WO1999061606A1 - RECEPTEURS MAMMALIENS gb2 ET GABA¿B? - Google Patents

RECEPTEURS MAMMALIENS gb2 ET GABA¿B? Download PDF

Info

Publication number
WO1999061606A1
WO1999061606A1 PCT/US1999/011869 US9911869W WO9961606A1 WO 1999061606 A1 WO1999061606 A1 WO 1999061606A1 US 9911869 W US9911869 W US 9911869W WO 9961606 A1 WO9961606 A1 WO 9961606A1
Authority
WO
WIPO (PCT)
Prior art keywords
receptor
gaba
mammalian
cell
leu
Prior art date
Application number
PCT/US1999/011869
Other languages
English (en)
Inventor
Janet Clark
Thomas I. Bonner
Original Assignee
The Government Of The United States As Represented By The Secretary, Department Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Government Of The United States As Represented By The Secretary, Department Of Health And Human Services filed Critical The Government Of The United States As Represented By The Secretary, Department Of Health And Human Services
Priority to AU43191/99A priority Critical patent/AU4319199A/en
Publication of WO1999061606A1 publication Critical patent/WO1999061606A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70571—Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/94—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving narcotics or drugs or pharmaceuticals, neurotransmitters or associated receptors
    • G01N33/9406—Neurotransmitters
    • G01N33/9426—GABA, i.e. gamma-amino-butyrate
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • the present invention relates to a new subtype of mammalian GABA B receptor. This subtype has been designated gb2 GABA B .
  • the present invention relates to nucleic acids (DNA) encoding gb2 GABA B .
  • DNA nucleic acids
  • vectors and host expression systems containing these nucleic acids to isolated and recombinantly- produced antigens encoded by these nucleic acids, and to antibodies produced against these antigens.
  • GABA ⁇ -aminobutyric acid or 4-aminobutanoic acid
  • GABAergic inhibitory synaptic transmission is mediated by two distinct types of receptors, ligand-gated chloride channels and G-protein-coupled receptors.
  • the multi-subunit GABA ⁇ receptors constitute the ligand-gated channels that when activated allow the passage of chloride ions into the cell resulting in hyperpolarization and cessation of neurotransmission.
  • GABA B receptors which are abundantly and heterogeneously distributed throughout the central nervous system, are members of the G-protein-coupled receptor superfamily and mediate a variety of inhibitory cellular processes through pertussis toxin-sensitive G-proteins G 0 and/or G,.
  • the G-proteins i.e., guanine nucleotide binding proteins
  • GABA B receptors Activation of GABA B receptors has been shown to reduce evoked neurotransmitter release through modulation of voltage-sensitive Ca" + and/or P currents, hyperpolarize a postsynaptic cell through activation of f currents, and regulate adenylyl cyclase activity (see, for example, review articles by Bowery, Annu. Rev. Pharmacol. Toxicol. 33, 109-147 (1993); Kerr et al.. Pharmac. Ther. 67. 187-246 (1995); Misgeld et al.. Prog. Neurobiol. 46. 423-462 (1995)).
  • GABA B receptors were originally identified due to their insensitivity to the GABA ⁇ antagonist bicuculline and their sensitivity to the agonist baclofen (Bowery et al.. Eur. J. Pharmacol. 71 , 53- 70 (1981); Hill et al.. Nature 290. 149-152 (1981 )).
  • Presynaptic GAB ⁇ B autoreceptors have been shown to modulate GABA release, while heteroreceptors modulate the release of several neurotransmitters and peptides including L-glutamate. somatostatin, substance P, and cholecystokinin (Huston et al., Neurosci. 68.
  • the identified receptors, rgb la and rglb. are members of the G protein-coupled seven transmembrane domain receptor family and are splice variants of the same receptor. These receptors exhibit the expected sensitivity and rank order of potency of GABA H receptor compounds that has been described in the literature for GABA B receptors in tissue preparations.
  • the present invention relates to a new subtype of mammalian GABA B receptor which has been designated gb2 GABA B .
  • the present invention relates to nucleic acids (DNA) encoding gb2 GABA B , to vectors and host expression systems containing these nucleic acids, to isolated and purified gb2 GABA B receptors, to isolated and recombinantly-produced antigens encoded by these nucleic acids, and to antibodies produced against these antigens.
  • EST expressed sequence tag
  • fhis is only the second GABA receptor p ⁇ an sequence to be identified.
  • the homology between rat receptor sequences (rgbl and rgb2) and human receptor sequence (hgb2 ) indicates that they might be members of a larger GABA B receptor family.
  • These receptors i.e.. hgb2. rgb2, and rgbl
  • rgb2 comprise a new subfamily of seven transmembrane G-protein-coupled receptors that share structure and sequence similarities with the metabotropic glutamate receptors.
  • Baclofen and GABA modulate cAMP synthesis through the gb2 receptors at ⁇ M concentrations.
  • the rgb2 mRNA exhibits a more discrete expression pattern in rat brain than rgbl and appears to be absent from white matter suggesting that it is predominantly localized to neurons.
  • One object of the invention is to provide a nucleic acid sequence that encodes a protein which comprises a mammalian gb2 GABA,, receptor.
  • a further object of the invention is to provide a nucleic acid sequence that encodes a protein which comprises a human gb2 GABA B receptor.
  • a further object of the invention is to provide constructs containing the genes encoding such receptors under the transcriptional and translational regulatory control of regulatory genes recognized by a desired host to which the mammalian gb2 GABA,, receptor genes are foreign.
  • a still further object of the invention is to provide an isolated or pure clone from a mammalian tissue DNA library, wherein the clone contains a DNA sequence that encodes a mammalian gb2 GABA B receptor.
  • Another object of the invention is to provide an isolated or pure clone from a human tissue DNA library, wherein the clone contains a DNA sequence that encodes a human gb2 GABA B receptor.
  • Another object of the invention is to provide an expression vector that contains the DNA of the invention and is capable of transforming a host cell.
  • Still another object of the invention is to provide host cells and have been transformed with such DNA and which express a mammalian gb2 GABA B receptor.
  • GABA GABA, receptors, and agonists or antagonists for GABA,, receptors.
  • isolated or essentially pure DNA sequences encoding mammalian gb2 GABA B receptors are disclosed herein.
  • the DNA sequences are cDNA sequences, and most preferably they are the cDNA sequences shown in SEQ. ID NO.: 1 (human) and SEQ. ID NO.: 2 (rat) or allelic variants thereof.
  • the mammalian gb2 GABA B receptors are hgb2 GABA B receptors as defined by SEQ. ID NO.: 3 (human) and rgb2 GABA B receptors as defined by SEQ. ID NO.: 4 (rat)) or allelic variants thereof.
  • Figure 1 provides schematic diagrams of hgb2 (panel A), rgb2 (panel B), rgb lb (panel C), and rgb la (panel D) sequences and shows the relative location of oligonucleotide primers and restriction enzyme sites used in constructing the cDNAs and the location of oligonucleotide primers used to make riboprobes for in situ hybridization histochemistry.
  • Left facing arrows represent sense primers
  • right facing arrows represent antisense primers.
  • the cloning of hgb2 is detailed in Example 1 ; the cloning of rgb2 is detailed in Example 2; the cloning of rgb lb and rgb la is detailed in Example 3.
  • Figure 2 illustrates the alignment of human gb2 and rat gb2 with rat gbl a and gblb receptor amino acid sequences. Dots indicate residues identical in all receptors. Hydrophobic domains are denoted by bars and labeled with the transmembrane domain (TM) numbers. Potential N-linked glycosylation sites are designated by an asterisk over the appropriate residues.
  • TM transmembrane domain
  • Figure 3 illustrates hgb2 (panel A) and rgb la (panel B) receptor-mediated modulation of forskolin-stimulated cAMP synthesis in hgb2/293-10 and rgb la/293-18 cells.
  • hgb2/293-10 and rgbla/293-18 cells stably expressing the hgb2 and rgbla receptors, respectively, were generated and assayed for modulation of forskolin- O 99/61606
  • FIG. 4 illustrates hgb2 mRNA expression in CNS and peripheral tissues as determined by Northern blot analysis. Clontech multiple human tissue Northerns were hybridized with a probe directed against the hgb2 receptor. Weak bands were observed in heart and spinal cord human mRNA.
  • Figure 5 illustrates the localization of rgb2 and rgbl receptor mRNA by in situ hybridization histochemistry. Coronal 12 ⁇ m thin sections of a rat forebrain are shown. Brightfield (A and C) and darkfield (B and D) illumination is demonstrated of the identical visual fields; A and B show rgbl and C and D show the rgb2 receptor mRNA. Note the lack of grains over the caudate nucleus and the septum in C and D.
  • the scale bar represents 1 mm.
  • Figure 6 illustrates the localization of rgb2 and rgbl receptor mRNA by in situ hybridization histochemistry. Coronal 12 ⁇ m thin sections of a rat forebrain are shown. Brightfield (A and C) and darkfield (B and D) illumination is demonstrated of the identical visual fields: A and B show the rgbl and C and D show the rgb2 receptor mRNA. Note the lack of grains over the hypothalamus in C and D.
  • the present invention relates to a new subtype of mammalian GAB A B receptor which has been designated gb2 GABA B .
  • the present invention relates to nucleic acids (DNA) encoding gb2 GABA B receptors, to vectors and host expression systems containing these nucleic acids, to isolated and purified gb2 GABA B receptors, to isolated and recombinantly-produced antigens encoded by these nucleic acids, and to antibodies produced against these antigens.
  • EST expressed sequence tag
  • the DNA of the invention is an isolated or essentially pure DNA sequence (i.e., polydeoxyribonucleotide) encoding a protein which comprises the new mammalian subtype gb2 GABA B receptors.
  • isolated and variations thereof means that the DNA is in isolation from DNA encoding proteins normally accompanying these receptors or encoding a different GABA receptor.
  • the DNA of the invention includes DNA encoding the gb2 GABA B receptor when that DNA has been cloned into a bacteria] vector, such as a plasmid, or into a viral vector that may be harbored by a bacteriophage, provided that such clones are isolated from clones that contain DNA encoding other proteins normally accompanying such receptors or encoding a different GABA receptor.
  • a bacteria such as a plasmid
  • a viral vector that may be harbored by a bacteriophage
  • the term "essentially pure" and variants thereof means the DNA is substantially free of DNA and RNA that does not encode the gb2 GABA B receptor. That is, there will be no more than about 0. 1 percent of other DNA and RNA and preferably no more than about 0.01 percent of other DNA and RNA in any sample that contains the DNA encoding the gb2 GABA B receptor.
  • the DNA of the invention is complementary DNA (cDNA).
  • cDNA complementary DNA
  • One preferred human cDNA has the nucleotide sequence as defined in SEQ. ID No.:l ; another preferred rat cDNA has the nucleotide sequence as defined in SEQ. ID No.:2.
  • the cDNA is approximately 5.5 to 5.8 kilobases in length.
  • the preferred human and rat cDNA code for proteins with the deduced amino acid sequence of SEQ. ID NO.:3 and SEQ. ID NO.:4, respectively. These proteins contain seven transmembrane regions (TM1 through TM7 as shown in Figure 2B).
  • allelic variations of the DNA and protein which do not significantly affect the functionality of the DNA and/or protein can also been employed and considered within the invention described herein.
  • an "allelic variation" of a given DNA and/or protein retains at least about 95 percent of the sequence of the comparison molecule (DNA or protein) and maintains the essential functionality of the comparison molecule.
  • the essential functionality is encoding a mammalian GABA B receptor of subtype gb2; for the protein of this invention, the essential functionality relates to its action as a O 99/61606
  • allelic variations may involve single or multiple mutations so long as the functionality remains intact.
  • the DNA of the invention may be obtained by various methods, as detailed in the examples, involving known molecular biology techniques.
  • the present invention also encompasses isolated or purified clones from mammalian tissue DNA library, which clone contains a DNA molecule encoding a mammalian gb2 GABA B receptor.
  • the clones comprise an essentially pure culture of bacteriophage containing the cDNA of SEQ. ID. NO.: 1 or SEQ. ID. NO.:2 inserted into the genome of the phage.
  • the clone comprises an essentially pure culture of bacteria, such as E. coli, containing the cDNA of SEQ. ID. NO.: 1 or SEQ. ID.
  • plasmid e.g., pUC-18, pBSSK II (-), pcDNA/amp, pcDNA3.1, and the like
  • plasmid e.g., pUC-18, pBSSK II (-), pcDNA/amp, pcDNA3.1, and the like
  • Cosmids. BACE YAC vectors, and ⁇ phages could also be used as expression systems for these genes.
  • the DNA of the invention can be used to transform procaryotic cells, such as bacteria, fungi, or other microorganisms, or transfect eucaryotic cells, such as yeast or, mammalian cells. Transformation or transfection is accomplished by techniques known in the molecular biology.
  • the DNA of the invention maybe joined to a wide variety of other DNA sequences for introduction into an appropriate host cell.
  • the companion DNA will depend upon the nature of the host, the manner of introduction of the DNA into the host, and whether episomal maintenance or integration is desired. Mammalian cells are the preferred host.
  • DNA is inserted into an expression vector, such as a plasmid, in proper orientation and correct reading frame for expression. If necessary, the DNA may be linked to the appropriate transcriptional and translational regulatory control nucleotide sequences recognized by the desired host, although such controls are generally available in the expression vector.
  • the vector is then introduced into the host through standard techniques. Generally, not all of the hosts will be transformed or transfected by the vector. Therefore, it will be necessary to select for transformed or transfected host cells.
  • One selection technique involves incorporating into the expression vector a DNA sequence, with any necessary control elements, that codes for a selectable trait in the transformed cell, such as antibiotic resistance. Alter-
  • the gene for such selectable trait can be on another vector, which is used to co-transform or co-transfect the desired host cell.
  • the preferred expression vector for use in the invention is the plasmid pcD3.1hgb2.
  • This plasmid can be prepared from the expression vector pcDNA3.1. After the modified expression vector has been prepared, it is transfected into a mammalian cell, using techniques known in the art.
  • the mammalian cell may be any one that can be transfected with the DNA of the present invention.
  • the cell is one that can be stably transfected with the DNA so that the DNA is integrated into the genome and expressed on an essentially continuous basis in the cell or its progeny.
  • the cell to be transfected is preferably one from a mammalian cell line that is capable of continuous growth in a suitable culture medium.
  • Preferred types of cell lines include those derived from human embryonic kidney cells, such as HEK-293.
  • neuronal cells such as the type of pheochromocytoma cells known as PC 12 cells, fibroblast cells, such as A9 L cells, epithelial-like cells, such as Chinese hamster ovary (CHO) ceils, and a glial or glial-like cells, such as c6 glioma cells.
  • PC 12 cells type of pheochromocytoma cells known as PC 12 cells
  • fibroblast cells such as A9 L cells
  • epithelial-like cells such as Chinese hamster ovary (CHO) ceils
  • a glial or glial-like cells such as c6 glioma cells.
  • the cells are evaluated by screening to identify and isolate those that have taken up the expression vector.
  • the expression vector will be stably inserted into the genome of the cell. If the stably transfected cells were originally from a continuous cell line, the celi can be clonally expanded to provide a cell line that is capable of continuous growth in a suitable culture medium and which expresses a mammalian gb2 GABA B receptor.
  • the cells and cell lines of the present invention can be used in the development of better drugs for the possible treatment of neurological and psychiatric disorders wherein GABA B receptors play an important role.
  • the DNA. clones, and vectors of the present invention can be used for the construction of such cells and cell lines.
  • the assays can be used to screen drugs in order to find or develop gb2 GABA B antagonists (substances that block the receptors) or agonists (substances that stimulate the receptors).
  • gb2 GABA B antagonists substances that block the receptors
  • agonists substances that stimulate the receptors.
  • Generally known techniques, modified in accordance with the discoveries and teachings disclosed herein, can be used with the cells and cell lines of the invention to evaluate potential antagonists or agonists by generating dose response, saturation, inhibition, or displacement curves. Initial candidates can be further tested for specificity, binding affinity, and activity.
  • Whether or not a chemical binds to a mammalian gb2 GABA B receptor can be determined by contacting the chemical with a cell or a part thereof from a host cell transformed by the DNA of the invention and determining the ability of the cell or part thereof to bind to the chemical in the appropriate assay in the presence of a chemical known to bind to a gb2 GABA B receptor, such as GABA and baclofen.
  • Gb2 GABA B receptor agonists are normally identified using both binding and functional assays.
  • Such functional assays include the so-called second messenger assays.
  • second messenger assays When neurotransmitters bind to receptors on the surface of cells, the metabolism of the various molecules is altered. When these molecules effect the physiology of the cell, they are referred to as second messengers.
  • Two second messenger pathways that have been well characterized are inositol phosphate and cyclic adenosine monophosphate (cAMP) metabolism. See Berridge, Annu. Rev. Biochem. 56, 159 (1987) and Gilman, Annu. Rev. Bioahem. S6, 615 (1987).
  • cAMP metabolism can be examined by various methods. The activity of the enzyme adenylate cyclase or the levels of cAMP can be measured.
  • the invention provides an in vitro method for evaluating a chemical to determine if it is a gb2 O 99/61606
  • the chemical is contacted with a cell transformed by the DNA of the invention.
  • the effect of the chemical on a second messenger pathway of the cells is then measured using conventional techniques.
  • Cells and cell lines expressing mammalian gb2 GABA B receptors can be used to provide a sufficient amount of the proteins for the preparation of antibodies using conventional techniques.
  • the antibodies can be used to define more clearly the localization of receptor types than is possible using in situ hybridization to mRNA. They could also be used for diagnostic purposes if clinically significant abnormalities were found in association with the gb2 GABA B receptors. Moreover, they would permit purification of the receptor proteins by affinity chromatography. Highly purified gb2 GABA B would permit the 3 -dimensional protein to be studied by X-ray crystallography. Such information would be especially useful in rational drug design.
  • Hgb2 and rgb2 Amino Acid Sequences Through EST data base searches, polymerase chain reaction, and library screening as described in the Examples, human and rat homologues of a novel receptor (hgb2 in human and rgb2 in rat) have been identified and isolated. These receptors have homology to the GABA B receptors (rgb la and rgb lb from rat) identified by Kaupmann et al. (Nature 386, 239-246 (1997)).
  • Figure 1 shows a schematic of the hgb2, rgb2, rgb la and rgb lb receptor nucleotide sequences denoting the placement of oligonucleotide primers and restriction enzyme sites used to generate each of these constructs and the expression plasmids.
  • Hgb2 receptor fragments were amplified from human brain cDNA while rgb2 was isolated from a rat cortex cDNA library followed by amplification of rat brain cDNA to obtain the 5' end of the receptor including the start site.
  • the resulting 5786 base pair sequence generated for hgb2 includes an open reading frame of 2826 bases.
  • the combined 5' RACE (i.e., rapid amplification of cDNA ends) product and insert for rgb2 spans 5459 base pairs and includes an open reading frame of 2823 O 99/61606
  • the cDNA sequences for hgb2 and rgb2 predict proteins of 942 and 941 amino acid, respectively, with relative molecular mass of 104 kD.
  • hgb2 and rgb2 sequences include 7 putative transmembrane regions, a large extracellular amino terminus of 476 residues, and 4 potential sites for N-linked glycosylation ( Figure 2). There is an abundance of proline residues in the amino terminus of both hgb2 and rgb2. with a string of 9 proline residues only 9 residues into the sequences.
  • Hgb2 Encodes a GABA P Receptor.
  • a functional screen of HEK293 cells stably transfected with pcD3.1hgb2 or pcD3.1rgbla revealed several cell lines expressing these receptors to varying degrees. Preliminary data is shown in Figure 3 for the stable cell lines hgb2/293-10 and rgb l a/293- 18.
  • Adenylyl cyclase was stimulated as described in the Example 8 with 10 uM forskolin in the presence or absence of 30 uM baclofen or 30 uM GABA.
  • 100 uM AOAA a GABA transaminase inhibitor
  • 100 uM nipecotic acid a GABA uptake blocker
  • hgb2/293-10 cells exhibited a 65% reduction in forskolin-stimulated cAMP synthesis with baclofen and a 50% decrease with GABA plus AOAA and nipecotic acid ( Figure 3).
  • a 40% reduction in forskolin-stimulated cAMP synthesis was observed for rgb 1 a/293-18 cells treated with baclofen and a 45% decrease was observed for GABA plus AOAA and nipecotic acid ( Figure 3).
  • baclofen nor GABA plus AOAA and nipecotic
  • Hgb2 Expression in Rat CNS and Peripheral Tissues Analysis of Northern blots of human mRNA from several brain regions and peripheral tissues with a probe directed against the hgb2 receptor reveals a single mRNA species of 6.2 kb (Figure 4). Hgb2 receptor mRNA is expressed in all of the brain areas tested although the level of expression seems to vary significantly with the highest being found in the cortex and thalamus and the lowest in the corpus callosum, caudate nucleus, and medulla. In addition, a weak 6.2 kb band is detected in spinal cord mRNA. No hgb2 receptor mRNA is detected in any of the peripheral tissues examined with the exception of the heart where a weak band is observed.
  • rgbl mRNA is found in glia as well. While hybridization to rgb2 mRNA has not been detected in glia. more detailed studies of rgb2 mRNA expression and protein localization at the cellular level are necessary before this possibility can be ruled out. While it is difficult to make a direct extrapolation from mRNA hybridization to protein location, the data presented herein are generally in agreement with previously published binding data (Chu et al., Neuroscience 34. 341-357 (1990); Bowery et al., Neuroscience 20. 365-383 (1987)). Binding of GABA in certain regions of the rat brain including the septal area, caudate putamen, hypothalamus and brainstem.
  • Example 1 Cloning of hgb2.
  • a tblastn search of the Genbank EST database using the amino acid sequence of the rat gbl receptor as query detected three ESTs (R76139, R80448, and Z43654) which showed distant homology to transmembrane domains 5-7 and another EST (T07261) which showed similarity to transmembrane domains 1-3.
  • JC135 and JC136 primers were derived from the transmembrane domains 5-7 ESTs while JC137 was derived from T07621. JC136 and JC137 primers were used together to generate a product of 722 bases which, when sequenced. confirmed that the ESTs were derived from the same mRNA.
  • APCACTAGAACTCCAGCTGGAAGTCA was designed based on EST AA323988 and used in a 3' RACE reaction as described above to yield a 2.3 kb band that when sequenced was shown to include a poly(A) signal.
  • 5' RACE with JC136 yielded a 0.88 kb Not I/BamH 1 fragment which when sequenced showed weak amino acid homology to rgbl .
  • JC153 (GCCTACGATGGCATCTGGGTCATCGC) was designed based on the JC136 5' RACE product sequence and paired with JC136 to yield a 1.1 kb fragment.
  • JC153/JC165 (JC165: AATAAGGCTCGAGGTCAGGTGCCAA) 2.2 kb PCR product and an EcoR I/Nae I fragment from a JC171/JC154 (JC171 : CAGCAGCCCGCCGCTCTCCATCAT; JC154: gcgcgtaatacgactcactatagggGTAGTTGAAGTCCTGGATCC G) 1 kb PCR product into EcoR I/Xhol digested pcDNAl/amp (Invitrogen).
  • pcDhgb2II was constructed by subcloning a Not I/Xmn I 5' RACE fragment obtained with AP2/JC186 into a Not I/Xmn 1 digested pcDhgb2I.
  • PcD3.1hgb2 was made by O 99/61606
  • Example 2 Cloning of rgb2.
  • Rgb2 was obtained by screening pools of clones from a rat cortex cDNA library using Southern blot analysis. DNA was prepared from each of 49 pools representing an average of 5 x 10 5 clones per pool and digested with Xho 1 to release the inserts from the vector DNA. 5 ⁇ g of Xho I digested pool DNA was run on a 0.8 % agarose gel and transferred to a nitrocellulose supported membrane (BA-S 85. Schleicher & Schuell) using a TurboBlotter (Schleicher & Schuell).
  • Nitrocellulose membranes were hybridized with a 32 P-labeled random primed (Boerhinger Mannheim) hgb2 JC137/JC136 (JC137: ccggaattcCAGAAGCTCATAAAGATGTCGAGTCC; JC 136: gcgggatccCTTCGGCACGAATACCAGGCAGAGGGT) PCR fragment in 3x Denhardf s and 3x SSC at 60°C. Hybridization was followed by two 15 min washes in 3x SSC at 60°C. Blots were imaged on the Fujix Phosphorlmaging system (Fuji). Bacteria from two pools was each used to make 22 subpools. DNA was prepared from these subpools and analyzed as described above.
  • a Xho I/Bgl II fragment from the 5' RACE of rgb2 and a Bgl II fragment from 37094a were subcloned into Xho I/BamH I digested pBSSK II (-).
  • the corrct orientation of the Bgl II fragment was established using restriction enzyme mapping with Xhol and BamH I.
  • PcD3.1 rgb2 was made by subcloning a Kpn I/BamH I fragment of the pBSSK II (-) plasmid with a BamH I/Xba I fragment from 37094a into Kpn I/Xba I digested pcDNA3.1.
  • Example 3 Cloning of rgbl b and rgbla.
  • Rgb 1 b was obtained by amplification of Clontech rat brain Marathon-Ready cDNA with JC140 (ccggaattcccaccATGGGCCCGGGGGGACCCTGTACC) and JC 141
  • pBSrgbl b was made by ligation of an EcoR I/Xba 1 fragment of rgbl b into EcoR I/Xba I prepared pBSSKII(-).
  • pcDrgblb was constructed by subcloning an EcoR I/Not I fragment from pBSrgblb into EcoR I/Not I prepared pcDNAl/amp (Invitrogen). Rgbla 5' sequence was obtained by 5' RACE with AP 1 or 2 paired with JC 144 (GAGTAG
  • pcDrgbla was constructed by subcloning an EcoR I/BstE II fragment from the pBSrgbla into EcoR I/BstE II digested pcDrgblb. An EcoR I/Not I fragment from pcDrgbla was subcloned into pcDNA3.1 (Invitrogen) to make pcD3.1rgbla.
  • Example 4 Northern Analysis. Clontech multiple human tissue Northerns were hybridized with the 0.88 kb Not I/BamH I fragment (bases 732-1613 of hgb2) at 42 °C in 5X SSPE. 10X Denhardt's. 50% formamide. 2% SDS, 100 ⁇ g/ml denatured salmon sperm DNA. Following hybridization blots were washed three times for 10 min each in 0.2X SSPE. 1 % SDS at 60°C. Blots were imaged on the Fujix Phosphorlmaging system (Fuji). O 99/61606
  • Example 5 In situ Hybridization Histochemistry. Preparation of rat brain sections, prehybridization and hybridization of rat brain slices was performed using conventional techniques (see, for example. Bradley et al.. J. Neurosci. 12. 2288- 2302 (1992); a general protocol can also be found on the following website: http://intramural.nimh.nih.gov/lcmr/snge/Protocol.html). Sections were hybridized with labeled antisense and sense riboprobes directed against rgb2 or rgbl .
  • Probes were generated by amplification of rgb2 with JC216 paired with JC217 or with JC218 paired with JC219 (JC216: cgcgcaattaaccctcactaaaggACAACAGCAAACGTTCAGGC; JC217: gcgcgtaatacgactcactatagggCATGCCTATGATGGTGAG; JC218: cgcgcaattaaccctcactaaaggCTGAGGACAAACCCTGACGC; JC219: gcgcgtaatacgactcactatagggGATGTCTTCTATGGGGTC) or by amplification of rgbl with JC 160 paired with JC 161 (JC 160: cgcgcaattaaccctcactaaaggAAGCTTATCCACCACGAC; JC 161 : gcgcgtaatacgactcactatagggAGCTGGATCCGAGAAGAA) and label
  • Example 6 Cell Culture and Stable Expression of hgb2 and rgbla.
  • HEK-293 cells human embryonic kidney cells, were cultured in DMEM supplemented with 10% fetal calf serum (Sigma), 1% penicillin/streptomycin (GIBCO/BRL), at 37 °C in 5% C0 2 .
  • HEK-293 cells grown to 75% confluency in 10- cm tissue culture plates were used for control, pcD3.1hgb2 and pcD3.1rgbla transfections.
  • HEK-293 cells were exposed to either a solution of cationic lipid/DNA (LipofectAMINE; GIBCO/BRL) in DMEM without fetal calf serum or penicillin/streptomycin (70 ⁇ g LipofectAMINE/ 10 ⁇ g of pcD3.1hgb2 or pcD3.1rgbla) or a solution containing cationic lipid alone (70 ⁇ g LipofectAMINE) in DMEM. for 5 hr at 37 °C. After incubation, lipid/DNA solutions were supplemented with equal volumes of DMEM with 20% fetal calf serum and cells were set at 37 °C overnight. Within 24 hr of transfection media was removed and replaced with serum- and penicillin/streptomycin-supplemented DMEM. Transfected cells were allowed to recover for 24 hr after which each 10-cm plate was split to five 10-cm plates in
  • DMEM fetal calf serum
  • penicillin/streptomycin and 375 ⁇ g/ml geneticin G418; and GIBCO/BRL
  • Resistant colonies were isolated and transferred to 24-well plates. I hose cells that survived the isolation procedure were cultured for preparation of total RNA for dot blot analysis (Example 7) and for cAMP response assays (Example 8) to screen for expression of hgb2 and rgbl a.
  • Example 7 Detection of hgb2 and rgbla RNA by Dot Blot Analysis.
  • the cells from Example 6 were grown in 6-well plates to 75-100% confluency.
  • Total RNA was prepared using the protocol provided with Trizol (GIBCO/BRL). Briefly, Trizol was added to each well and cells were triturated and transferred to 1.5 ml mierofuge tubes. Samples were extracted with chloroform followed by precipitation with 2-propanol. Pellets were resuspended in 7.4% formaldehyde/6X SSC and stored at -20 °C until analysis. Half of each sample was diluted in equal volume of 7.4% formaldehyde/6X SSC, denatured and applied to a supported nitrocellulose membrane using a dot blot apparatus.
  • Blots were hybridized at 42 °C overnight followed by one 20 min wash at 25 °C with 2X SSC, 0.1% SDS and two 30 min washes at 68 °C with 0.2X SSC. 0.1% SDS. Blots were imaged on the Fujix Phosporlmaging system. Data tabulation is underway.
  • Example 8 Determination of Cellular cAMP Response.
  • HEK-293 cells from Example 6 which stably express the hgb2 and rgb 1 a receptors were lifted in IX PBS, 2.5 mM EDTA, counted, pelleted and resuspended at 1.5 x 10 5 cells per 100 ⁇ l in Krebs-Ringer-Hepes medium.
  • 100 ⁇ M Ro 20-1724 (RBI; Natick. MA) and incubated at 37°C for 20 min.
  • 100 ⁇ l cells was added to 100 ⁇ l of prewarmed (37°C. 10 min) Krebs-Ringer-Hepes medium.
  • 100 ⁇ M Ro 20-1724 without or with agonists, antagonists and/or forskolin was O 99/61606
  • Immulon II removawells (Dynatech; Chantilly, VA ) were coated overnight with 100 ⁇ l of protein G (1 mg/ml in 0.1M NaHC0 3 , pH 9.0) at 4°C.
  • protein G-coated plates Prior to use protein G-coated plates were rinsed with PBS-gelatin-Tween (phosphate buffered saline containing 0.1% gelatin, 0.2% Tween»20) 3 times quickly and then once for 30 minutes. Following the rinse with PBS-gelatin-Tween the RIA was set up by adding 100 ⁇ l 50 mM sodium acetate, pH 4.75. cAMP standards or aliquots from treated cells, 5.000-7.000 cpm ,25 I-succinyl cAMP.
  • GCCGTTCTGA GCCGAGCCGG AACCCTAGCC CGAGACGGAG CCGGGGCCCG GGCCGGCGCC 360
  • GAAGAAGATC ATCAAGGACC AGAAACTGCT TGTGATCGTG GGGGGCATGC TGCTGATCGA 2280
  • CAGCAAGTAC ATCGGGATGA GTGTCTACAA CGTGGGGATC ATGTGCATCA TCGGGGCCGC 2580
  • GAAGTCCTTA TTTCTTCACA AAGAAGAGGA ACGGAAATGG GACGTCTTCC TTAACATCTG 3540
  • ACATGCTCCA CATGGGACCT GTGTCACCCA ATGAGATGTT TGTTACTCTG GTAAATGCCA 3960
  • GCATCCATCT TCCTCTTTGG CCTCGACGGG TCCTTCGTCT CAGAAAAGAC CTTTGAAACA 1800
  • CTCTGCACGG TCCGGACCTG GATTCTCACC GTGGGCTACA CAACTGCCTT TGGGGCCATG 1860
  • AAGACCTCCA CTTCAGTC C CAGCGTGAAC CAGGCGAGCA CGTCACGCCT GGAGGGACTG 2520 AGTCAGAAA ACCACCGCCT TCGAATGAAG ATCACAGAGC TGGACAAAGA CTTGGAAGAA 2580
  • CAAGAGCTCA ACGACATCCT CAGCTTGGGC AACTTCACAG AGAGCACAGA TGGAGGAAAG 2700
  • CTGTCGCTCC AGCTCCCCAT CCTTCACCAC GCCTACCTCC CATCCATCGG AGGCGTGGAT 2880
  • TGCTAAAAGT CATCTCTGTG TTCCTGAGCT AGAGCTGCTG GCCCAGGGCC CCCTGGCTTC 3960

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Neurology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention porte sur un polypeptide d'une sous-unité de récepteurs mammaliens GABAB, à savoir la sous-unité gb2, ainsi que sur un ADN codant la sous-unité. La sous-unité gb2, associée à un polypeptide mammalien gb1, exprime l'activité du récepteur GABAB. L'invention porte également sur des vecteurs d'expression du polypeptide gb2 et sur des cellules l'exprimant, ainsi que sur des procédés de production d'une sous-unité de récepteurs GABAB gb2 dans une cellule mammalienne, ces procédés consistant à déterminer la capacité d'une substance à se lier à un récepteur mammalien GABAB et à évaluer si une substance module une activité exprimée d'un récepteur GABAB. L'invention porte en outre sur un anticorps qui réagit de manière immunospécifique à une sous-unité du récepteur gb2 mammalien.
PCT/US1999/011869 1998-05-29 1999-05-28 RECEPTEURS MAMMALIENS gb2 ET GABA¿B? WO1999061606A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU43191/99A AU4319199A (en) 1998-05-29 1999-05-28 Mammalian gb2 gaba Beta receptors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US8727498P 1998-05-29 1998-05-29
US60/087,274 1998-05-29

Publications (1)

Publication Number Publication Date
WO1999061606A1 true WO1999061606A1 (fr) 1999-12-02

Family

ID=22204183

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/011869 WO1999061606A1 (fr) 1998-05-29 1999-05-28 RECEPTEURS MAMMALIENS gb2 ET GABA¿B?

Country Status (2)

Country Link
AU (1) AU4319199A (fr)
WO (1) WO1999061606A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1044265A1 (fr) * 1998-08-27 2000-10-18 Synaptic Pharmaceutical Corporation Adn codant un polypeptide gaba br2 et ses utilisations
EP1092017A1 (fr) * 1998-06-29 2001-04-18 Garvan Institute Of Medical Research Recepteur gaba-b
EP1109565A1 (fr) * 1998-09-01 2001-06-27 Smithkline Beecham Corporation Recepteur de gabab1aa
US6518399B1 (en) 1998-09-07 2003-02-11 Smithkline Beecham Corporation Receptor

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK, Accession Number AF056085, CLARK et al., "gb2, a second GABA-B receptor. Homo sapiens GABA-B receptor mRNA, complete cds", 08 October 1998. *
DATABASE GENBANK, Accession Number AF058795, CLARK et al., "gb2, a second GABA-B receptor. Rattus norvegicus GABA-B receptor gb2 mRNA, complete cds", 15 October 1998. *
DATABASE GENBANK, Accession Number AF074483, BOROWSKY et al., "Direct Submission Homo sapiens GABA-B receptor 2 mRNA, complete cds", 07 January 1999. *
DATABASE GENBANK, Accession Number AF095723, CLARK et al., "gb2, a second GABA-B receptor. Homo sapiens GABA-B receptor splice variant 1 mRNA, partial cds", 08 October 1998. *
DATABASE GENBANK, Accession Number AF095724, CLARK et al., "gb2, a second GABA-B receptor. Homo sapiens GABA-B receptor splice variant 2 mRNA, partial cds", 08 October 1998. *
DATABASE GENBANK, Accession Number AF095784, LIU et al., "Cloning and characterization of a novel human GABA-B receptor subtype with high affinity for GABA and low affinity for baclofen", 17 May 1999. *
JONES, K.A. ET AL.,: "GABAB receptors function as heteromeric assembly of the subunits GABABR1 and GABABR2", NATURE, NATURE PUBLISHING GROUP, UNITED KINGDOM, vol. 396., 17 December 1998 (1998-12-17), United Kingdom, pages 674 - 679., XP002116148, ISSN: 0028-0836, DOI: 10.1038/25348 *
KAUPMANN K., ET AL.: "GABAB-RECEPTOR SUBTYPES ASSEMBLE INTO FUNCTIONAL HETEROMERIC COMPLEXES.", NATURE, NATURE PUBLISHING GROUP, UNITED KINGDOM, vol. 396., no. 17., 1 December 1998 (1998-12-01), United Kingdom, pages 683 - 687., XP000867007, ISSN: 0028-0836, DOI: 10.1038/25360 *
KUNER R, ET AL.: "ROLE OF HETEROMER FORMATION IN GABAB RECEPTOR FUNCTION", SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 283, 1 January 1995 (1995-01-01), US, pages 74 - 77, XP002923190, ISSN: 0036-8075, DOI: 10.1126/science.283.5398.74 *
WHITE J.H. ET AL.,: "Heterodimerization is required for the formation of a functional GABAB receptor.", NATURE, NATURE PUBLISHING GROUP, UNITED KINGDOM, vol. 396., 17 December 1998 (1998-12-17), United Kingdom, pages 679 - 682., XP002116149, ISSN: 0028-0836, DOI: 10.1038/25354 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1092017A1 (fr) * 1998-06-29 2001-04-18 Garvan Institute Of Medical Research Recepteur gaba-b
EP1092017A4 (fr) * 1998-06-29 2005-06-08 Garvan Inst Med Res Recepteur gaba-b
EP1044265A1 (fr) * 1998-08-27 2000-10-18 Synaptic Pharmaceutical Corporation Adn codant un polypeptide gaba br2 et ses utilisations
EP1044265A4 (fr) * 1998-08-27 2002-10-29 Synaptic Pharma Corp Adn codant un polypeptide gaba br2 et ses utilisations
EP1109565A1 (fr) * 1998-09-01 2001-06-27 Smithkline Beecham Corporation Recepteur de gabab1aa
EP1109565A4 (fr) * 1998-09-01 2004-05-19 Smithkline Beecham Corp Recepteur de gabab1aa
US6518399B1 (en) 1998-09-07 2003-02-11 Smithkline Beecham Corporation Receptor

Also Published As

Publication number Publication date
AU4319199A (en) 1999-12-13

Similar Documents

Publication Publication Date Title
JP3628691B2 (ja) ヒト神経細胞性ニコチン性アセチルコリン受容体組成物およびそれらの使用方法
EP1243648A1 (fr) Nouveaux recepteurs couples a la proteine de liaison a guanosine triphosphate, leurs genes, leur preparation et leur utilisation
KR20010080882A (ko) 구성적으로 활성화된 비내생성 인간 ｇ 단백질 결합형수용체
US20070185313A1 (en) Human neuronal nicotinic acetylcholine receptor compositions and methods employing same
JP2002531091A (ja) Ｐｔｈ１ｒおよびｐｔｈ３ｒレセプター
CA2231748A1 (fr) Nouveau recepteur couple a la proteine g (hfgan72x)
JP2002512779A (ja) 新規なｇ−タンパク質共役型受容体
JP2002522011A (ja) Ｇタンパク質共役型受容体１４２７３レセプター
JPH11235184A (ja) ヒト７回膜貫通受容体をコードするｃＤＮＡクローンＨＮＥＡＡ８ １
JP2002536989A (ja) ガラニン受容体と類似したｇタンパク質共役受容体
WO1999046296A1 (fr) Ecr673: recepteur couple a une proteine g du domaine transmembranaire 7
WO1999061606A1 (fr) RECEPTEURS MAMMALIENS gb2 ET GABA¿B?
US6461836B1 (en) Molecular cloning of a 7TM receptor (AxOR34) and screening methods thereof
JP2003513629A (ja) 新規なｇｐｃｒ＿ｋｄ５ポリペプチドおよびそのｄｎａ配列
US6682908B1 (en) Mouse growth hormone secretagogue receptor
US6495665B1 (en) Isoforms of mouse serotonin 5-HT2C receptor
JP2003504054A (ja) Ｇ−タンパク質共役型受容体およびそのｄｎａ配列
US20030083245A1 (en) Novel receptors
EP1097169A1 (fr) Recepteur secretagogue d'hormones de croissance chez la souris
JP3497871B2 (ja) レセプター蛋白質，その製造法およびその用途
US20030229216A1 (en) Constitutively activated human G protein coupled receptors
EP1507006A1 (fr) Procede de criblage d'un medicament contre l'insuffisance renale
EP1070128A1 (fr) Recepteur axor4 de couplage a la proteine g
EP1068235A1 (fr) Nouveaux composes
WO2001040259A2 (fr) Recepteurs de l'orexine-1 de singe

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase

Ref country code: KR

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase