able to favor an increase in the repertoire of T-cells, by allowing a better efficiency of the immune response within the framework of the different immunotherapeutic, prophylactic or vaccine strategies).
  • These peptides may advantageously be delivered, for example, by the use of viral vectors, viral or synthetic particles, lipopeptides, conventional adjuvants, naked nucleic acids or adsorbed on particles, or liposomes.
  • the peptides can be chemically or biochemically modified; some of the amino acids can be replaced by an analogous amino acid, according to the conventional criteria of homologies (A or G; S or T; I, L or V; F, Y or W; N or Q; D or E).
  • the present invention also relates to immunogenic or vaccine compositions, for protection against autoimmune diseases, in particular in subjects at risk, characterized in that it comprises at least one peptide comprising at least one motif of the CKS type and / or at least one peptide consisting of a motif having an affinity with one of the haplotypes of the HLA class I or class II system and a pharmaceutically acceptable vehicle.
  • said motif is selected from the group consisting of peptides as defined in Table I above.
  • said peptide has the following sequence: CKH sequence: LONRRALDLLTAERGGTclFLGEECCYYV (SEQ ID NO: 120). It is remarkable to note at the level of position 380 of the envin protein, the contiguity of the CKS-17 type motifs (underlined) and of the peptide having the highest score (in bold; see peptide in position 399 in Table I , SEQ ID NO: 68) in the sequence CKH.
  • lymphocyte subgroups for example of cytotoxic lymphocytes, by the peptides of Table I and by extension their counterparts, is blocked by usual immunotherapy maneuvers such as for example serotherapy and vaccination.
  • the association of two sequences or sequences analogous to the CKH peptide is capable of causing a synergistic process in the immune response, which could involve complementary signaling and activation pathways, able to modulate lymphocyte activation.
  • Vaccination concerns the production of antibodies directed against the peptides of Table I, according to the rules of the art and according to the release methods controlled by artificial or cellular implants using a composition as defined above and by use of gene therapy maneuvers, such as for example by expression of the nucleic sequences coding for the peptides of Table I. Consequently, the subject of the invention is also immunogenic or vaccine compositions characterized in that they comprise a vector including at least one nucleic sequence encoding a peptide as defined in Table I, optionally associated with a sequence encoding a CKS-17 type motif.
  • Serotherapy concerns the use of neutralizing antibodies produced from the peptides in Table I and their counterparts.
  • Protein products generated by endogenous retroviral sequences or produced in parallel can advantageously be characterized by micro-methods of analysis and quantification of peptides and proteins: HPLC / FPLC or equivalent, capillary electrophoresis or equivalent, micro-sequencing techniques (method d 'Edman or equivalent, mass spectrometry ).
  • the subject of the invention is also antibodies directed against one or more of the peptides described above and their use either for the implementation of an in vitro detection method, in particular differential for the presence of such a sequence in an individual, either for the preparation of a composition suitable for use in serotherapy in neuropathologies with an autoimmune component.
  • Said antibodies are advantageously polyclonal or monoclonal antibodies obtained by an immunological reaction of a human organism, mammals, birds or other species with respect to proteins, as defined above.
  • the subject of the present invention is a method of differential immunological screening for human or endogenous retroviral sequences of the HERV-7q family, normal or pathological, characterized in that it comprises bringing a biological sample into contact with an antibody according to the invention , the reading of the result being revealed by an appropriate means, in particular EIA, ELISA, RIA, fluorescence.
  • such an in vitro diagnostic method comprises bringing a biological sample taken from a patient into contact with antibodies according to the invention and detection using any suitable method. , in particular with the aid of labeled anti-immunoglobulins, immunological complexes formed between proteins produced normally or pathologically and antibodies.
  • Monoclonal or polyclonal antibodies produced from antigens corresponding to synthetic peptides, recombinant polypeptide or proteins, make it possible to follow the expression of peptides or proteins produced normally or pathologically.
  • the analysis is preferably carried out by ELISA, or equivalent, Western-blot or equivalent, or by immunohistochemistry.
  • the present invention also relates to a method for identifying and detecting endogenous retroviral patterns, abnormally expressed in the context of pathologies associated with cancer, or neuropathologies in particular autoimmune, in the first row of which multiple sclerosis, characterized in that it comprises the comparative analysis of the sequences extracted from a biological sample with the sequences according to the invention.
  • the present invention also relates to the application of the nucleic sequences or protein sequences according to the invention to the diagnosis, to the prognosis, to the evaluation of the genetic susceptibility, to all human diseases induced, innate or acquired in particular those with components cancerous, autoimmune and / or with neurological incidence, such as multiple sclerosis, associated syndromes and neurodegenerative diseases in which all or part of the nucleic acid sequences according to the invention and related endogenous or exogenous forms intervene.
  • the present invention also relates to hybrid nucleic acid sequences, characterized in that they comprise nucleic acid sequences or motifs according to the invention, combined with sequences or motifs of endogenous origin or of origin or exogenously induced.
  • the present invention further relates to a recombinant cloning or expression vector, characterized in that it comprises a nucleic sequence in accordance with the invention.
  • Therapeutic maneuvers can be envisaged by using some of the nucleic sequences contained in HERV-7q and the sequences of the same family or deduced polypeptide structures or by using peptides or proteins, or specific antibodies.
  • all or part of the endogenous retroviral nucleic acid sequences of the HERV-7q type can be used as a vector or vector elements with a therapeutic vocation, in particular the LTR sequences and the gag region (SEQ ID NO: 2, 21 and 22).
  • the advantage of such sequences lies in the safety of the vector thus formed, in the possibility of targeted specific insertion in a region well defined by a strategy analogous to homologous recombination, in cell targeting, possibly transient in the case of placental expression in women.
  • Another aspect relates to the possibility of associating to the genes of interest biologically active retroviral motifs (peptide immunomodulators, such as represented in SEQ ID NO 68-118, hereinafter, fusogenic peptide ).
  • the present invention also relates to transgenic animals, characterized in that they comprise all or part of a sequence of HERV-7q type (SEQ ID NO: 1-22 and 61).
  • Table II below establishes the correspondences between the numbers of the sequences as they appear in the list of sequences and the names of the different sequences.
  • FIG. 1 Mapping of the human endogenous retroviral region HERV-7q.
  • the upper part of the figure corresponds to an anonymous region of the human genome located on the long arm of chromosome 7.
  • the env C-terminal region (4.3) extends upstream in a long open reading frame (4.2).
  • Domain 4.1 corresponds to the N-terminal region of the domain approx.
  • - Figure 10 Alignment of a deduced protein gag motif (top) belonging to an infectious retrovirus (EMBL accession number: A60200) with the deduced protein gag motif (bottom) identified in HERV-7q. Nonsense codons are in bold and underlined. Identical amino acids are specified by 2 dashes. A dash indicates a homologous deletion or amino acid.
  • - Figure 11 Alignment of an env motif (top) belonging to an infectious retrovirus (EMBL accession number: A60170) with the env motif (bottom) identified in HERV-7q. Homologous nucleotides are specified by a colon and deletions by a dash.
  • EXAMPLE 1 Detection, by gene amplification, of a nucleic sequence belonging to a gag or env type domain according to the invention, in a sample of genomic DNA of human or mammal origin. Gene amplification is carried out using genomic DNA isolated from the blood. Anticoagulant treatment is carried out with 1 ml of citrate solution (per liter: 4.8 g citric acid, 13.2 g of sodium citrate, 14.7 g glucose) per 6 ml of blood fresh. After centrifugation of 20 ml of blood for 15 min at 13.0000 g, the supernatant is removed and the fraction enriched in white blood cells is transferred to a new tube, then recentrifuged under the same conditions as above.
  • citrate solution per liter: 4.8 g citric acid, 13.2 g of sodium citrate, 14.7 g glucose
  • the fraction enriched in white blood cells is resuspended in an extraction buffer (10 nm Tris-HCl, 0.1 M EDTA, 20 ⁇ g / ml of pancreatic RNAse treated to eliminate DNAses. 0.5% SDS, pH 8.0 ), then incubated for 1 hour at 37 ° C. Proteinase K is added to a final concentration of 100 ⁇ g / ml. The suspension of the lysed cells is incubated at 50 ° C for 3 hours with periodic shaking, then treated with an equal volume of phenol equilibrated with 0.5 M Tris-HCl, pH 8.0. The emulsion formed is placed on a wheel for one hour, then centrifuged at 5000 g for 15 minutes at room temperature.
  • the aqueous solution is treated by a triple dépro- téinisé phenol extraction to obtain a degree of purification corresponding to a final absorbance ratio A260 / A280 greater than 1.75.
  • the aqueous fraction is precipitated by 0.2 vol. of sodium acetate and 10 M 2 vol. ethanol.
  • the DNA is then either removed with the end of a curved pasteur pipette, or centrifuged at 5000 g for 5 min at room temperature.
  • the DNA or the pellet of DNA was washed two times with 70% ethanol, then taken up in 1 ml of TE pH 8.0 to be eluted under gentle agitation for 12 to 24 hours.
  • Oligonucleotides specific for the endogenous sequences described according to the invention are chosen to amplify the gag or env region of the endogenous retroviral regions described according to the invention.
  • the genomic DNA studied comes from patients with pathologies such as multiple sclerosis and individuals reputed to be healthy.
  • thermostable DNA polymerases used were chosen for their high fidelity during the amplification process, such as Vent , DNA polymerase (Biolabs) or equivalent, and are used according to the conditions recommended by the supplier.
  • the amplification strategy uses, depending on the case, a simple PCR, or a nested or semi-nested PCR.
  • the 1505 nt fragment amplified by the G1F-G1R pair: 1505 nt is used in order to generate the probes capable of hybridizing the various PCR amplification products.
  • - primer G2F, nested direction SEQ ID NO: 39).
  • Oligonucleotides used to amplify the env region of HERV-7q are:
  • the 2529 nt fragment amplified by the pair of primers E1F-E1R is used in order to generate the probes capable of hybridizing the various PCR amplification products.
  • PCR is performed from 50 to 200 ng of genomic DNA.
  • the PCR conditions are those recommended by the supplier.
  • the cyclic amplification conditions are carried out in 50 ⁇ l: a denaturation of 94 ° C for 1 min., A hybridization of 70 ° C for 1 min., And an elongation at 72 ° C for 1 to 2 min., according to the amplified fragments. After 35 cycles, a terminal reaction is carried out at 72 ° C for 10 min.
  • the automatic sequencing of the amplified samples is carried out using an Applied Biosystems sequencer of the ABI 377 type or another comparable model, according to the protocols supplied by the manufacturer. In the case of a nested PCR or semi-nested, the same experimental conditions are used, with the only difference that the sample of genomic DNA is replaced with 5 to 10 .mu.l of the amplification product from the first PCR.
  • EXAMPLE 2 Detection by gene amplification of a nucleic sequence according to the invention in a biological sample of genomic DNA taken from patients with a declared candidate pathology or the suspicion of this pathology.
  • the amplification protocol is the same as in Example 1, except for the origin of the sample which comes from patients with a candidate pathology.
  • a reputed normal genomic DNA sample is systematically integrated into all of the amplified pathological samples and then analyzed.
  • PCR products are separated on a gel of 1.5% agarose, and transferred in the presence of 0.4 N sodium hydroxide to a charged nylon membrane.
  • Hybridization is carried out with a specific probe corresponding to the PCR fragments amplified either by the G1F-G1R pairs or by the E1F-E1R pair. The probe is marked by incorporation of dUTP-digoxygenin according to the supplier's protocol (Boehringer Mannheim).
  • the hybridization is carried out in a hybridization buffer (5XSSC, 50% formamide, 0.1% lauroyl-sarcosine, 0.02% SDS, 2% Boehringer blocking reagent) overnight at 42 ° C.
  • the Southern is washed 2 times 5 min.
  • SSCP single strand conformation polymorphism
  • PCR fragments capable of exhibiting an alteration in their nucleotide sequence are sequenced according to Example 1.
  • Hybridization using a specific oligonucleotide (17 seas to 20 seas) corresponding to the modified nucleotide region makes it possible to identify the samples exhibiting an identical modification (ASO method). Briefly, the southern is hybridized with an oligonucleotide marked distally either with P 32 , or in the presence of digoxygenin (according to the protocol of Boehringer Mannheim) then washed under stringent conditions at 65% C in a 6XSSC solution, 0.05% sodium pyrophosphate.
  • an automatic nucleotide sequencing was carried out on six PCR fragments, coming from 5 patients with MS and a control considered normal, and which were amplified from primers F645: CTTCAAACAACAACCAGGAGG (SEQ ID NO: 121) (located 26 nucleotides upstream of the initiator methionine) and PS5D: TTGGGGAGGTTGGCCGACGA (SEQ ID NO: 122) (located 6 nucleotides downstream of the nonsense codon of the emerin. envin were observed on the DNA of some of the patients ( Figure 17).
  • SEQ ID NO: 22 (reading frame 1) and Figure 19: start of the coding sequence: position 7874, end of the coding sequence 1 st nonsense codon (position 9493)
  • SEQ ID NO: 35 start of the coding sequence : position 7874, end of coding sequence 1 st nonsense codon (position 9493) (reading frame 1)
  • Figure 19 start of coding sequence: position 6970, end of coding sequence 1st nonsense codon (position 9493) (reading frame 1)
  • Figure 20 start of the coding sequence: position 6971, the end of the reading frame is shifted according to the case of 1, 2 or 3 codons
  • Figure 21 start of coding sequence: position 6972, end of reading frame is offset depending on the case of 1. 2 or 3 codons
  • SEQ ID NO: 22 Different peptides corresponding to all or part of SEQ ID NO: 22 (see SEQ ID NO: 23-27 and 35) have been synthesized by genetic engineering in order to test their antigenic specificity vis-à-vis sera or tissues of affected patients. from SEP, for example. Briefly, all or part of the env region of HERV-7q is subcloned into the vectors pQE30, 31 and 32.
  • the vectors pQE30. 31 and 32 contain, in 5 ′ of the multi-cloning site, the consensual sequences for transcription (the strong promoter of bacteriophage T5, 2 operators of the lactose operon), translation (a synthetic ribosomal attachment site). Likewise.
  • pQE30, 31 and 32 have, at 3 ', the transcription terminator for phage 1 as well as a "Stop" codon for translation.
  • the expression of the protein takes place after transformation in E. coli Ml 5.
  • the plasmid pQE30, 31 and 32 have, upstream of the polycloning site, the coding sequence for a sequence of 6 histidines having an affinity for nickel ions. This sequence allows the purification of the chimeric protein expressed, by adsorption on a resin constituted by a chelating ligand, nitrilotriacetic acid (NT A), charged with 4 nickel ions (NI-NTA resin, Qiagen).
  • the transformation is carried out by electroporation or treatment with calcium chloride.
  • a colony of E. coli Ml 5 is incubated in 100 ml of LB medium containing 250 ⁇ g of kanamycin, with shaking at 37 ° C. until an OD 600 of 0.5 is obtained. After centrifugation for 5 minutes at 2000 g at 4 ° C, the bacterial pellet is taken up in 30 ml of TFB1 solution (100 mM rubinium chloride, 50 mM manganese chloride, 30 mM potassium acetate, 10 mM CaC12 , 15% o glycerol, pH 5.8), at 4 ° C for 90 minutes.
  • TFB1 solution 100 mM rubinium chloride, 50 mM manganese chloride, 30 mM potassium acetate, 10 mM CaC12 , 15% o glycerol, pH 5.8
  • the bacterial pellet is taken up in 4 ml of TFB2 solution (10 mM rubidium chloride, 10 mM MOPS, 75 mM CaCl2. 15% glycerol, pH 8).
  • Cells can be stored at -70 ° C in 500 ml aliquots. 20 ⁇ l of the ligation and 125 ⁇ l of competent cells are mixed and placed in ice for 20 minutes. After a thermal shock of 42 ° C. for 90 seconds, the cells are agitated for 90 minutes at 37 ° C. in 500 ml of Psi-broth medium (LB medium supplemented with 4 mM of MgSO 4 , 10 mM of potassium chloride). The transformed cells are spread on LB-agar dishes supplemented with 25 ⁇ g / ml of kanamycin, and 100 ⁇ g / ml ampicillin, and the dishes are incubated overnight at 37 ° C.
  • Psi-broth medium LB medium supplemented with 4 mM of
  • the potentially recombinant clones are subcultured in an orderly fashion on a nylon filter deposited on an LB-agar box supplemented with 25 ⁇ g / ml of kanamycin and 100 ⁇ g / ml of ampicillin. After one night at 37 ° C. recombinant clones were identified by hybridization of the plasmid DNA with the nucleotide probe amplified by PCR with the pair of primers according to SEQ ID NO: 45 and SEQ ID NO: 46.
  • An independent colony containing the insert is inoculated with 20 ml of LB medium supplemented with 25 ⁇ g / ml of kanamycin and 100 ⁇ g / ml of ampicillin. After one night at 37 ° C. with shaking, 500 ml of the same medium are incubated at 1/50 ° with this preculture until an OD 600 of 0.8 is obtained, then 1 to 2 mM final of IPTG is added. After 5 hours, the cells are centrifuged for 20 minutes at 4000 g.
  • Part of the cell pellet is taken up in 5 ml of sonication buffer (50 mM sodium phosphate pH 7.8, 300 mM NaCl) and then placed in ice. After a rapid sonication, the cells are centrifuged for 20 minutes at 10,000 g. Part of the cell pellet is taken up in 10 ml of a 30 mM Tris / HCl-20% sucrose pH8 solution. The cells are incubated for 5 to 10 minutes with shaking, after adding 1 mM EDTA. After centrifugation for 10 minutes at 8000 g at 4 ° C, the pellet is taken up in 10 ml of 5 mM of ice-cold MgS04. After 10 minutes in ice with stirring, the cells are centrifuged for 10 minutes at 8000 g at 4 ° C.
  • sonication buffer 50 mM sodium phosphate pH 7.8, 300 mM NaCl
  • the pellet is taken up in 5 ml / g in buffer A (6 M GuHCl (guanidine hydrochloride), 0.1 M sodium phosphate, 0.01 M Tris / HCl, pH 8), 1 hour at room temperature.
  • the lysate is centrifuged for 15 minutes at 10,000 g at 4 ° C, and the supernatant is supplemented with 8 ml of Ni-NTA resin, pre-equilibrated in buffer A. After 45 minutes at room temperature, the resin is poured into a column, washed by 10 times the volume of the column with buffer A then by 5 times the volume of the column with buffer B (8 M urea, 0.1 M sodium phosphate, 0.01 M Tris / HCl, pH 8).
  • the column is washed with buffer C (8 M urea, 0.1 M sodium phosphate, 0.01 M Tris / HCl, pH 6.3) until 1280 is less than 0.01.
  • the recombinant protein is eluted with 10 to 20 ml of buffer D (8 M urea, 0.1 M sodium phosphate, 0.01 M Tris / HCl, pH 5.9) then with 10 to 20 ml of buffer E (8 M urea, 0.1 M sodium phosphate, 0.01 M Tris / HCl, pH 4.5), then with 20 ml of buffer F (6 M HC1, 0.2 M acetic acid).
  • buffer F 6 M HC1, 0.2 M acetic acid
  • Antibodies are obtained in the same way, from peptides synthesized chemically according to the Merrifield technique (G. Barany and B. Merrifield, 1980, in The peptides, 2, 1-284, E. Gross and J. Meienhofer, Académie Press, New York).
  • the specific antibodies obtained are used for the purpose of detecting the serum or tissue expression of all or part of the endogenous retroviral sequences according to the invention, in normal and pathological cases.
  • Proteins of serum or tissue origin are separated on acrylamide-SDS gel and then transferred to a nitrocellulose filter using a Novablot 2117-2250 (LKB) device.
  • the transfer is carried out on a Hybond C- extra sheet (Amersham) using a 100 mM CAPS buffer pH 11, methanol, water (V / V / V: 1/1/8) containing 1 mM CaCl2- After a transfer 1 hour at 0.8 mA / cm 2 , the sheet is saturated for one hour at room temperature in PBS-0.5% gelatin. The sheet is brought into the presence of the specific antibody at a concentration of 1/1000 in PBS-0.25% gelatin.
  • the filter is washed 3 times 15 minutes in PBS-0.1% Tween-20, then the filter is incubated for 30 minutes in the presence of a secondary antibody coupled to alkaline phosphatase (Promega). diluted 1/7500 in PBS-0.25% gelatin. After three washes in PBS-0.1% Tween-20, the filter is equilibrated in a buffer (100 mM Tris-HCl pH 9.5, 100 mM NaCl, 5 mM MgCl2). The revelation is carried out in the presence of 45 ⁇ l of NBT at 75 mg / ml and 35 ⁇ l of BCIP at 50 mg / ml, for 10 ml of alkaline phosphatase buffer.
  • a buffer 100 mM Tris-HCl pH 9.5, 100 mM NaCl, 5 mM MgCl2
  • the chimeric proteins obtained by genetic engineering are also used at the end of biological activity tests, such as for example for the biological activity test of the CKS-17 type peptide identified in the env domain of HERV-7q ( Figure 5).
  • PCR fragments obtained are subcloned into the plasmid PGEM 4Z (Promega) which has, on either side of its polycloning site, the promoter sequences for the RNA polymerase SP6 and T7.
  • the skill method used is electroporation.
  • the plasmid and the PCR fragment are hybridized in a ratio of 50 ng of vector (cut to Sma I) per 100 ng of PCR fragment (made blunt-ended by treatment with the Klenow fragment of DNA polymerase). Incubation takes place overnight at 22 ° C. in the ligation buffer (66 mM Tris-HCl pH 7.5, 5 mM MgCl2. 1 mM dithioerythritol, 1 mM ATP) in the presence of lu. of T4 DNA ligase and then is stopped by denaturation for 10 minutes at 65 ° C. At the same time, the strain d ⁇ .
  • Coli JM 105 is seeded overnight at 37 ° C in LB medium. This preculture is diluted to 1/500 and placed at 37 ° C until an OD 600 equal to 1. For the rest of the procedure, the cells will always be kept cold. After centrifugation for 5 minutes at 3500 g at 4 ° C, the cell pellet is resuspended in 1/4 vol. ultra-pure ice water. This step is repeated 5 to 6 times. Then the pellet is resuspended in 1/4000 vol. water; 10% sterile glycerol is added allowing the conservation of the electrocompetent cells, in 10 ⁇ l aliquots at 20 ° C.
  • the potentially recombinant white clones are subcultured in an orderly fashion on an LB / ampicillin box and in parallel on a nylon filter deposited on an LB / ampicillin box. These two dishes are incubated overnight at 37 ° C.
  • the recombinant clones are then identified by hybridization with a nucleic acid probe amplified by PCR with the pair of primers according to SEQ ID NO: 45 and SEQ ID NO: 46 and labeled with digoxigenin.
  • the recombinant clones are cultured in 50 ml of medium LB / ampicillin (100 ⁇ g / ml) shaking overnight at 37 ° C. After centrifugation at 3500 g for 15 minutes at 4 ° C, the bacterial pellet is taken up in 4 ml of PI buffer (50 mM Tris-HCl, 10 mM EDTA, 400 ⁇ g / ml RNase A, pH 8) and 4 ml of P2 buffer ( 200 mM NaOH, 1% SDS). The mixture is incubated at room temperature for 5 minutes.
  • PI buffer 50 mM Tris-HCl, 10 mM EDTA, 400 ⁇ g / ml RNase A, pH 8
  • P2 buffer 200 mM NaOH, 1% SDS
  • Ribonucleic probes are used as specific probes, in particular for the detection of transcripts expressed by the endogenous retroviral sequences according to the invention.
  • EXAMPLE 6 Construction of a transgenic mouse containing all or part of the envin gene.
  • a transgenic mouse containing all or part of the HERV-7q sequence (SEQ ID NO: 3) is constructed in order to identify the sequences responsible for tissue specificity, and to evaluate the role of all or part of the endogenous retroviral motifs of the HERV type. -7q, in particular all or part of the peptide motifs of the envin.
  • the micro-injection technique used refers to the conventional technique (Hogan et al., (1994), Manipulating the mouse embryo, Cold Spring Harbor, Cold Spring Harbor Laboratory Press) or its equivalents.
  • RNA tumor viruses (Weiss RA. Varmus HE, Teich NM, and Coffin JM eds), Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Hematology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Neurology (AREA)
  • Pathology (AREA)
  • Rehabilitation Therapy (AREA)
  • Rheumatology (AREA)
  • Toxicology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
PCT/FR1999/001513 1998-06-23 1999-06-23 Famille de sequences nucleiques et de sequences proteiques deduites presentant des motifs retroviraux endogenes humains, et leurs applications Ceased WO1999067395A1 (fr)

Priority Applications (8)

Application Number Priority Date Filing Date Title
AU43751/99A AU4375199A (en) 1998-06-23 1999-06-23 Nucleic sequence and deduced protein sequence family with human endogenous retroviral motifs, and their uses
CA2331923A CA2331923C (fr) 1998-06-23 1999-06-23 Famille de sequences nucleiques et de sequences proteiques deduites presentant des motifs retroviraux endogenes humains, et leurs applications
JP2000556036A JP2002518051A (ja) 1998-06-23 1999-06-23 ヒト内因性レトロウイルスモチーフを有する核酸及び推定されるタンパク質配列のファミリーのならびにその使用
DE69939114T DE69939114D1 (de) 1998-06-23 1999-06-23 Nukleinsäuresequenzfamilie und entsprechende proteinsequenzen, die humane endogene retrovirale motive enthalten, und ihre anwendungen
US09/719,554 US6919438B1 (en) 1998-06-23 1999-06-23 Nucleic sequence and deduced protein sequence family with human endogenous retroviral motifs, and their uses
EP99926538A EP1090122B1 (fr) 1998-06-23 1999-06-23 Famille de sequences nucleiques et de sequences proteiques deduites presentant des motifs retroviraux endogenes humains, et leurs applications
US11/028,539 US7534439B2 (en) 1998-06-23 2005-01-05 Nucleic sequence and deduced protein sequence family with human endogenous retroviral motifs, and their uses
US12/336,813 US20090263783A1 (en) 1998-06-23 2008-12-17 Nucleic sequence and deduced protein sequence family with human endogenous retroviral motifs, and their uses

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR98/07920 1998-06-23
FR9807920A FR2780069B1 (fr) 1998-06-23 1998-06-23 Famille de sequences nucleiques et de sequences proteiques deduites presentant des motifs retroviraux endogenes humains et leurs applications

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US09719554 A-371-Of-International 1999-06-23
US11/028,539 Division US7534439B2 (en) 1998-06-23 2005-01-05 Nucleic sequence and deduced protein sequence family with human endogenous retroviral motifs, and their uses

Publications (1)

Publication Number Publication Date
WO1999067395A1 true WO1999067395A1 (fr) 1999-12-29

Family

ID=9527737

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR1999/001513 Ceased WO1999067395A1 (fr) 1998-06-23 1999-06-23 Famille de sequences nucleiques et de sequences proteiques deduites presentant des motifs retroviraux endogenes humains, et leurs applications

Country Status (8)

Country Link
US (3) US6919438B1 (https=)
EP (2) EP1090122B1 (https=)
JP (1) JP2002518051A (https=)
AU (1) AU4375199A (https=)
CA (1) CA2331923C (https=)
DE (1) DE69939114D1 (https=)
FR (1) FR2780069B1 (https=)
WO (1) WO1999067395A1 (https=)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AT411262B (de) * 2001-09-27 2003-11-25 Wolff Klaus Dr Humanes endogenes retrovirus
FR2865403A1 (fr) * 2004-01-23 2005-07-29 Biomerieux Sa Composition pour le traitement d'une pathologie associee a la msrv/herv-w
US7211659B2 (en) 2001-07-05 2007-05-01 Chiron Corporation Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
US7282364B2 (en) 2001-08-31 2007-10-16 Novartis Vaccines And Diagnostics, Inc. Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides and uses thereof
US7348177B2 (en) 1998-12-31 2008-03-25 Novartis Vaccines And Diagnostics, Inc. Expression of HIV polypeptides and production of virus-like particles
US7943375B2 (en) 1998-12-31 2011-05-17 Novartis Vaccines & Diagnostics, Inc Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
US20120189647A1 (en) * 2004-03-30 2012-07-26 Institut Gustave Roussy Polypeptide sequence involved in the modulation of the immunosuppresive effect of viral proteins

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1224291A1 (en) * 1999-10-28 2002-07-24 Universite De Geneve Multiple sclerosis-related superantigen
FR2805279B1 (fr) * 2000-02-23 2004-09-24 Jean Jacques Guilhou Sequences retrovirales associees a des affections cutanees
US20070249808A1 (en) * 2000-10-30 2007-10-25 Bernard Conrad Multiple Sclerosis-related superantigen
US8680065B2 (en) * 2008-09-11 2014-03-25 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Oligonucleotides of human endogenous retrovirus 9 (ERV-9) long terminal repeat (LTR) and methods of use
AU2018322831B2 (en) * 2017-09-01 2023-04-27 Inprother Aps A vaccine for use in the prophylaxis and/or treatment of a disease
JP7344300B2 (ja) 2018-09-18 2023-09-13 ブイエヌブイ ニューコ インク. Arcベースのカプシドおよびその使用
WO2020252455A1 (en) 2019-06-13 2020-12-17 The General Hospital Corporation Engineered human-endogenous virus-like particles and methods of use thereof for delivery to cells
CN110470837B (zh) * 2019-08-30 2022-09-16 苏州西山生物技术有限公司 利用猴srv病毒gp20蛋白检测猴srv病毒的方法及其试剂盒
US11129892B1 (en) 2020-05-18 2021-09-28 Vnv Newco Inc. Vaccine compositions comprising endogenous Gag polypeptides
EP4185600A4 (en) 2020-07-24 2024-12-04 The General Hospital Corporation Enhanced virus-like particles and methods of use thereof for delivery to cells
WO2023086882A1 (en) * 2021-11-11 2023-05-19 The Trustees Of The University Of Pennsylvania Compositions and methods comprising car t cells comprising prdm1 and/or nr4a3 knockout

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2737500A1 (fr) * 1995-08-03 1997-02-07 Bio Merieux Materiel viral et fragments nucleotidiques associes a la sclerose en plaques, a des fins de diagnostic, prophylactiques et therapeutiques
WO1998023755A1 (en) * 1996-11-26 1998-06-04 Bio Merieux Viral material and nucleotide fragments associated with multiple sclerosis, for diagnostic, prophylactic and therapeutic purposes
WO1999002666A2 (fr) * 1997-07-07 1999-01-21 Bio Merieux Materiel nucleique retroviral et fragments nucleotidiques notamment associes a la sclerose en plaques et/ou la polyarthrite rhumatoide, a des fins de diagnostic, prophylactiques et therapeutiques
WO1999002696A1 (fr) * 1997-07-07 1999-01-21 Bio Merieux Sequences retroviraux endogenes, associees a des maladies auto-immunes et/ou a des perturbations de la grossesse
WO1999026972A1 (en) * 1997-11-21 1999-06-03 Genetics Institute, Inc. Secreted proteins and polynucleotides encoding them

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5871996A (en) * 1994-02-04 1999-02-16 Bio Merieux Retrovirus agents MSRV1 and MSRV2 associated with multiple sclerosis
US5708157A (en) * 1996-07-26 1998-01-13 Genetics Institute, Inc. Secreted proteins and polynucleotides encoding them

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2737500A1 (fr) * 1995-08-03 1997-02-07 Bio Merieux Materiel viral et fragments nucleotidiques associes a la sclerose en plaques, a des fins de diagnostic, prophylactiques et therapeutiques
WO1998023755A1 (en) * 1996-11-26 1998-06-04 Bio Merieux Viral material and nucleotide fragments associated with multiple sclerosis, for diagnostic, prophylactic and therapeutic purposes
WO1999002666A2 (fr) * 1997-07-07 1999-01-21 Bio Merieux Materiel nucleique retroviral et fragments nucleotidiques notamment associes a la sclerose en plaques et/ou la polyarthrite rhumatoide, a des fins de diagnostic, prophylactiques et therapeutiques
WO1999002696A1 (fr) * 1997-07-07 1999-01-21 Bio Merieux Sequences retroviraux endogenes, associees a des maladies auto-immunes et/ou a des perturbations de la grossesse
WO1999026972A1 (en) * 1997-11-21 1999-06-03 Genetics Institute, Inc. Secreted proteins and polynucleotides encoding them

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ALLIEL PM ET AL: "Rétrovirus endogènes et sclérose en plaques. II. HERV-7q", COMPTES RENDUS DES SEANCES DE L'ACADEMIE DES SCIENCES SERIE III: SCIENCES DE LA VIE., vol. 321, no. 10, October 1998 (1998-10-01), MONTREUIL FR, pages 857 - 863, XP002101381 *
ALLIEL PM ET AL: "Séquences rétrovirales endogènes anlogues à celle du nouveau rétrovirus MSRV associé à la sclérose en plaques ( première partie)", COMPTES RENDUS DES SEANCES DE L'ACADEMIE DES SCIENCES SERIE III: SCIENCES DE LA VIE., vol. 321, no. 6, June 1998 (1998-06-01), MONTREUIL FR, pages 495 - 499, XP002101380 *
DATABASE EMBL NUCLEOTIDE SEQU 1 January 1900 (1900-01-01), XP002118730, Database accession no. AC000064 *
DATABASE EMBL NUCLEOTIDE SEQU 1 January 1900 (1900-01-01), XP002119234, Database accession no. X93499 *
MITANI M ET AL: "Suppressive effect on polyclonal B-cell activation of a synthetic peptide homologous to a transmembrane component of oncogenic retrovirus", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 84, no. 1, January 1987 (1987-01-01), WASHINGTON US, pages 237 - 240, XP002118729 *
VITELLI R ET AL: "Molecular cloning and expression analysis of the human rab7 GTP-ase complementary deoxyribonucleic acid", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 229, no. 3, 1996, ORLANDO, FL US, pages 887 - 890 *

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7348177B2 (en) 1998-12-31 2008-03-25 Novartis Vaccines And Diagnostics, Inc. Expression of HIV polypeptides and production of virus-like particles
US7943375B2 (en) 1998-12-31 2011-05-17 Novartis Vaccines & Diagnostics, Inc Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
US9598469B2 (en) 2001-07-05 2017-03-21 Novartis Vaccines And Diagnostics, Inc. HIV-1 south african subtype C env proteins
US8133494B2 (en) 2001-07-05 2012-03-13 Novartis Vaccine & Diagnostics Inc Expression cassettes endcoding HIV-1 south african subtype C modified ENV proteins with deletions in V1 and V2
US7211659B2 (en) 2001-07-05 2007-05-01 Chiron Corporation Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
US7282364B2 (en) 2001-08-31 2007-10-16 Novartis Vaccines And Diagnostics, Inc. Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides and uses thereof
US7510862B2 (en) 2001-09-27 2009-03-31 Avir Green Hills Biotechnology Research Development Trade Ag Polynucleotide fragments of an infectious human endogenous retrovirus
AT411262B (de) * 2001-09-27 2003-11-25 Wolff Klaus Dr Humanes endogenes retrovirus
US8008460B2 (en) 2001-09-27 2011-08-30 Avir Green Hills Biotechnology Research Development Trade Ag Polynucleotide fragments of an infectious human endogenous retrovirus
US7666420B2 (en) 2004-01-23 2010-02-23 Biomerieux Composition for treating pathology associated with MSRV/HERV-W
WO2005080437A1 (fr) * 2004-01-23 2005-09-01 Biomerieux Composition pour le traitement d'une pathologie associee a la msrv/herv-w
EP2365002A3 (fr) * 2004-01-23 2012-05-02 bioMérieux Composition pour le traitement d'une pathologie associée à la MSRV/HERV-W
EP3133087A1 (fr) * 2004-01-23 2017-02-22 bioMérieux Dosage de cytokines associées à la msrv/herv-w
FR2865403A1 (fr) * 2004-01-23 2005-07-29 Biomerieux Sa Composition pour le traitement d'une pathologie associee a la msrv/herv-w
US20120189647A1 (en) * 2004-03-30 2012-07-26 Institut Gustave Roussy Polypeptide sequence involved in the modulation of the immunosuppresive effect of viral proteins
US8597657B2 (en) * 2004-03-30 2013-12-03 Institut Gustave Roussy Mutated env sequence involved in the modulation of the immunosuppressive effect of viral proteins

Also Published As

Publication number Publication date
EP1997895A1 (fr) 2008-12-03
US6919438B1 (en) 2005-07-19
FR2780069A1 (fr) 1999-12-24
US20090263783A1 (en) 2009-10-22
CA2331923A1 (fr) 1999-12-29
US7534439B2 (en) 2009-05-19
CA2331923C (fr) 2014-02-18
EP1090122B1 (fr) 2008-07-16
JP2002518051A (ja) 2002-06-25
US20050118573A1 (en) 2005-06-02
FR2780069B1 (fr) 2002-06-28
DE69939114D1 (de) 2008-08-28
AU4375199A (en) 2000-01-10
EP1090122A1 (fr) 2001-04-11

Similar Documents

Publication Publication Date Title
EP1090122A1 (fr) Famille de sequences nucleiques et de sequences proteiques deduites presentant des motifs retroviraux endogenes humains, et leurs applications
EP1916304B1 (fr) Polypeptides antigéniques associés à la sclérose en plaques et utilisations
Barmak et al. Human T cell leukemia virus type I-induced disease: pathways to cancer and neurodegeneration
EP0674004B1 (fr) Virus MSRV1 associé à la Sclérose en Plaques, ses constituants nucléiques et leurs applications
EP1497467A2 (fr) Oligonucleotide issus des sequences codant pour la composante de surface des proteines d enveloppe des ptlv et leurs utilisat ions
Jamain et al. Transduction of the human gene FAM8A1 by endogenous retrovirus during primate evolution
US20120270773A1 (en) Trim5alpha mutants and uses thereof
KR20160111973A (ko) 인간 t 림프영양성 바이러스 타입 1에 대한 면역 반응들을 발생시키기 위한 렌티바이러스 벡터들
FR2741088A1 (fr) Methode de traitement de maladies neurodegeneratives mettant en oeuvre un anticorps ic2, un fragment ou derive de celui-ci et compositions pharmaceutiques correspondantes
JP4249269B2 (ja) 自己免疫疾患および/または妊娠障害に関連する内因性レトロウイルス配列
US20040241642A1 (en) Polynucleotide fragments of an infections human endogenous retrovirus
WO2005097179A2 (fr) Antigene tat stabilise et ses applications pour la vaccination anti-vih.
EP1612270B1 (fr) Matérial nucléique retroviral et fragments nucléotidiques, associés à la sclérose en plaques, à des fins de diagnostic, prophylactiques et thérapeutiques
EP0743364A2 (fr) Fragments d'acide nucléique dérivés du génome du virus VIH-1, peptides correspondants et leurs applications en tant que réactifs d'évaluation du risque de transmission materno-foetal du VIH-1
WO2001070941A2 (en) An infective endogenous retrovirus in association with demyelinating diseases e.g. multiple sclerosis
WO2005097180A1 (fr) Antigene tat dimerique et ses applications pour la vaccination anti-vih.
FR2713651A1 (fr) Nouvelle composition pour un effet antiviral.
WO1994003493A1 (en) Peptides derived from an immunosuppressive region in the retroviral genome

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2331923

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1999926538

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09719554

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1999926538

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 1999926538

Country of ref document: EP