WO1999063092A1 - Proteine specifique aux racines intervenant dans le transport de l'auxine - Google Patents

Proteine specifique aux racines intervenant dans le transport de l'auxine Download PDF

Info

Publication number
WO1999063092A1
WO1999063092A1 PCT/US1999/012277 US9912277W WO9963092A1 WO 1999063092 A1 WO1999063092 A1 WO 1999063092A1 US 9912277 W US9912277 W US 9912277W WO 9963092 A1 WO9963092 A1 WO 9963092A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
auxin
eirl
plant
root
Prior art date
Application number
PCT/US1999/012277
Other languages
English (en)
Other versions
WO1999063092A9 (fr
Inventor
Christian Luschnig
Roberto A. Gaxiola
Paula Grisafi
Gerald R. Fink
Original Assignee
Whitehead Institute For Biomedical Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Whitehead Institute For Biomedical Research filed Critical Whitehead Institute For Biomedical Research
Publication of WO1999063092A1 publication Critical patent/WO1999063092A1/fr
Publication of WO1999063092A9 publication Critical patent/WO1999063092A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8291—Hormone-influenced development
    • C12N15/8294—Auxins

Definitions

  • the plant hormone auxin indole-3 -acetic acid (IAA)
  • IAA indole-3 -acetic acid
  • morphogenesis e.g., the differentiation of vascular tissue and lateral or adventitious root formation
  • physiological responses to the environment such as phototropism and gravitropism.
  • Plant tropisms, growth towards or away from a stimulus such as light or gravity, have been ascribed to asymmetric plant growth in which one side of a plant organ elongates to a greater extent than the other, resulting in a curvature toward or away from the stimulus (Darwin, C, et al, (1880) Power of movements in plants.
  • Root gravitropism growth in a direction defined by gravity
  • the roots curve downward exhibiting a positive gravitropic growth response.
  • auxin transport systems comprising auxin influx and efflux activities, exist in several species of plants (Estelle, M., (1996) Curr Biol 6: 1589-91). IAA is thought to be polarly transported, from its point of synthesis in the plant shoot, down to the root (acropetal transport) tip via the vascular system, and then transported up from the root tip to the elongation zone (basipetal transport) where it probably localizes in the epidermis. This polarized cell to cell transport can be explained by the chemiosmotic hypothesis (Goldsmith, M.H.M. , (1977) Ann. Rev. Plant Physiol.
  • IAA auxin anion
  • the transit of IAA " (auxin anion) out of a cell and into an adjoining cell is thought to depend on, and be regulated by, an efflux carrier protein (Lomax, T.L., et al, (1995) In Plant Hormones, Kluwer Academic Publishers. Dordrecht, Boston, London; Jacobs, M. and S.F. Gilbert, (1983) Science. 220: 1297-1300).
  • an efflux carrier protein Limax, T.L., et al, (1995) In Plant Hormones, Kluwer Academic Publishers. Dordrecht, Boston, London; Jacobs, M. and S.F. Gilbert, (1983) Science. 220: 1297-1300.
  • gravitropism could result from the differential activity of an IAA efflux carrier in response to gravity.
  • auxin transport inhibitors such as 2,3,5-triiodobenzoic acid (TIBA) and N-1-naphtylphtalamic acid (NPA)
  • TIBA 2,3,5-triiodobenzoic acid
  • NPA N-1-naphtylphtalamic acid
  • TIBA 2,3,5-triiodobenzoic acid
  • NPA N-1-naphtylphtalamic acid
  • Described herein is the isolation and characterization of a plant gene which encodes an auxin-transport-efflux carrier protein that is required for gravitropism.
  • the disclosed protein and gene are targets for regulation of auxin transport in response to the hormones ethylene and auxin (including auxin analogues and auxin derivatives) and the inhibition of auxin transport mediated by synthetic transport inhibitors.
  • a specific embodiment of the present invention relates to a plant gene, referred to as EIRl (for: Ethylene Insensitive Root) , and its encoded auxin transport (e.g., efflux) carrier protein, EIRl, which is required for gravitropism; assays useful for assessing EIRl activity and determining structure/function relationships characteristic of mutagenized alleles of EIRl; inhibitors and enhancers of EIRl protein identified by the assays; methods of increasing transport of (efflux) auxin in plant roots by introducing EIRl DNA into the root of a plant, directly or indirectly (e.g., by producing plants from seeds containing exogenous EIRl DNA); methods of producing plants which exhibit greater resistance to herbicides (relative to the susceptibility exhibited by the corresponding wild type plant) which are auxin derivatives or auxin analogues or formulations comprising an auxin transport inhibitor in combination with a second herbicide relative to the susceptibility that is exhibited by the corresponding wild type plants; genetically engine
  • EIRl DNA, REH1 DNA wherein the DNA is expressed in the roots as a functional root-specific auxin transport protein; and the transgenic plant exhibits greater resistance (or tolerance) to herbicides which are auxin derivatives or auxin analogues or compositions comprising an auxin transport inhibitor, than the sensitivity exhibited by the corresponding wild type plant; plant tissues or parts obtained from such plant tissues; and seeds from which plants with increased herbicide resistance can be produced.
  • herbicides which are auxin derivatives or auxin analogues or compositions comprising an auxin transport inhibitor
  • the subject of this invention are mutant ezVl genes (mutant alleles), the encoded mutant protein and eir ⁇ mutant plants, in which the roots are agravitropic and have a reduced sensitivity to ethylene (relative to wild type plants).
  • Figures 1A - 1C are dose response curves of normalized root growth from wild type plants (black circle, Col-O; black square, Ws;) and eirl mutants (open circle, eirl- 1; open square, eirl -3) in the presence of 1-aminocyclopropane-l-carboxylic-acid (ACC; the immediate biosynthetic precursor of ethylene ), 2,3,5 triiodobenzoic acid (TIBA ;an inhibitor of auxin transport ), and napthaleneacetic acid (NAA; an auxin analogue).
  • ACC 1-aminocyclopropane-l-carboxylic-acid
  • TIBA 2,3,5 triiodobenzoic acid
  • NAA napthaleneacetic acid
  • Figure 2 is a schematic representation of an EcoRI fragment isolated from phage ⁇ 5-3. The bars indicate the 9 exons of EIR 1. Those segments presumed to be translated are black. Two mutations are indicated beneath the line: Insertion of Ac in eirl -3 after amino acid 133 and base substitution of the intron/exon junction in eirl-1. The grey bar above the line indicates the genomic fragment amplified by inverse PCR as described herein.. Abbreviations for restriction sites are as follows: RI: EcoRI; H: HinDIII; Ba: BamUl; X: Xbal; B: Bell.
  • Figure 3 shows the alignment of the deduced amino acid sequences of EIRl (S ⁇ Q ID NO.: 1), the rice homologue REHl (S ⁇ Q ID NO.: 2) and the two putative Arabidopsis homologues AEH1 (S ⁇ Q ID NO.: 3) and AEH2 (S ⁇ Q ID NO.:4).
  • EIRl and REHl ORFs of the cDNAs were deduced.
  • the protein sequences of AEH1 and AEH2 were deduced from the genomic sequences by identifying canonical splice donor and acceptor sites. Identical residues are boxed and dashes indicate gaps in the sequence.
  • Black lines correspond to the 10 potential transmembrane domains shared by all 4 proteins. Potential, conserved N-glycosylation sites are typed in bold letters.
  • An arrow indicates the cleavage site of a potential N-terminal signal peptide found for ⁇ IRI, R ⁇ I and A ⁇ l.
  • Figure 4 shows the alignment of the conserved - (top) ⁇ IRJ, S ⁇ Q ID NO.:5; R ⁇ I, S ⁇ Q ID NO.:6 and C-terminal (bottom) ⁇ IRI, S ⁇ Q ID NO.: 25; R ⁇ 1, S ⁇ Q ID NO: 26) protein transmembrane domains of ⁇ IRI and R ⁇ I with a number of selected bacterial transporters (mdcF, S ⁇ Q ID NO.: 7; livM, S ⁇ Q ID NO.: 8; arsB, S ⁇ Q ID NO: 9; and sbmA, S ⁇ Q ID NO.: 10). Identical residues are boxed.
  • Figure 5 is the nucleotide sequence of EIRl genomic DNA (S ⁇ Q ID NO.: 11), including the promoter.
  • Figure 6 is the nucleotide sequence of EIRl cDNA (S ⁇ Q ID NO.: 12) (GenBank accession number AF056026).
  • Figure 7 is the amino acid sequence of ⁇ IRI protein (S ⁇ Q ID NO.: 1).
  • Figure 8 is the nucleotide sequence of the rice homologue (REHl) cDNA (S ⁇ Q ID NO.: 13) (GenBank accession number AF056027).
  • Figure 9 is the amino acid sequence of the rice homologue (R ⁇ I) protein (S ⁇ Q ID NO. 2).
  • Figures 10 A and 10 B are graphs demonstrating auxin transport activity in yeast strains gef ⁇ and gefl EIRl. The graphs summarize the amount (in percent) of 14 C-IAA remaining in yeast cell samples taken at different points from cells maintained under various assay conditions. The amount of total radioactivity incorporated by the cells was determined in a sample of cells prior to their introduction into the assay. Bars indicate standard deviations derived from 3 parallel samples. Each experiment was performed at least four times.
  • Figure 10 A shows a lack of auxin transport in gefl cells assayed in the presence of an external carbon source (2% glucose) in the efflux buffer.
  • Figure 10 B shows the results of an assay performed in the absence of an external carbon source; auxin transport under these conditions depends exclusively on the pre- established membrane potential.
  • Fig. 10 B gefl; gefl EIRl
  • Fig. 10 B demonstrates that the expression of EIRl in gefl yeast results in the retention of about 10 to about 20 percent less ,4 C-IAA within the cells.
  • the ge ⁇ + CCCP and gefl EIRl + CCCP 1 data demonstrate that the inclusion of the protonophore CCCP in the efflux buffer eliminates auxin transport activity.
  • Figures 11 A and 11 B are graphs comparing the growth of yeast cells expressing either wild type EIRl or one of three Ser97 negative alleles of EIRl .
  • the conserved amino acid Ser97 of EIRl was replaced with another amino acid residue, thereby producing three mutants: EIR1-S97G; EIR1-S97A and EIR1-S97E.
  • Figure 11 A shows the growth curve of gefl transformed with either EIRl or one of the Ser97 mutants in Synthetic Complete medium (SC) .
  • Figure 1 1 B shows the growth curve of either EIRl or one of the Ser97 mutants in SC supplemented with 200 ⁇ M 5-fluoro- indole.
  • EIRl a plant gene whose function is required for gravitropism. Genetic and physiological analyses of the EIRl gene and eirl mutants (eirl-1 , w ⁇ v6-52 and eirl -3) support a role for EIRl involvement in root-specific auxin transport (efflux). Furthermore, the data provided herein indicate that EIRl protein, which functions as a root-specific auxin efflux carrier, is a target for the regulation of auxin transport.
  • the present invention relates to an isolated root-specific protein involved in auxin transport, isolated nucleic acid (e.g., DNA, RNA), for example, DNA encoding the protein, mutants of the DNA and altered forms of the encoded root-specific protein, and uses for the proteins and encoding DNA.
  • isolated nucleic acid e.g., DNA, RNA
  • root-specific DNA designated EIRl and modified EIRl nucleic acids have been isolated and characterized.
  • the EIRl protein is required for gravitropism and is involved in root- specific auxin transport.
  • EIRl protein which functions as an efflux carrier, as a target for regulation of auxin transport by ethylene and synthetic transport inhibitors.
  • Genomic EIRl DNA and EIRl cDNA nucleotide sequences and the encoded EIRl protein (amino acid) sequence are presented, as are the nucleotide sequence and amino acid sequences of a rice homologue, designated REHl ( for: Rice EIRl Homologue) and REHl, respectively.
  • DNA encoding a root-specific protein involved in auxin transport encompasses such DNA from any and all plant types (e.g., mustard plants, corn, rice, wheat and other grains or grasses, other crop plants, flowering plants).
  • Isolated DNA which is the subject of the invention encodes a protein which is involved in root-specific transport, such as EIRl -protein encoding DNA.
  • DNA encoding a protein involved in root-specific auxin transport includes: (a) the sequences presented herein (SEQ ID NOS.: 11-13) and portions of any of those sequences, provided that they encode a functional root-specific auxin transport carrier protein; (b) DNA which, due to degeneracy of the genetic code, encodes EIRl protein of the present invention (e.g., ELRl protein having the amino acid sequence of SEQ ID NOS.: 1, 2, 5 or 6); (c) DNA which hybridizes under high stringency conditions to the complement of any DNA of (a) or (b) and; (d) DNA which is from Arabidopsis or from a plant species other than Arabidopsis which is sufficiently similar in sequence to DNA of (a), (b) or (c) to encode a root-specific protein involved in auxin transport (e.g., as demonstrated by the
  • Homologous DNA can be identified by substantial nucleic acid sequence homology to an EIRl nucleic acid.
  • homologous DNA can be identified based upon overall nucleic acid sequence homology with the EIRl DNA sequence disclosed herein, allowing for the degeneracy of the genetic code and codon bias in different species of plants, and on the requirement that homologous sequences encode a functional root-specific auxin transport (efflux) carrier protein.
  • the overall homology of the nucleotide sequence is preferably greater than about 40%, preferably greater than 60% , still more preferably greater than about 80% and most preferably greater than 90% homologous.
  • the invention also comprises the use of the disclosed nucleic acid sequences, or portions thereof, as probes and primers for the identification and isolation of homologous sequences from other species of plants.
  • DNA of the present invention also includes coding or noncoding DNA which is the complement of any of the DNA of (a) - (d) and portions (or fragments) thereof which are of sufficient length (e.g., at least four to six nucleotides) to hybridize to complementary DNA and remain hybridized (e.g., in order that hybridization can be detected, such as for diagnostic or assay purposes).
  • Such fragments also include those which hybridize to characteristic portions of the DNA of the present invention (e.g., to a characteristic portion of DNA of SEQ ID NOS.: 11, 12 or 13).
  • the complement of DNA encoding a root-specific protein of the present invention is also a subject of this invention.
  • DNA complementary to all or a portion of EIRl protein encoding DNA is the subject of this invention.
  • Such complementary DNA is useful as probes and primers, for example, in hybridization and amplification (e.g., PCR) reactions.
  • modified EIRl nucleic acid refers to a variant EIRl nucleic acid molecule which includes addition, substitution, insertion or deletion of one or more nucleotide(s), thereby producing a modified nucleotide sequence.
  • nucleic acid encompasses DNA (genomic and cDNA), RNA and analogues (e.g., comprising base analogues such as inosine) thereof.
  • modified EIRl nucleic acid can embody either a naturally occurring allelic variant or a synthetically produced sequence.
  • the disclosed naturally occurring (e.g., wild type) nucleic acid isolated from Arabidopsis thaliana can be used as a precursor nucleic acid molecule which can be modified by standard techniques that are well- known to those of skill in the art to produce a synthetic variant. For example, site- directed mutagenesis or cassette-mutagenesis can be used to substitute one or more nucleotides.
  • Promoters and other regulatory sequences e.g., cis acting elements and/or transcriptional enhancers
  • cis acting elements and/or transcriptional enhancers are also the subject of this invention, as are their use in vectors and expression systems designed to direct the tissue-preferential transcription of foreign (e.g., heterologous) genes operably linked thereto, in the roots of plants.
  • the isolate nucleic acid which is the subject of the invention can be obtained from a plant as it occurs in nature, or can be produced by synthetic (e.g., chemical) methods or recombinant methods.
  • mutant genes such as the mutant gene designated eirl -3 which is present in an agravitropic mutation.
  • the isolated root-specific proteins involved in auxin transport and allelic variants thereof which are the subject of the invention include the encoded protein products of the DNA sequences disclosed herein and functional portions and fragments thereof.
  • the invention comprises proteins having the amino acid sequence comprising SEQ ID NOS.: 1 and 2.
  • Plant tissues and seeds characterized by an increased resistance (or tolerance) to the effects of herbicides which are auxin derivatives, auxin analogues, or an herbicidal formulation comprising at least one auxin transport inhibitor applied in combination with at least one additional herbicide, relative to the corresponding wild type plants are also the subject of this invention.
  • herbicides which are auxin derivatives, auxin analogues, or an herbicidal formulation comprising at least one auxin transport inhibitor applied in combination with at least one additional herbicide, relative to the corresponding wild type plants are also the subject of this invention.
  • the invention relates to plants, plant tissues , and seeds which are resistant to growth inhibition by an herbicide (which is an auxin derivative or an auxin analogue), or an herbicidal composition (which includes an auxin, analogue derivative, auxin analogue or auxin transport inhibitor), at concentrations which normally inhibit the growth of those plants, plant tissues or seeds.
  • an herbicide which is an auxin derivative or an auxin analogue
  • an herbicidal composition which includes an auxin, analogue derivative, auxin analogue or auxin transport inhibitor
  • concentrations which normally inhibit the growth of those plants, plant tissues or seeds.
  • the present invention relates to a method of producing a transgenic plant characterized by altered auxin homeostasis. The method comprises introducing DNA encoding a root-specific auxin transport carrier protein into a plant cell under conditions in which the DNA is expressed, thereby producing a transformed plant cell; and producing a transgenic plant from the resulting transformed cell.
  • Transgenic plants can be produced using DNA described herein and methods known to those of skill in the art.
  • DNA encoding a root-specific auxin transport protein can be introduced into plants or plant tissues (e.g., roots) or seeds by transformation (e.g., transfection or transduction) using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, protoplast fusion, electroporation or bombardment (e.g., microprojectile bombardment) with nucleic acid-coated particles.
  • auxin transport inhibitor refers to compounds which act by inhibiting the transmembrane movement (e.g., transport) of auxin which accumulates in cells as a result of polar auxin transport and affects plant growth.
  • auxin transport inhibitors are themselves herbicides. The observation that auxin transport inhibitors are usually highly active herbicides is consistent with this usage.
  • the terms “resistance” and “tolerance” refer to the sensitivity of a plant to the toxic effects of an herbicide, such that a genetically engineered plant, whose genome comprises a nucleotide sequence encoding a root-specific heterologous auxin transport carrier protein is resistant to an herbicide.
  • Genetically engineered plants (transgenic plants) of the present invention include, but are not limited to, vascular plants, including gymnosperms and agronomically important plant crops, such as rice, wheat, barley, rye, corn, soybeans, canola, sunflower, sorghum, sugarcane, fruits (oranges, grapefruit, lemons, limes, apples, pears, melons, plums, cherries, peaches, apricots, strawberries, grapes, raspberries, pineapples, bananas), vegetables (potatoes, carrots, sweet potatoes, beans, peas, lettuce, cabbage, cauliflower, broccoli, turnip, radishes, spinach, onions, garlic, peppers, pumpkins) and angiosperms or flowering plants, both monocots and dicots.
  • vascular plants including gymnosperms and agronomically important plant crops, such as rice, wheat, barley, rye, corn, soybeans, canola, sunflower, sorghum, sugarcane, fruits (o
  • plants with greater resistance are genetically engineered plants whose root cells comprise heterologous DNA which encodes a protein involved in auxin transport (e.g., EIRl DNA, REHl DNA) which is expressed as a functional root- specific auxin transport (e.g., efflux) protein.
  • the corresponding wild type plant differs from the genetically engineered plant in that the wild type plant has not been altered to comprise the heterologous DNA present in the genetically engineered plant.
  • the heterologous DNA which encodes an auxin specific efflux carrier protein is constitutively expressed in a tissue-specific (e.g., root tissue) fashion and the expression trait and resulting phenotype is stably transmitted (sexually and somatically) to progeny cells.
  • the invention comprises transgenic plants, the cells of which comprise heterologous DNA stably integrated into the plant nuclear DNA.
  • the expression of the heterologous DNA encoding an auxin specific efflux carrier is inducible.
  • transgenic plants characterized by an altered auxin homeostasis exhibit a distinctive phenotype, attributed to increased auxin efflux, such as an increased number of lateral or adventitious roots.
  • Such plants may also be further characterized by an increased auxin transport rate relative to the auxin transport rate of a corresponding wild type plant.
  • heterologous DNA means DNA isolated from a source other than the plant, or plant cell, in which it is expressed (e.g., from a source other than the cell into which it is introduced or in which it is present as a result of having been introduced into a precursor cell, such as seeds or plant tissue from which a plant develops or seeds or plant tissue obtained from a genetically engineered plant).
  • the heterologous DNA can be from the same plant type (e.g., Arabidopsis DNA introduced into Arabidopsis) or from a different plant type (e.g., Arabidopsis DNA introduced into corn, wheat, rice or other plant type, rice DNA introduced into corn, wheat or other plant type).
  • Heterologous DNA can be used, for example, to avoid or reduce the silencing or inactivation to which the endogenous gene or its encoded protein (e.g., post-translational modification) can be subjected.
  • auxin transport efflux
  • auxin transport inhibitor in combination with a second herbicide.
  • plants e.g., crop plants, flowering plants, gymnosperms
  • plants which are genetically engineered to include or are produced from seeds, plant tissues, or plant parts which include EIRl or REHl DNA
  • Plant part is meant to include any portion of a plant from which a regenerated plant can be produced. Plants which show increased auxin transport and/or enhanced root tissue growth and/or differentiation (compared to the corresponding wild type plants) resulting from altered auxin homeostasis are also the subject of this invention.
  • the invention also comprises genetically engineered plants comprising a heterologous DNA sequence encoding a root-specific protein involved in auxin transport, wherein the genetically engineered plant exhibits a distinctive phenotype, relative to the phenotype of an isogenic plant which does not comprise a heterologous DNA encoding a protein involved in root-specific auxin transport, attributed to the effects of altered auxin homeostasis.
  • transgenic plants characterized by a phenotype comprising an increased number of lateral or adventitious roots.
  • EIR1-S97G Three alleles, EIR1-S97G, EIR1-S97A and ELR1- S97E, were created and characterized, as described in Example 10. These alleles were expressed in diploid yeast strains, defective for the gefl gene, under the control of the ADH-promoter. The strains were tested in a filter assay carried out with either 5- fluoro-indole or 5-fluoro-indole acetic acid. The strains exhibited a hypersensitivity to these compounds. Also described herein is an assay for assessing agents (compounds and molecules) for their effects on auxin transport.
  • auxin transport is assessed in yeast by measuring transport of detectably labeled (e.g., radiolabeled) auxin.
  • This assay is useful to determine whether an agent inhibits or enhances the activity of ELRl protein and, as a result, inhibits or enhances auxin transport.
  • the auxin transport assay can be used for example to characterize EIRl alleles identified by their ability to confer an altered growth phenotype. For example, one would expect to find an increased auxin transport rate associated with an allele which confers significantly increased resistance of gefl yeast cells to fluoroindolics.
  • the yeast cell-based overexpression model disclosed herein provides a functional assay useful for assessing structure/function relationships in isolated DNA molecules and mutated EIRl sequences encoding auxin transport proteins and their variants.
  • the yeast cell-based overexpression model can be used to identify an allele (mutant) of EIRl which confers altered auxin-mediated responses in a plant.
  • the overexpression assay comprises: introducing a mutated EIRl nucleic acid into yeast cells, thereby producing transformed yeast cells; contacting the transformed yeast cells with a fiuorinated indolic compound under assay conditions which favor the diffusion of the compound into the yeast cells; determining the growth phenotype of the cells; and comparing the growth phenotype of the transformed cells to the growth phenotype of wild type cells, wherein detection of an altered growth phenotype in the transformed cells relative to the growth phenotype of wild type cells is indicative of a nucleic acid which is an allele that results in altered auxin-mediated responses in a plant.
  • the altered growth phenotype observed in the overexpression assay can be either an increased tolerance or an increased sensitivity to concentrations of the fluorinated indolic compounds, relative to the sensitivity of wild type cells. Diploid yeast cells which are defective for the GEF1 gene, and therefore have an altered ion hemostasis are particularly useful for the establishment of an overexpression assay.
  • the overexpression assay is useful, for example, to identify mutant nucleotide sequences, produced by random mutagenesis of wild-type DNA sequences encoding auxin transport proteins which exhibit altered growth phenotypes (either enhanced or decreased sensitivity) to fluorinated indolic compounds.
  • Yeast strains exhibiting altered growth phenotypes comprise mutated DNA sequences which upon introduction into a transgenic plant will alter auxin homestasis and auxin-mediated responses such as growth, morphogenesis (lateral or adventitious root formation) and tropisms (gravitropism).
  • the present invention also comprises transgenic plants comprising mutant EIRl alleles identified in the yeast cell-based overexpression assay. The sequences (nucleotide and amino acid) and topology of EIRl, its homology to several bacterial carrier proteins and its function establish that ELRl functions as a root-specific auxin transport (efflux) carrier protein involved in gravitropism
  • DAG germination
  • Seed stocks for eirl-1 and eto3-l were obtained from the Arabidopsis Biological Resource Center at OSU, Columbus, OH), ctrl-1 was a kind gift from J. Hua at Caltech, Pasadena, CA. agrl-52 was obtained from K. Okada, National Institute for Basic Biology, Okazaki, Japan. PIG4: :GUS was a kind gift from J. Normanly, University of Massachusetts, A herst, MA. Transposon line B222 was obtained from DNA Plant Technology Corporation, Oakland, CA.
  • Genomic DNA was prepared according to a protocol from Quiagen. After grinding the frozen tissue, the resulting powder was incubated at 74°C for 20 minutes in lysis buffer (100 mM Tris/HCl pH 9.5, 1.4 M NaCl, 0.02 M EDTA, 2% CTAB, 1% PEG 8000). After extraction with an equal amount of chloroform, DNA was precipitated with isopropanol. After resuspension in 1 M NaCl and treatment with RNase A, the DNA was loaded onto equilibrated Quiagen columns and purified according to the manufacturer's instructions. DNA extracted from the Ac line B222 and eirl -3 was digested with EcoRl and BcR. The ends of the DNA were made blunt with Klenow fragment.
  • This DNA was religated and used for inverse PCR performed with oligonucleotides CCTCGGGTTCGAAATCG (SEQ ID NO.: 14) and GGGGAAGAACTAATGAAGTGTG (SEQ ID NO.: 15). After 40 cycles of amplification at 60°C annealing temperature, the products were separated on 1% agarose gels. A fragment specific for eirl -3 DNA was cloned into pGEMT (Promega) to give pGsacl and used for Southern hybridization on eirl-3 and wild type DNA. Phage genomic and cDNA libraries of A.
  • thaliana (Kieber, J.J., et al, (1993) Cell 72: 427-441) were probed with pGsacl using standard techniques. (Ausubel, F.M., et al, (1987) Current Protocols in Molecular Biology. John Wiley & Sons, Inc). Genomic clone ⁇ 5-3, which hybridized to pGsacl, was subcloned into pBluescriptll (Stratagene) to give pB5-3. The sequence of an EcoRI fragment approximately 8kb in length was determined on an ABI Automated DNA sequencer.
  • RS-PCR RNA Template-Specific Polymerase Chain Reaction
  • RNA from tissue of sterile grown plants was isolated. (Niyogi, K.K. and G.R. Fink, (1992) Plant Cell 4: 721-33) Vegetative tissue isolated from plants 15 DAG was used. Flower-specific RNA was isolated at approximately 20 DAG and silique-specific RNA at about 25 DAG. polyA + RNA was isolated with the polyATract kit from Promega. About 50 ng of polyA + RNA of each tissue was used for RNA Template-Specific PCR (RS-PCR). RS-PCR with slight modifications was performed as described by (Shuldiner, A.R., et al, (1993) In: Methods in Molecular Biology: PCR Protocols: Current Methods and Applications Human Press Inc. Totowa, NJ).
  • Oligonucleotides GAACATCGATGACCAAGCTTAGGTATCGATAGCCCCACGGAACTCAAA (SEQ ID NO.: 16) (underlined bases are complementary to nucleotides 454 to 470 of the EIRl coding region) and CTTATACGGATATCCTGGCAATTCGGACTTGTTAjQ CTTTAGGGTTAA (SEQ ID NO.: 17 (underlined bases are complementary to nucleotides 335 to 351 of ACT2 coding region) were added to polyA + RNA to a final concentration of 2 ⁇ M in a volume of 10 ⁇ l. The tubes were placed at 65°C for 10 minutes and allowed to cool down to 37°C. First strand cDNA synthesis was performed using Gibco BRL AMV Reverse Transcriptase. Primer pairs
  • GAACATCGATGACC AAGCTTAGGTATCGATA SEQ ID NO.: 18
  • GGCAAAGACATGTACGATGT TTTAGCGG SEQ ID NO.: 19
  • CTTATACGGATATCCTGGCAATTCGGACTT SEQ ID NO.: 20
  • GTCTGTGACAATGGAACTGGAATG SEQ ID NO.: 21
  • eirl-3/eirl-3 plants (eirl -3 still contains the Ac-donor T-DNA-construct conferring hygromycin resistance) were crossed into plants homozygous for either eirl-1 or wav6-52.
  • Heterozygous Fl plants (eirl-3/wav6-52 and eirl -3/eir 1-1) identified as resistant to hygromycin were defective in root gravitropism, giving evidence for the allelism of the three mutants analyzed.
  • F2 plants derived from each of the Fl heterozygotes were all Eirl ⁇ " whereas the hygromycin resistance marker segregated as a single, dominant locus.
  • Double mutants e.g. ein2-l/ein2-l eirl-l/eirl-1) were derived from crosses of homozygous single mutant lines and scored for segregation in the F2 generation of the initial crosses.
  • Double mutant candidates were backcrossed into their two parental single mutant lines and their genotype verified by complementation with parental testers.
  • eirl-1 alfl-1 double mutants we used eirl-l/eirl-1 plants for pollination of alfl-1 VALF1 heterozygotes.
  • F2 seeds were scored for segregation of Eirl ⁇ and Alfl _ phenotypes.
  • the double mutant was verified by segregation of the aerial Alfl _ phenotype in Eirl F3 plants derived from the initial cross.
  • Yeast strains transformed with pAD-EI and pAD4M were grown to an O.D. 600 of 0.8 to 0.9.
  • Cells were pelleted and an aliquot corresponding to 15ml starting culture was washed in lOmM Na Citrate buffer pH 4.5.
  • the pellet was resuspended in 1ml of lOmM Na Citrate (pH 4.5) supplemented with lmM IAA (final concentration) and 2.5 micro Ci 14 C-IAA
  • the cells were allowed to incorporate the tracer for 10 or 20 minutes. The cells were subsequently washed on MF-filters (Millipore) on a multifiltration unit, and resuspended in Synthetic Complete (SC)-medium adjusted to pH 4.0 with HC1. Aliquots of the suspension were dropped onto MF-filters and washed twice with SC- medium
  • Filter Paper #740 After they dried, the filters were transferred onto the yeast plates, which then were incubated at 25%C in the dark for two to five days. After that, yeast growth was monitored and documented.
  • EIRl For expression of EIRl in S cerevisiae the insert of pBc5-2 was cloned into pAD4M (described in Ballester et al, (1989) Cell, 59: 681-686) to give pAD-El.
  • a frameshift mutation in EIRl was obtained by filling in the internal HindHI site resulting in a nonsense mutation after codon 178 (plasmid pADEl-H).
  • pAD4M described in Ballester et al, (1989) Cell, 59: 681-686
  • GGGTCTAGAGTCGACGCA CTGAGCAGCGTAAT (SEQ IDNO.: 24) forPCR amplification of a fragment encoding 3 copies of the HA-epitope.
  • the PCR product was ligated into pAD-El resulting in pAD-EIHA coding for a protein with the 3xHA-tag fused to the authentic C-terminus of EIRl .
  • Immunostaining of the tagged protein in haploid and diploid cells was performed as described by Gaxiola, R.A., et al, (1998) Proc. Natl Acad. Sci. USA 95: 4046-4050. Cells were viewed by using charge-coupled device microscopy and sectioned by using SCANALYTICS (Billerica, MA).
  • EXAMPLE 1 Isolation and phenotypic characterization of eirl -3
  • An agravitropic mutant e.g., a plant whose roots do not respond to gravistimulation
  • This agravitropism segregated as if it resulted from a mutation in a single gene.
  • a comparison of DNA isolated from the mutant transposon-tagged line B222-24 with the untransposed parental line B222 on Southern blots revealed that the mutant contained an additional copy of the transposon. This extra Ac element cosegregated with the mutant phenotype, suggesting that the mutation, designated eirl -3 was caused by the insertion of the transposon element.
  • This agravitropic mutation, eirl -3 is allelic to two previously described mutations, wav6-52 (allelic with agrl), which was isolated as an agravitrophic mutant (Bell, C.J. and P.E. Maher, (1990) Mol. Gen. Genet. 220:289-293) and eirl-1 , which was isolated as an ethylene insensitive mutant (Roman, G., et al, (1995) Genetics. 139: 1393-1409).
  • the new mutation, eirl-3 fails to complement wav6-52, and eirl-1 showing that all three are alleles of EIRl.
  • eirl mutant roots do not respond to gravity when germinated and grown on agar plates oriented vertically. Instead, eirl roots grow in random directions, whereas EIRl roots grow downward. If the seedlings are reoriented so that the roots are now parallel to the surface of the earth, after 24 hours, the roots of wild type reorient downward (roughly 90%), whereas roots of eirl fail to reorient their growth.
  • Root growth of eirl mutant plants is less sensitive to ethylene than that of the wild type, suggesting an involvement of ethylene in the regulation of root tropic responses, eirl roots have a phenotype that is similar to EIRl roots grown in the presence of NPA and TLB A, inhibitors of auxin transport that block cell elongation (Sussman, M.R. and M.H.M. Goldsmith, (1981) Planta 152: 13-18). Moreover, eirl root elongation was much more resistant than EIRl to NPA and TLBA ( Figures 1 A - IC). By contrast, these auxin transport inhibitors inhibit lateral root formation to the same extent in both wild type and eirl mutants.
  • eirl root growth is more resistant than wild type to 1-aminocyclopropane-l-carboxylic acid (ACC), the immediate biosynthetic precursor of the growth regulator ethylene ( Figure 1A).
  • ACC 1-aminocyclopropane-l-carboxylic acid
  • Figure 1A the immediate biosynthetic precursor of the growth regulator ethylene
  • the root growth inhibition of eirl mutants is no different from EIRl with respect to other growth regulators (abscissic acid, gibberellic acid, kinetin), the auxin-analogue NAA (-napthaleneacetic acid) ( Figure IC), and 2,4-D (2,4-dichloro- phenoxyacetic acid).
  • the etW mutants have longer roots than wild type plants (Table 1), which could be due to an increased rate of cell division and/or to greater elongation of individual root cells.
  • Direct measurement showed that eirl-3 root cells were longer than wild type cells (Table 1). However, it is possible that increased cell division contributes to the increased length as well.
  • Root lengths are indicated in mm, cell length in ⁇ m.
  • the eirl-3 allele was cloned using an inverse Polymerase Chain Reaction (PCR) approach.
  • PCR inverse Polymerase Chain Reaction
  • a 600 bp fragment amplified from eirl-3 DNA hybridized to the additional band caused by the Ac transposon element insert in eirl-3.
  • This subcloned fragment was used to screen an A. thaliana genomic phage library.
  • Three genomic clones of the putative EIRl gene ( ⁇ 5-3, ⁇ 6-l and ⁇ 6-3) had the same restriction pattern.
  • the subcloned insert of ⁇ 5-3 was used for screening cDNA libraries. Eight hybridizing phage clones were isolated from approximately 5xl0 5 plaques screened. These clones all show similar restriction patterns.
  • the Ac insertion in eirl-3 is located after codon 113 in exon 2 ( Figure 2).
  • the insertion is flanked by a perfect 8 bp direct repeat and probably results in a null allele of the affected gene.
  • Results showed that eirl-1 (as compared with the progenitor Columbia wild type) contains a transition mutation at the intron 5/exon 6 border that replaces the absolutely conserved G at splice position -1. (Brown, J.W.S., (1996) Plant J. 10: 111-180)
  • the eirl-1 mutation presumably results in a truncated ELRl protein that would lack a conserved portion of the molecule ( Figure 2).
  • eirl-1 was transformed with the putative EIRl ORF and more than 2kb of upstream sequences. All five independent hygromycin-resistant transformants of eirl-1 tested had a root growth phenotype typical of wild type. Therefore, the defects of the eirl-1 mutant were complemented by the genomic fragment. No other large ORFs were present on the genomic fragment used in the transformation. Therefore, the open reading frame has been designated as the coding region of EIRl.
  • EIRl The amino acid sequence of EIRl is consistent with a role for this protein in transport of IAA.
  • ELRl is predicted to be an integral membrane protein. The presence of potential N-glycosylation sites and a potential N-terminal signal peptide indicates localization in the plasma membrane.
  • EIRl also has similarities to several membrane proteins involved in translocation of a variety of different substances across the plasma membrane.
  • the transporters related to ELRl are diverse in their substrate specificity and translocate amino acids, heavy metals, antibiotics, and dicarboxylic acids. Perhaps the most compelling evidence that EIRl plays a role in transport is that expression of EIRl in S. cerevisiae confers increased resistance to fluorinated analogues of indolic compounds.
  • the resistance phenotypes are strongest in the gefl mutant, which has increased sensitivity to various compounds probably as a result of altered ion homeostasis (Gaxiola, R.A., et al, (1998) Proc. Natl Acad. Sci. USA 95: 4046-4050). Resistance to these indoles is completely dependent upon a functional EIRl gene product as neither ClC-0 nor a mutated version of EIRl were capable of restoring yeast growth in the presence of fluorinated indolic compounds.
  • the EIRl protein could prevent the inhibition of yeast by these compounds either by preventing their uptake or facilitating their efflux from the cytosol.
  • the preferential localization of ELRl in the plasma membrane of yeast is consistent with either of these mechanisms.
  • EXAMPLE 3 EIRl, a Highly conserveed Plant Gene Family with Similarities to Bacterial Transporters
  • EIRl belongs to a highly conserved gene family. Arabidopsis has several genes with considerable homology to EIR. In addition to several Arabidopsis ESTs (Genbank accession numbers: T04468, T43636, R84151, and Z38079), similar ORFs were found in database entries of the Arabidopsis Genome Initiative. Two close relatives dubbed AEH1 and AEH2 (for Arabidopsis EIRl Homologue) were located on clones T26J12 and MKQ4 on chromosome 1 and 5 respectively. These relatives probably account for the extra restriction fragments that hybridize to the ELRl probe under conditions of high stringency.
  • the transmembrane domains are located in the highly conserved portions of the proteins — 5 at the N-terminus and 5 at the C- terminus ( Figure 4).
  • the internal segments of the protein though less conserved in sequence than the putative membrane spanning domains, exhibits a number of similarities.
  • the central hydrophilic segments have a remarkably high content of serine and proline.
  • EIRl possesses a number of potential N-glycosylation sites, two of which are also found in REHl and AEHl ( Figure 3).
  • EIRl has no ER-retention signal but does have a potential N-terminal signal peptide (von Heijne, G., (1986) Nucleic Acids Res.14:
  • the open reading frame (ORF) of the EIRl cDNA (SEQ ID NO.: 12) comprises nucleotides 19-1962 ( Figure 6); the ORF of the REHl cDNA (SEQ LD NO.: 13) comprises nucleotides 158-1945 ( Figure 8).
  • the two hydrophobic portions of EIRl show restricted similarity to a number of bacterial membrane proteins ( Figure 4).
  • the mdcF (U95087) protein is a potential malonate transporter from Klebsiella pneumoniae (Hoenke, S. ⁇ t al, (1997) Eur. J. Biochem.
  • E.coli arsB (P37310) represents a part of the arsenic efflux system.
  • sbmA (X54153)
  • X54153 another integral membrane protein of E. coli, has been shown to be necessary for uptake of the antibiotic Microcin 25
  • EIRl is a membrane protein with a related function.
  • EIRl might be a gene involved in regulation of ethylene responses specific to the root.
  • the response of the entire eirl mutant plant to endogenous ethylene was examined by constructing double mutants of eirl with eto3 and ctrl.
  • eto3 causes overproduction of ethylene, giving rise to the typical triple response (the hypocotyl of plants germinated in the dark remains short, undergoes radial swelling and apical hook formation is exaggerated).
  • the double mutants eirl-3/eto3-l and eirl -3/ctr 1-1 were germinated both in the dark and under constant illumination. Dark germinated plants still undergo the triple response, indicating that the eirl mutation has no influence on germination and early development of the aerial parts of the seedling . However, the inhibition of root elongation caused by eto3 and Ctrl mutations is considerably reduced in the double mutants.
  • the simplest model to explain the phenotypes of the eirl mutant is that EIRl is required for efflux of auxin from the cells of the root tip into the elongation zone. If the root is oriented so that there is an increase in the auxin concentration on one side of the root tip, then ELRl would pump auxin into the adjacent elongation zone with the concomitant inhibition of cell elongation. In eirl mutants the increased auxin in the lower portion of the root tip would fail to be transported into the elongation zone, and there would be no differential elongation. The predicted phenotypes of such a defect agree with those observed for an eirl mutation. The root should be agravitropic, and longer overall than an EIRl root.
  • RNA-specific-PCR was used to analyze EIRl expression in the plant.
  • Primers located on the 5' end of the EIRl -cDN A were used to amplify transcripts from reverse transcribed poly-A + RNA derived from roots, leaves, stems, flowers, and siliques.
  • Primers for first strand cDNA synthesis were chimeric, having a 5' extension with no complementary sequences in the Arabidopsis genome. This sequence extension was used for subsequent PCR to avoid contamination.
  • Genomic DNA from ecotype Col-O served as a negative control. Results revealed a specific RS-PCR product in the root, but not in any other tissues.
  • the root-specificity of EIRl -expression correlates well with the root-specific alterations detected in eirl mutants, suggesting that these defects are likely to be a consequence of the absence of EIRl function in the roots.
  • EIRl Function is Required for Auxin Homeostasis in Root Cells
  • the involvement of EIRl in root-specific auxin distribution was tested by analysis of the expression pattern of an auxin inducible gene, AtIAA2.
  • the expression of AtIAA2 has been shown to be strongly induced within a few minutes after exposure to auxin (Abel, S., et al, (1996) BioEssays. 18: 647-654)
  • the AtIAA2 expression pattern was visualized using a reporter construct, PIG4::GUS, a fransgene expressing ⁇ -glucuronidase under control of the AtIAA2-promoter. AttIAA2 expression is strongest in the root meristem in wild type and eirl-3.
  • AtIAA2 When wild type is gravistimulated, expression of AtIAA2 extends into the elongation and differentiation zone. Moreover, the expression is asymmetric with the lower portion of the elongation zone showing more intense staining than the upper. This asymmetric staining suggests that the lower portion of the elongation zone has elevated auxin levels as compared with the upper level. By contrast, reporter expression in eirl-3 does not respond to the gravistimulus and remains restricted to the root tip.
  • the eirl root is known to be less sensitive to ethylene and to have an increased resistance to synthetic auxin transport inhibitors. These phenotypes could be explained if ethylene, like auxin transport inhibitors, interferes with tissue distribution of auxin.
  • the effect of exogenous auxin on PIG4:: GUS was assessed. Expression of AtIAA2 has been shown to be strongly induced within a few minutes after exposure to auxin (Abel, S., et al, (1995). J Mol Biol. 251: 533-49). In plants grown on regular medium, GUS staining is found in the root meristem and in the stele proximal to the root meristem.
  • NAA an auxin analogue
  • Plants (wild type and mutant) with the reporter responded quite differently to growth in ACC (the immediate biosynthetic precursor of ethylene) (1 ⁇ M ACC for 24 hours).
  • ACC the immediate biosynthetic precursor of ethylene
  • the entire elongation and differentiation zone shows considerable GUS staining upon ACC treatment.
  • expression of GUS in the cell division zone appeared to be enhanced.
  • eirl-3 mutant plant roots grown in ACC shows virtually no response in these tissues. Expression is restricted to the root tip at an intensity similar to that of plants grown in the absence ofACC.
  • auxin transport inhibitor TIBA The results with the auxin transport inhibitor TIBA are similar to those obtained with exogenous ACC.
  • the reporter construct is induced in wild type but the mutant has a very reduced response.
  • auxin is the only known endogenous inducer of AtIAA2 (Abel, S., et al, (1996) BioEssays. 18: 647-654)
  • ectopic expression of AtIAA2 in wild-type roots treated with auxin transport inhibitors should be a consequence of elevated auxin concentrations in those cells that express the reporter.
  • Unaltered AtIAA2 expression in TIBA- and ACC-treated eirl-3 roots suggests that auxin concentrations in cells of the root elongation zone remain unaffected when treated with these compounds.
  • the expression pattern of the auxin-inducible AtIAA2::GUS fusion in eirl-3 is consistent with a block in auxin transport in the roots of this mutant.
  • this reporter is expressed in root tips and at a low level in the younger parts of the vascular tissue. Wild type plants in the presence of ethylene, show increased expression of the reporter in the elongation zone, suggesting that these cells have an increased level of IAA.
  • auxin-inducible reporter upon gravistimulation supports and extends these results.
  • the auxin reporter is expressed asymmetrically, with more intense GUS-staining localized to the lower side of the elongation zone.
  • This distribution is consistent with a model that proposes an inhibitory role for auxin in the regulation of root cell elongation and differential inhibition as the basis for gravitropism. Consistent with this interpretation, the agravitropic eirl-3 mutant grown under the same conditions fails to show differential staining or induction of the reporter in the elongation zone.
  • the failure of cells in the elongation zone of eirl roots to respond to IAA could be a consequence either of a failure to synthesize or to redistribute this growth regulator in response to ethylene.
  • the effect of the eirl mutation on the root phenotype of the alfl mutant supports the redistribution hypothesis.
  • the alfl mutation results in an approximately ten-fold increase in the endogenous concentration of IAA (Boerjan, W., et al, (1995) Plant Cell. 7: 1405-1419).
  • the high auxin level enhances the formation of lateral and adventitious roots but, also inhibits root elongation.
  • eto3 and ctrl are also suppressed by eirl.
  • the entire plant exhibits a strong ethylene response.
  • eto3 causes ethylene overproduction
  • ctrl is probably a negative regulator of the ethylene response because ctrl strains act as if they were in the presence of high ethylene although they do not have elevated ethylene concentrations (Kieber, J.J., et al, (1993) Cell. 72: 427-441).
  • the eirl mutant partially suppresses the ctrl phenotypes suggesting that EIRl acts either downstream of ETO3 and CTRl or in a pathway parallel to that in which ETO3 and CTRl function (Roman, G., et al, (1995) Genetics. 139: 1393-1409).
  • the decreased sensitivity of the eirl root to the inhibitory effects of ethylene as well as to the synthetic auxin transport inhibitors TIBA and NPA suggests a connection between auxin and ethylene. This behavior is similar to that of the HOOKLESS1 (HLSl), mutants of Arabidopsis (Lehman, A., et al, (1996) Cell. 85: 183-94).
  • HLSl is thought to control bending in the apical tip of the hypocotyl because hlsl mutants fail to form the apical hook during germination.
  • Expression of the HLSl gene and enhanced hook formation are induced by treatment of plants with ethylene, which causes differential cell elongation.
  • wild type seedlings grown in the presence of NPA have the same effect on apical hook formation and tissue distribution of auxin-induced genes as does the hlsl mutant.
  • auxin transport inhibitors phenocopy the hlsl mutant, which is defective in the response of the apical hook to ethylene.
  • an ethylene response gene may control differential cell growth by regulating auxin activity or distribution.
  • the growth characteristics of the eirl mutants also suggest a connection between auxin and ethylene.
  • the eirl mutant root like the apical hook of the hlsl mutant is less sensitive to both exogenous and endogenous ethylene. Growth of wild type in the presence of auxin transport inhibitors blocks apical hook formation and the negative gravitropic response of the root.
  • the eirl roots are resistant to auxin transport inhibitors. In fact, this cross-resistance to both ethylene and auxin transport inhibitors is characteristic of mutants defective for auxin and ethylene responses (Fujita, H. and K. Syono, (1996) Plant Cell Physiol. 37: 1094- 1101). This phenomenon probably represents an underlying mechanistic connection between the ethylene response and the auxin response, which is not yet understood.
  • EXAMPLE 7 eirl Blocks the Inhibition of Root Growth Caused by High Endogenous Levels of
  • EIRl is responsible for the redistribution of endogenous auxin
  • the eirl mutation should block the defects in strains producing high levels of auxin.
  • the effect of endogenous auxin was examined in eirl-1 alfl-1 double mutants.
  • the alfl mutation results in an enormously increased concentration of internal auxin, which leads to severe morphological alterations, which include the development of numerous short adventitious and lateral roots (Celenza, J.L., et al, (1995) Genes Dev. 9: 2131-2142; Boerjan, W. et al, (1995) Plant Cell 7: 1405-1419).
  • the short root phenotype is caused by inhibition of cell elongation.
  • the eirl-1 mutation completely suppresses the short root phenotype caused by alfl-1, and retains the agravitropic phenotype, whereas the aerial portion of the eirl alfl double mutant resembles alfl.
  • auxin in Saccharomyces cerevisiae Expressing EIRl
  • relatively acidic assay conditions e.g., pH 4.0
  • IAAAH dissociates and efflux of IAA-depends on anion transporters.
  • yeast can maintain its intracellular (higher) pH for at least 30 minutes. This pH gradient is sufficient for EIRl -mediated 14 C-LAA transport as shown by the gefl and gefl EIRl data ( Figure 10B).
  • Data resulting from the same experiment performed in the presence of the presence of the plasma-membrane specific protonophore CCCP demonstrates that under these under these conditions all differences in axuin transport activity between the EIRl -expressing and the control strain are gone (gefl+CCCP; gefl EIRl+CCCP ( Figure 10B)).
  • Adding CCCP causes uptake of protons from the more acidic extracellular space into the cells. As a result the intracellular pH drops which gives rise to a protonation of IAA- .
  • IAAH in turn can diffuse across the plasma membrane following a concentration gradient.
  • yeast strains that overexpress a plasmid borne Arabidopsis EIRl gene under the control of the ADH1 promoter were analyzed.
  • Wild type yeast strains are only slightly sensitive to fluorinated indolic compounds such as 5-DL- fluoro-tryptophan or 5-fluoro-indole, toxic analogues of potential precursors of IAA (Bartel, B., (1997) Plant Mol. Biol. 48: 51-66).
  • strains, which carry the Agefl deletion (a mutant which alters ion homeostasis in yeast (Gaxiola, R.A., et al, (1998) Proc. Natl Acad. Sci.
  • EIRl gene is required for this resistance because yeast strains containing a mutant form of the EIRl gene (a frameshift in the EIRl OF, plasmid pADEl-H) fail to show the increased resistance to fluoro-indoles. Moreover, this resistance is specific to these indolic compounds because strains carrying the EIRl gene are no more resistant than controls to fluconazole, another inhibitor of yeast growth. In addition, the increased resistance is not simply the consequence of expression of a foreign transporter in yeast. Expression of the Torpedo marmorata chloride channel (ClC-0), which suppresses many of the gefl defects, failed to confer increased resistance to indolic compounds.
  • ClC-0 Torpedo marmorata chloride channel
  • hemagglutinin (HA) epitope-tagged version of EIRl was introduced into S cerevisiae.
  • Examination of immunodecorated yeast cells using charge-coupled microscopy localized the most intense staining of EIRl to the plasma membrane. This membrane localization is consistent with a role for EIRl in excluding compounds from the cell and, thereby, preventing the toxicity of the indolic compounds.
  • EXAMPLE 10 Creation and Characterization of EIRl Alleles Site-specific mutagenesis was performed in order to replace the conserved residue Ser97 of EIRl with other amino acids. Three alleles were made: EIR1- S97G, EIR1-S97A and ELR1-S97E. Table 2 shows a comparison of the nucleotide and the deduced amino acid sequence of EIRl and the three negative alleles proximal to Serine 97. The affected amino acid residue is typed in bold letters, alterations in the nucleotide sequence are indicated as lower case letters. Mutations were introduced by site-directed mutagenesis. No other alterations in the nucleotide sequences could be detected.
  • a possible consequence of protein retention within the cell would be an increased concentration of the toxic, indolic compounds which, in turn, would explain the hypersensitivity of yeast strains, expressing the negative alleles. Increased intracellular concentrations of these compounds could be mediated by either binding of Flouroindolic to the mutant EIRl -protein or by increased uptake of the toxins into the vesicle-like structures.
  • the growth delay caused by a replacement of Serine 97 does not interfere with yeast growth in the absence of Flouroindolic.
  • the Growth curves of gefl strains transformed with either EIRl or one of the Ser97 mutants in Synthetic Complete medium (SC) ( Figure 11 A) or SC supplemented with 200 ⁇ M 5-fluoro- indole ( Figure 1 IB) indicates that although growth in unsupplemented medium is not affected by the mutations; growth in the presence of 5-fluoro-indole is severely reduced in all three mutant strains.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Cell Biology (AREA)
  • Endocrinology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un gène végétal spécifique aux racines qui code une protéine vectrice pour le transport de l'auxine, laquelle est indispensable pour le géotropisme. L'invention concerne également une protéine vectrice de flux pour le transport de l'auxine, des plantes obtenues par génie génétique dont les génomes renferment de l'ADN hétérologue codant une protéine vectrice de flux d'auxine spécifique aux racines, ou de l'ADN hétérologue codant une partie suffisante de ladite protéine pour coder une protéine vectrice fonctionnelle et pour conférer un phénotype caractérisé par une sensibilité diminuée vis-à-vis d'un herbicide qui est un dérivé d'auxine, un analogue d'auxine ou une formulation comprenant un inhibiteur de transport d'auxine en combinaison avec un second herbicide. L'invention concerne en outre des procédés utiles pour identifier les cibles moléculaires intervenant dans la transduction des signaux du géotropisme, pour évaluer les effets d'agents sur le transport de l'auxine, et pour déterminer le rôle de l'expression génique et du mécanisme moléculaire du transport de l'auxine polaire.
PCT/US1999/012277 1998-06-03 1999-06-03 Proteine specifique aux racines intervenant dans le transport de l'auxine WO1999063092A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US8778998P 1998-06-03 1998-06-03
US60/087,789 1998-06-03

Publications (2)

Publication Number Publication Date
WO1999063092A1 true WO1999063092A1 (fr) 1999-12-09
WO1999063092A9 WO1999063092A9 (fr) 2000-04-06

Family

ID=22207278

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/012277 WO1999063092A1 (fr) 1998-06-03 1999-06-03 Proteine specifique aux racines intervenant dans le transport de l'auxine

Country Status (1)

Country Link
WO (1) WO1999063092A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007011771A2 (fr) * 2005-07-19 2007-01-25 Basf Plant Science Gmbh Augmentation du rendement dans des plantes surexprimant les genes mtp
US7422901B2 (en) 1999-05-07 2008-09-09 E.I. Du Pont De Nemours And Company Auxin transport proteins
US10947555B2 (en) 2004-04-30 2021-03-16 Dow Agrosciences Llc Herbicide resistance genes
US11371055B2 (en) 2005-10-28 2022-06-28 Corteva Agriscience Llc Herbicide resistance genes

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997049810A1 (fr) * 1996-06-21 1997-12-31 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Controle genetique du transport polaire de l'auxine dans les plantes et manipulation de la croissance, l'architecture et la morphogenese des plantes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997049810A1 (fr) * 1996-06-21 1997-12-31 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Controle genetique du transport polaire de l'auxine dans les plantes et manipulation de la croissance, l'architecture et la morphogenese des plantes

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LUSCHNIG C ET AL.: "EIR1, a root-specific protein involved in auxin transport, is required for gravitropism in Arabidopsis thaliana", GENES AND DEVELOPMENT, vol. 12, no. 14, 15 July 1998 (1998-07-15), pages 2175 - 2187, XP002116368 *
MÜLLER A ET AL.: "AtPIN2 defines a locus of Arabidopsis for root gravitropism control", EMBO JOURNAL, vol. 17, no. 23, 1 December 1998 (1998-12-01), pages 6903 - 6911, XP002116369 *
ROMAN G ET AL.: "Genetic Analysis of Ethylene Signal Transduction in Arabidopsis thaliana: Five Novel Mutant Loci Integrated into a Stress REsponse Pathway", GENETICS, vol. 139, no. 3, March 1995 (1995-03-01), pages 1393 - 1409, XP002116371 *
UTSUNO K ET AL.: "AGR, an Agravitropic locus of Arabidopsis thaliana, Encodes a Novel Membrane-Protein Family Member", PLANT AND CELL PHYSIOLOGY, vol. 39, no. 10, October 1998 (1998-10-01), pages 1111 - 1118, XP002116370 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7422901B2 (en) 1999-05-07 2008-09-09 E.I. Du Pont De Nemours And Company Auxin transport proteins
EP2055779A2 (fr) 1999-05-07 2009-05-06 E.I. Dupont De Nemours And Company Protéines de transport d'auxine
EP2055779A3 (fr) * 1999-05-07 2009-08-12 E.I. Dupont De Nemours And Company Protéines de transport d'auxine
US7638681B2 (en) 1999-05-07 2009-12-29 E.I. Du Pont De Nemours And Company Auxin transport proteins
US7943753B2 (en) 1999-05-07 2011-05-17 E. I. Du Pont De Nemours And Company Auxin transport proteins
US10947555B2 (en) 2004-04-30 2021-03-16 Dow Agrosciences Llc Herbicide resistance genes
US11149283B2 (en) 2004-04-30 2021-10-19 Dow Agrosciences Llc Herbicide resistance genes
US11299745B1 (en) 2004-04-30 2022-04-12 Dow Agrosciences Llc Herbicide resistance genes
WO2007011771A2 (fr) * 2005-07-19 2007-01-25 Basf Plant Science Gmbh Augmentation du rendement dans des plantes surexprimant les genes mtp
WO2007011771A3 (fr) * 2005-07-19 2007-07-12 Basf Plant Science Gmbh Augmentation du rendement dans des plantes surexprimant les genes mtp
US11371055B2 (en) 2005-10-28 2022-06-28 Corteva Agriscience Llc Herbicide resistance genes

Also Published As

Publication number Publication date
WO1999063092A9 (fr) 2000-04-06

Similar Documents

Publication Publication Date Title
Luschnig et al. EIR1, a root-specific protein involved in auxin transport, is required for gravitropism inArabidopsis thaliana
US7220587B2 (en) Ethylene insensitive plants
Lehman et al. HOOKLESS1, an ethylene response gene, is required for differential cell elongation in the Arabidopsis hypocotyl
Chalfun-Junior et al. ASYMMETRIC LEAVES2-LIKE1 gene, a member of the AS2/LOB family, controls proximal–distal patterning in Arabidopsis petals
EP3018217B1 (fr) Gène restaurateur rf4 de type c de stérilité masculine cytoplasmique de maïs, marqueurs moléculaires et leur utilisation
PL202462B1 (pl) Wyizolowany kwas nukleinowy do modyfikacji cech roślin przy użyciu genu wernalizacji VRN2, para starterów, sposób wytwarzania kwasu nukleinowego, sposób identyfikowania, klonowania lub określania obecności w genetycznie zmienionej roślinie kwasu nukleinowego, sposób selekcjonowania rośliny posiadającej żądany allel genu VRN2, zrekombinowany wektor, komórka gospodarza, sposób transformowania komórki gospodarza, sposób wytwarzania rośliny transgenicznej, roślina transgeniczna, część lub rozmnóżka rośliny, wyizolowany polipeptyd, sposób wytwarzania polipe
Niu et al. LOOSE FLOWER, a WUSCHEL‐like Homeobox gene, is required for lateral fusion of floral organs in Medicago truncatula
US20070094744A1 (en) A novel stay-green gene and method for preparing stay-green transgenic plants
WO1997035986A1 (fr) Molecules d'acides nucleiques codant pour des proteines de type cytochromes p450 intervenant dans la synthese des brassinosteroides
US20070101457A1 (en) Methods of controlling reproduction in plants
JP2002534128A (ja) 除草剤のターゲットとなる遺伝子とその遺伝子をターゲットとする方法
Lelandais‐Brière et al. Disruption of AtOCT1, an organic cation transporter gene, affects root development and carnitine‐related responses in Arabidopsis
EP3060665A1 (fr) Végétaux modifiés
Jang Functional characterization of PhapLEAFY, a FLORICAULA/LEAFY ortholog in Phalaenopsis aphrodite
US6921848B2 (en) Genes involved in brassinosteroid hormone action in plants
Li et al. Molecular and genetic characterization of a self-compatible apple cultivar,‘CAU-1’
US10487337B2 (en) Methods for monocot plant improvement
CN110241130B (zh) 控制植物粒数和粒重的gsn1基因、编码蛋白及其应用
WO1999063092A1 (fr) Proteine specifique aux racines intervenant dans le transport de l'auxine
KR20000006260A (ko) 식물을왜성화시키는방법
CN113151323A (zh) 一种控制玉米籽粒发育基因ZmRH4的克隆、功能研究及标记挖掘
JP2002521005A (ja) エチレンシグナル伝達経路における銅トランスポーター
CN111533807A (zh) AET1-RACK1A-eIF3h复合物在植物环境温度适应性中的应用
US20090025100A1 (en) DWF12 and Mutants Thereof
Nguyen Functional characterization and analysis of Carica papaya SHORT VEGETATIVE PHASE (CpSVP)

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: C2

Designated state(s): CA JP

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

COP Corrected version of pamphlet

Free format text: PAGES 1/11-11/11, DRAWINGS, REPLACED BY NEW PAGES 1/15-15/15; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

122 Ep: pct application non-entry in european phase