WO1999046237A1 - Modulators of protein tyrosine phosphatases - Google Patents

Modulators of protein tyrosine phosphatases Download PDF

Info

Publication number
WO1999046237A1
WO1999046237A1 PCT/DK1999/000126 DK9900126W WO9946237A1 WO 1999046237 A1 WO1999046237 A1 WO 1999046237A1 DK 9900126 W DK9900126 W DK 9900126W WO 9946237 A1 WO9946237 A1 WO 9946237A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound according
selective
ptpases
compound
amino
Prior art date
Application number
PCT/DK1999/000126
Other languages
French (fr)
Inventor
Henrik Sune Andersen
Josef Vagner
Claus Bekker Jeppesen
Niels Peter Hundahl Møller
Sven Branner
Lone Jeppesen
Ole Hvilsted Olsen
Lars Fogh Iversen
Daniel Dale Holsworth
Frank Urban Axe
Yu Ge
Todd Kevin Jones
Wiliam Charles Ripka
Roy Teruyuki Uyeda
Jing Su
Farid Bakir
Luke Milburn Judge
Lutz Stefan Richter
Original Assignee
Novo Nordisk A/S
Ontogen Corporation
RICHTER, Birgith
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novo Nordisk A/S, Ontogen Corporation, RICHTER, Birgith filed Critical Novo Nordisk A/S
Priority to HU0102612A priority Critical patent/HUP0102612A2/en
Priority to BR9908723-5A priority patent/BR9908723A/en
Priority to IL13831899A priority patent/IL138318A0/en
Priority to CA002323472A priority patent/CA2323472A1/en
Priority to KR1020007010089A priority patent/KR20010041811A/en
Priority to JP2000535620A priority patent/JP2004500308A/en
Priority to EP99907336A priority patent/EP1080068A1/en
Priority to MXPA00008921A priority patent/MXPA00008921A/en
Priority to AU27139/99A priority patent/AU2713999A/en
Publication of WO1999046237A1 publication Critical patent/WO1999046237A1/en
Priority to NO20004526A priority patent/NO20004526L/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C235/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms
    • C07C235/70—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups and doubly-bound oxygen atoms bound to the same carbon skeleton
    • C07C235/84—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups and doubly-bound oxygen atoms bound to the same carbon skeleton with the carbon atom of at least one of the carboxamide groups bound to a carbon atom of a six-membered aromatic ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/78—Carbon atoms having three bonds to hetero atoms, with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D213/79—Acids; Esters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/02—Drugs for disorders of the endocrine system of the hypothalamic hormones, e.g. TRH, GnRH, CRH, GRH, somatostatin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C233/00—Carboxylic acid amides
    • C07C233/01—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms
    • C07C233/56—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having carbon atoms of carboxamide groups bound to carbon atoms of carboxyl groups, e.g. oxamides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C237/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups
    • C07C237/02—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups having the carbon atoms of the carboxamide groups bound to acyclic carbon atoms of the carbon skeleton
    • C07C237/22—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups having the carbon atoms of the carboxamide groups bound to acyclic carbon atoms of the carbon skeleton having nitrogen atoms of amino groups bound to the carbon skeleton of the acid part, further acylated
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D207/00—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/30—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members
    • C07D207/34—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/08—Indoles; Hydrogenated indoles with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, directly attached to carbon atoms of the hetero ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/10—Indoles; Hydrogenated indoles with substituted hydrocarbon radicals attached to carbon atoms of the hetero ring
    • C07D209/14—Radicals substituted by nitrogen atoms, not forming part of a nitro radical
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/78—Carbon atoms having three bonds to hetero atoms, with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D213/79—Acids; Esters
    • C07D213/80—Acids; Esters in position 3
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
    • C07D231/02—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings
    • C07D231/10—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D231/14—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D231/38—Nitrogen atoms
    • C07D231/40—Acylated on said nitrogen atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C07D239/02—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings
    • C07D239/24—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members
    • C07D239/28—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms
    • C07D239/32—One oxygen, sulfur or nitrogen atom
    • C07D239/42—One nitrogen atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C07D239/02—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings
    • C07D239/24—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members
    • C07D239/28—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms
    • C07D239/46—Two or more oxygen, sulphur or nitrogen atoms
    • C07D239/52—Two oxygen atoms
    • C07D239/54—Two oxygen atoms as doubly bound oxygen atoms or as unsubstituted hydroxy radicals
    • C07D239/545—Two oxygen atoms as doubly bound oxygen atoms or as unsubstituted hydroxy radicals with other hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms
    • C07D239/557—Two oxygen atoms as doubly bound oxygen atoms or as unsubstituted hydroxy radicals with other hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms, e.g. orotic acid
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D241/00—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings
    • C07D241/02—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings
    • C07D241/10—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members
    • C07D241/14—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D241/24—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D241/26—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals with nitrogen atoms directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D261/00—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings
    • C07D261/02—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings
    • C07D261/06—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings having two or more double bonds between ring members or between ring members and non-ring members
    • C07D261/08—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings having two or more double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D271/00—Heterocyclic compounds containing five-membered rings having two nitrogen atoms and one oxygen atom as the only ring hetero atoms
    • C07D271/02—Heterocyclic compounds containing five-membered rings having two nitrogen atoms and one oxygen atom as the only ring hetero atoms not condensed with other rings
    • C07D271/06—1,2,4-Oxadiazoles; Hydrogenated 1,2,4-oxadiazoles
    • C07D271/07—1,2,4-Oxadiazoles; Hydrogenated 1,2,4-oxadiazoles with oxygen, sulfur or nitrogen atoms, directly attached to ring carbon atoms, the nitrogen atoms not forming part of a nitro radical
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D271/00—Heterocyclic compounds containing five-membered rings having two nitrogen atoms and one oxygen atom as the only ring hetero atoms
    • C07D271/02—Heterocyclic compounds containing five-membered rings having two nitrogen atoms and one oxygen atom as the only ring hetero atoms not condensed with other rings
    • C07D271/10—1,3,4-Oxadiazoles; Hydrogenated 1,3,4-oxadiazoles
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D271/00—Heterocyclic compounds containing five-membered rings having two nitrogen atoms and one oxygen atom as the only ring hetero atoms
    • C07D271/02—Heterocyclic compounds containing five-membered rings having two nitrogen atoms and one oxygen atom as the only ring hetero atoms not condensed with other rings
    • C07D271/10—1,3,4-Oxadiazoles; Hydrogenated 1,3,4-oxadiazoles
    • C07D271/113—1,3,4-Oxadiazoles; Hydrogenated 1,3,4-oxadiazoles with oxygen, sulfur or nitrogen atoms, directly attached to ring carbon atoms, the nitrogen atoms not forming part of a nitro radical
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/02—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
    • C07D333/04—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom
    • C07D333/26—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D333/38—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/50—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
    • C07D333/52—Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes
    • C07D333/62—Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the hetero ring
    • C07D333/66—Nitrogen atoms not forming part of a nitro radical
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/50—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
    • C07D333/52—Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes
    • C07D333/62—Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the hetero ring
    • C07D333/68—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D409/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D409/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/10—Spiro-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/12—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains three hetero rings
    • C07D495/14—Ortho-condensed systems

Definitions

  • the present invention provides novel compounds, novel compositions, methods of their use, and methods of their identification, where such compounds are pharmacologically useful inhibitors of Protein Tyrosine Phosphatases (PTPases, PTPs) such as PTP1B, TC-PTP, CD45, SHP-1 , SHP-2, PTP ⁇ , PTP ⁇ , PTP ⁇ , PTP ⁇ , PTP ⁇ , PTP ⁇ , PTP ⁇ , PTPD1 , PTPD2, PTPH1 , PTP-MEG1 , PTP-LAR, and HePTP or ligands of phosphotyrosine units.
  • PTPases Protein Tyrosine Phosphatases
  • PTPases protein tyrosine phosphatases
  • PTPases protein tyrosine phosphatases
  • PTP ⁇ , LAR, TC-PTP, SHP-1 , SHP-2, PTP ⁇ , CD45, PTP1 B, HePTP protein tyrosine phosphatases
  • tyrosine phosphatases can also contribute to the symptoms and progression of various diseases (Wiener, et al., J. Natl. cancer Inst. 86:372-8, 1994; Hunter and Cooper, Ann. Rev. Biochem, 54:897-930, 1985). Furthermore, there is increasing evidence which suggests that inhibition of these PTPases may help treat certain types of diseases such as diabetes, autoimmune disease, acute and chronic inflammation and various forms of cancer.
  • Protein phosphorylation is now well recognized as an important mechanism utilized by ceils to transduce signals during different stages of cellular function (Fischer et al, Science 253:401-6 (1991); Flint et al., The EMBO J. 12:1937-46 (1993)).
  • phosphatases There are at least two major classes of phosphatases: (1) those that dephosphorylate proteins (or peptides) that contain a phosphate group(s) on a serine or threonine moiety (termed Ser/Thr phosphatases) and (2) those that remove a phosphate group(s) from the amino acid tyrosine (termed protein tyrosine phosphatases or PTPases).
  • the PTPases are a family of enzymes that can be classified into two groups: a) intra- cellular or nontransmembrane PTPases and b) receptor-type or transmembrane PTPases.
  • Intracellular PTPases Most known intracellular type PTPases contain a single conserved catalytic phosphatase domain consisting of 220-240 amino acid residues. The regions outside the PTPase domains are believed to play important roles in localizing the intracellular PTPases subcellularly (Mauro, L.J. and Dixon, J.E. TIBS 19: 151-155 (1994)). The first intracellular PTPase to be purified and characterized was PTP1B which was isolated from human placenta (Tonks et al., J. Biol. Chem. 263: 6722-6730 (1988)). Shortly after, PTP1B was cloned (Charbonneau et al., Proc.
  • intracellular PTPases include (1) T-cell PTPase (Cool et al. Proc. Natl. Acad. Sci. USA 86: 5257-5261 (1989)), (2) rat brain PTPase (Guan et al., Proc. Natl. Acad. Sci. USA 87:1501-1502 (1990)), (3) neuronal phosphatase STEP (Lombroso et al., Proc. Natl. Acad. Sci.
  • LMW-PTPase Low molecular weight phosphotyrosine-protein phosphatase shows very little sequence identity to the intracellular PTPases described above.
  • this enzyme belongs to the PTPase family due to the following characteristics: (i) it possesses the PTPase active site motif: Cys-Xxx-Xxx-Xxx-Xxx-Xxx-Arg (Cirri et al., Eur. J. Biochem. 214: 647-657 (1993)); (ii) this Cys residue forms a phospho- intermediate during the catalytic reaction similar to the situation with 'classical' PTPases (Cirri et al., supra; Chiarugi et al., FEBS Lett.
  • Receptor-type PTPases consist of a) a putative ligand-binding extracellular domain, b) a transmembrane segment, and c) an intracellular catalytic region.
  • the structures and sizes of the putative ligand-binding extracellular domains of receptor-type PTPases are quite divergent.
  • the intracellular catalytic regions of receptor-type PTPases are very homologous to each other and to the intracellular PTPases.
  • Most receptor-type PTPases have two tandemly duplicated catalytic PTPase domains.
  • the first receptor-type PTPases to be identified were (1) CD45/LCA (Ralph, S.J., EMBO J. 6: 1251 -1257 (1987)) and (2) LAR (Streuli et al., J. Exp. Med. 168: 1523- 1530 (1988)) that were recognized to belong to this class of enzymes based on homology to PTP1B (Charbonneau et al., Proc. Natl. Acad. Sci. USA 86: 5252-5256 (1989)).
  • CD45 is a family of high molecular weight glycoproteins and is one of the most abundant leukocyte cell surface glycoproteins and appears to be exclusively ex- pressed upon cells of the hematopoietic system (Trowbridge and Thomas, Ann. Rev. Immunol. 12: 85-116 (1994)).
  • PTP-U2/GLEPP1 (Seimiya et al., Oncogene 10: 1731-1738 (1995); Thomas et al., J. Biol. Chem. 269: 19953-19962 (1994)), and (14) DEP-1; (IV) PTP ⁇ ,_PTP ⁇ . All receptor-type PTPases except Type III contain two PTPase domains. Novel PTPases are continuously identified, and it is anticipated that more than 500 different species will be found in the human genome, i.e. close to the predicted size of the protein tyrosine kinase superfamiiy (Hanks and Hunter, FASEB J. 9: 576-596 (1995)).
  • PTPases are the biological counterparts to protein tyrosine kinases (PTKs). Therefore, one important function of PTPases is to control, down-regulate, the activity of PTKs.
  • PTKs protein tyrosine kinases
  • a more complex picture of the function of PTPases now emerges.
  • Several studies have shown that some PTPases may actually act as positive mediators of cellular signalling.
  • the SH2 domain-containing SHP-2 seems to act as a positive mediator in insulin-stimulated Ras activation (Noguchi et al., Mol. Cell. Biol. 14: 6674-6682 (1994)) and of growth factor-induced mitogenic signal trans- duction (Xiao et al., J. Biol. Chem.
  • Dual specificity protein tyrosine phosphatases define a subclass within the PTPases family that can hydrolyze phosphate from phosphortyrosine as well as from phosphor-serine/threonine.
  • dsPTPases contain the signature sequence of PTPases: Cys-Xxx-Xxx-Xxx ⁇ Xxx-Xxx-Arg. At least three dsPTPases have been shown to dephosphorylate and inactivate extracellular signal-regulated kinase (ERKs)/mitogen-activated protein kinase (MAPK): MAPK phosphatase (CL100, 3CH134) (Charles et al., Proc. Natl. Acad.
  • dsPTPases Transcription of dsPTPases are induced by different stimuli, e.g. oxidative stress or heat shock (Ishibashi et al., J. Biol. Chem. 269: 29897-29902 (1994); Keyse and Emslie, Nature 359: 644-647 (1992)).
  • stimuli e.g. oxidative stress or heat shock (Ishibashi et al., J. Biol. Chem. 269: 29897-29902 (1994); Keyse and Emslie, Nature 359: 644-647 (1992)).
  • cdc25 Millar and Russell, Cell 68: 407-410 (1992)
  • KAP Hannon et al., Proc. Natl. Acad. Sci. USA 91: 1731-1735 (1994)
  • tyrosine dephosphorylation of cdc2 by a dual specific phosphatase, cdc25 is required for induction of mitosis in yeast (review by Walton and Dixon, Annu. Rev. Biochem. 62: 101-120 (1993)).
  • PTPases were originally identified and purified from cell and tissue lysates using a variety of artificial substrates and therefore their natural function of dephosphorylation was not well known. Since tyrosine phosphorylation by tyrosine kinases is usu- ally associated with cell proliferation, cell transformation and cell differentiation, it was assumed that PTPases were also associated with these events. This association has now been proven to be the case with many PTPases.
  • PTP1 B a phosphatase whose structure was recently elucidated (Barford et al., Science 263:1397- 1404 (1994)) has been shown to be involved in insulin-induced oocyte maturation (Flint et al., The EMBO J. 12:1937-46 (1993)) and recently it has been suggested
  • _-_rb B2 that the overexpression of this enzyme may be involved in p185 -associated breast and ovarian cancers (Wiener, et al., J. Natl. cancer Inst. 86:372-8 (1994); Weiner et al., Am. J. Obstet. Gynecol. 170:1177-883 (1994)).
  • the insulin-induced oocyte maturation mechanism has been correlated with the ability of PTP1B to block activation of S6 kinase.
  • the association with cancer is recent evidence which suggests that overexpression of PTP1 B is statistically correlated with increased levels of p 185 c - erb B2 jn ovar j an anc j breast cancer.
  • PTP1 B The role of PTP1 B in the etiology and pro ⁇ gression of the disease has not yet been elucidated. Inhibitors of PTP1 B may therefore help clarify the role of PTP1B in cancer and in some cases provide thera-Guinic treatment for certain forms of cancer.
  • PTPases the insulin receptor signalling pathway/diabetes
  • Insulin is an important regulator of different metabolic processes and plays a key role in the control of blood glucose. Defects related to its synthesis or signalling lead to diabetes mellitus. Binding of insulin to its receptor causes rapid (auto)phosphorylation of several tyrosine residues in the intracellular part of the b-subunit. Three closely po- sitioned tyrosine residues (the tyrosine-1150 domain) must all be phosphorylated to obtain full activity of the insulin receptor tyrosine kinase (IRTK) which transmits the signal further downstream by tyrosine phosphorylation of other cellular substrates, including insulin receptor substrate- 1 (IRS-1) (Wilden et al., J. Biol. Chem.
  • IRTK appears to be tightly regulated by PTP-mediated dephosphorylation in vivo (Khan et al., J. Biol. Chem. 264: 12931-12940 (1989); Faure et al., J. Biol. Chem. 267: 11215-11221 (1992); Rothenberg et al., J. Biol. Chem. 266: 8302-8311 (1991)).
  • PTPases ⁇ and ⁇ While it appears that the target of the negative regulatory activity of PTPases ⁇ and ⁇ is the receptor itself, the downmodulating effect of the intracellular TC-PTP seems to be due to a downstream function in the IR-activated signal.
  • PTP1B and TC- PTP are closely related, PTP1 B had only little influence on the phosphorylation pattern of insulin-treated cells.
  • Both PTPases have distinct structural features that determine their subcellular localization and thereby their access to defined cellular sub- strates (Frangione et al, Cell 68: 545-560 (1992); Faure and Posner, Glia 9: 311-314 (1993)).
  • PTP1 B and TC-PTP may, at least in part, be explained by the fact that they do not co-localize with the activated insulin receptor.
  • PTP1B and TC-PTP have been excluded as candidates for the IR-associated PTPases in hepatocytes based on subcellular local- ization studies (Faure et al, J. Biol. Chem. 267: 11215-11221 (1992)).
  • the transmembrane PTPase CD45 which is believed to be hematopoietic cell- specific, was in a recent study found to negatively regulate the insulin receptor tyrosine kinase in the human multiple myeloma cell line U266 (Kulas et al., J. Biol. Chem. 271 : 755-760 (1996)).
  • Knock-out mice have been useful in elucidating the importance of specific genes in a number of cases. From the results presented above, it would be expected that in particular LAR K.O. mice, PTP ⁇ K.O. mice and PTP1 B K.O. mice, respectively, could provide important information in relation to insulin signaling.
  • Two groups have generated LAR K.O. mice (Schaapveld at al., Developmental Biology 188: 134-146 (1997); Skarnes et al., Proc. Natl Acad.Sci. U.S.A. 92:6592-6596 (1995)). Goldstein and co- workers analyzed the LAR K.O. mice from Skarnes et al.
  • PTP1 B -/- mice were compared with +/+ and +/- mice of the same genetic background (Elchebly et al., Science 283: 1544-1548 (1999)). In this latter study (Elcheby et al., supra), it was found that disruption of the gene encoding the PTP1 B yielded healthy mice that - in the fed state - had blood glucose levels that were slightly lower and concentrations of insulin that were about Vi of those found in their PTP1 B+/+ littermates. Further, both insulin and glucose tolerance tests showed enhanced insulin sensitivity in the PTP K.O. mice.
  • PTP1B-/- and PTP1B-/+ mice were resistant to weight gain and remained insulin sensitive - in contrast to the PTP1B +/+ mice that rapidly gained weight and became insulin resistant.
  • Analysis of the levels of tyrosine phosphorylation of the insulin receptor and insulin receptor substrate-1 (IRS-1) showed increased phosphorylation of these proteins in PTP1B -/- mice (liver and muscle) in comparison with the PTP1B +/+ mice. All of these findings are in accordance with the notion that PTP1 B is likely to play a major role as negative regulator of the insulin receptor signaling pathway - and in contrast to the above-mentioned in vitro studies. The authors conclude that 'these results make PTP-1 B a potential therapeutic target for treatment of type 2 diabetes and obesity' (Elcheby et al., supra).
  • Somatostatin inhibits several biological functions including cellular proliferation
  • somatostatin analogs inhibit the growth of pancreatic cancer presumably via stimulation of a single PTPase, or a subset of PTPases, rather than a general activation of PTPase levels in the cells (Liebow et al, Proc. Natl. Acad. Sci.
  • stably expressed in CHO-K1 ceils can stimulate PTPase activity and that this stimulation is pertussis toxin-sensitive. Whether the inhibitory effect of somatostatin on hormone and growth factor secretion is caused by a similar stimulation of PTPase activity in hormone producing cells remains to be determined.
  • PTPases the immune system/autoimmunity
  • CD45 is one of the most abundant of the cell surface glycoproteins and is expressed exclusively on hemopoetic cells. In T cells, it has been shown that CD45 is one of the critical components of the signal transduction machinery of lymphocytes.
  • CD45 phosphatase plays a pivotal role in antigen-stimulated proliferation of T lymphocytes after an antigen has bound to the T cell receptor (Trowbridge, Ann. Rev. Immunol, 12:85-116 (1994)).
  • Lck a lymphocyte-specific member of the Src family protein-tyrosine kinase (Mustelin etal., Proc. Natl. Acad. Sci. USA 86: 6302-6306 (1989); Ostergaard et al., Proc. Natl. Acad. Sci. USA 86: 8959-8963 (1989)).
  • Fyn another member of the Src family protein- tyrosine kinases, Fyn, seems to be a selective substrate for CD45 compared to Lck and Syk (Katagiri et al., J Biol. Chem. 270: 27987-27990 (1995)).
  • CD45 has also been shown to be essential for the antibody mediated degranulation of mast cells (Berger et al., J. Exp. Med. 180:471-6 (1994)). These studies were also done with mice that were CD45-deficient. In this case, an IgE-mediated degranulation was demonstrated in wild type but not CD45-deficient T cells from mice. These data suggest that CD45 inhibitors could also play a role in the symptomatic or therapeutic treatment of allergic disorders.
  • HePTP lymphoid-specific protein tyrosine phosphatase
  • SHP-1 plays a significant role in regulating the erythropoietin signalling pathway, which is enhanced in mice lacking intact SHP-1 (Schultz et al. Cell 73: 1445-1454.
  • selective PTPase inhibitors may be attractive drug candidates both as immunosup- pressors and as immunostimulants as well as inhibitors and stimulants of the hematopoietic system.
  • PTPase inhibitors as immunmodulators by demonstrating the capacity of the vanadium-based PTPase inhibitor, BMLOV, to induce apparent B cell selective apoptosis compared to T cells (Schieven et al., J. Biol. Chem. 270: 20824-20831 (1995)). 12 PTPases: cell-cell interactions/cancer
  • Focal adhesion plaques an in vitro phenomenon in which specific contact points are formed when fibroblasts grow on appropriate substrates, seem to mimic, at least in part, cells and their natural surroundings.
  • Several focal adhesion proteins are phosphorylated on tyrosine residues when fibroblasts adhere to and spread on extracellular matrix (Gumbiner, Neuron 11, 551-564 (1993)).
  • Aberrant tyrosine phosphorylation of these proteins can lead to cellular transformation.
  • the intimate association between PTPases and focal adhesions is supported by the finding of several in- tracellular PTPases with ezrin-iike N-terminal domains, e.g. PTPMEG1 (Gu et al, Proc. Natl. Acad. Sci.
  • PTPH1 Yang and Tonks, Proc. Natl. Acad. Sci. USA 88: 5949-5953 (1991)
  • PTPD1 Yang and Tonks, Proc. Natl. Acad. Sci. USA 88: 5949-5953 (1991)
  • PTPD1 M ⁇ ller et al, Proc. Natl. Acad. Sci. USA 91: 7477-7481 (1994)
  • the ezrin-like domain show similarity to several proteins that are believed to act as links between the cell membrane and the cy- toskeleton.
  • PTPD1 was found to be phosphorylated by and associated with c-src in vitro and is hypothesized to be involved in the regulation of phosphorylation of focal adhesions (M ⁇ ller et al, supra).
  • PTPases may oppose the action of tyrosine kinases, including those responsible for phosphorylation of focal adhesion proteins, and may therefore function as natural inhibitors of transformation.
  • TC-PTP and especially the truncated form of this enzyme (Cool et al, Proc. Natl. Acad. Sci. USA 87: 7280-7284 (1990)), can inhibit the transforming activity of v-en and v-fms (Lam ers et al, J. Biol. Chem. 268: 22456-22462 (1993); Zander et al, Oncogene 8: 1175-1182 (1993)).
  • PTP1B The expression level of PTP1B was found to be increased in a mammary cell line transformed with neu (Zhay et al, Cancer Res. 53: 2272-2278 (1993)).
  • the intimate relationship between tyrosine kinases and PTPases in the development of cancer is further evidenced by the recent finding that PTP ⁇ is highly expressed in murine mammary tumors in transgenic mice over-expressing c-neu and v-Ha-ras, but not c-myc or int-2 (Elson and Leder, J Biol. Chem. 270: 26116-26122 (1995)).
  • the human 13 gene encoding PTPg was mapped to 3p21 , a chromosomal region which is frequently deleted in renal and lung carcinomas (LaForgia et al, Proc. Natl. Acad. Sci. USA 88: 5036-5040 (1991)).
  • PTPases appear to be involved in controlling the growth of fibroblasts.
  • Swiss 3T3 cells harvested at high density contain a membrane-associated PTPase whose activity on an average is 8-fold higher than that of cells harvested at low or medium density (Pallen and Tong, Proc. Natl. Acad. Sci. USA 88: 6996-7000 (1991)). It was hypothesized by the authors that density-dependent inhibition of cell growth involves the regulated elevation of the activity of the PTPase(s) in question.
  • PTPases Two closely related receptor-type PTPases, PTPK and PTP ⁇ , can mediate homophilic cell-cell interaction when expressed in non-adherent insect cells, suggesting that these PTPases might have a normal physiological function in cell-to-cell signalling (Gebbink et al, J. Biol. Chem. 268: 16101-16104 (1993); Brady-Kalnay et al, J. Cell Biol. 122: 961-972 (1993); Sap et al, Mol. Cell. Biol. 14: 1-9 (1994)).
  • PTPk and PTP ⁇ do not interact with each other, despite their structural similarity (Zondag et al, J. Biol. Chem.
  • PTPases may play an important role in regulating normal cell growth.
  • PTPases may also function as positive mediators of intracellular signalling and thereby induce or enhance mitogenic responses. Increased activity of certain PTPases might therefore result in cellular transformation and tumor formation.
  • overexpression of PTP ⁇ was found to lead to transformation of rat embryo fibroblasts (Zheng, supra).
  • SAP-1 a novel PTP, SAP-1 , was found to be highly expressed in pancreatic and colorectal cancer cells.
  • SAP-1 is mapped to chromosome 19 region q13.4 and might be related to carcinoembryonic antigen mapped to 19q13.2 (Uchida et al., J. Biol. Chem. 269: 12220-12228 (1994)). Further, the dsPTPase, cdc25, dephosphorylates cdc2 at Thr14/Tyr-15 and thereby functions as positive regulator of 14 mitosis (reviewed by Hunter, Cell 80: 225-236 (1995)). Inhibitors of specific PTPases are therefore likely to be of significant therapeutic value in the treatment of certain forms of cancer.
  • PTPases platelet aggregation
  • PTPases are centrally involved in platelet aggregation.
  • Agonist-induced platelet activation results in calpain-cataiyzed cleavage of PTP1B with a concomitant 2-fold stimulation of PTPase activity (Frangioni et al, EMBO J. 12: 4843-4856 (1993)).
  • the cleavage of PTP1 B leads to subcellular relocation of the enzyme and correlates with the transition from reversible to irreversible platelet aggregation in platelet-rich plasma.
  • the rate of bone formation is determined by the number and the activity of osteoblasts, which in term are determined by the rate of proliferation and differentiation of osteoblast progenitor cells, respectively. Histomorphometric studies indicate that the osteoblast number is the primary determinant of the rate of bone formation in hu- mans (Gruber et al, Mineral Electrolyte Metab. 12: 246-254 (1987); reviewed in Lau et al, Biochem. J. 257: 23-36 (1989)). Acid phosphatases/PTPases may be involved in negative regulation of osteoblast proliferation. Thus, fluoride, which has phosphatase inhibitory activity, has been found to increase spinal bone density in osteopo- rotics by increasing osteoblast proliferation (Lau et al, supra).
  • OST-PTP parathyroid regulated, recep- tor-like PTPase
  • PTPases microorganisms
  • PTPases are essential elements in a variety of cellular signalling processes. Inhibitors or modulators of these enzymes, or a given subset of PTPases, or even one specific PTPase, are therefore attractive drug candidates. However, until now only a limited set of inhibitors has been reported in the literature. Some of the most potent inhibitors are analogs of tyrosine-phosphorylated peptides and therefore not suitable candidates for oral use.
  • Vanadate and Pervanadate induce insulin-like effects in cells and animals.
  • a few anecdotal, clinical studies with formulas of vanadate have shown positive effects in humans with type II diabetes.
  • the mechanism of action at the cellular level is believed to be via inhibition of PTPases.
  • Pervanadate the complexes of vanadate and hydrogen peroxide
  • the effects are very sensitive to the assay constituents such as EDTA and reducing agents (e.g.
  • vanadate and peroxovana- dium-based compounds inhibit a broad range of PTPases. It conceivable that the mechanism of action, i.e. oxidation of the active site cysteine, will cause substantial problems when attempting to develop compounds that selectively inhibit specific PTPases. Further, the toxic effects of vanadate, pervanadate and peroxovanadium- based inhibitors will likely prevent their use for treatment of chronic diseases such as diabetes. 17
  • Bisphosphonates have been successfully used as therapeutic agents for treatment of bone disorders such as osteoporosis and Paget's disease. Bisphosphonates inhibits osteoclast resorption which results in reduced bone turnover and a net gain in bone mineral density (for review, see Rodan and Fleisch, J. Clin. Invest. 97: 2692-2696 (1996)). It is currently believed that the mechanism of action at the cellular level is via bisphosphonates' inhibitory activity against PTPases (in the osteoclasts) (Skorey et al., J. Biol. Chem. 272: 22472-22480 (1997); Opas et al., Biochemical Pharmacology 54: 721-727 (1997)).
  • AuTM disodium aurothiomalate
  • PTPases autoimmune and inflammatory dis- orders
  • AuTM appears to inhibit PTPases via its interaction with the active site nucleophilic cysteine in these enzymes.
  • Dithiothreitol can prevent or almost completely prevent this inhibition, which is in contrast to compounds of the present invention.
  • bisphosphonates substantial problems are likely to arise if the gold compounds were to be used to develop selective inhibitors.
  • the inhibitors described above are non-selective. Some of the observed toxic effects or side effects are likely to be caused, at least in part, by their lack of selectivity.
  • FIG. 1 Steady State Enzyme Kinetic Analysis.
  • PTP1 B was incubated in 96 well plates with different concentrations of the substrate, para-nitrophenyl phosphate (pNPP), and the inhibitor, 2-(oxalylamino)benzoic acid: 0, 7.4, 22.2, 66.7 and 200 ⁇ M - final assay concentration).
  • Buffer 100 mM sodium acetate pH 5.5, 50 mM NaCl, 5 mM dithiothreitol, 0.1 % (w/v) bovine serum albumin, incubation time: 45 minutes; temperature: 25°C.
  • Sodium hydroxide was added and the absorbance read at 405 nm.
  • Figure 2 Steady State Enzyme Kinetic Analysis. Conditions as in Figure 2, except that the buffer was (final assay concentration): 100 mM sodium acetate pH 5.5, 50 mM NaCl, 5 mM glutathione, 1 mM EDTA, and 0.1 % bovine serum albumin. Incubation time: 60 mins. Exp. 1167-3
  • FIG. 3 Time course experiments.
  • PTP1 B was incubated in 96 well plates at room temperature with 2.5 M para-nitrophenol phosphate (pNPP) in a buffer containing.
  • the compound, 2-(oxalylamino)benzoic acid was added at final assay concentrations of 250, 125 and 62.5 ⁇ M.
  • the reaction was started by addition of the enzyme, and the stopped at the indicated time intervals by addition of NaOH.
  • the absorbance at 405 nm was finally measured in all wells.
  • B As in (A), except that EDTA was added to a final concentration of 1 mM.
  • FIG. 6 Steady State Enzyme Kinetic Analysis.
  • PTP ⁇ was incubated in 96 well plates with different concentrations of the substrate, para-nitrophenyl phosphate (pNPP), and the inhibitor, 5-(1 ,3-dioxo-1 ,3-dihydro- isoindol-2-ylmethyl)-2-(oxalyl-amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid: 0, 7.4, 22.2, 66.7 and 200 ⁇ M - final assay concentrations.
  • pNPP para-nitrophenyl phosphate
  • Buffer final assay concentration: 100 mM sodium acetate pH 5.5, 50 mM NaCl, 5 mM glutathione, 1 mM EDTA, and 0.1 % bovine serum albumin. Reaction temperature: 25 °C. After 60 minutes, 10 ⁇ l of a 0.5 M sodium hydroxide solution (in 50 percent (vol/vol) ethanol) was added to each well and the absorbance was read at 405 nm. (B) Michaelis Menten Plots.
  • PTP ⁇ was incubated in 96 well plates with different concentrations of the substrate, para-nitrophenyl phosphate, and the inhibitor, 5-(1 ,3-dioxo-1 ,3- dihydro-isoindol-2-ylmethyl)-2-(oxalyl-amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3- carboxylic acid: 0, 37, 111.1 , 333.3 and 1000 ⁇ M - final assay concentrations.
  • a high throughput screening scintillation proximity assay (SPA - Amersham) was developed using PTP1 B and a synthetic, biotinylated, 33 P-phosphorylated peptide as substrate.
  • This peptide substrate which corresponds to the activation loop of the insulin receptor kinase, i.e. Thr-Arg-Asp-lle-Tyr-Glu-Thr-Asp-Tyr-Tyr-Arg-Lys-NH 2 , was 33 P-phosphorylated on tyrosine residues using the insulin receptor tyrosine kinase.
  • a compound library was screened and a number of hits identified.
  • analogues of this hit i.e. 2-(oxalyl-amino) benzoic acid
  • the compounds of the invention can be derived by changing in a systematic fashion the elements needed for binding to/inhibition of/modulation of the active sites of PTPases and/or to other molecules with pTyr recognition units using procedures well known to those skilled in the art.
  • Such novel compounds may be inhibitors or modulators of protein-tyrosine phosphatases or other molecules with pTyr recognition units and they may be classical, competitive inhibitors or mixed-type inhibitors.
  • the present invention pro- vides methods for making both non-selective and selective inhibitors and modulators of molecules with pTyr recognition units including protein-tyrosine phosphatases.
  • the compounds of the invention can be further modified to act as prodrugs.
  • the Original compound 1 it is within the scope of the invention to modify the compounds of the invention, termed the Original compound 1 , by attaching chemical groups that will improve the bioavailability of said compounds in such a way that the uptake in cells or mammals is facilitated.
  • modifications which are not intended in any way to limit the scope of the invention, include changing of one or more carboxy groups to esters (for instance methyl esters, ethyl esters, acetoxymethyl esters or other acyloxymethyl esters).
  • esters for instance methyl esters, ethyl esters, acetoxymethyl esters or other acyloxymethyl esters.
  • Compounds of the invention, original compounds, such modified by attaching chemical groups are termed 'modified compounds'. Said chemical groups may or may not be apparent in the claims of this invention.
  • modified compounds which are not intended in any way to limit the scope of the invention, are compounds that have been cyclized at specific positions - socalled 'cyclic compounds' - which upon uptake in cells or mammals become hy- drolyzed at the same specific position(s) in the molecule to yield the compounds of the invention, the original compounds, which are then said to be 'non-cyclic'.
  • the latter original compounds in most cases will contain other cyclic or heterocyclic structures that will not be hydrolyzed after uptake in cells or mammals.
  • said modified compounds will not show a be- 23 havior in biochemical assays similar to that of the original compound, i.e.
  • the corresponding compounds of the invention without the attached chemical groups or said modifications.
  • Said modified compounds may even be inactive in biochemical assays.
  • these attached chemical groups of the modified compounds may in turn be removed spontaneously or by endogenous enzymes or enzyme systems to yield compounds of the invention, original compounds.
  • 'Uptake' is defined as any process that will lead to a substantial concentration of the compound inside cells or in mammals.
  • the compounds After uptake in cells or mammals and after removal of said attached chemical group or hydrolysis of said cyclic com- pound, the compounds may have the same structure as the original compounds and thereby regain their activity and hence become active in cells and/or in vivo after uptake.
  • a mammalian cell line which can be obtained from the American Tissue Type Collection or other similar governmental or commercial sources, is incubated with said modified compound. After incubation at conditions well known to those skilled in the art, the cells are washed appropriately, lysed and the lysate is isolated. Appropriate controls, well known to those skilled in the art, must be included.
  • a number of different procedures may in turn be used to extract and purify said compound from said lysate. Said compound may or may not retain the attached chemical group or said cyclic compound may or may not have been hydrolyzed.
  • a number of different procedures - well known to those skilled in the art may be used to structurally and chemically characterize said purified compound. Since said purified compound has been isolated from said cell lysate and hence has been taken up by said cell line, a comparison of said structurally and chemically characterized compound with that of the original unmodified compound (i.e.
  • said purified compound may be subjected to enzyme kinetic analysis as described in detail in the present invention. If the kinetic profile is similar to that of the original compound without said attached chemical group, but different 24 from said modified compound, this confirms that said chemical group has been removed or said cyclic compounds has been hydrolyzed. Similar techniques may be used to analyze compounds of the invention in whole animals and mammals.
  • a preferred prodrug is acetoxymethyl esters of the compounds of the present invention which may be prepared by the following general procedure (C.Schultz et al, The Journal of Biological Chemistry, 1993, 268, 6316-6322. J;
  • a carboxylic acid (1 equivalent) is suspended in dry acetonitrile (2 ml per 0.1 mmol).
  • Diisopropyl amine (3.0 equivalents) is added followed by bromomethyl acetate (1.5 equivalents).
  • the mixture is stirred under nitrogen overnight at room temperature.
  • Acetonitrile is removed under reduced pressure to yield an oil which is diluted in eth- ylacetate and washed with water (3 x).
  • the organic layer is dried over anhydrous magnesium sulfate. Filtration followed by solvent removal under reduced pressure afford a crude oil.
  • the product is purified by column chromatography on silica gel, using an appropriate solvent system.
  • Signal transduction is a collective term used to define all cellular processes that follow the activation of a given cell or tissue.
  • Examples of signal transduction which are not intended to be in any way limiting to the scope of the invention claimed, are cellular events that are induced by polypeptide hormones and growth factors (e.g. insulin, insulin-like growth factors I and II, growth hormone, epidermal growth factor, platelet-derived growth factor), cytokines (e.g. inter-leukins), extracellular matrix components, and cell-cell interactions.
  • polypeptide hormones and growth factors e.g. insulin, insulin-like growth factors I and II, growth hormone, epidermal growth factor, platelet-derived growth factor
  • cytokines e.g. inter-leukins
  • Phosphotyrosine recognition units/tyrosine phosphate recognition units/pTyr recognition units are defined as areas or domains of proteins or gly- coproteins that have affinity for molecules containing phosphorylated tyrosine residues (pTyr).
  • Examples of pTyr recognition units which are not intended to be in any way limiting to the scope of the invention claimed, are: PTPases, SH2 domains and PTB domains. Further, in some receptor-type or receptor-like PTPases, the second domain (the C-terminal domain) most likely does not pos- 25 sess catalytic activity.
  • the second domain of CD45 does not seem to act as an active PTPase (see Kashio et al., J. Biol. Chem. 273, 33856-22863 (1998) and references herein). However, the second domain of CD45 seems to play an important role as a phosphotyrosine recognition unit and to be critical for interleukin-2 secretion and substrate recruitment of TCRz in vivo (Kashio et al., supra). Thus, the second domain of CD45 in this case may play a similar role as a SH2 domain and hence act as a phosphotyrosine recognition unit. Although not formally proven, other molecules that are similar to PTPases, such as IA-2 and IA-2b, may act as pTyr recognition units.
  • Proteins with phosphotyrosine recognition units are defined as proteins or glycoproteins that contain phosphotyrosine recognition units.
  • a ligand is defined as a molecule or compound that binds to another molecule.
  • An example of a ligand, which is not intended in any way to limit the scope of the definition, is a non-peptide molecule with a molecular weight equal to or below 2500 daltons which binds to a protein or a glycoprotein.
  • a phosphotyrosine recognition unit ligand is defined as a molecule that binds to the phosphotyrosine recognition unit(s) of a protein or a glycoprotein with phosphotyrosine recognition unit(s).
  • a phosphotyrosine recognition unit ligand include PTPase inhibitors and/or PTPase modulators.
  • Another non-limiting example of a phosphotyrosine recognition unit ligand is a compound that binds to an SH2 domain and/or to a PTB domain.
  • PTPases are defined as enzymes with the capacity to dephosphorylate pTyr- containing proteins or glycoproteins.
  • Examples of PTPases which are not intended to be in any way limiting to the scope of the invention claimed, are: 'classical' PTPases (intracellular PTPases (e.g. PTP1B, TC-PTP, PTP1C, PTP1D, PTPD1 , PTPD2) and receptor-type PTPases (e.g. PTP ⁇ , PTP ⁇ , PTP ⁇ , PTP ⁇ , CD45, PTPK, PTP ⁇ ), dual specificty phosphatases (VH1, VHR, cdc25), LMW- PTPases or acid phosphatases.
  • a list of currently known classical and other PTPases reported to GenBank is shown in Table 1 (with the appropriate accession number indicated). 26
  • hPTPFMI X95712 hPTPgamma 09247 X54132 hPTPHl M64572 hPTPHE M64322 hPTPIA2 L18983 Z48226 hPTPIA2beta U65065 hPTPIAR AF007555 L76258 hPTPICA512 X62899 hPTPkappa L77886 Z70660 hPTPLl X80289 hPTPmu X58288 hPTPPCP2 X97198 hPTPpi U81561 hPTPPNPl X79676 hPTPpsi U60289 U73727 hPTPrho AF043644 AL024473 A1022239 AQ02047 hPTPRO U71075 hPTPS31 132035 132036 132037 132038 132039 hPTPSAPl D15049 hPTPsigma U35234 U40317 U41725 h
  • rPTP2E U17971 U18293 rPTPalpha L01702 rPTPBEMl (partial . cds) D45412 rPTPBEM2 D45413 rPTPBEM3 D45414 rPTPD30 (complet cds) U28938 rPTPDEPl U40790 rPTPepsilon D78610 D78613 rPTPGMCl AF063249 rPTPICA105 X925G3 D38222 rPTPNE6 U73458 Z50735 rPTPOST L36884 rPTPPl L19180 rPTPPS 19181 rPTPpsi U66566 rPTPsigma L11587 12329 19933 rPTPzeta U09357 rRKPTP D38072 rSTEP S49400 rSHPl U77038 rTCPTP X58828 rPTPTD14 AF077000
  • hPTPCAAXl U48296 hPTPCAAX2 U48297 hPTPCIP2 L25876 hPTPCdil U02681 hPTPICAAR Y08569 hPTPTEPl U96180 hPTPkiaa0283 AB006621 hPTPPRL-1 AF051160 hPTPPR -3 AF041434 hPTP_putative_ AF007118 mPTP-IFl Y17345 mPTP-IF2 Y17344 mPTP-IF2P Y17343
  • Microbial PTPases ie. eubacteria & vira
  • Oher eukaryotes ie. Drosophila, yeast, fungi, xenopus etc.
  • a modulator of PTPases is compound that causes a change of the activity of a PTPase.
  • PTPase modulators may either make the PTPase less active or more active.
  • PTPase modulators may according to the present definition bind to the active site of PTPases or to areas outside the active site of PTPases (so-called allosteric modula- tors).
  • Another, non-limiting example of a PTPase modulator is a compound that changes the substrate specificity of a PTPase.
  • a PTPase domain is defined as a part of the full PTPase molecule, which typically - but not always - possess characteristic enzymatic activity, i.e. the capacity to dephos- phorylate pTyr-containing proteins or glycoproteins.
  • a PTPase domain of a classical PTPase will typically consist of 220-350 amino acid residues and correspond to amino acid residues number 30 to 270 of PTP1 B.
  • PTPase domains may be expressed in eukaryotic and prokaryotic expression system either as the domain itself or as part of a fusion protein.
  • SH2 domains Src homology 2 (SH2) domains are non-catalytic protein modules that bind to pTyr (phosphotyrosine residue) containing proteins, i.e. SH2 domains are pTyr recognition units. SH2 domains, which consist of ⁇ 100 amino acid residues, are found in a number of different molecules involved in signal transduction processes. The fol- lowing is a non-limiting list of proteins containing SH2 domains: Src, Hck, Lck, Syk, Zap70, SHP-1 , SHP-2, STATs, Grb-2, She, p85/PI3K, Gap, vav (see Russell et al, FEBS Lett.
  • PTB domain phos- photyrosine binding domain
  • a PTPase family is defined as a group of PTPases that are structurally related. Thus, one accepted way of defining a PTPase family is based on the primary structures of PTPases outside the PTPase domain(s) or their overall structures (Fischer et al. (1991) Science 253: 401-406; B.J. Goldstein (1995) in Protein Profile, volume 2, num- ber 13, Academic Press Ltd., London..
  • PTPase families defined in such way are:
  • PTP1B family PTP1B; TC-PTP
  • PEST Proiine-Glutamic acid-Serine-Threonine sequence containing PTPases: PTP-PEST; PEP
  • PTPases containing very small, highly giycosylated extracellular regions the PTP ⁇ family: PTP ⁇ ; PTP ⁇ .
  • PTP ⁇ family PTP ⁇ , PTP ⁇ (k) The IA-2 family (I) The PTP ⁇ family (m) The CD45 family
  • PTPases may also be divided into families based on sequence alignments of the primary sequence (Goldstein vide supra). Computer programs well- known to those skilled in the arts (e.g. GCG University of Wisconsin, refs.) may be used to performed such alignments. Further analysis is performed with computer pro- grams such as CLUSTALX resulting in a so-called phylogenetic tree. An example of said phylogenetic tree is shown in Figure 7. It should be pointed out that the above described ways of dividing PTPases into families show considerable overlap.
  • PTPases into families is the latter based on primary sequence alignments of PTPases, since it is likely that this definition in turn can be used to es- tablish assays that will allow development of PTPase inhibitors or modulators that selectively react with a given PTPase family or members of a specific family (i.e. selective inhibitors). 37
  • Modulation of cellular processes is defined as the capacity of compounds of the invention to 1) either increase or decrease ongoing, normal or abnormal, signal transduction, 2) initiate normal signal transduction, and 3) initiate abnormal signal transduction.
  • Modulation of pTyr-mediated signal transduction/modulation of the activity of molecules with pTyr recognition units is defined as the capacity of compounds of the invention to 1) increase or decrease the activity of proteins or glycoproteins with pTyr recognition units (e.g. PTPases, SH2 domains or PTB domains) or to 2) de- crease or increase the association of a pTyr-containing molecule with a protein or glyco-protein with pTyr recognition units either via a direct action on the pTyr recognition site or via an indirect mechanism.
  • proteins or glycoproteins with pTyr recognition units e.g. PTPases, SH2 domains or PTB domains
  • Examples of modulation of pTyr-mediated signal transduction/modulation of the activity of molecules with pTyr recognition units are: a) inhibition of PTPase activity leading to either increased or decreased signal transduction of ongoing cellular processes; b) inhibition of PTPase activity leading to initiation of normal or abnormal cellular activity; c) stimulation of PTPase activity leading to either increased or decreased signal transduction of ongoing cellular processes; d) stimulation of PTPase activity leading to initiation of normal or abnormal cellular ac- tivity; e) inhibition of binding of SH2 domains or PTB domains to proteins or glycoproteins with pTyr leading to increase or decrease of ongoing cellular processes; f) inhibition of binding of SH2 domains or PTB domains to proteins or glycoproteins with pTyr leading to initiation of normal or abnormal cellular activity.
  • a subject is defined as any mammalian species, including humans.
  • a compound is defined as a PTPase inhibitor if the following criteria are fulfilled: (a) the inhibitory capacity must be determined as described in detail below and the inhibition constant, K,, value must be below 1000 ⁇ M; (b) at least one PTPase must be inhibited by the compounds of the invention. Any PTPase may be used for the analyses.
  • PTPases are: PTP1 B; SHP-1 , SHP-2; PTP-PEST; 38
  • PTP ⁇ ; PTP ⁇ ; LAR; CD45 Further examples are given in Table 1. In addition, any PTPase not mentioned herein may be used.
  • K inhibitor constants
  • values may be performed according to a number of different experimental procedures including inhibitor fluorescence quenching. However, in all cases, to evaluate the compounds of the present invention such methods must be supplemented with procedures that measure the effect of the com- pounds on the catalytic activity of the enzymes. The conditions for such assays are illustrated below.
  • PTPases used for the analyses may be expressed as intact molecules or as PTPase domains.
  • Assay conditions must be selected to ensure enzyme stability, i.e. the enzyme must in the absence of substrate retain at least 50 per cent of the initial activity over the assay period.
  • buffer system well known to those skilled in the art may be selected for analysis of compounds of the invention.
  • Preferred buffers used for analysis of PTPase inhibi- tion or modulation are listed below.
  • the reaction time is preferred to be between 2 and 60 minutes.
  • reaction temperature well known to those skilled in the art may be selected for analysis of compounds of the invention.
  • the preferred temperature is in the following range: 4° C to 37° C.
  • Substrates used in the reaction may be selected from the following: (a) p-nitrophenyl phosphate (pNPP); (b) tyrosine-phosphorylated peptides; (c) natural substrates (e.g. autophosphorylated insulin receptor) or parts thereof (e.g. autophosphorylated tyrosine kinase domain of the insulin receptor).
  • pNPP p-nitrophenyl phosphate
  • tyrosine-phosphorylated peptides e.g. autophosphorylated insulin receptor
  • parts thereof e.g. autophosphorylated tyrosine kinase domain of the insulin receptor.
  • the enzyme reaction may be followed by measurement of released phosphate or by spectrophotometric/fluorometric methods according to procedures well known to those skilled in the art.
  • the concentration of substrate and inhibitor must be varied independently according to the following guidelines.
  • a range of substrate concentrations must be varied with a preferred maximum, final assay concentration at least 10-fold above that of the K m value for the enzyme determined under the same conditions.
  • the minimum final assay concentration is pref- 41
  • inhibitor concentrations At least 2 different inhibitor concentrations must be used. The concentrations will depend on the actual compounds, but they must be selected in such a way that nonlinear regression analysis allows determination of inhibitor constants with an accuracy acceptable to those skilled in the art.
  • V 0 the initial velocity
  • K m is defined as the concentration of substrate used to obtain an initial velocity corresponding to 50 percent of the maximal obtainable velocity (V max ) at full substrate saturation of the enzyme. K m is measured without addition of inhibitor.
  • V max is the maximum obtainable initial velocity (limiting rate) determined at full sub- strate saturation.
  • K app is the apparent K m value determined in the presence of inhibitor.
  • V ap p is the apparent V max value determined in the presence of inhibitor.
  • Mixed-type inhibitors are defined as inhibitors that affect both K m and V, max 42
  • Non-competitive inhibitors are defined as inhibitors that decrease V app without any effect on K m .
  • K s the inhibitor constant of competitive inhibitors
  • K app (K m / Kir[i] + K m (equation 1) where [i] is the concentration of the inhibitor
  • the K, values for a given compound may be calculated either using linear transformation procedures or nonlinear regression fit to classical Michaelis Menten enzyme kinetic models as defined above assuming competitive or mixed-type inhibition.
  • Preferred compounds of the invention belongs to the class of competitive or mixed-type inhibitors.
  • PTP1 B was incubated with a compound of the invention (described in Example 2).
  • PTP1 B A truncated form of PTP1 B, corresponding to the N-terminal 321 amino acids was expressed in E. coli and purified to apparent homogeneity using published procedures well-known to those skilled in the art.
  • the enzyme reactions were carried out using standard conditions essentially as described by Burke et al (Biochemistry 35; 15989-15996 (1996)).
  • the assay conditions were as follows. Half of a 96-well plate was used for this experiment, p-nitrophenyl phosphate (pNPP) was used as substrate (see Table 2).
  • 3-(Oxalyl- amino)naphthalene-2-carboxylic acid dissolved in DMSO was used as inhibitor and used at the following final assay concentrations: 100 ⁇ M (added to all wells in column 1), 33.3 ⁇ M (added to all wells in column 2); 11.1 ⁇ M (added to all wells in column 3); 3.7 ⁇ M (added to all wells in column 4).
  • Assay buffer was added in columns 5 and 6 instead of the inhibitor (same volume as the inhibitor in columns 1-4).
  • Assay buffer 100 mM sodium acetate pH 5.5, 50 mM NaCl, 5 mM glutathione, 1 mM EDTA, and 0.1 % bovine serum albumin.
  • the reaction was started by addition of the enzyme, PTP1B.
  • Assay buffer was added in column 6 instead of the enzyme (same volume as the enzyme in columns 1-5).
  • the total volume in each well was 100 ⁇ l, including 10 ⁇ l of inhibitor dissolved in DMSO or 10 ⁇ l DMSO added to the control wells that did not receive inhibitor.
  • the tem- perature was 25 °C. After 60 minutes, NaOH was added and the absorbance was read at 405 nm. The results are shown in Table 2. 44
  • the values in wells H1 through H5 indicated any color (OD 405 value) derived from the inhibitor itself. In the present example, the inhibitor does not give rise to any OD 405 value.
  • the values in column 6 indicate the OD 405 values due to the absorbance of the substrate. Therefore, the corrected OD 405 values in Table 4 must be further corrected for the absorbance at 405 nm which is caused by the inhibitor and/or the substrate, as shown in Table 5.
  • Selectivity of an inhibitor is defined as the property of such compound to inhibit or modulate a certain PTPase or certain PTPases more efficiently than other PTPases.
  • a selective inhibitor may inhibit one PTPase only or one PTPase family only.
  • other selective inhibitors also include compounds that inhibit a set of several PTPases or PTPase families more efficiently than other sets of PTPases or PTPase families.
  • selectivity which is not intended in any way to limit the scope of the invention, is a competitive inhibitor that has a K, value of 50 ⁇ M against PTP1B and a K j value of 500 ⁇ M or more against PTP ⁇ .
  • An example of a selective modulator which is not intended in any way to limit the scope of the invention, is a modulator that causes a 2-fold increase of the activity of SHP-1 without affecting the activity of PTP ⁇ .
  • RNA total or messenger RNA
  • RNA can be isolated from placenta, liver, skeletal muscle, fat tissue, and peripheral blood leukocytes. Using standard procedures (Ausubel, F. M., et al. (Eds.).
  • the PCR technique was used to prepare cDNA corresponding to the following PTPase domains (Ausubel et al., supra): PTP1 B; PTP ⁇ domain 1 ; PTP ⁇ domain 1 ; PTP ⁇ ; CD45 domain 1 and 2.
  • Ap- 48 intestinalte restriction sites have been included in the oligonucleotides to allow cloning into appropriate expression vectors.
  • the pGEX expression vectors (Pharmacia) were used.
  • an additional N-terminal methionine (Met - M) was included in some of the constructs (indicated as (M)).
  • GST fusion proteins were then induced by addition of isopropyl-1-thio-b-D-galactopyranoside, and the cultures were grown for additional 3 hrs at room temperature.
  • the GST fusion proteins were purified according to the manufacturer's instructions (Pharmacia) with minor modifications. In brief, all purification steps were conducted at approx. 4 °C.
  • the cell pellets were suspended (5 ml/g) in lysis buffer (50 mM imidazole, 5 mM EDTA, 0.1 % b-mercaptoetanol, 10 % glycerol, 10 ⁇ g/ml aprotinin, 0.1 % lysozyme and 1 mM PMSF; pH 7.2) by stirring for 1h prior to lysis under nitrogen pressure (>2000 psi) in a Parr cell disruption bomb. Triton X-100 (0.1 %) was added to the lysate and stirring continued for 1h prior to centrifugation at 40000 g for 30 min.
  • lysis buffer 50 mM imidazole, 5 mM EDTA, 0.1 % b-mercaptoetanol, 10 % glycerol, 10 ⁇ g/ml aprotinin, 0.1 % lysozyme and 1 mM PMSF; pH 7.2
  • the supematant was applied to a Glutathione Sepharose column (Pharmacia) equilibrated with GST-equilibration buffer (50 mM imidazole, 1 mM EDTA, 150 mM NaCl and 10 % glycerol; pH 7.2) and initially washed with the same buffer. The flow direction was changed and washing was continued with a washing buffer (50 mM Tris, 1 mM EDTA and 10 % glycerol; pH 8). Finally, the bound protein was eluted with 10 mM glutathione in the washing buffer.
  • the CD45 fusion protein was further purified on G25 and Mono Q columns (Pharmacia). The purified PTP domains are stored at -80 °C until use. Immediately prior to use the enzyme preparations are diluted appropriately.
  • the following final assay concentrations of pNPP were used: 20 mM, 10 mM, 5 mM, 2.5 mM, 1.25 mM, 0.63 mM, 0.31 mM.
  • the compound, 5-(1 ,3-dioxo-1 ,3-dihydro-isoindol- 2-ylmethyl)-2-(oxalyl-amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid, dissolved in dimethyisulfoxide (DMSO) was used as inhibitor and used at the following final assay concentrations: 200 ⁇ M, 66.6 ⁇ M; 22.2 ⁇ M; 7.4 ⁇ M.
  • Assay buffer instead of enzyme, and/or substrate was added to appropriate control wells as de- scribed in detail for PTP1 B above.
  • Assay buffer final assay concentration: 100 mM sodium acetate pH 5.5, 50 mM NaCl, 5 mM glutathione, 1 mM EDTA, and 0.1 % bovine serum albumin.
  • the reaction was started by addition of the enzyme, GST-PTP ⁇ domain 1 (final dilution 1 :10000).
  • the assay total volume in each well was 100 ⁇ l, including 10 ⁇ l of inhibitor dissolved in DMSO or 10 ⁇ l DMSO added to the control wells that did not receive inhibitor. The temperature was 25 °C.
  • Figure 6B shows the results when the same compound (5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-2-(oxalyl- amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid) is tested against PTP ⁇ (final dilution 1 :2000) in the following buffer: 50 mM HEPES pH 7.0, 100 mM NaCl, 5 mM glutathione, 1 mM EDTA, and 0.1 % bovine serum albumin.
  • a selective inhibitor is defined as an inhibitor that shows selectivity.
  • a non-selective inhibitor is defined as an inhibitor that does not show selectivity.
  • a selective modulator is defined as a modulator that shows selectivity.
  • the compound of example 82 is an example of a non-selective inhibitor, whereas the compound of example 83 behaves like a selective inhibitor. It should be noted that the compound in example 83 when tested against other PTPases might be inhibitory against these. Yet, according to the present definition, the compound in example 83 is a selective inhibitor due to the fact that it inhibits PTP1B with little effect on the other PTPases tested in Table 10. Also, according to the present definition, the compound in example 82 is a non-selective inhibitor due to its inhibitory capacity against several PTPases, even though it has weak activity, if any, against PTP-LAR. 52 A chemical group is defined as any single atom or any group of covalently linked atoms or any molecule, including any radical thereof.
  • halogen or halo include fluorine, chlorine, bromine, and iodine.
  • alkyl includes C C 6 straight chain saturated and C 2 -C 6 unsaturated aliphatic hydrocarbon groups, C C 6 branched saturated and C 2 -C 6 unsaturated aliphatic hydrocarbon groups, C 3 -C 6 cyclic saturated and C 5 -C 6 unsaturated aliphatic hydrocarbon groups, and C C 6 straight chain or branched saturated and C 2 -C 6 straight chain or branched unsaturated aliphatic hydrocarbon groups substituted with C 3 -C 6 cyclic saturated and unsaturated aliphatic hydrocarbon groups having the specified number of carbon atoms.
  • this definition shall include but is not limited to methyl (Me), ethyl (Et), propyl (Pr), butyl (Bu), pentyl, hexyl, heptyl, ethenyl, propenyl, butenyl, penentyl, hexenyl, isopropyl (i-Pr), isobutyl (i-Bu), tert-butyl (t-B ), sec-butyl (s-Bu), isopentyl, neopentyl, cyclopropyl, cyclobutyl, cy- clopentyl, cyclohexyl, cyclopentenyl, cyclohexenyl, methylcyclopropyl, ethylcyclohexenyl, butenylcyclopentyl, and the like.
  • substituted alkyl represents an alkyl group as defined above wherein the substi- tutents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, hy- droxy, COR 5 , C ⁇ Ceaikyl, C C ⁇ alkyloxy, aryloxy, arylC Cealkyloxy, thio, C ⁇ C ⁇ alkylthio, arylthio, arylC ⁇ Cealkylthio, NR 7 R 8 , CrCgalkylamino, arylamino, arylC ⁇ C ⁇ alkylamino, di(arylC 1 -C 6 alkyl)amino, C ⁇ Cealkylcarbonyl, arylC r C 6 alkylcarbonyl, C ⁇ Cgalkyl-carboxy, arylC r C 6 alkylcarboxy, C r C 6 alkylcarbonylamino, -
  • alkyloxy (e.g. methoxy, ethoxy, propyloxy, allyioxy, cyclohexyloxy) represents an "alkyl” group as defined above having the indicated number of carbon atoms attached through an oxygen bridge.
  • alkyloxyalkyl represents an "alkyloxy” group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • aryloxy (e.g. phenoxy, naphthyloxy and the like) represents an aryl group as defined below attached through an oxygen bridge.
  • arylalkyioxy e.g. phenethyloxy, naphthylmethyloxy and the like
  • arylalkyl represents an “arylalkyl” group as defined below attached through an oxygen bridge.
  • arylalkyloxyalkyl represents an "arylalkyioxy” group as defined above attached through an “alkyl” group defined above having the indicated number of carbon atoms.
  • arylthio e.g. phenylthio, naphthylthio and the like
  • arylthio represents an “aryl” group as defined below attached through an sulfur bridge.
  • alkyloxycarbonyl e.g. methylformiat, ethylformiat and the like
  • alkyloxycarbonyl represents an “alkyloxy” group as defined above attached through a carbonyl group.
  • aryloxycarbonyl e.g. phenylformiat, 2-thiazolylformiat and the like
  • aryloxycarbonyl represents an “aryloxy” group as defined above attached through a carbonyl group.
  • arylalkyloxycarbonyl e.g. benzylformiat, phenyletylformiat and the like repre- sents an "arylalkyioxy” group as defined above attached through a carbonyl group.
  • alkyloxycarbonyialkyl represents an "alkyloxycarbonyl” group as defined above attached through an “alkyl” group as defined above having the indicated number of carbon atoms.
  • arylalkyloxycarbonylalkyl represents an "arylalkyloxycarbonyl” group as defined above attached through an “alkyl” group as defined above having the indicated number of carbon atoms.
  • alkylthio (e.g. methylthio, ethylthio, propylthio, cyclohexenylthio and the like) represents an “alkyl” group as defined above having the indicated number of carbon atoms attached through a sulfur bridge.
  • arylalkylthio (e.g. phenylmethylthio, phenylethylthio, and the like) represents an "arylalkyl” group as defined above having the indicated number of carbon atoms attached through a sulfur bridge.
  • alkylthioalkyl represents an "alkylthio" group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • arylalkylthioalkyl represents an "arylalkylthio" group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • alkylamino e.g. methylamino, diethylamino, butylamino, N-propyl-N-hexylamino, (2-cyclopentyl)propylamino, hexenylamino, pyrrolidinyl, piperidinyl and the like
  • alkylamino represents one or two "alkyl” groups as defined above having the indicated number of carbon atoms attached through an amine bridge.
  • the two alkyl groups may be taken together with the nitrogen to which they are attached forming a saturated, partially saturated or aromatic cyclic, bicyclic or tricyciic ring system containing 3 to 14 carbon atoms and 0 to 3 additional heteroatoms selected from nitrogen, oxygen or sulfur, the ring system can optionally be substituted with at least one d-C ⁇ alkyl, aryl, aryld-Cealkyl, hydroxy, oxo, d-Cealkyloxy, C r CealkyloxyCrCealkyl, NR 9 R 10 , C 1 -C 6 alkylaminoC 1 -C 6 alkyl substituent wherein the alkyl and aryl groups are optionally substituted as defined in the definition section and R 9 and R 10 are defined as above.
  • arylalkylamino e.g. benzylamino, diphenylethylamino and the like
  • arylalkylamino represents one or two "arylalkyl” groups as defined above having the indicated number of carbon atoms attached through an amine bridge.
  • the two "arylalkyl” groups may be taken together with the nitrogen to which they are attached forming a saturated, partially saturated or aromatic cyclic, bicyclic or tricyciic ring system containing 3 to 14 carbon atoms and 0 to 3 additional heteroatoms selected from nitrogen, oxygen or sulfur, the ring system can optionally be substituted with at least one C Cealkyl, aryl, arylCrCealkyl, hydroxy, oxo, CrCealkyloxy, C r C 6 alkyloxyC r C 6 alkyl, NR 9 R 10 , C CealkylaminoC Cgalkyl substituent wherein the alkyl and aryl groups are optionally substituted as defined in the definition section and R 9 and R 10 are defined as above.
  • alkylaminoalkyl represents an "alkylamino" group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • arylalkyla inoalkyl represents an "arylalkylamino" group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • arylalkyl e.g. benzyl, phenylethyl
  • arylalkyl represents an "aryl” group as defined below attached through an alkyl having the indicated number of carbon atoms or substituted alkyl group as defined above.
  • alkylcarbonyl e.g. cyclooctylcarbonyl, pentylcarbonyl, 3-hexenylcarbonyi
  • arylalkylcarbonyl e.g. phenylcyclopropylcarbonyl, phenylethylcarbonyl and the like
  • arylalkylcarbonyl represents an "arylalkyl” group as defined above having the indicated number of carbon atoms attached through a carbonyl group.
  • alkylcarbonylalkyl represents an “alkylcarbonyl” group attached through an “alkyl” group as defined above having the indicated number of carbon atoms.
  • arylalkylcarbonylalkyi represents an "arylalkylcarbonyl” group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • alkylcarboxy e.g. heptylcarboxy, cyclopropylcarboxy, 3-pentenylcarboxy
  • alkylcarbonyl represents an "alkylcarbonyl” group as defined above wherein the carbonyl is in turn attached through an oxygen bridge.
  • arylalkylcarboxy e.g. benzylcarboxy, phenylcyclopropylcarboxy and the like
  • arylalkylcarbonyl represents an "arylalkylcarbonyl” group as defined above wherein the carbonyl is in turn attached through an oxygen bridge.
  • alkylcarboxyalkyl represents an “alkylcarboxy” group attached through an “alkyl” group as defined above having the indicated number of carbon atoms.
  • arylalkylcarboxyalkyl represents an "arylalkylcarboxy” group attached through an “alkyl” group as defined above having the indicated number of carbon atoms.
  • alkylcarbonylamino e.g. hexylcarbonylamino, cyclopentylcarbonyl-aminomethyl, methylcarbonylaminophenyl
  • alkylcarbonylamino represents an "alkylcarbonyl” group as defined above wherein the carbonyl is in turn attached through the nitrogen atom of an amino group.
  • the nitrogen atom may itself be substituted with an alkyl or aryl group.
  • arylalkylcarbonylamino (e.g. benzylcarbonylamino and the like) represents an “arylalkylcarbonyl” group as defined above wherein the carbonyl is in turn attached through the nitrogen atom of an amino group.
  • the nitrogen atom may itself be substituted with an alkyl or aryl group.
  • alkylcarbonylaminoalkyl represents an "alkylcarbonylamino” group attached through an “alkyl” group as defined above having the indicated number of carbon atoms.
  • the nitrogen atom may itself be substituted with an alkyl or aryl group.
  • arylalkylcarbonylaminoalkyl represents an “arylalkylcarbonylamino” group attached through an “alkyl” group as defined above having the indicated number of carbon atoms.
  • the nitrogen atom may itself be substituted with an alkyl or aryl group.
  • alkylcarbonylaminoalkylcarbonyl represents an alkylcarbonylaminoalkyl group attached through a carbonyl group.
  • the nitrogen atom may be further substituted with an "alkyl” or "aryl” group.
  • aryl represents an unsubstituted, mono-, di- or trisubstituted monocyclic, polycy- die, biaryl and heterocyclic aromatic groups covalently attached at any ring position capable of forming a stable covalent bond, certain preferred points of attachment being apparent to those skilled in the art (e.g., 3-indolyl, 4-imidazolyl).
  • the aryl substituents are independently selected from the group consisting of halo, nitro, cyano, trihalomethyl, C r C 6 alkyl, aryl, arylCrCealkyl, hydroxy, COR 5 , CrC- ⁇ alkyloxy, d-CealkyloxyCrC- ⁇ alkyl, aryloxy, arylC,- C 6 alkyloxy, aryld-CealkyloxyCrCealkyl, thio, d-Cgalkylthio, C C ⁇ alkylthioC C ⁇ al yl, arylthio, arylC r C 6 alkylthio, arylCrCsalkylthioC C ⁇ alkyl, NR 8 R 9 , C r C 6 -alkylamino, CrC ⁇ alkylaminoC C 6 alkyl, arylamino, arylC C 6 alkylamino,
  • aryl includes but is not limited to phenyl, biphenyl, indenyl, fluorenyl, naphthyl (1-naphthyl, 2-naphthyl), pyrrolyl (2-pyrrolyl), pyrazolyl (3-pyrazolyl), imidazolyl (1- imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl), triazolyl (1 ,2,3-triazoM-yl, 1 ,2,3-triazol-2- yl 1 ,2,3-triazol-4-yl, 1 ,2,4-triazol-3-yl), oxazolyl (2-oxazolyl, 4-oxazolyl, 5-oxazolyl), isoxazolyl (3-isoxazolyl, 4-isoxazoiyl, 5-isoxazolyl), thiazolyl (2-thiazolyl, 4-thiazolyl, 5-thiazo
  • arylcarbonyl e.g. 2-thiophenyicarbonyl, 3-methoxy-anthrylcarbonyl, oxazolylcar- bonyl
  • arylcarbonyl represents an "aryl” group as defined above attached through a carbonyl group.
  • arylalkylcarbonyl e.g. (2,3-dimethoxyphenyl)-propylcarbonyl, (2- chloronaphthyl)pentenylcarbonyl, imidazolylcyclo-pentylcarbonyl
  • arylalkylcarbonyl represents an "arylalkyl” group as defined above wherein the "alkyl” group is in turn attached through a carbonyl.
  • the compounds of the present invention which have asymmetric centers may occur as ra- cemates, racemic mixtures, and as individual enantiomers or diastereoisomers, with all iso- meric forms being included in the present invention as well as mixtures thereof.
  • salts of the compounds of the invention where a basic or acidic group is present in the structure, are also included within the scope of this invention.
  • an acidic substituent such as -COOH, 5-tetrazolyl and P(O)(OH)2
  • an acidic salt such as hydrochloride, hydrobromide, acetate, maleate, palmoate, methanesulfonate, p-toluenesulfonate, and the like
  • an acidic salt such as hydrochloride, hydrobromide, acetate, maleate, palmoate, methanesulfonate, p-toluenesulfonate, and the like, can be used as the dosage form.
  • esters can be employed, e.g., methyl, tert-butyl, pivaloyioxymethyl, and the like, and those esters known in the art for modifying solubility or hydrolysis characteristics for use as sustained release or prodrug formulations.
  • solvates may form solvates with water or common organic solvents. Such solvates are encompassed within the scope of the invention.
  • terapéuticaally effective amount shall mean that amount of drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal, or human that is being sought by a researcher, veterinarian, medical doctor or other.
  • the present invention relates to compounds that fulfills all of the following 3 criteria:
  • R, R and R 4 are any chemical group or combination of chemical groups
  • (2) acts as a phosphotyrosine recognition unit ligand, preferably an inhibitor or modulator of one or more PTPases or proteins that contain SH2 domains;
  • R, R,and R 4 are any chemical group or combination of chemical groups, and R- preferably is H.
  • R 1 ? R 2 , R 3 , R 4 and R 5 are any chemical group or combination of chemical groups, and R 3 and R 5 may be covalently linked to each other; 61
  • (2) acts as a phosphotyrosine recognition unit ligand, preferably an inhibitor or modulator of one or more PTPases or proteins that contain SH2 domains;
  • (3) has a molecular weight below or equal to 2500 daltons.
  • R,, R 3 , R 4 and R 5 are any chemical group or combination of chemical groups, and R 3 and R 5 may be covalently linked to each other, and R preferably is H.
  • R 1 t R 3 , R 4 and R 5 are any chemical group or combination of chemical groups, and R 3 and R 5 may be covalently linked to each other, and R is preferably H. 62
  • the compounds of the invention has a structure represented by Formula VI
  • R 3 , R 4 and R 5 are any chemical group or combination of chemical groups, and R 3 and R 5 may be covalently linked to each other, and R is preferably H.
  • a together with the double bond in formula VII represents any aryl as defined above, and R,, R 2 , R 3 and R 4 are any chemical group or combination of chemical groups.
  • Formula VIII 63 wherein A together with the double bond in formula VIII represents any aryl as defined above, and R, R 1 f R 3 and R 4 are any chemical group or combination of chemical groups, and R preferably is H.
  • a together with the double bond in formula IX represents any aryl as defined above, and R R 2 , R 3 and R 4 are any chemical group or combination of chemical groups.
  • a together with the double bond in formula X represents any aryl as defined above, and R 2 , R 3 and R 4 are any chemical group or combination of chemical groups.
  • a together with the double bond in formula XI represents any aryl as defined above, and R, R 3 and R 4 are any chemical group or combination of chemical groups, and R prefera- bly is H.
  • R is a chemical group capable of being a proton donor and/or a proton acceptor, preferably -COOH, 5-tetrazolyl, -NH 2 , -CONH 2 , and R, R 2 , R 3 and R 4 are any chemical group or combination of chemical groups.
  • A is together with the double bond in Formula 1 phenyl, biphenyl, indenyl, fluorenyl, fluo- renyl-9-one, naphthyl, pyridyl, pyridazinyl, pyrimidyl or pyrazinyl;
  • R 3 , R 16 and R 17 are hydrogen, halo, nitro, cyano, trihalomethyl, Chalky!, aryl, arylC r C 6 - alkyl, hydroxy, carboxy, carboxyC ⁇ Cgalkyl, C 1 -C 6 alkyioxycarbonyl, aryloxycarbonyl, arylC r C 6 alkyloxycarbonyl, C Cgalkyioxy, CrC ⁇ alkyloxyd-C ⁇ alkyl, aryloxy, arylC C 6 alkyloxy, arylCrCealkyloxyCrC ⁇ alkyl, thio, C r C 6 alkylthio, d-CealkylthioCrCealkyl, arylthio, arylC r C 6 alkylthio, arylC CealkylthioC Cealkyl, NR 7 R 8 , d-Cealkyl-aminod-C ⁇ alky
  • A-B-C-D-C r C 6 alkyl wherein A is CrC ⁇ alkyl, aryl or arylC r C 6 alkyl; B is amino, thio, SO, SO 2 or oxo; C is C C ⁇ alkyl, amino; D is a chemical bond, amino or C ⁇ Cgalkyl wherein the alkyl and aryl groups are optionally substituted; or 67
  • R 12 , R 13 , and R 14 are independently hydrogen, C r C 6 alkyl, aryl, arylC r C 6 alkyl and the alkyl and aryl groups are optionally substituted;
  • R 4 is hydrogen, hydroxy, d-C 6 alkyl, aryl, aryld-C 6 alkyl, NR 7 R 8 , d-C 6 alkyloxy; wherein the alkyl and aryl groups are optionally substituted;
  • R 5 is hydroxy, d-C 6 alkyl, aryl, aryld-C 6 alkyl, CF 3 , NR 7 R 8 ; wherein the alkyl and aryl groups are optionally substituted;
  • R 6 is hydrogen, C r C 6 alkyl, aryl, aryld-C 6 alkyl; wherein the alkyl and aryl groups are optionally substituted;
  • R 7 and R 8 are independently selected from hydrogen, C r C 6 alkyl, aryl, aryld-C 6 alkyl, C-- C 6 alkylcarbonyl, arylcarbonyl, aryld-C 6 alkyicarbonyl, d-C 6 alkyl-carboxy or arylC r C 6 alkylcarboxy wherein the alkyl and aryl groups are optionally substituted; or R 7 and R 8 are together with the nitrogen to which they are attached forming a saturated, partially saturated or aromatic cyclic, bicyclic or tricyciic ring system containing from 3 to 14 carbon atoms and from 0 to 3 additional heteroatoms selected from nitrogen, oxygen or sulfur, the ring system can optionally be substituted with at least one C 1 -C 6 alkyl, aryl, aryld-C 6 alkyl, hydroxy, oxo, C r C 6 alkyloxy, aryld-C 6 alkyloxy, d
  • R 7 and R 8 are independently a saturated or partial saturated cyclic 5, 6 or 7 membered amine, imide or lactam; 68
  • Compounds of the invention may modulate or inhibit the activity of protein tyrosine phosphatases or other molecules with phosphotyrosine recognition unit(s) via different mechanisms of action. Examples of such mechanism of actions, which are not intended in any way to limit the scope of the invention, are (a) classical competitive inhibition; (b) uncom- petitive inhibition; (c) mixed-type inhibition as defined above.
  • the invention furthermore relates to compounds which after uptake in cells or mammals has a structure as defined above.
  • the compounds of the invention act as classical, competitive inhibitors of one or more PTPases.
  • the compounds of the invention act as mixed-type inhibitors of one or more PTPases.
  • the compounds of the invention substantially act as an inhibitor of one or more PTPases involved in regulation of tyrosine kinase signalling pathways.
  • the compounds of the invention substantially inhibit or modulate receptor-tyrosine kinase signalling pathways via interaction with one or more regulatory PTPases, preferably the signalling pathways of the insulin receptor, the IGF-I receptor and/or other members of the insulin receptor family, the EGF-receptor family, the platelet-derived growth factor receptor family, the nerve growth factor receptor family, the hepatocyte growth factor receptor family, the growth hormone receptor family and/or members of other receptor-type tyrosine kinase families.
  • regulatory PTPases preferably the signalling pathways of the insulin receptor, the IGF-I receptor and/or other members of the insulin receptor family, the EGF-receptor family, the platelet-derived growth factor receptor family, the nerve growth factor receptor family, the hepatocyte growth factor receptor family, the growth hormone receptor family and/or members of other receptor-type tyrosine kinase families.
  • the compounds of the invention substantially inhibit or modulate non-receptor tyrosine kinase signalling through modulation of one or more regulatory PTPases, preferably modulation of members of the Src kinase family or other intracellular kinases. 69 in another preferred embodiment, the compounds of the invention substantially inhibit or modulate the activity of one or more PTPases that negatively regulate signal transduction pathways.
  • the compounds of the invention inhibit or modulate the activity of one or more PTPases that positively regulate signal transduction pathways, preferably CD45.
  • the compounds of the invention inhibit or modulate the activity of one or more PTPases that positively regulate signal transduction pathways in immune ceils.
  • the compounds of the invention inhibit or modulate the activity of one or more PTPases that negatively regulate signal transduction pathway.
  • the compounds of the invention inhibit one or more PTPases via binding to the active site of said PTPase(s) or to other sites that negatively influences the binding of substrate to said PTPase(s), an allosteric modulator.
  • the compounds of the invention modulate the activity of one or more PTPases via interaction with structures positioned outside of the active sites of the enzymes, preferably SH2 domains.
  • the compounds of the invention modulate the signal trans- duction pathways via binding of the compounds of the invention to SH2 domains or PTB domains of non-PTPase signalling molecules.
  • the compounds of the invention are characterized by being selective PTPase inhibitors or compounds that are selective phosphotyrosine recognition unit ligands.
  • the compound of the invention can e.g. be selective for a PTPase not described herein or, preferably, a PTPase listed in Table 1.
  • the compounds of the invention are characterized by being non-selective PTPase inhibitors such as inhibitors or modulators of at least 4 PTPases or 4 PTPase families.
  • the compounds of the invention are selective for the PTP ⁇ family.
  • the compounds of the invention are selective for PTP ⁇ .
  • the compounds of the invention are selective for PTP ⁇ .
  • the compounds of the invention are selective for CD45.
  • the compounds of the invention are selective for PTP ⁇ fam- ily.
  • the compounds of the invention are selective for PTP ⁇ .
  • the compounds of the invention are selective for PTP- DEP1.
  • the compounds of the invention are selective for PTP-LAR family.
  • the compounds of the invention are selective for PTP-LAR.
  • the compounds of the invention are selective for PTP ⁇ .
  • the compounds of the invention are selective for PTP ⁇ .
  • the compounds of the invention are selective for PTP ⁇ family. 71 In one preferred embodiment, the compounds of the invention are selective for PTP ⁇ .
  • the compounds of the invention are selective for PTPK.
  • the compounds of the invention are selective for PTP1 B family.
  • the compounds of the invention are selective for PTP1B.
  • the compounds of the invention are selective for TC-PTP.
  • the compounds of the invention are selective for SHP-PTP family.
  • the compounds of the invention are selective for SHP-1.
  • the compounds of the invention are selective for SHP-2.
  • the compounds of the invention are selective for PTP ⁇ fam- ily.
  • the compounds of the invention are selective for PTP ⁇ .
  • the compounds of the invention are selective for PTP-PEST family.
  • the compounds of the invention are selective for PTPH1 family.
  • the compounds of the invention are selective for PTPH1.
  • the compounds of the invention are selective for PTPD1. 72 In one preferred embodiment, the compounds of the invention are selective for PTPD2.
  • the compounds of the invention are selective for PTPMEG1.
  • the compounds of the invention are selective for IA-2 family.
  • the compounds of the invention are selective for IA-2.
  • the compounds of the invention are selective for IA-2 ⁇ .
  • the compounds of the invention are selective for the PTP ⁇ family.
  • the compounds of the invention are selective for PTP ⁇ .
  • the compounds of the invention are selective for PTPp.
  • the compounds of the invention are selective for PTP ⁇ .
  • the compounds of the invention have a molecular weight of less than 1000 Daltons, and preferably of more than 100 Daltons.
  • the compounds of the invention have K, values of less than 200 ⁇ M against one or more PTPases.
  • the compounds of the invention have K j values of less than 2 ⁇ M against one or more PTPases.
  • the compounds of the invention have K j values of less than 100 nM against one or more PTPases. 73 In another preferred embodiment, the compounds of the invention have a K j value of ⁇ 2 ⁇ M against one or two PTPase or PTPase families and a K j value of > 50 ⁇ M against at least two other PTPases or PTPase families.
  • the compounds of the invention have a K, value of ⁇
  • the compounds of the invention have a IC 50 value of less than 200 M against one or more molecules with phosphotyrosine recognition unit(s).
  • the compounds of the invention have a IC 50 value of less than 2 M against one or more molecules with phosphotyrosine recognition unit(s).
  • the compounds of the invention have a IC 50 value of less than 100 nM against one or more molecules with phosphotyrosine recognition unit(s).
  • the compounds of the invention act as inhibitors of one or more PTPases, e.g. protein tyrosine phosphatases involved in regulation of tyrosine kinase signalling pathways.
  • PTPases e.g. protein tyrosine phosphatases involved in regulation of tyrosine kinase signalling pathways.
  • Preferred embodiments include modulation of receptor- tyrosine kinase signalling pathways via interaction with regulatory PTPases, e.g. the signalling pathways of the insulin receptor, the IGF-I receptor and other members of the insulin receptor family, the EGF-receptor family, the platelet-derived growth factor receptor family, the nerve growth factor receptor family, the hepatocyte growth factor receptor family, the growth hormone receptor family and members of other receptor-type tyrosine kinase families.
  • regulatory PTPases e.g. the signalling pathways of the insulin receptor, the IGF-I receptor and other members of the insulin receptor family, the EGF-re
  • Further preferred embodiments of the inventions is modulation of non- receptor tyrosine kinase signalling through modulation of regulatory PTPases, e.g. modulation of members of the Src kinase family and other non-receptor tyrosine kinases.
  • PTPases e.g. modulation of members of the Src kinase family and other non-receptor tyrosine kinases.
  • One type of preferred embodiment of the inventions relates to modulation of the activity of PTPases that negatively regulate signal transduction pathways.
  • An example, which is not intended in any way to limit the scope of the invention, is SHP-1 that negatively regulates 74 the erythropoietin signalling pathway.
  • Another type of preferred embodiments of the inventions relate to modulation of the activity of PTPases that positively regulate signal transduction pathways.
  • CD45 which dephosphorylates tyrosine kinase of the Src family and thereby plays a positive role in signalling in cells from the hematopoietic system.
  • One type of preferred CD45 inhibitor can be used to regulate the activity of lymphocytes, including T- and/or B-lymphocytes.
  • the compounds of the invention act as modulators or inhibitors of the active site of one or more PTPases.
  • the compounds of the invention modulate the activity of one or more PTPases via interaction with structures positioned outside of the active sites of the enzymes, preferably SH2 domains.
  • Further preferred embodiments include modulation of signal transduction pathways via binding of the compounds of the invention to SH2 domains or PTB domains of non- PTPase signalling molecules.
  • the compounds of the invention are selective inhibitors that are more than 10-fold potent against one PTPase family than against another PTP family.
  • the compounds of the invention can be used for managing, treating or preventing type I diabetes, type II diabetes, impaired glucose tolerance, insulin resistance, obesity, immune dysfunctions including autoimmunity and AIDS, diseases with dysfunctions of the coagulation system, allergic diseases, osteoporosis, proliferative disorders including cancer and psoriasis, diseases with decreased or increased synthesis or effects of growth hormone, diseases with decreased or increased synthesis of hormones or cytokines that regulate the release of/or response to growth hormone, diseases of the brain including Alzheimer's disease and schizophrenia, and infectious diseases.
  • the compounds of the invention can be used for the following reasons.
  • the compounds of the invention can be used for managing, treating or preventing type I diabetes, type II diabetes, impaired glucose tolerance, insulin resistance, and/or obesity. 75 In another embodiment, the compounds of the invention can be used for managing, treating or preventing conditions with immune dysfunctions, including autoimmunity such as rheumatoid arthritis, systemic lupus erythematosus.
  • the compounds of the invention can be used as immunosuppres- sants.
  • the compounds of the invention can be used for managing or treating conditions with immune dysfunctions including AIDS.
  • the compounds of the invention can be used for managing, treating or preventing allergic diseases, including asthma and allergic skin diseases.
  • the compounds of the invention can be used for managing, treat- ing or preventing proliferative disorders, including cancer.
  • the compounds of the invention can be used for managing, treating or preventing osteoporosis.
  • the compounds of the invention can be used for managing, treating or preventing psoriasis.
  • the compounds of the invention can be used for managing, treating or preventing diseases with decreased or increased synthesis or effects of growth hormone, diseases with decreased or increased synthesis of hormones or cytokines that regulate the release of/or response to growth hormone.
  • the compounds of the invention can be used for managing, treating or preventing diseases with dysfunctions of the coagulation system.
  • the compounds of the invention can be used for managing, treating or preventing diseases of the brain including Alzheimer's disease and schizophrenia. 76 In another embodiment, the compounds of the invention can be used for managing, treating or preventing infectious diseases.
  • the compounds of the invention can furthermore be used to manufacture of medicaments for managing, treating or preventing the above-mentioned diseases and disorders.
  • Other preferred embodiments include use of the compounds of the invention for modulation of cell-cell interactions as well as cell-matrix interactions.
  • the present invention is furthermore concerned with pharmaceutical compositions comprising, as an active ingredient, at least one of the compounds of the present invention in association with a pharmaceutical carrier or diluent.
  • the pharmaceutical composition can comprise at least one of the compounds of the invention combined with compounds exhibiting a different activity, e.g. an antibiotic or other pharmacologically active material.
  • the compounds of the invention may be used as therapeuti- cals to inhibit or modulate one or more PTPases involved in regulation of the insulin receptor tyrosine kinase signalling pathway in patients with type I diabetes, type II diabetes, impaired glucose tolerance, insulin resistance, and obesity.
  • Further preferred embodiments include use of the compounds of the invention for management of disorders with general or specific dysfunctions of PTPase activity, e.g. proliferarive disorders such as psoriasis and neopiastic diseases.
  • the compounds of the invention may be used in pharmaceutical preparations for management of osteoporosis.
  • Preferred embodiments of the invention further include use of compound of the invention in pharmaceutical preparations to increase the secretion or action of growth hormone and its analogous or somatomedins including IGF-1 and IGF-2 by modulating the activity of one or more PTPases or other signal transduction molecules with affinity for phosphotyro- sine involved controlling or inducing the action of these hormones or any regulating molecule.
  • the compounds of the invention may be used in pharmaceutical preparations for management of various disorders of the immune system, either as a stimulant or suppressor 77 of normal or perturbed immune functions, including autoimmune reactions. Further embodiments of the invention include use of the compounds of the invention for management of allergic reactions, e.g. asthma, dermal reactions, conjunctivitis.
  • the compounds of the invention may be used in pharmaceutical preparations used for immunosuppression.
  • a non-limiting example of such use is in connection with management of organ and/or tissue transplantation.
  • compounds of the invention may be used in pharmaceutical preparations for prevention or induction of platelet aggregation.
  • compounds of the invention may be used in pharmaceutical preparations for management of infectious disorders, in particular, the compounds of the invention may be used for management of infectious disorders caused by Yersinia and other bacteria as well as disorders caused by viruses or other micro-organisms.
  • Compounds of the invention may additionally be used for management or prevention of diseases in animals, including commercially important animals.
  • Also included in the present invention is a process for isolation of PTPases via affinity purification procedures based on the use of immobilized compounds of the invention using procedures well-known to those skilled in the art. Such methods, well-known to those skilled in the arts, may be used to identify novel PTPases or other molecules with phosphotyrosine recognition units.
  • compounds of the invention may be immobilized by coupling to a solid-phase.
  • a tissue sample or a sample from a cell line prepared as a lysate by methods well-known to those skilled in the art may be passed over said solid-phase coupled with a compound of the invention.
  • PTPases or other molecules with phosphotyrosine recognition units will be bound to the compounds of the invention coupled to the solid phase.
  • Said PTPases or other molecules with phosphotyrosine recognition units may in turn be released by procedures well-known in the art and further subjected to amino acid sequence analysis according to standard procedures well- known to those skilled in the art.
  • amino acid sequence analysis By back-translation of said amino acid sequence into a 78 nucleotide sequence of the corresponding cDNA can be deduced using the appropriate genetic code.
  • Said nucleotide sequence can be used to design and produce an equivalent oligonucleotide, which in turn can be used to identify partial or full-length cDNA clones from appropriate cDNA libraries encoding a protein or glycoprotein corresponding to or similar to the isolated PTPase or molecule with pTyr recognition units.
  • Said oligonucleotide or isolated cDNA clone(s) can similariy be used to isolate genomic clones corresponding to said cDNA clones.
  • Said partial or full-length cDNA can be inserted into appropriate vectors and expressed and purified proteins with procedures well known to those skilled in the arts. Said purified proteins, in particular PTPases, may be used to further analyze the inhibitory capacity and selectivity of compounds of the invention as described.
  • the invention is further directed to compounds of the invention coupled to a suitable solid- phase matrix such as a Wang-resin or a Rink-resin
  • the invention is further diected to a method for isolating a protein or a glycoprotein with affinity for a compound according to the invention from a biological sample, comprising:
  • the invention is further directed to a method for isolating a protein-tyrosine phosphatase with affinity for a compound according to the invention from a biological sample, compris- ing
  • the invention is further directed to a method for isolating a Src-homology 2 domain containing protein or a phosphotyrosine binding domain containing protein with affinity for a compound of the present invention from a biological sample, comprising 79
  • the present invention also relates to a compound of the invention coupled to a fluorescent or radioactive molecule.
  • the invention furthermore relates to a method for coupling a fluorescent or radioactive molecule to a compound of the invention comprising
  • the invention is further directed to a method for detecting protein-tyrosine phosphatase or other molecules with phosphotyrosine recognition unit(s) in a cell or in a subject using a compound of the invention coupled to a fluorescent or radioactive molecule comprising
  • the invention is further directed to a method for quantifying the amount of protein-tyrosine phosphatases or other molecules with phosphotyrosine recognition unit(s) in a cell or in a subject using a compound of the invention coupled to a fluorescent or radioactive molecule comprising
  • the invention is also concerned with a method for determining the function of a given protein-tyrosine phosphatase or group of protein-tyrosine phosphatases or said molecules with phosphotyrosine recognition unit(s) in a cell or a subject using a compound of the invention coupled to a fluorescent or radioactive molecule comprising • contacting said cell or an extract thereof or a biological sample from said subject or by injecting said compound into said subject in order for said compound to produce a complex with said protein-tyrosine phosphatase or said molecules with phosphotyrosine recognition unit(s)
  • dosages suitable for oral administration comprise from about 0.5 mg to about 1000 mg, preferably from about 1 mg to about 500 mg of the compounds of the invention ad- mixed with a pharmaceutical carrier or diluent.
  • the compounds of the invention may be administered in a pharmaceutically acceptable acid addition salt form or where possible as a metal or a C ⁇ -aikylammonium salt.
  • Such salt forms exhibit approximately the same order of activity as the free acid forms.
  • compositions comprising a compound of the invention or a pharmaceutically acceptable salt thereof and, usually, such compositions also contain a pharmaceutical carrier or diluent.
  • compositions containing the com- 81 pounds of this invention may be prepared by conventional techniques and appear in conventional forms, for example capsules, tablets, solutions or suspensions.
  • the pharmaceutical carrier employed may be a conventional solid or liquid carrier.
  • Exam- pies of solid carriers are lactose, terra alba, sucrose, talc, gelatine, agar, pectin, acacia, magnesium stearate and stearic acid.
  • Examples of liquid carriers are syrup, peanut oil, olive oil and water.
  • the carrier or diluent may include any time delay material known to the art, such as glyceryl monostearate or glyceryl distearate, alone or mixed with a wax.
  • the preparation can be tabletted, placed in a hard gelatine capsule in powder or pellet form or it can be in the form of a troche or lozenge.
  • the amount of solid carrier will vary widely but will usually be from about 25 mg to about 1 g.
  • the preparation may be in the form of a syrup, emulsion, soft gelatin capsule or sterile injectable liquid such as an aqueous or non-aqueous liquid suspension or solution.
  • the compounds of this invention are dispensed in unit dosage form comprising 10-200 mg of active ingredient in or together with a pharmaceutically acceptable carrier per unit dosage.
  • the dosage of the compounds according to this invention is 1-500 mg/day, e.g. about 100 mg per dose, when administered to patients, e.g. humans, as a drug.
  • a typical tablet that may be prepared by conventional tabletting techniques contains
  • Active compound (as free compound 100 mg or salt thereof) Colloidal silicon dioxide (Areosil ® ) 1.5 mg
  • the route of administration may be any route which effectively transports the active compound to the appropriate or desired site of action, such as oral or parenteral e.g. redal, transdermal, subcutaneous, intranasal, intramuscular, topical, intravenous, intraurethrai, ophthalmic solution or an ointment, the oral route being preferred.
  • oral or parenteral e.g. redal, transdermal, subcutaneous, intranasal, intramuscular, topical, intravenous, intraurethrai, ophthalmic solution or an ointment, the oral route being preferred.
  • TLC thin layer chromatography
  • CDCI 3 is deuterio chloroform
  • CD3OD is tetradeuterio methanol
  • DMSO-d 6 is hexadeuterio dimethylsulfoxide.
  • the structures of the compounds are confirmed by either elemental analysis or NMR, where peaks as- signed to characteristic protons in the title compounds are presented where appropriate.
  • the aqueous phase was extracted with ethyl acetate 85 (100 ml) and the combined organic phases were washed with water (2 x 80 ml), diluted aqueous ammoniac (80 ml) and saturated aqueous sodium chloride (80 ml).
  • the organic phase was dried (MgSO 4 ), filtered and evaporated in vacuo affording 3.4 g of crude 4-amino- biphenyl-3-carboxylic acid methyl ester which was purified on silicagel (1 I) using a mixture of ethyl acetate and heptane (1 :3) as eluent. Pure fractions were collected and evaporated in vacuo affording 2.7 g (91 %) of 4-amino-biphenyl-3-carboxylic acid methyl ester.
  • 5-(3-Dimethylamino-prop-1 -yny0-2-(oxalyl-amino)-benzoic acid To a solution of 5-lodoanthranilic acid (3.0 g, 11.4 mmol) and N,N-diisopropylethylamine (4 ml, 22.8 mmol) in anhydrous tetrahydrofuran (40 ml) was added imidazol-1-yl-oxo-acetic acid tert-butyl ester (4.47g, 22.8 mmol). The reaction was stirred at room temperature for 3 h. The solvents were evaporated in vacuo and the crude mixture extracted into ethyl acetate (70 ml).
  • the dried product (0.65 g) was purified by silica gel (400 ml) chromatography using 5 % acetic acid in ethyl acetate as eluent. Pure fractions were collected and the volatiles were evaporated in vacuo. The residue was washed with water and dried in vacuo at 50 °C for 16 h affording 0.4 g (36 %) of the tjtle compound as a solid.
  • Example 54 The following examples were prepared in a similar way as described in Example 54.

Abstract

The present invention provides novel compounds, novel compositions, methods of their use, and methods of their manufacture, where such compounds are pharmacologically useful inhibitors of Protein Tyrosine Phosphatases (PTPases, PTPs) such as PTP1B, TC-PTP, CD45, SHP-1, SHP-2, PTPα, PTPε, PTPν, PTPδ, PTPσ, PTPz, PTPβ, PTPD1, PTPD2, PTPH1, PTP-MEG1, PTP-LAR, and HePTP. These compounds are indicated in the management or treatment of a broad range of diseases such as autoimmune diseases, acute and chronic inflammation, osteoporosis, various forms of cancer and malignant diseases, and type I diabetes and type II diabetes.

Description

1
Modulators of Protein Tyrosine Phosphatases
FIELD OF INVENTION
The present invention provides novel compounds, novel compositions, methods of their use, and methods of their identification, where such compounds are pharmacologically useful inhibitors of Protein Tyrosine Phosphatases (PTPases, PTPs) such as PTP1B, TC-PTP, CD45, SHP-1 , SHP-2, PTPα, PTPε, PTPμ, PTPδ, PTPσ, PTPζ, PTPβ, PTPD1 , PTPD2, PTPH1 , PTP-MEG1 , PTP-LAR, and HePTP or ligands of phosphotyrosine units. These compounds are indicated in the management or treatment of a broad range of diseases such as autoimmune diseases, acute and chronic inflammation, osteoporosis, various forms of cancer and malignant diseases, and type I diabetes and type II diabetes.
BACKGROUND OF THE INVENTION
In accordance with the definition of in vivo activity of protein tyrosine phosphatases (PTPases) such as the following non-limiting examples PTPα, LAR, TC-PTP, SHP-1 , SHP-2, PTPβ, CD45, PTP1 B, HePTP, it has been found that their unique activity plays a major role in the intracellular modulation and regulation of fundamental cellular signalling mechanisms involved in metabolism, growth, proliferation and differentiation (Flint et al., The EMBO J. 12:1937-46,1993; Fischer et al, Science 253:401- 6, 1991). Overexpression or altered activity of tyrosine phosphatases can also contribute to the symptoms and progression of various diseases (Wiener, et al., J. Natl. cancer Inst. 86:372-8, 1994; Hunter and Cooper, Ann. Rev. Biochem, 54:897-930, 1985). Furthermore, there is increasing evidence which suggests that inhibition of these PTPases may help treat certain types of diseases such as diabetes, autoimmune disease, acute and chronic inflammation and various forms of cancer.
Protein phosphorylation is now well recognized as an important mechanism utilized by ceils to transduce signals during different stages of cellular function (Fischer et al, Science 253:401-6 (1991); Flint et al., The EMBO J. 12:1937-46 (1993)). There are at least two major classes of phosphatases: (1) those that dephosphorylate proteins (or peptides) that contain a phosphate group(s) on a serine or threonine moiety (termed Ser/Thr phosphatases) and (2) those that remove a phosphate group(s) from the amino acid tyrosine (termed protein tyrosine phosphatases or PTPases).
The PTPases are a family of enzymes that can be classified into two groups: a) intra- cellular or nontransmembrane PTPases and b) receptor-type or transmembrane PTPases.
Intracellular PTPases: Most known intracellular type PTPases contain a single conserved catalytic phosphatase domain consisting of 220-240 amino acid residues. The regions outside the PTPase domains are believed to play important roles in localizing the intracellular PTPases subcellularly (Mauro, L.J. and Dixon, J.E. TIBS 19: 151-155 (1994)). The first intracellular PTPase to be purified and characterized was PTP1B which was isolated from human placenta (Tonks et al., J. Biol. Chem. 263: 6722-6730 (1988)). Shortly after, PTP1B was cloned (Charbonneau et al., Proc. Natl. Acad. Sci. USA 86: 5252-5256 (1989); Chernoff et al., Proc. Natl. Acad. Sci. USA 87: 2735-2789 (1989)). Other examples of intracellular PTPases include (1) T-cell PTPase (Cool et al. Proc. Natl. Acad. Sci. USA 86: 5257-5261 (1989)), (2) rat brain PTPase (Guan et al., Proc. Natl. Acad. Sci. USA 87:1501-1502 (1990)), (3) neuronal phosphatase STEP (Lombroso et al., Proc. Natl. Acad. Sci. USA 88: 7242-7246 (1991)), (4) ezrin- domain containing PTPases: PTPMEG1 (Gue. al., Proc. Natl. Acad. Sci. USA 88: 5867-57871 (1991)), PTPH1 (Yang and Tonks, Proc. Natl. Acad. Sci. USA 88: 5949- 5953 (1991)), PTPD1 and PTPD2 (Møller et al., Proc. Natl. Acad. Sci. USA 91: 7477- 7481 (1994)), FAP-1/BAS (Sato et al., Science 268: 411-415 (1995); Banville et al., J. Biol. Chem. 269: 22320-22327 (1994); Maekawa et al., FEBS Letters 337: 200-206 (1994)), and SH2 domain containing PTPases: PTP1C/SH-PTP1/SHP-1 (Plutzky et al., Proc. Natl. Acad. Sci. USA 89: 1123-1127 (1992); Shen et al., Nature Lond. 352: 736-739 (1991)) and PTP1D/Syp/SH-PTP2/SHP-2 (Vogel et al., Science 259: 1611- 1614 (1993); Feng et al., Science 259: 1607-1611 (1993); Bastein et al., Biochem. Biophys. Res. Comm. 196: 124-133 (1993)).
Low molecular weight phosphotyrosine-protein phosphatase (LMW-PTPase) shows very little sequence identity to the intracellular PTPases described above. However, this enzyme belongs to the PTPase family due to the following characteristics: (i) it possesses the PTPase active site motif: Cys-Xxx-Xxx-Xxx-Xxx-Xxx-Arg (Cirri et al., Eur. J. Biochem. 214: 647-657 (1993)); (ii) this Cys residue forms a phospho- intermediate during the catalytic reaction similar to the situation with 'classical' PTPases (Cirri et al., supra; Chiarugi et al., FEBS Lett. 310: 9-12 (1992)); (iii) the overall folding of the molecule shows a surprising degree of similarity to that of PTP1 B and Yersinia PTP (Su et al., Nature 370: 575-578 (1994)).
Receptor-type PTPases consist of a) a putative ligand-binding extracellular domain, b) a transmembrane segment, and c) an intracellular catalytic region. The structures and sizes of the putative ligand-binding extracellular domains of receptor-type PTPases are quite divergent. In contrast, the intracellular catalytic regions of receptor-type PTPases are very homologous to each other and to the intracellular PTPases. Most receptor-type PTPases have two tandemly duplicated catalytic PTPase domains.
The first receptor-type PTPases to be identified were (1) CD45/LCA (Ralph, S.J., EMBO J. 6: 1251 -1257 (1987)) and (2) LAR (Streuli et al., J. Exp. Med. 168: 1523- 1530 (1988)) that were recognized to belong to this class of enzymes based on homology to PTP1B (Charbonneau et al., Proc. Natl. Acad. Sci. USA 86: 5252-5256 (1989)). CD45 is a family of high molecular weight glycoproteins and is one of the most abundant leukocyte cell surface glycoproteins and appears to be exclusively ex- pressed upon cells of the hematopoietic system (Trowbridge and Thomas, Ann. Rev. Immunol. 12: 85-116 (1994)).
The identification of CD45 and LAR as members of the PTPase family was quickly followed by identification and cloning of several different members of the receptor-type PTPase group. Thus, 5 different PTPases, (3) PTPα, (4) PTPβ, (5) PTPδ, (6) PTPε, and (7) PTPζ, were identified in one early study (Krueger et al., EMBO J. 9: 3241- 3252 (1990)). Other examples of receptor-type PTPases include (8) PTPγ (Barnea et al., Mol. Cell. Biol. 13: 1497-1506 (1995)) which, like PTPζ (Krueger and Saito, Proc. Natl. Acad. Sci. USA 89: 7417-7421 (1992)) contains a carbonic anhydrase-like do- main in the extracellular region, (9) PTPμ (Gebbink et al., FEBS Letters 290: 123-130 (1991)), (10) PTPK (Jiang et al., Mol. Cell. Biol. 13: 2942-2951 (1993)). Based on structural differences the receptor-type PTPases may be classified into subtypes (Fischer et al., Science 253: 401-406 (1991)): (I) CD45; (II) LAR, PTPδ, (11) PTPσ ; (III) PTPβ, (12) SAP-1 (Matozaki et al., J. Biol. Chem. 269: 2075-2081 (1994)), (13) PTP-U2/GLEPP1 (Seimiya et al., Oncogene 10: 1731-1738 (1995); Thomas et al., J. Biol. Chem. 269: 19953-19962 (1994)), and (14) DEP-1; (IV) PTPα,_PTPε. All receptor-type PTPases except Type III contain two PTPase domains. Novel PTPases are continuously identified, and it is anticipated that more than 500 different species will be found in the human genome, i.e. close to the predicted size of the protein tyrosine kinase superfamiiy (Hanks and Hunter, FASEB J. 9: 576-596 (1995)).
PTPases are the biological counterparts to protein tyrosine kinases (PTKs). Therefore, one important function of PTPases is to control, down-regulate, the activity of PTKs. However, a more complex picture of the function of PTPases now emerges. Several studies have shown that some PTPases may actually act as positive mediators of cellular signalling. As an example, the SH2 domain-containing SHP-2 seems to act as a positive mediator in insulin-stimulated Ras activation (Noguchi et al., Mol. Cell. Biol. 14: 6674-6682 (1994)) and of growth factor-induced mitogenic signal trans- duction (Xiao et al., J. Biol. Chem. 269: 21244-21248 (1994)), whereas the homologous SHP-1 seems to act as a negative regulator of growth factor-stimulated proliferation (Bignon and Siminovitch, Clin.lmmunol. Immunopathol. 73: 168-179 (1994)). Another example of PTPases as positive regulators has been provided by studies designed to define the activation of the Src-family of tyrosine kinases. in particular, sev- eral lines of evidence indicate that CD45 is positively regulating the activation of hematopoietic cells, possibly through dephosphorylation of the C-terminal tyrosine of Fyn and Lck (Chan et al., Annu. Rev. Immunol. 12: 555-592 (1994)).
Dual specificity protein tyrosine phosphatases (dsPTPases) define a subclass within the PTPases family that can hydrolyze phosphate from phosphortyrosine as well as from phosphor-serine/threonine. dsPTPases contain the signature sequence of PTPases: Cys-Xxx-Xxx-Xxx~Xxx-Xxx-Arg. At least three dsPTPases have been shown to dephosphorylate and inactivate extracellular signal-regulated kinase (ERKs)/mitogen-activated protein kinase (MAPK): MAPK phosphatase (CL100, 3CH134) (Charles et al., Proc. Natl. Acad. Sci. USA 90: 5292-5296 (1993)); PAC-1 (Ward et al., Nature 367: 651-654 (1994)); rVH6 (Mourey et al., J. Biol. Chem. 271: 3795-3802 (1996)). Transcription of dsPTPases are induced by different stimuli, e.g. oxidative stress or heat shock (Ishibashi et al., J. Biol. Chem. 269: 29897-29902 (1994); Keyse and Emslie, Nature 359: 644-647 (1992)). Further, they may be in- volved in regulation of the cell cycle: cdc25 (Millar and Russell, Cell 68: 407-410 (1992)); KAP (Hannon et al., Proc. Natl. Acad. Sci. USA 91: 1731-1735 (1994)). Interestingly, tyrosine dephosphorylation of cdc2 by a dual specific phosphatase, cdc25, is required for induction of mitosis in yeast (review by Walton and Dixon, Annu. Rev. Biochem. 62: 101-120 (1993)).
PTPases were originally identified and purified from cell and tissue lysates using a variety of artificial substrates and therefore their natural function of dephosphorylation was not well known. Since tyrosine phosphorylation by tyrosine kinases is usu- ally associated with cell proliferation, cell transformation and cell differentiation, it was assumed that PTPases were also associated with these events. This association has now been proven to be the case with many PTPases. PTP1 B, a phosphatase whose structure was recently elucidated (Barford et al., Science 263:1397- 1404 (1994)) has been shown to be involved in insulin-induced oocyte maturation (Flint et al., The EMBO J. 12:1937-46 (1993)) and recently it has been suggested
_-_rb B2 that the overexpression of this enzyme may be involved in p185 -associated breast and ovarian cancers (Wiener, et al., J. Natl. cancer Inst. 86:372-8 (1994); Weiner et al., Am. J. Obstet. Gynecol. 170:1177-883 (1994)). The insulin-induced oocyte maturation mechanism has been correlated with the ability of PTP1B to block activation of S6 kinase. The association with cancer is recent evidence which suggests that overexpression of PTP1 B is statistically correlated with increased levels of p185 c-erb B2 jn ovarjan ancj breast cancer. The role of PTP1 B in the etiology and pro¬ gression of the disease has not yet been elucidated. Inhibitors of PTP1 B may therefore help clarify the role of PTP1B in cancer and in some cases provide thera- peutic treatment for certain forms of cancer.
The activity of a number of other newly discussed phosphatases are currently under investigation. Two of these: SHP-1 and Syp/PTP1 D/SHPTP2/PTP2C/SHP-2 have recently been implicated in the activation of Platelet Derived Growth Factor and Epi- dermal Growth Factor induced responses (Li et al., Mole. Cell. Biol. 14:509-17
(1994)). Since both growth factors are involved in normal cell processing as well as disease states such as cancer and arteriosclerosis, it is hypothesized that inhibitors of these phosphatases would also show therapeutic efficacy. Accordingly, the com- pounds of the present invention, which exhibit inhibitory activity against various PTPases, are indicated in the treatment or management of the foregoing diseases.
PTPases: the insulin receptor signalling pathway/diabetes
Insulin is an important regulator of different metabolic processes and plays a key role in the control of blood glucose. Defects related to its synthesis or signalling lead to diabetes mellitus. Binding of insulin to its receptor causes rapid (auto)phosphorylation of several tyrosine residues in the intracellular part of the b-subunit. Three closely po- sitioned tyrosine residues (the tyrosine-1150 domain) must all be phosphorylated to obtain full activity of the insulin receptor tyrosine kinase (IRTK) which transmits the signal further downstream by tyrosine phosphorylation of other cellular substrates, including insulin receptor substrate- 1 (IRS-1) (Wilden et al., J. Biol. Chem. 267: 16660- 16668 (1992); Myers and White, Diabetes 42: 643-650 (1993); Lee and Pilch, Am. J. Physiol. 266: C319-C334 (1994); White et al., J. Biol. Chem. 263: 2969-2980 (1988)). The structural basis for the function of the tyrosine-triplet has been provided by recent X-ray crystallographic studies of IRTK that showed tyrosine-1150 to be autoinhibitory in its unphosphorylated state (Hubbard et al., Nature 372: 746-754 (1994)).
Several studies clearly indicate that the activity of the auto-phosphorylated IRTK can be reversed by dephosphorylation in vitro (reviewed in Goldstein, Receptor 3: 1-15 (1993); Mooney and Anderson, J. Biol. Chem. 264: 6850-6857 (1989)), with the tri- phosphorylated tyrosine-1150 domain being the most sensitive target for protein- tyrosine phosphatases (PTPases) as compared to the di- and mono- phosphorylated forms (King et al., Biochem. J. 275: 413-418 (1991)). It is, therefore, tempting to speculate that this tyrosine-triplet functions as a control switch of IRTK activity. Indeed, the IRTK appears to be tightly regulated by PTP-mediated dephosphorylation in vivo (Khan et al., J. Biol. Chem. 264: 12931-12940 (1989); Faure et al., J. Biol. Chem. 267: 11215-11221 (1992); Rothenberg et al., J. Biol. Chem. 266: 8302-8311 (1991)). The intimate coupling of PTPases to the insulin signalling pathway is further evidenced by the finding that insulin differentially regulates PTPase activity in rat hepa- toma cells (Meyerovitch et al., Biochemistry 31: 10338-10344 (1992)) and in livers from alloxan diabetic rats (Boylan et al., J. Clin. Invest. 90: 174-179 (1992)). Relatively little is known about the identity of the PTPases involved in IRTK regulation. However, the existence of PTPases with activity towards the insulin receptor can be demonstrated as indicated above. Further, when the strong PTPase-inhibitor perva- nadate is added to whole cells an almost full insulin response can be obtained in adi- pocytes (Fantus et al, Biochemistry 28: 8864-8871 (1989); Eriksson et al, Diabetolo- gia 39: 235-242 (1995)) and skeletal muscle (Leighton et al, Biochem. J. 276: 289- 292 (1991)). In addition, recent studies show that a new class of peroxovanadium compounds act as potent hypogiycemic compounds in vivo (Posner et al, supra). Two of these compounds were demonstrated to be more potent inhibitors of dephospho- rylation of the insulin receptor than of the EGF-receptor.
It was recently found that the ubiquitously expressed SH2 domain containing PTPase, SHP-2 (Vogel et al, 1993, supra), associates with and dephosphorylates IRS-1 , but apparently not the IR itself (Kuhne et al, J. Biol. Chem. 268: 11479-11481 (1993); (Kuhne et al, J. Biol. Chem. 269: 15833-15837 (1994)).
Previous studies suggest that the PTPases responsible for IRTK regulation belong to the class of membrane-associated (Faure et al, J. Biol. Chem. 267: 11215-11221 (1992)) and glycosylated molecules (Haring et al, Biochemistry 23: 3298-3306 (1984); Sale, Adv. Prot. Phosphatases 6: 159-186 (1991)). Hashimoto et al. have pro- posed that LAR might play a role in the physiological regulation of insulin receptors in intact cells (Hashimoto et al, J. Biol. Chem. 267: 13811-13814 (1992)). Their conclusion was reached by comparing the rate of dephosphorylation/inactivation of purified IR using recombinant PTP1B as well as the cytoplasmic domains of LAR and PTPa. Antisense inhibition was recently used to study the effect of LAR on insulin signalling in a rat hepatoma cell line (Kulas et al, J. Biol. Chem. 270: 2435-2438 (1995)). A suppression of LAR protein levels by about 60 percent was paralleled by an approximately 150 percent increase in insulin-induced auto-phosphorylation. However, only a modest 35 percent increase in IRTK activity was observed, whereas the insulin- dependent phosphatidylinositol 3-kinase (PI 3-kinase) activity was significantly in- creased by 350 percent. Reduced LAR levels did not alter the basal level of IRTK tyrosine phosphorylation or activity. The authors speculate that LAR could specifically dephosphorylate tyrosine residues that are critical for PI 3-kinase activation either on the insulin receptor itself or on a downstream substrate. While previous reports indicate a role of PTPα in signal transduction through src activation (Zheng et al., Nature 359: 336-339 (1992); den Hertog et al, EMBO J. 12: 3789-3798 (1993)) and interaction with GRB-2 (den Hertog et al, EMBO J. 13: 3020- 3032 (1994); Su et al, J. Biol. Chem. 269: 18731-18734 (1994)), a recent study sug- gests a function for this phosphatase and its close relative PTPε as negative regulators of the insulin receptor signal (Møller et al, 1995 supra). This study also indicates that receptor-like PTPases play a significant role in regulating the IRTK, whereas intracellular PTPases seem to have little, if any, activity towards the insulin receptor. While it appears that the target of the negative regulatory activity of PTPases α and ε is the receptor itself, the downmodulating effect of the intracellular TC-PTP seems to be due to a downstream function in the IR-activated signal. Although PTP1B and TC- PTP are closely related, PTP1 B had only little influence on the phosphorylation pattern of insulin-treated cells. Both PTPases have distinct structural features that determine their subcellular localization and thereby their access to defined cellular sub- strates (Frangione et al, Cell 68: 545-560 (1992); Faure and Posner, Glia 9: 311-314 (1993)). Therefore, the lack of activity of PTP1 B and TC-PTP towards the IRTK may, at least in part, be explained by the fact that they do not co-localize with the activated insulin receptor. In support of this view, PTP1B and TC-PTP have been excluded as candidates for the IR-associated PTPases in hepatocytes based on subcellular local- ization studies (Faure et al, J. Biol. Chem. 267: 11215-11221 (1992)).
The transmembrane PTPase CD45, which is believed to be hematopoietic cell- specific, was in a recent study found to negatively regulate the insulin receptor tyrosine kinase in the human multiple myeloma cell line U266 (Kulas et al., J. Biol. Chem. 271 : 755-760 (1996)).
Knock-out (K.O.) mice have been useful in elucidating the importance of specific genes in a number of cases. From the results presented above, it would be expected that in particular LAR K.O. mice, PTPα K.O. mice and PTP1 B K.O. mice, respectively, could provide important information in relation to insulin signaling. Two groups have generated LAR K.O. mice (Schaapveld at al., Developmental Biology 188: 134-146 (1997); Skarnes et al., Proc. Natl Acad.Sci. U.S.A. 92:6592-6596 (1995)). Goldstein and co- workers analyzed the LAR K.O. mice from Skarnes et al. (supra) and claimed that these mice exhibited profound defects in glucose-homeostasis and (Ren et al., Diabe- tes 47:493-497 (1998)). However, the control mice in this study were of a different genetic background than the K.O. mice. Other studies - using the LAR K.O. mice generated by Schaapveld et al. (supra) - did not confirm the results obtained by Ren et al. (supra) (A. R. Sorensen et al., Diabetologia 40 (Suppl 1):556-556 (1997)). In a recent thorough study, PTP1 B K.O. mice (i.e. PTP1 B -/- mice) were compared with +/+ and +/- mice of the same genetic background (Elchebly et al., Science 283: 1544-1548 (1999)). In this latter study (Elcheby et al., supra), it was found that disruption of the gene encoding the PTP1 B yielded healthy mice that - in the fed state - had blood glucose levels that were slightly lower and concentrations of insulin that were about Vi of those found in their PTP1 B+/+ littermates. Further, both insulin and glucose tolerance tests showed enhanced insulin sensitivity in the PTP K.O. mice. On a high-fat diet, PTP1B-/- and PTP1B-/+ mice were resistant to weight gain and remained insulin sensitive - in contrast to the PTP1B +/+ mice that rapidly gained weight and became insulin resistant. Analysis of the levels of tyrosine phosphorylation of the insulin receptor and insulin receptor substrate-1 (IRS-1) showed increased phosphorylation of these proteins in PTP1B -/- mice (liver and muscle) in comparison with the PTP1B +/+ mice. All of these findings are in accordance with the notion that PTP1 B is likely to play a major role as negative regulator of the insulin receptor signaling pathway - and in contrast to the above-mentioned in vitro studies. The authors conclude that 'these results make PTP-1 B a potential therapeutic target for treatment of type 2 diabetes and obesity' (Elcheby et al., supra).
PTPases: somatostatin
Somatostatin inhibits several biological functions including cellular proliferation
(Lamberts et al, Molec. Endocrinol. 8: 1289-1297 (1994)). While part of the antiprolif- erative activities of somatostatin are secondary to its inhibition of hormone and growth factor secretion (e.g. growth hormone and epidermal growth factor), other antiprolif- erative effects of somatostatin are due to a direct effect on the target cells. As an ex- ample, somatostatin analogs inhibit the growth of pancreatic cancer presumably via stimulation of a single PTPase, or a subset of PTPases, rather than a general activation of PTPase levels in the cells (Liebow et al, Proc. Natl. Acad. Sci. USA 86: 2003- 2007 (1989); Colas et al, Eur. J. Biochem. 207: 1017-1024 (1992)). In a recent study it was found that somatostatin stimulation of somatostatin receptors SSTR1 , but not 10
SSTR2, stably expressed in CHO-K1 ceils can stimulate PTPase activity and that this stimulation is pertussis toxin-sensitive. Whether the inhibitory effect of somatostatin on hormone and growth factor secretion is caused by a similar stimulation of PTPase activity in hormone producing cells remains to be determined.
PTPases: the immune system/autoimmunity
Several studies suggest that the receptor-type PTPase CD45 plays a critical role not only for initiation of T cell activation, but also for maintaining the T cell receptor- mediated signalling cascade. These studies are reviewed in: (Weiss A., Ann. Rev. Genet. 25: 487-510 (1991); Chan et al, Annu. Rev. Immunol. 12: 555-592 (1994); Trowbridge and Thomas, Annu. Rev. Immunol 12: 85-116 (1994)). CD45 is one of the most abundant of the cell surface glycoproteins and is expressed exclusively on hemopoetic cells. In T cells, it has been shown that CD45 is one of the critical components of the signal transduction machinery of lymphocytes. In particular, evidence has suggested that CD45 phosphatase plays a pivotal role in antigen-stimulated proliferation of T lymphocytes after an antigen has bound to the T cell receptor (Trowbridge, Ann. Rev. Immunol, 12:85-116 (1994)). Several studies suggest that the PTPase activity of CD45 plays a role in the activation of Lck, a lymphocyte-specific member of the Src family protein-tyrosine kinase (Mustelin etal., Proc. Natl. Acad. Sci. USA 86: 6302-6306 (1989); Ostergaard et al., Proc. Natl. Acad. Sci. USA 86: 8959-8963 (1989)). These authors hypothesized that the phosphatase activity of CD45 activates Lck by dephosphorylation of a C-terminal tyrosine residue, which may, in turn, be related to T-cell activation. In a recent study it was found that recombinant p56lck specifically associates with recombinant CD45 cytoplasmic domain protein, but not to the cytoplasmic domain of the related PTPαa (Ng et al., J Biol Chem. 271 : 1295-1300 (1996)). The p56lck-CD45 interaction seems to be mediated via a nonconventional SH2 domain interaction not requiring phosphotyrosine. In immature B cells, another member of the Src family protein- tyrosine kinases, Fyn, seems to be a selective substrate for CD45 compared to Lck and Syk (Katagiri et al., J Biol. Chem. 270: 27987-27990 (1995)).
Studies using transgenic mice with a mutation for the CD45-exon6 exhibited lacked mature T ceils. These mice did not respond to an antigenic challenge with the typi- 11 cal T cell mediated response (Kishihara et al., Cell 74:143-56 (1993)). Inhibitors of CD45 phosphatase would therefore be very effective therapeutic agents in conditions that are associated with autoimmune disease.
CD45 has also been shown to be essential for the antibody mediated degranulation of mast cells (Berger et al., J. Exp. Med. 180:471-6 (1994)). These studies were also done with mice that were CD45-deficient. In this case, an IgE-mediated degranulation was demonstrated in wild type but not CD45-deficient T cells from mice. These data suggest that CD45 inhibitors could also play a role in the symptomatic or therapeutic treatment of allergic disorders.
Another recently discovered PTPase, an inducible lymphoid-specific protein tyrosine phosphatase (HePTP) has also been implicated in the immune response. This phosphatase is expressed in both resting T and B lymphocytes, but not non- hemopoetic cells. Upon stimulation of these cells, mRNA levels from the HePTP gene increase 10-15 fold (Zanke et al, Eur. J. Immunol. 22:235-239 (1992)). In both T and B cells HePTP may function during sustained stimulation to modulate the immune response through dephosphorylation of specific residues. Its exact role, however remains to be defined.
Likewise, the hematopoietic cell specific SHP-1 seems to act as a negative regulator and play an essential role in hematopoietic cell development. Thus, SHP-1 plays a significant role in regulating the erythropoietin signalling pathway, which is enhanced in mice lacking intact SHP-1 (Schultz et al. Cell 73: 1445-1454. In accor- dance with the above-mentioned important function of CD45, HePTP and SHP-1 , selective PTPase inhibitors may be attractive drug candidates both as immunosup- pressors and as immunostimulants as well as inhibitors and stimulants of the hematopoietic system. One recent study illustrates the potential of PTPase inhibitors as immunmodulators by demonstrating the capacity of the vanadium-based PTPase inhibitor, BMLOV, to induce apparent B cell selective apoptosis compared to T cells (Schieven et al., J. Biol. Chem. 270: 20824-20831 (1995)). 12 PTPases: cell-cell interactions/cancer
Focal adhesion plaques, an in vitro phenomenon in which specific contact points are formed when fibroblasts grow on appropriate substrates, seem to mimic, at least in part, cells and their natural surroundings. Several focal adhesion proteins are phosphorylated on tyrosine residues when fibroblasts adhere to and spread on extracellular matrix (Gumbiner, Neuron 11, 551-564 (1993)). However, aberrant tyrosine phosphorylation of these proteins can lead to cellular transformation. The intimate association between PTPases and focal adhesions is supported by the finding of several in- tracellular PTPases with ezrin-iike N-terminal domains, e.g. PTPMEG1 (Gu et al, Proc. Natl. Acad. Sci. USA 88: 5867-5871 (1991)), PTPH1 (Yang and Tonks, Proc. Natl. Acad. Sci. USA 88: 5949-5953 (1991)) and PTPD1 (Møller et al, Proc. Natl. Acad. Sci. USA 91: 7477-7481 (1994)). The ezrin-like domain show similarity to several proteins that are believed to act as links between the cell membrane and the cy- toskeleton. PTPD1 was found to be phosphorylated by and associated with c-src in vitro and is hypothesized to be involved in the regulation of phosphorylation of focal adhesions (Møller et al, supra).
PTPases may oppose the action of tyrosine kinases, including those responsible for phosphorylation of focal adhesion proteins, and may therefore function as natural inhibitors of transformation. TC-PTP, and especially the truncated form of this enzyme (Cool et al, Proc. Natl. Acad. Sci. USA 87: 7280-7284 (1990)), can inhibit the transforming activity of v-en and v-fms (Lam ers et al, J. Biol. Chem. 268: 22456-22462 (1993); Zander et al, Oncogene 8: 1175-1182 (1993)). Moreover, it was found that transformation by the oncogenic form of the HER2/neu gene was suppressed in NIH 3T3 fribroblasts overexpressing PTP1B (Brown-Shimer et al, Cancer Res. 52: 478- 482 (1992)).
The expression level of PTP1B was found to be increased in a mammary cell line transformed with neu (Zhay et al, Cancer Res. 53: 2272-2278 (1993)). The intimate relationship between tyrosine kinases and PTPases in the development of cancer is further evidenced by the recent finding that PTPε is highly expressed in murine mammary tumors in transgenic mice over-expressing c-neu and v-Ha-ras, but not c-myc or int-2 (Elson and Leder, J Biol. Chem. 270: 26116-26122 (1995)). Further, the human 13 gene encoding PTPg was mapped to 3p21 , a chromosomal region which is frequently deleted in renal and lung carcinomas (LaForgia et al, Proc. Natl. Acad. Sci. USA 88: 5036-5040 (1991)).
In this context, it seems significant that PTPases appear to be involved in controlling the growth of fibroblasts. In a recent study it was found that Swiss 3T3 cells harvested at high density contain a membrane-associated PTPase whose activity on an average is 8-fold higher than that of cells harvested at low or medium density (Pallen and Tong, Proc. Natl. Acad. Sci. USA 88: 6996-7000 (1991)). It was hypothesized by the authors that density-dependent inhibition of cell growth involves the regulated elevation of the activity of the PTPase(s) in question. In accordance with this view, a novel membrane-bound, receptor-type PTPase, DEP-1 , showed enhanced (>=10-fold) expression levels with increasing cell density of WI-38 human embryonic lung fibroblasts and in the AG1518 fibroblast cell line (όstman et al, Proc. Natl. Acad. Sci. USA 91: 9680-9684 (1994)).
Two closely related receptor-type PTPases, PTPK and PTPμ, can mediate homophilic cell-cell interaction when expressed in non-adherent insect cells, suggesting that these PTPases might have a normal physiological function in cell-to-cell signalling (Gebbink et al, J. Biol. Chem. 268: 16101-16104 (1993); Brady-Kalnay et al, J. Cell Biol. 122: 961-972 (1993); Sap et al, Mol. Cell. Biol. 14: 1-9 (1994)). Interestingly, PTPk and PTPμ do not interact with each other, despite their structural similarity (Zondag et al, J. Biol. Chem. 270: 14247-14250 (1995)). From the studies described above it is apparent that PTPases may play an important role in regulating normal cell growth. However, as pointed out above, recent studies indicate that PTPases may also function as positive mediators of intracellular signalling and thereby induce or enhance mitogenic responses. Increased activity of certain PTPases might therefore result in cellular transformation and tumor formation. Indeed, in one study overexpression of PTPα was found to lead to transformation of rat embryo fibroblasts (Zheng, supra). In addition, a novel PTP, SAP-1 , was found to be highly expressed in pancreatic and colorectal cancer cells. SAP-1 is mapped to chromosome 19 region q13.4 and might be related to carcinoembryonic antigen mapped to 19q13.2 (Uchida et al., J. Biol. Chem. 269: 12220-12228 (1994)). Further, the dsPTPase, cdc25, dephosphorylates cdc2 at Thr14/Tyr-15 and thereby functions as positive regulator of 14 mitosis (reviewed by Hunter, Cell 80: 225-236 (1995)). Inhibitors of specific PTPases are therefore likely to be of significant therapeutic value in the treatment of certain forms of cancer.
PTPases: platelet aggregation
Recent studies indicate that PTPases are centrally involved in platelet aggregation. Agonist-induced platelet activation results in calpain-cataiyzed cleavage of PTP1B with a concomitant 2-fold stimulation of PTPase activity (Frangioni et al, EMBO J. 12: 4843-4856 (1993)). The cleavage of PTP1 B leads to subcellular relocation of the enzyme and correlates with the transition from reversible to irreversible platelet aggregation in platelet-rich plasma. In addition, the SH2 domain containing PTPase, SHP- 1/SH-PTP1 , was found to translocate to the cytoskeleton in platelets after thrombin stimulation in an aggregation-dependent manner (Li et al, FEBS Lett. 343: 89-93 (1994)).
Although some details in the above two studies were recently questioned there is over-all agreement that PTP1B and SHP-1 play significant functional roles in platelet aggregation (Ezumi et al, J. Biol. Chem. 270: 11927-11934 (1995)). In accordance with these observations, treatment of platelets with the PTPase inhibitor pervanadate leads to significant increase in tyrosine phosphorylation, secretion and aggregation (Pumiglia et al, Biochem. J. 286: 441-449 (1992)).
PTPases: osteoporosis
The rate of bone formation is determined by the number and the activity of osteoblasts, which in term are determined by the rate of proliferation and differentiation of osteoblast progenitor cells, respectively. Histomorphometric studies indicate that the osteoblast number is the primary determinant of the rate of bone formation in hu- mans (Gruber et al, Mineral Electrolyte Metab. 12: 246-254 (1987); reviewed in Lau et al, Biochem. J. 257: 23-36 (1989)). Acid phosphatases/PTPases may be involved in negative regulation of osteoblast proliferation. Thus, fluoride, which has phosphatase inhibitory activity, has been found to increase spinal bone density in osteopo- rotics by increasing osteoblast proliferation (Lau et al, supra). Consistent with this ob- 15 servation, an osteoblastic acid phosphatase with PTPase activity was found to be highly sensitive to mitogenic concentrations of fluoride (Lau et al, J. Biol. Chem. 260: 4653-4660 (1985); Lau et al, J. Biol Chem. 262: 1389-1397 (1987); Lau et al, Adv. Protein Phosphatases 4: 165-198 (1987)). Interestingly, it was recently found that the level of membrane-bound PTPase activity was increased dramatically when the osteoblast-like cell line UMR 106.06 was grown on collagen type-l matrix compared to uncoated tissue culture plates. Since a significant increase in PTPase activity was observed in density-dependent growth arrested fibroblasts (Pallen and Tong, Proc. Natl. Acad. Sci. 88: 6996-7000 (1991)), it might be speculated that the increased PTPase activity directly inhibits cell growth. The mitogenic action of fluoride and other phosphatase inhibitors (molybdate and vanadate) may thus be explained by their inhibition of acid phosphatases/PTPases that negatively regulate the cell proliferation of osteoblasts. The complex nature of the involvement of PTPases in bone formation is further suggested by the recent identification of a novel parathyroid regulated, recep- tor-like PTPase, OST-PTP, expressed in bone and testis (Mauro et al, J. Biol. Chem. 269: 30659-30667 (1994)). OST-PTP is up-regulated following differentiation and matrix formation of primary osteoblasts and subsequently down-regulated in the osteoblasts which are actively mineralizing bone in culture. It may be hypothesized that PTPase inhibitors may prevent differentiation via inhibition of OST-PTP or other PTPases thereby leading to continued proliferation. This would be in agreement with the above-mentioned effects of fluoride and the observation that the tyrosine phosphatase inhibitor orthovanadate appears to enhance osteoblast proliferation and matrix formation (Lau et al, Endocrinology 116: 2463-2468 (1988)). In addition, it was recently observed that vanadate, vanadyl and pervanadate all increased the growth of the osteoblast-like cell line UMR106. Vanadyl and pervanadate were stronger stimulators of cell growth than vanadate. Only vanadate was able to regulate the cell differentiation as measured by cell alkaline phosphatase activity (Cortizo et al, Mol. Cell. Biochem. 145: 97-102 (1995)).
PTPases: microorganisms
Dixon and coworkers have called attention to the fact that PTPases may be a key element in the pathogenic properties of Yersinia (reviewed in Clemens et al. Molecular Microbiology 5: 2617-2620 (1991)). This finding was rather surprising since tyrosine 16 phosphate is thought to be absent in bacteria. The genus Yersinia comprises 3 species: Y. pestis (responsible for the bubonic plague), Y. pseudoturberculosis and Y. en- terocolitica (causing enteritis and mesenteric lymphadenitis). Interestingly, a dual- specificity phosphatase, VH1, has been identified in Vaccinia virus (Guan et al, Nature 350: 359-263 (1991)). These observations indicate that PTPases may play critical roles in microbial and parasitic infections, and they further point to PTPase inhibitors as a novel, putative treatment principle of infectious diseases.
BRIEF DESCRIPTION OF THE INVENTION
As described above, PTPases are essential elements in a variety of cellular signalling processes. Inhibitors or modulators of these enzymes, or a given subset of PTPases, or even one specific PTPase, are therefore attractive drug candidates. However, until now only a limited set of inhibitors has been reported in the literature. Some of the most potent inhibitors are analogs of tyrosine-phosphorylated peptides and therefore not suitable candidates for oral use.
I. Vanadate and Pervanadate. Vanadate and pervanadate/peroxovanadium compounds induce insulin-like effects in cells and animals. A few anecdotal, clinical studies with formulas of vanadate have shown positive effects in humans with type II diabetes. The mechanism of action at the cellular level is believed to be via inhibition of PTPases. Pervanadate (the complexes of vanadate and hydrogen peroxide) were recently found to be an irreversible inhibitor of PTPases via oxidation of the active site catalytic cysteine (Huyer et al., J. Biol. Chem. 272: 843-851 (1997)). Further, the effects are very sensitive to the assay constituents such as EDTA and reducing agents (e.g. dithiothreitol, DTT). It should be noted that vanadate and peroxovana- dium-based compounds inhibit a broad range of PTPases. It conceivable that the mechanism of action, i.e. oxidation of the active site cysteine, will cause substantial problems when attempting to develop compounds that selectively inhibit specific PTPases. Further, the toxic effects of vanadate, pervanadate and peroxovanadium- based inhibitors will likely prevent their use for treatment of chronic diseases such as diabetes. 17
II. Bisphosphonates. Bisphosphonates have been successfully used as therapeutic agents for treatment of bone disorders such as osteoporosis and Paget's disease. Bisphosphonates inhibits osteoclast resorption which results in reduced bone turnover and a net gain in bone mineral density (for review, see Rodan and Fleisch, J. Clin. Invest. 97: 2692-2696 (1996)). It is currently believed that the mechanism of action at the cellular level is via bisphosphonates' inhibitory activity against PTPases (in the osteoclasts) (Skorey et al., J. Biol. Chem. 272: 22472-22480 (1997); Opas et al., Biochemical Pharmacology 54: 721-727 (1997)). However, the inhibitory effect of alendronate was found to be very sensitive to assay constituents such as EDTA and DTT). Further, it was shown that the inhibition is time dependent. The mechanism of action at the biochemical level was recently shown to be via oxidation of the catalytic cysteine in the active site (Skorey et al., vide supra). It should be noted that bisphosphonates inhibit a broad range of PTPases. It is conceivable that the mechanism of action, i.e. oxidation of the active site cysteine, will cause substantial problems when attempting to develop bisphosphonate-based compounds that selectively inhibit specific PTPases.
III. Gold compounds, it was recently shown that disodium aurothiomalate (AuTM), which been successfully used in the treatment of autoimmune and inflammatory dis- orders, act as an inhibitor of PTPases (Wang et al, Biochemical Pharmacology 54:703-711 (1997)). However, AuTM appears to inhibit PTPases via its interaction with the active site nucleophilic cysteine in these enzymes. Dithiothreitol can prevent or almost completely prevent this inhibition, which is in contrast to compounds of the present invention. As for the bisphosphonates, substantial problems are likely to arise if the gold compounds were to be used to develop selective inhibitors.
The inhibitors described above are non-selective. Some of the observed toxic effects or side effects are likely to be caused, at least in part, by their lack of selectivity.
Thus, there is a strong need for a non-peptide, general, competitive or mixed-type, reversible classical PTPase inhibitor or compounds, which can be used for further optimization to potent and selective inhibitors. 18 BRIEF DESCRIPTION OF THE DRAWING
Figure 1. Steady State Enzyme Kinetic Analysis. PTP1 B was incubated in 96 well plates with different concentrations of the substrate, para-nitrophenyl phosphate (pNPP), and the inhibitor, 2-(oxalylamino)benzoic acid: 0, 7.4, 22.2, 66.7 and 200 μM - final assay concentration). Buffer: 100 mM sodium acetate pH 5.5, 50 mM NaCl, 5 mM dithiothreitol, 0.1 % (w/v) bovine serum albumin, incubation time: 45 minutes; temperature: 25°C. Sodium hydroxide was added and the absorbance read at 405 nm. (A) Michaelis Menten Plots; (B) plot of the apparent Km values relative to the concentration of the inhibitor; (C) plot of the apparent Vmax relative to the concentration of the inhibitor. For further details, see the section DEFINITIONS. Exp.no. 1230-5.
Figure 2. Steady State Enzyme Kinetic Analysis. Conditions as in Figure 2, except that the buffer was (final assay concentration): 100 mM sodium acetate pH 5.5, 50 mM NaCl, 5 mM glutathione, 1 mM EDTA, and 0.1 % bovine serum albumin. Incubation time: 60 mins. Exp. 1167-3
Figure 3. Time course experiments. (A) PTP1 B was incubated in 96 well plates at room temperature with 2.5 M para-nitrophenol phosphate (pNPP) in a buffer containing. The compound, 2-(oxalylamino)benzoic acid, was added at final assay concentrations of 250, 125 and 62.5 μM. The reaction was started by addition of the enzyme, and the stopped at the indicated time intervals by addition of NaOH. The absorbance at 405 nm was finally measured in all wells. (B) As in (A), except that EDTA was added to a final concentration of 1 mM.
Figure 4. Steady State Enzyme Kinetic Analysis. PTP1B was incubated in 96 well plates with different concentrations of the substrate, para-nitrophenyl phosphate, and the inhibitor, 3-(oxalyl-amino)naphthalene-2-carboxyiic acid : 0, 3.7, 11.1 , 33.3 and 100 μM - final assay concentration). Buffer (final assay concentration): 100 mM sodium acetate pH 5.5, 50 mM NaCl, 5 mM glutathione, 1 mM EDTA, and 0.1 % bovine serum albumin. Incubation time:60 mins.; temperature: 25 °C. Sodium hydroxide was added and the absorbance read at 405 nm. (A) Michaelis Menten Plots; (B) plot of the apparent Km values relative to the concentration of the inhibitor; (C) plot of the 19 apparent Vmax relative to the concentration of the inhibitor. For further details, see the section DEFINITIONS.
Figure 5. Steady State Enzyme Kinetic Analysis. PTP1B was incubated in 96 well plates with different concentrations of the substrate, para-nitrophenyl phosphate, and the inhibitor, 2-(oxaiyl-amino)-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid: 0, 18.5, 55.6, 166.7 and 500 μM - final assay concentration). Buffer (final assay concentration): 100 mM sodium acetate pH 5.5, 50 mM NaCl, 5 mM dithiothreitol, 0.1 % (w/v) bovine serum albumin. Incubation time:60 mins.; temperature: 25 °C. So- dium hydroxide was added and the absorbance read at 405 nm. (A) Michaelis Menten Plots; (B) plot of the apparent Km values relative to the concentration of the inhibitor; (C) plot of the apparent Vmax relative to the concentration of the inhibitor. For further details, see the section DEFINITIONS.
Figure 6. Steady State Enzyme Kinetic Analysis. (A) Michaelis Menten Plots. PTPα was incubated in 96 well plates with different concentrations of the substrate, para-nitrophenyl phosphate (pNPP), and the inhibitor, 5-(1 ,3-dioxo-1 ,3-dihydro- isoindol-2-ylmethyl)-2-(oxalyl-amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid: 0, 7.4, 22.2, 66.7 and 200 μM - final assay concentrations. Buffer (final assay concentration): 100 mM sodium acetate pH 5.5, 50 mM NaCl, 5 mM glutathione, 1 mM EDTA, and 0.1 % bovine serum albumin. Reaction temperature: 25 °C. After 60 minutes, 10 μl of a 0.5 M sodium hydroxide solution (in 50 percent (vol/vol) ethanol) was added to each well and the absorbance was read at 405 nm. (B) Michaelis Menten Plots. PTPα was incubated in 96 well plates with different concentrations of the substrate, para-nitrophenyl phosphate, and the inhibitor, 5-(1 ,3-dioxo-1 ,3- dihydro-isoindol-2-ylmethyl)-2-(oxalyl-amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3- carboxylic acid: 0, 37, 111.1 , 333.3 and 1000 μM - final assay concentrations. Buffer (final assay concentration): 50 mM HEPES pH 7.0, 100 mM NaCl, 5 mM glutathione, 1 mM EDTA, and 0.1 % bovine serum albumin. Reaction temperature: 25 °C. After 60 minutes, 20 μl of a 0.5 M sodium hydroxide solution (in 50 percent (vol/vol) ethanol) was added to each well and the absorbance was read at 405 nm. For further details, see the section DEFINITIONS. 20
Figure 7. Homology Tree Based on Multiple Sequence Alignments of PTPase Domain I
DETAILED DESCRIPTION OF THE INVENTION
A high throughput screening scintillation proximity assay (SPA - Amersham) was developed using PTP1 B and a synthetic, biotinylated, 33P-phosphorylated peptide as substrate. This peptide substrate, which corresponds to the activation loop of the insulin receptor kinase, i.e. Thr-Arg-Asp-lle-Tyr-Glu-Thr-Asp-Tyr-Tyr-Arg-Lys-NH2, was 33P-phosphorylated on tyrosine residues using the insulin receptor tyrosine kinase. A compound library was screened and a number of hits identified. Surprisingly, one of these hits, oxalyl-amino benzoic acid proved to act as a classical, competitive, reversible active site-directed inhibitor (see below). 2-(Oxalyl-amino)benzoic acid was first described by (Friedlaender et al. Chem. Ber., 14, 1921 (1881)). However, de- spite that this compound has been known for decades there are no reports indicating any PTPase inhibitory activity.
First we analyzed the mode of inhibition of 2-(oxalyl-amino)benzoic acid and analogues thereof using classical steady-state enzyme kinetic methodology as described in R. A. Copeland, Enzymes - A Practical Introduction to Structure, Mechanism and Data Analysis, VCH Publishers, Inc., New York, 1996 (Figure 1). The illustrations are not intended in any way to limit the scope of the invention. In particular, it is not the intention to limit the scope of the invention to inhibitors that do not show any time dependence. Likewise, it is not the intention to limit the scope of the invention to classical, competitive inhibitors.
It appears from Figure 1 that some of the compounds of the invention (exemplified by oxalylamino benzoic acid) behave as a reversible, classical competitive inhibitor of PTP1B (linear relationship between inhibitor concentration and the apparent Km (Fig. 1 (B); no influence on Vmax (Fig. 1 (C)). The K| value was found to be about 30 μM. The calculation of Kj is described in detail below and further illustrated by an example in the section DEFINITIONS. 21
We also investigated the influence of assay constituents, which have previously been found to significantly influence the inhibition of other PTPase inhibitors - as described above. EDTA was added to the assay buffer, and dithiothreitol was replaced by glutathione (Figure 2).
It appears from Figure 2 that the inhibitors of the present invention as an important feature, and in sharp contrast to the inhibitors described above, are insensitive to assay constituents such EDTA and the reducing agent (linear relationship between inhibitor concentration and the apparent Km (Fig. 2 (B); no influence on Vmax (Fig. 2 (C)). The Kj value was found to be about 50 μM. The reversible nature of the inhibition process is clearly indicated by the fact that Vmax is independent of inhibitor concentration.
Further, it is demonstrated in Figure 3 that some of the compounds of the present invention do not show any sign of time dependency. Again, this shows the reversible nature of the inhibition.
We set out to identify more precisely the chemical elements defining the PTPase inhibitory capacity by analyzing a set novel chemical analogues. Importantly, as will be illustrated below, analogues of this hit (i.e. 2-(oxalyl-amino) benzoic acid) essentially retained the same enzyme kinetic profile, i.e. the behave like classical competitive inhibitors. Thus, the compounds of the invention can be derived by changing in a systematic fashion the elements needed for binding to/inhibition of/modulation of the active sites of PTPases and/or to other molecules with pTyr recognition units using procedures well known to those skilled in the art.
Examples of the enzyme kinetic behavior of analogues of 2-(oxalyl-amino)benzoic acid are shown in Figure 4 and 5. Surprisingly, these novel compounds retain the classical competitive mode of inhibition as observed with 2-(oxalyl-amino)benzoic acid. From this it appears that those skilled in the art may make novel analogues of the original compound that still act as inhibitors of protein-tyrosine phosphatases. As an example, which is not intended in any way to limit the scope of the invention, those skilled in the art may add substituents to 2-(oxalyl-amino)benzoic acid and 22 thereby change the potency and selectivity into other preferred compounds of the invention. Such novel compounds may be inhibitors or modulators of protein-tyrosine phosphatases or other molecules with pTyr recognition units and they may be classical, competitive inhibitors or mixed-type inhibitors. Thus, the present invention pro- vides methods for making both non-selective and selective inhibitors and modulators of molecules with pTyr recognition units including protein-tyrosine phosphatases.
The compounds of the invention can be further modified to act as prodrugs.
It is a well known problem in drug discovery that compounds, such as enzyme inhibitors, may be very potent and selective in biochemical assays, yet be inactive in vivo. This lack of so-called bioavailability may be ascribed to a number of different factors such as lack of or poor absorption in the gut, first pass metabolism in the liver, poor uptake in cells. Although the factors determining bioavailability are not completely understood, there are many examples in the scientific literature - well known to those skilled in the art - of how to modify compounds, which are potent and selective in biochemical assays but show low or no activity in vivo, into drugs that are biologically active. It is within the scope of the invention to modify the compounds of the invention, termed the Original compound1, by attaching chemical groups that will improve the bioavailability of said compounds in such a way that the uptake in cells or mammals is facilitated. Examples of said modifications, which are not intended in any way to limit the scope of the invention, include changing of one or more carboxy groups to esters (for instance methyl esters, ethyl esters, acetoxymethyl esters or other acyloxymethyl esters). Compounds of the invention, original compounds, such modified by attaching chemical groups are termed 'modified compounds'. Said chemical groups may or may not be apparent in the claims of this invention. Other examples of modified compounds, which are not intended in any way to limit the scope of the invention, are compounds that have been cyclized at specific positions - socalled 'cyclic compounds' - which upon uptake in cells or mammals become hy- drolyzed at the same specific position(s) in the molecule to yield the compounds of the invention, the original compounds, which are then said to be 'non-cyclic'. For the avoidance of doubt, it is understood that the latter original compounds in most cases will contain other cyclic or heterocyclic structures that will not be hydrolyzed after uptake in cells or mammals. Generally, said modified compounds will not show a be- 23 havior in biochemical assays similar to that of the original compound, i.e. the corresponding compounds of the invention without the attached chemical groups or said modifications. Said modified compounds may even be inactive in biochemical assays. However, after uptake in cells or mammals these attached chemical groups of the modified compounds may in turn be removed spontaneously or by endogenous enzymes or enzyme systems to yield compounds of the invention, original compounds. 'Uptake' is defined as any process that will lead to a substantial concentration of the compound inside cells or in mammals. After uptake in cells or mammals and after removal of said attached chemical group or hydrolysis of said cyclic com- pound, the compounds may have the same structure as the original compounds and thereby regain their activity and hence become active in cells and/or in vivo after uptake. A number of procedures, well known to those skilled in the art, may be used to verify that the attached chemical groups have been removed or that the cyclic compound has been hydrolyzed after uptake in cells or mammals. An example, which is not intended in any way to limit the scope of the invention, is given in the following. A mammalian cell line, which can be obtained from the American Tissue Type Collection or other similar governmental or commercial sources, is incubated with said modified compound. After incubation at conditions well known to those skilled in the art, the cells are washed appropriately, lysed and the lysate is isolated. Appropriate controls, well known to those skilled in the art, must be included. A number of different procedures, well known to those skilled in the art, may in turn be used to extract and purify said compound from said lysate. Said compound may or may not retain the attached chemical group or said cyclic compound may or may not have been hydrolyzed. Similarly, a number of different procedures - well known to those skilled in the art - may be used to structurally and chemically characterize said purified compound. Since said purified compound has been isolated from said cell lysate and hence has been taken up by said cell line, a comparison of said structurally and chemically characterized compound with that of the original unmodified compound (i.e. without said attached chemical group or said non-cyclic compound) will immedi- ately provide those skilled in the art information on whether the attached chemical group as been removed in the cell or if the cyclic compound has been hydrolyzed. As a further analysis, said purified compound may be subjected to enzyme kinetic analysis as described in detail in the present invention. If the kinetic profile is similar to that of the original compound without said attached chemical group, but different 24 from said modified compound, this confirms that said chemical group has been removed or said cyclic compounds has been hydrolyzed. Similar techniques may be used to analyze compounds of the invention in whole animals and mammals.
A preferred prodrug is acetoxymethyl esters of the compounds of the present invention which may be prepared by the following general procedure (C.Schultz et al, The Journal of Biological Chemistry, 1993, 268, 6316-6322. J;
A carboxylic acid (1 equivalent) is suspended in dry acetonitrile (2 ml per 0.1 mmol). Diisopropyl amine (3.0 equivalents) is added followed by bromomethyl acetate (1.5 equivalents). The mixture is stirred under nitrogen overnight at room temperature. Acetonitrile is removed under reduced pressure to yield an oil which is diluted in eth- ylacetate and washed with water (3 x). The organic layer is dried over anhydrous magnesium sulfate. Filtration followed by solvent removal under reduced pressure afford a crude oil. The product is purified by column chromatography on silica gel, using an appropriate solvent system.
DEFINITIONS
Signal transduction is a collective term used to define all cellular processes that follow the activation of a given cell or tissue. Examples of signal transduction, which are not intended to be in any way limiting to the scope of the invention claimed, are cellular events that are induced by polypeptide hormones and growth factors (e.g. insulin, insulin-like growth factors I and II, growth hormone, epidermal growth factor, platelet-derived growth factor), cytokines (e.g. inter-leukins), extracellular matrix components, and cell-cell interactions.
Phosphotyrosine recognition units/tyrosine phosphate recognition units/pTyr recognition units are defined as areas or domains of proteins or gly- coproteins that have affinity for molecules containing phosphorylated tyrosine residues (pTyr). Examples of pTyr recognition units, which are not intended to be in any way limiting to the scope of the invention claimed, are: PTPases, SH2 domains and PTB domains. Further, in some receptor-type or receptor-like PTPases, the second domain (the C-terminal domain) most likely does not pos- 25 sess catalytic activity. As a non-limiting example, the second domain of CD45 does not seem to act as an active PTPase (see Kashio et al., J. Biol. Chem. 273, 33856-22863 (1998) and references herein). However, the second domain of CD45 seems to play an important role as a phosphotyrosine recognition unit and to be critical for interleukin-2 secretion and substrate recruitment of TCRz in vivo (Kashio et al., supra). Thus, the second domain of CD45 in this case may play a similar role as a SH2 domain and hence act as a phosphotyrosine recognition unit. Although not formally proven, other molecules that are similar to PTPases, such as IA-2 and IA-2b, may act as pTyr recognition units.
Proteins with phosphotyrosine recognition units are defined as proteins or glycoproteins that contain phosphotyrosine recognition units.
A ligand is defined as a molecule or compound that binds to another molecule. An example of a ligand, which is not intended in any way to limit the scope of the definition, is a non-peptide molecule with a molecular weight equal to or below 2500 daltons which binds to a protein or a glycoprotein.
A phosphotyrosine recognition unit ligand is defined as a molecule that binds to the phosphotyrosine recognition unit(s) of a protein or a glycoprotein with phosphotyrosine recognition unit(s). Thus, non-limiting examples of a phosphotyrosine recognition unit ligand include PTPase inhibitors and/or PTPase modulators. Another non-limiting example of a phosphotyrosine recognition unit ligand is a compound that binds to an SH2 domain and/or to a PTB domain.
PTPases are defined as enzymes with the capacity to dephosphorylate pTyr- containing proteins or glycoproteins. Examples of PTPases, which are not intended to be in any way limiting to the scope of the invention claimed, are: 'classical' PTPases (intracellular PTPases (e.g. PTP1B, TC-PTP, PTP1C, PTP1D, PTPD1 , PTPD2) and receptor-type PTPases (e.g. PTPα, PTPε, PTPβ, PTPγ, CD45, PTPK, PTPμ), dual specificty phosphatases (VH1, VHR, cdc25), LMW- PTPases or acid phosphatases. A list of currently known classical and other PTPases reported to GenBank is shown in Table 1 (with the appropriate accession number indicated). 26
Table 1
List of PTPases (partial and full length cDNA)
Name Accession Number
Bovine bPTPBAl U20807
Chicken cLAR L32780
CPTPIB U86410 cPTPalpha Z32749. 22437 cPTPcrγp2 U65891 cPTPgamma U38349 cPTPlambda L13285,Z21960 cPTPsyp U38620 cPTPzeta L27625
Human hCD 5 Y00638 Y00062 p08575 hchPTPl U42361 hGLEPPl U20489
HLAR Y00815 hLCPTP D11327 hLyPTPl AF001846 hLyPTP2 AF001847 hMEGl M68941 hMEG2 M83738 hPCPTPl D64053 U42361 hPEST D13380 M93425 hPTPlB M31724 M33689 hSHPl M74903 X62055 M77273 X82817* X82818** hSHP2 X70766 L08807 D13540 L03535 L07527 hPTPlE U12128 D21209 D21210 D21211 hPTPalpha M34668 X54130 X54890 X53364 hPTPBDPl X79568 hPTPbeta X54131 hPTPchlg U77917 U77916* hPTPCOMl Z79693 hPTPDl X79510
1.PTPD2 X82676 PTPdelta X54133 L38929 hPTPDEPl U10886 D37781 hPTPEC X82635 E09724* PTPepsilon
Figure imgf000028_0001
X54134 27
Table 1 (continued)
List of PTPases (partial and full length cDNA)
Name Accession Number
hPTPFMI X95712 hPTPgamma 09247 X54132 hPTPHl M64572 hPTPHE M64322 hPTPIA2 L18983 Z48226 hPTPIA2beta U65065 hPTPIAR AF007555 L76258 hPTPICA512 X62899 hPTPkappa L77886 Z70660 hPTPLl X80289 hPTPmu X58288 hPTPPCP2 X97198 hPTPpi U81561 hPTPPNPl X79676 hPTPpsi U60289 U73727 hPTPrho AF043644 AL024473 A1022239 AQ02047 hPTPRO U71075 hPTPS31 132035 132036 132037 132038 132039 hPTPSAPl D15049 hPTPsigma U35234 U40317 U41725 hPTPU2 Z48541 hPTPzeta M93426 X54135 U88967 hTCPTP M25393 M81478 M80737 hPTP-af007118 AF007118 hchPTP U42361
Mouse mCD45 M14342 M92933 M33482 mDPZPTP D28529 m AR Z37988 mMEG2 Af013490 mPEP M90388 mPEST X86781 mPTPlB M97590 U24700 mPTPlC M68902 M90389 mPTPID 08663 D84372 mPTP35 X74438 mPTP36 D31842
Figure imgf000029_0001
mPTPalpha M33671 M36033 28
Table 1 (continued)
List of PTPases (partial and full length cDNA)
Name Accession Number
mPTPbeta X58289 mPTPBL Z32740 mPTPBR7 D31898 mPTPbyp D45212 mPTPdelta D13903 E09890 E09891 E09892 mPTPepsilon U35368 U36758 D83484 U62387 U40280 mPTPesp U36488 mPTPFLPl U52523 U49853 mPTPftpl D88187 mPTPgamma L09562 mPTPGMCl AF073998 AF073999 mPTPGMCl AF073998 AF073999 mPTPHA2 40595 mPTPIA2 U11812 mPTPKl U35124 mPTPkappa 10106 mPTPlambda U55057 mPTPmu X58287 mPTPNP U57345 mPTPP19 X63440 S36169 mPTPphi U37467 U37466 U37465 mPTPRIP D83966 mPTPR lO D37801 D83072 mPTPNU3 X82288 mPTPT9 D28530 D28531* mPTPSL Z30313 Z23058 mPTPtestis D64141 mSTEP61 U28217 S80329 U28216 mTCPTP S52655 M81477 M80739
Rat rCBPTP M10072 Y00065 rLAR L11586 U00477 X83546 X83505 rLCPTP U28356 rPC12PTPl U14914 rPTP- E10496 E10496 rPTP-E09723 E09723 rPTPlB M33962 rPTPID U09307 U05963
Figure imgf000030_0001
rPTP20 U69673 29
Table 1 (continued)
List of PTPases (partial and full length cDNA)
Name Accession Number
rPTP2E U17971 U18293 rPTPalpha L01702 rPTPBEMl (partial . cds) D45412 rPTPBEM2 D45413 rPTPBEM3 D45414 rPTPD30 (complet cds) U28938 rPTPDEPl U40790 rPTPepsilon D78610 D78613 rPTPGMCl AF063249 rPTPICA105 X925G3 D38222 rPTPNE6 U73458 Z50735 rPTPOST L36884 rPTPPl L19180 rPTPPS 19181 rPTPpsi U66566 rPTPsigma L11587 12329 19933 rPTPzeta U09357 rRKPTP D38072 rSTEP S49400 rSHPl U77038 rTCPTP X58828
Figure imgf000031_0001
rPTPTD14 AF077000
Rabbit rabPTP-oc U32587
Other PTPases
VHl-like (ie both dual + tyrosine) hC lOO X68277 S46269 hMKP-2 U48807 hMKP-4 Y08302 hPAC- 1 U23853 L11329 hPTEN U93051 AF000731 AF000732 AF000733 AF000734 hPTPpys l X93920 hPTPpyst2 X93921
Figure imgf000031_0002
hPTPTH2 AF019083 30
Table 1 (continued)
List of PTPases (partial and full length cDNA)
Name Accession Number
hTYPl S80G32 hVHl ??? hVH2 U21108 hVH5 U27193 hVHR ??? mERP S64851 mI29-PACl U09268 mMKP-1 X61940 mNTTPl X95518 mPAC-1 11330 mPRL-1 U84411 mSty U11054 mSTYX U34973 mVHl X61940 myxomaPTP 31960 nostocPTP L11392 raccPTP 13165 rCLlOO S81478 X84004 rMKP-2 U23438
RPRL-1 L27843 ru02553 U02553 rVH6 U42627 shopePTP 32180 yVHl L04673 hPRL3 AF041434
LMW
bPTPlm M83656 hRBClmw M83653 M83654 yLMPTPl L33929 y TPl U11057 L48604
cdc25-family:
hPTPcdc25a M81933 hPTPcdc25b2 Z68092
Figure imgf000032_0001
hcdcl4B AF023158 31
Table 1 (continued)
List of PTPases (partial and full length cDNA)
Name Accession Number -
Unclassified mammalian PTPases:
hPTPCAAXl U48296 hPTPCAAX2 U48297 hPTPCIP2 L25876 hPTPCdil U02681 hPTPICAAR Y08569 hPTPTEPl U96180 hPTPkiaa0283 AB006621 hPTPPRL-1 AF051160 hPTPPR -3 AF041434 hPTP_putative_ AF007118 mPTP-IFl Y17345 mPTP-IF2 Y17344 mPTP-IF2P Y17343
Microbial PTPases (ie. eubacteria & vira)
autovPTP M96763 salmPTP U63293 strepPTP U37580
Rachiplusia ou nuclear polyhedrosis virus npvPTP AF068270
Oher eukaryotes (ie. Drosophila, yeast, fungi, xenopus etc.)
Arabidopsis thaliana atPTPl AF055635 atPTPl-exons-introns AJ006309
Caenorhabditis elegans ceCosmid Z80216 cePTP2 AF015882 cePTP6 Z70284 cePTPclr-1 AF047880 cePTPPRL-1 AF063401 32
Table 1 (continued)
List of PTPases (partial and full length cDNA)
Name Accession Number
Drosophila d AR M27700 dPTPlOD M80465 M80538 dPTP4E L20894 dPTP61F L11253 14849 L11252 L11251 dPTP69D M27699 dPTP99A M80464 M80539 M81795 dPTPcork U19909
Figure imgf000034_0001
dPTPPR -1 AF047880 AF047881
Dictyostelium discoideum dictPTP L07125 dictPTP2 L15420 dictPTP3 U38197
Emericella nidulans fPTPncdc25 X64601 S37934
Tritrichomonas foetus triPTP.pep U66070
Schizosaccharomyces pombe yPTPl Z73100 yPTPcand L01038 yPTPMSG5 D17548 yPTPpypl M63257 yPTPpyp2 X59599 S51320 yPTPpyp3 X69994 S51385 yPTPtrna X75077 33
Table 1 (continued)
List of PTPases (partial and full length cDNA)
Name Accession Number
Yersinea cerivisiae yscPTP M64062 yscPTP2 M38723 M82872 yscPTP3 AF006304
Xenopus
XCD45 AF024438
XPTP-SH2 U15287 xPTPalpha U09135 xPTPXl L33098
Figure imgf000035_0001
xPTPXIO L33099
Hirudo medicinaliS hmLarl AF017084 hmLar2 AF017083
Pisum sativum (pea) peaPTPl AJ005589
Glycine max (soybean) soybeanPTPl AJ006308
34
A modulator of PTPases is compound that causes a change of the activity of a PTPase. PTPase modulators may either make the PTPase less active or more active. PTPase modulators may according to the present definition bind to the active site of PTPases or to areas outside the active site of PTPases (so-called allosteric modula- tors). Another, non-limiting example of a PTPase modulator is a compound that changes the substrate specificity of a PTPase.
A PTPase domain is defined as a part of the full PTPase molecule, which typically - but not always - possess characteristic enzymatic activity, i.e. the capacity to dephos- phorylate pTyr-containing proteins or glycoproteins. A PTPase domain of a classical PTPase will typically consist of 220-350 amino acid residues and correspond to amino acid residues number 30 to 270 of PTP1 B. PTPase domains may be expressed in eukaryotic and prokaryotic expression system either as the domain itself or as part of a fusion protein.
SH2 domains Src homology 2 (SH2) domains are non-catalytic protein modules that bind to pTyr (phosphotyrosine residue) containing proteins, i.e. SH2 domains are pTyr recognition units. SH2 domains, which consist of ~100 amino acid residues, are found in a number of different molecules involved in signal transduction processes. The fol- lowing is a non-limiting list of proteins containing SH2 domains: Src, Hck, Lck, Syk, Zap70, SHP-1 , SHP-2, STATs, Grb-2, She, p85/PI3K, Gap, vav (see Russell et al, FEBS Lett. 304:15-20 (1992); Pawson, Nature 373: 573-580 (1995); Sawyer, Bio- polymers (Peptide Science) 47: 243-261 (1998); and references herein). The structural requirements for SH2 domain/pTyr protein interactions have been ana- lyzed with synthetic, tyrosine phosphorylated peptides and further elucidated by X-ray crystallography and NMR. The signature motif, FLVRES (single amino acid code), forms part of the binding pocket for pTyr. In addition, other binding pocket(s) play(s) a role in defining affinity and selectivity. Thus, in the Src SH2 domain a hydrophobic pocket binds the amino acid positioned 3 residues C-terminal to the pTyr residue (i.e. pY+3). Numerous studies have pointed to the importance of residues positioned C- terminal to the pTyr residue (for review, see Pawson, supra). Determination of ligand binding to SH2 domains. Several methods - well known to those skilled in the art - have been developed that are useful for assessment of the binding of non-phosphate-containing ligands to SH2 domains. One example, which is 35 not intended in any way to limit the scope of the present invention, was recently published by Yao and coworkers (Yao et al., J. Med. Chem. 42: 25-35 (1999)). These authors used the surface plasmon reasonance method for determination of the inhibitory capacity of non-phosphate containing ligands on Grb2 SH2 domain binding (IC50). In brief, recombinant GST-Grb2 SH2 domain was incubated with various amounts of ligand and allowed to flow across the surface-bound the SHC phos- phopeptide, DDPSpYVNVQ (single amino acid code, where pY indicates phosphotyrosine). The amount of equilibrium binding (Ru(max)) was determined and compared to binding without the presence of ligand. The above SHC phosphopeptide, DDPSpYVNVQ, served as a control. Similarly, ligand binding can be determined for other SH2 domains using appropriate surface-bound tyrosine-phosphorylated peptides well known to those skilled in the art.
Other non-limiting approaches to assess peptide ligand binding to SH2 domains have been developed by several laboratories (Fantl et al., Cell 69: 413-423 (1992); Ward et al., J. Biol. Chem. 271: 5603-5609 (1996); and references herein). Such assays can also be used for assessment of the binding of non-peptide ligands to SH2 domains with slight modifications well understood by those skilled in the art.
PTB domains Recently, a novel type of pTyr recognition unit (PTP domain = phos- photyrosine binding domain) was identified in she, which is an adaptor protein
(Kavanaugh and Williams, Science 266: 1862-1865). The PTB domains are longer than SH2 domain (~ 190 residues). Assays for ligand binding to the she PTB domain was recently developed by Kavanaugh and coworkers (Kavanaugh et al., Science 268: 1177-1179 (1995); Laminet et al., J. Biol. Chem. 271 : 264-269 (1996)).
A PTPase family is defined as a group of PTPases that are structurally related. Thus, one accepted way of defining a PTPase family is based on the primary structures of PTPases outside the PTPase domain(s) or their overall structures (Fischer et al. (1991) Science 253: 401-406; B.J. Goldstein (1995) in Protein Profile, volume 2, num- ber 13, Academic Press Ltd., London.. Non-limiting examples of PTPase families defined in such way are:
(a) SH-2 domain containing PTPases, the SHP family: SHP-1 ; SHP-2
(b) PTP1B family: PTP1B; TC-PTP
(c) Ezrin-domain containing PTP family: PTPH1 ; PTPD1; PTPD2; PTPMEG 36
(d) The PTP-BAS family
(e) Proiine-Glutamic acid-Serine-Threonine (PEST) sequence containing PTPases: PTP-PEST; PEP
(f) PTPases containing very small, highly giycosylated extracellular regions, the PTPα family: PTPα; PTPε.
(g) Receptor-type PTPases with one intracellular PTP domain, the PTPβ family: PTPβ, DEP-1 , GLEPP-1 , SAP-1
(h) PTPases containing extracellular regions with immunoglobulin-like domains and Fibronectin Ill-like domains, the PTP-LAR family: PTP-LAR; PTPσ; PTPδ. (i) PTPases containing extracellular regions with MAM domains, the PTPμ family: PTPμ; PTPK. (j) PTPases containing extracellular regions with similarity to carbonic anhydrase, the
PTPζ family: PTPζ, PTPγ (k) The IA-2 family (I) The PTPψ family (m)The CD45 family
It should be noted that not all PTPases have been - or can be - classified into any families.
As an alternative, PTPases may also be divided into families based on sequence alignments of the primary sequence (Goldstein vide supra). Computer programs well- known to those skilled in the arts (e.g. GCG University of Wisconsin, refs.) may be used to performed such alignments. Further analysis is performed with computer pro- grams such as CLUSTALX resulting in a so-called phylogenetic tree. An example of said phylogenetic tree is shown in Figure 7. It should be pointed out that the above described ways of dividing PTPases into families show considerable overlap. The preferred definition of PTPases into families is the latter based on primary sequence alignments of PTPases, since it is likely that this definition in turn can be used to es- tablish assays that will allow development of PTPase inhibitors or modulators that selectively react with a given PTPase family or members of a specific family (i.e. selective inhibitors). 37
Modulation of cellular processes is defined as the capacity of compounds of the invention to 1) either increase or decrease ongoing, normal or abnormal, signal transduction, 2) initiate normal signal transduction, and 3) initiate abnormal signal transduction.
Modulation of pTyr-mediated signal transduction/modulation of the activity of molecules with pTyr recognition units is defined as the capacity of compounds of the invention to 1) increase or decrease the activity of proteins or glycoproteins with pTyr recognition units (e.g. PTPases, SH2 domains or PTB domains) or to 2) de- crease or increase the association of a pTyr-containing molecule with a protein or glyco-protein with pTyr recognition units either via a direct action on the pTyr recognition site or via an indirect mechanism. Examples of modulation of pTyr-mediated signal transduction/modulation of the activity of molecules with pTyr recognition units, which are not intended to be in any way limiting to the scope of the invention claimed, are: a) inhibition of PTPase activity leading to either increased or decreased signal transduction of ongoing cellular processes; b) inhibition of PTPase activity leading to initiation of normal or abnormal cellular activity; c) stimulation of PTPase activity leading to either increased or decreased signal transduction of ongoing cellular processes; d) stimulation of PTPase activity leading to initiation of normal or abnormal cellular ac- tivity; e) inhibition of binding of SH2 domains or PTB domains to proteins or glycoproteins with pTyr leading to increase or decrease of ongoing cellular processes; f) inhibition of binding of SH2 domains or PTB domains to proteins or glycoproteins with pTyr leading to initiation of normal or abnormal cellular activity.
A subject is defined as any mammalian species, including humans.
DEFINITION OF PTPase INHIBITION ACCORDING TO THE PRESENT INVENTION
A compound is defined as a PTPase inhibitor if the following criteria are fulfilled: (a) the inhibitory capacity must be determined as described in detail below and the inhibition constant, K,, value must be below 1000 μM; (b) at least one PTPase must be inhibited by the compounds of the invention. Any PTPase may be used for the analyses. Non-limiting examples of PTPases are: PTP1 B; SHP-1 , SHP-2; PTP-PEST; 38
PTPα; PTPμ; LAR; CD45. Further examples are given in Table 1. In addition, any PTPase not mentioned herein may be used.
DETERMINATION OF INHIBITOR CONSTANTS
Determination of inhibitor constants (K; values) may be performed according to a number of different experimental procedures including inhibitor fluorescence quenching. However, in all cases, to evaluate the compounds of the present invention such methods must be supplemented with procedures that measure the effect of the com- pounds on the catalytic activity of the enzymes. The conditions for such assays are illustrated below.
PTPases
PTPases used for the analyses may be expressed as intact molecules or as PTPase domains.
Assay conditions
Assay conditions must be selected to ensure enzyme stability, i.e. the enzyme must in the absence of substrate retain at least 50 per cent of the initial activity over the assay period.
Buffer systems
Any buffer system well known to those skilled in the art may be selected for analysis of compounds of the invention. Preferred buffers used for analysis of PTPase inhibi- tion or modulation are listed below.
Buffer 1
100 mM NaAc (sodium acetate) pH 5.5 0.1 % BSA (bovine serum albumin) 15 mM DTT (dithiothreitol)
Buffer 2
100 mM NaAc pH 5.5 39
50 mM NaCl 0.1 % BSA 5 mM DTT
Buffer 3
100 mM NaAc pH 5.5 50 mM NaCl 0.1 % BSA
5 mM GSH (glutathione) 1 mM EDTA
Buffer 4
50 mM HEPES pH 7.0 100 mM NaCl 0.1 % BSA 5 mM DTT
Buffer 5
50 mM HEPES pH 7.0 100 mM NaCl 0.1 % BSA 5 mM GSH 1 mM EDTA
Buffer 6
20 mM MES pH 6.0 150 mM NaCl 5 mM DTT 0.1 % BSA
Buffer 7
(constant ionic strength buffer described by Ellis & Morrison (1982) Methods Enzy- mol 777: 301-342) 50 mM Tris 40
50 mM Bis-Tris 100 mM acetate pH range: 4.5 - 9.0 with or without reducing agents (DTT, GSH, 2-mercaptoethanol) with or without carrier proteins (e.g. BSA, gelatine)
Reaction time
The reaction time is preferred to be between 2 and 60 minutes.
Reaction temperature
Any reaction temperature well known to those skilled in the art may be selected for analysis of compounds of the invention. The preferred temperature is in the following range: 4° C to 37° C.
Substrates
Substrates used in the reaction may be selected from the following: (a) p-nitrophenyl phosphate (pNPP); (b) tyrosine-phosphorylated peptides; (c) natural substrates (e.g. autophosphorylated insulin receptor) or parts thereof (e.g. autophosphorylated tyrosine kinase domain of the insulin receptor). When pNPP is used as substrate the en- zyme reaction is followed by measurement of the optical density at a wavelength of approximately 405 nm. In case of (b) and (c), the enzyme reaction may be followed by measurement of released phosphate or by spectrophotometric/fluorometric methods according to procedures well known to those skilled in the art.
Concentration of compound and substrate
To ensure optimal determination of the inhibitor constants the concentration of substrate and inhibitor must be varied independently according to the following guidelines.
A range of substrate concentrations must be varied with a preferred maximum, final assay concentration at least 10-fold above that of the Km value for the enzyme determined under the same conditions. The minimum final assay concentration is pref- 41
erably equal to or below that of the Km value for the enzyme determined under the same conditions.
At least 2 different inhibitor concentrations must be used. The concentrations will depend on the actual compounds, but they must be selected in such a way that nonlinear regression analysis allows determination of inhibitor constants with an accuracy acceptable to those skilled in the art.
Calculation of inhibitor constants, K
Definitions
V0, the initial velocity, is the reaction corresponding to time zero.
Km is defined as the concentration of substrate used to obtain an initial velocity corresponding to 50 percent of the maximal obtainable velocity (Vmax) at full substrate saturation of the enzyme. Km is measured without addition of inhibitor.
Vmax is the maximum obtainable initial velocity (limiting rate) determined at full sub- strate saturation.
Kapp is the apparent Km value determined in the presence of inhibitor.
Vapp is the apparent Vmax value determined in the presence of inhibitor.
Competitive inhibitors are defined as compounds that bind to the substrate binding site of the enzyme, or in close enough proximity to occlude the substrate binding site. True competitive inhibitors, also termed classical competitive inhibitors, increase Kapp without any effect on Vmax.
Mixed-type inhibitors are defined as inhibitors that affect both Km and V, max 42
Non-competitive inhibitors are defined as inhibitors that decrease Vapp without any effect on Km.
In accordance with classical Michaelis-Menten kinetics, the inhibitor constant of competitive inhibitors, Ks, may be calculated from the following equation
Kapp = (Km / Kir[i] + Km (equation 1) where [i] is the concentration of the inhibitor The competitive part of Kj of mixed-type inhibitors, KjC, may be calculated from Kic=.7((Vm/Km)*(Kapp/Vapp)-1) (equation 2)
The uncompetitive part of Kj of mixed-type inhibitors, KjU, may be calculated from KiU=i/(Vmax Vapp-1) (equation 3)
The K, values for a given compound may be calculated either using linear transformation procedures or nonlinear regression fit to classical Michaelis Menten enzyme kinetic models as defined above assuming competitive or mixed-type inhibition. Preferred compounds of the invention belongs to the class of competitive or mixed-type inhibitors.
Further information on the definitions of the above enzyme kinetic parameters may be found in any reference book on enzyme kinetics. Non-limiting examples of such reference books are: (a) Copeland (vide supra); (b) M. Dixon & E.C. Webb, Enzymes, 2nd Edition, Longmans, London, 1996; (c) A. Cornish-Bowden, Fundamentals of Enzyme Kinetics, Portland Press, 1995.
Calculation of inhibitor constants - an example
The calculation of K, values may become more apparent by the following example, which is not intended in any way to limit the scope of the invention.
PTP1 B was incubated with a compound of the invention (described in Example 2). 43
A truncated form of PTP1 B, corresponding to the N-terminal 321 amino acids was expressed in E. coli and purified to apparent homogeneity using published procedures well-known to those skilled in the art. The enzyme reactions were carried out using standard conditions essentially as described by Burke et al (Biochemistry 35; 15989-15996 (1996)). The assay conditions were as follows. Half of a 96-well plate was used for this experiment, p-nitrophenyl phosphate (pNPP) was used as substrate (see Table 2). The following final assay concentrations of pNPP were used: 10 mM (added to all wells in row A), 5 mM (added to all wels in row B), 2.5 mM (added to all wells in row C), 1.25 mM (added to all wells in row D), 0.63 mM (added to all wells in row E), 0.31 mM (added to all wells in row F), 0.16 mM (added to all wells in row G). No substrate was added to row H (a volume of assay buffer corresponding to that of pNPP was added to all wells in row H). 3-(Oxalyl- amino)naphthalene-2-carboxylic acid dissolved in DMSO (Example 2) was used as inhibitor and used at the following final assay concentrations: 100 μM (added to all wells in column 1), 33.3 μM (added to all wells in column 2); 11.1 μM (added to all wells in column 3); 3.7 μM (added to all wells in column 4). Assay buffer was added in columns 5 and 6 instead of the inhibitor (same volume as the inhibitor in columns 1-4). Assay buffer (final assay concentration): 100 mM sodium acetate pH 5.5, 50 mM NaCl, 5 mM glutathione, 1 mM EDTA, and 0.1 % bovine serum albumin. The reaction was started by addition of the enzyme, PTP1B. Assay buffer was added in column 6 instead of the enzyme (same volume as the enzyme in columns 1-5). The total volume in each well was 100 μl, including 10 μl of inhibitor dissolved in DMSO or 10 μl DMSO added to the control wells that did not receive inhibitor. The tem- perature was 25 °C. After 60 minutes, NaOH was added and the absorbance was read at 405 nm. The results are shown in Table 2. 44
Table 2
Absorbance measured at 405 nm
1 2 3 4 5 6
A 1.226 1.369 1.445 1.461 1.469 0.124 B 0.929 1.172 1.33 1.35 1.429 0.084 C 0.623 0.971 1.17 1.25 1.311 0.064 D 0.426 0.718 0.948 1.047 1.139 0.053
E 0.254 0.45 0.651 0.755 0.837 0.048 F 0.142 0.266 0.394 0.454 0.501 0.044 G 0.095 0.159 0.226 0.259 0.287 0.044
Figure imgf000046_0001
H 0.043 0.041 0.044 0.042 0.043 0.044
Calculation of K, values
The actual data from Table 2 are shown with the assay setup in Table 3.
Table 3
Inhib noEnz pNPP 100.0 33.3 11.1 3.7 0.0 0.0
10.00 1.226 1.369 1.445 1.461 1.469 0.124
5.00 0.929 1.172 1.33 1.35 1.429 0.084
2.50 0.623 0.971 1.17 1.25 1.311 0.064
1.25 0.426 0.718 0.948 1.047 1.139 0.053
0.63 0.254 0.45 0.651 0.755 0.837 0.048
0.31 0.142 0.266 0.394 0.454 0.501 0.044
0.16 0.095 0.159 0.226 0.259 0.287 0.044
Figure imgf000046_0002
0 0.043 0.041 0.044 0.042 0.043 0.044
First the absorbance measurement have to be corrected for any OD405 value derived from the control well H6, as shown in Table 4. 45
Table 4
Inhib noEnz pNPP 100.0 33.3 11.1 3.7 0.0 0.0
10.00 1.182 1.325 1.401 1.417 1.425 0.08
5.00 0.885 1.128 1.286 1.306 1.385 0.04
2.50 0.579 0.927 1.126 1.206 1.267 0.02
1.25 0.382 0.674 0.904 1.003 1.095 0.009
0.63 0.21 0.406 0.607 0.711 0.793 0.004
0.31 0.098 0.222 0.35 0.41 0.457 0
0.16 0.051 0.115 0.182 0.215 0.243 0
Figure imgf000047_0001
0 -0.001 -0.003 0 -0.002 -0.001 0
The values in wells H1 through H5 indicated any color (OD405 value) derived from the inhibitor itself. In the present example, the inhibitor does not give rise to any OD405 value. The values in column 6 indicate the OD405 values due to the absorbance of the substrate. Therefore, the corrected OD405 values in Table 4 must be further corrected for the absorbance at 405 nm which is caused by the inhibitor and/or the substrate, as shown in Table 5.
Table 5
Inhib noEnz pNPP 100.0 33.3 11.1 3.7 0.0 0
10.00 1.103 1.248 1.321 1.339 1.346 0 5.00 0.846 1.091 1.246 1.268 1.346 0 2.50 0.56 0.91 1.106 1.188 1.248 0 1.25 0.374 0.668 0.895 0.996 1.087 0 0.63 0.207 0.405 0.603 0.709 0.79 0 0.31 0.099 0.225 0.35 0.412 0.458 0 0.16 0.052 0.118 0.182 0.217 0.244 0
Figure imgf000047_0002
0 0 0 0 0 0 0
The corrected values in Table 5 are now used for calculation of the K| values of the inhibitor at each of the analyzed inhibitor concentrations (100, 33.3, 11.1 and 3.7 μM, respectively). Classical Michaelis-Menten plots of these data are shown in Figure 4 (A). Using non-linear regression analysis of the data in Table 5, the apparent Km val- 46
ues (in mM; Kapp) and apparent Vmax values (OD405 values; Vapp) are calculated for each inhibitor concentration (Table 6).
Table 6
Inh 100 33.3 11.1 3.70 0
Kapp 4.30 1.53 0.89 0.69 0.59
Figure imgf000048_0001
Vapp 1.57 1.44 1.47 1.46 1.50
These data are shown graphically in Figure 4 (B) and (C).
Using the data in Table 6 and Equation 1 (see above) the K| values can be calculated for each inhibitor concentration (Table 7). Table 7
Inhibitor concentration (μM) 100.0 33.3 11.1 3.7
Figure imgf000048_0002
Ki (μM) 16.0 21.1 22.5 23.0
It appears that the Kj values are almost the same, irrespective of the inhibitor con- centration. When combining this with the fact that the inhibitor does not change the Vmax value it can be concluded that this inhibitor is a classical, competitive inhibitor. This is further illustrated by calculating competitive part of K| (KjC) assuming mixed- type inhibition and using Equation 2 (see above). If the inhibitor is mixed-type then the calculated KjC values should differ significantly from the K, values in Table 7. The KjC values for the present inhibitor is shown in Table 8.
Table 8
Inhibitor concentration (μM) 100.0 33.3 11.1 3.7
Figure imgf000048_0003
Kic 17.0 19.8 21.1 19.9
It appears that the K,c values in Table 8 are almost identical to the K, values in Table 7. 47
Selectivity of an inhibitor is defined as the property of such compound to inhibit or modulate a certain PTPase or certain PTPases more efficiently than other PTPases. A selective inhibitor may inhibit one PTPase only or one PTPase family only. However, other selective inhibitors also include compounds that inhibit a set of several PTPases or PTPase families more efficiently than other sets of PTPases or PTPase families.
An example of selectivity, which is not intended in any way to limit the scope of the invention, is a competitive inhibitor that has a K, value of 50 μM against PTP1B and a Kj value of 500 μM or more against PTPα. An example of a selective modulator, which is not intended in any way to limit the scope of the invention, is a modulator that causes a 2-fold increase of the activity of SHP-1 without affecting the activity of PTPα.
To further illustrate the use of different PTPases in evaluating the potency of an inhibitor, a brief description will be given of how to make and express other PTP constructs. For those skilled in the art, this description will allow expression and purification of other PTPase domains that can be used for evaluation of potency as well as selectivity (vide infra) of PTPase inhibitors. In brief, appropriate sources of tissue or cells or cell lines are used to isolate RNA (total or messenger RNA). As non-limiting examples, RNA can be isolated from placenta, liver, skeletal muscle, fat tissue, and peripheral blood leukocytes. Using standard procedures (Ausubel, F. M., et al. (Eds.). SHORT PROTOCOLS IN MOLECULAR BIOLOGY, 2nd EDITION: A compendium of methods from Current Protocols in Molecular Biology. John Wiley and Sons, Inc. New York ISBN 0-471-57735-9 (1992); Ausubel, Frederick M. Current Protocols on CD-ROM User's Guide; Current protocols in molecular biology. John Wiley and Sons, Inc. (1998). ), well known to those skilled in the art, cDNA was prepared from appropriate RNA preparations. Such cDNA preparations in turn served as template for the polymerase chain reaction (PCR). It should further be noted that ap- propriate cDNA templates can be obtained from commercial sources such as Clontech (1020 East Meadow Circle, Palo Alto, CA 94303). The PCR technique was used to prepare cDNA corresponding to the following PTPase domains (Ausubel et al., supra): PTP1 B; PTPα domain 1 ; PTPε domain 1 ; PTPβ; CD45 domain 1 and 2. Ap- 48 propriate restriction sites have been included in the oligonucleotides to allow cloning into appropriate expression vectors. In these examples, which are not intended in any way to limit the scope of the invention, the pGEX expression vectors (Pharmacia) were used. For convenient cloning into other expression vectors (not shown here), an additional N-terminal methionine (Met - M) was included in some of the constructs (indicated as (M)). All sequences were confirmed by sequencing of both strands. Further details are given in Table 9. The information on the oligonucleotides used for the PCRs and the GenBank accession numbers for the specific PTPases in question will allow those skilled in the art to obtain cDNA encoding these PTPase domains. After insertion into the appropriate expression vectors, Escherichia coli was transformed with the expression vectors encoding the above glutathione-S- transferase (GST) fusion proteins. Overnight cultures were diluted 1 :25 and grown for 3 hrs at 37 oC. Expression of GST fusion proteins was then induced by addition of isopropyl-1-thio-b-D-galactopyranoside, and the cultures were grown for additional 3 hrs at room temperature. The GST fusion proteins were purified according to the manufacturer's instructions (Pharmacia) with minor modifications. In brief, all purification steps were conducted at approx. 4 °C. The cell pellets were suspended (5 ml/g) in lysis buffer (50 mM imidazole, 5 mM EDTA, 0.1 % b-mercaptoetanol, 10 % glycerol, 10 μg/ml aprotinin, 0.1 % lysozyme and 1 mM PMSF; pH 7.2) by stirring for 1h prior to lysis under nitrogen pressure (>2000 psi) in a Parr cell disruption bomb. Triton X-100 (0.1 %) was added to the lysate and stirring continued for 1h prior to centrifugation at 40000 g for 30 min. The supematant was applied to a Glutathione Sepharose column (Pharmacia) equilibrated with GST-equilibration buffer (50 mM imidazole, 1 mM EDTA, 150 mM NaCl and 10 % glycerol; pH 7.2) and initially washed with the same buffer. The flow direction was changed and washing was continued with a washing buffer (50 mM Tris, 1 mM EDTA and 10 % glycerol; pH 8). Finally, the bound protein was eluted with 10 mM glutathione in the washing buffer. The CD45 fusion protein was further purified on G25 and Mono Q columns (Pharmacia). The purified PTP domains are stored at -80 °C until use. Immediately prior to use the enzyme preparations are diluted appropriately.
It should be noted that similar methods - well known to those skilled in the art - could be used to obtain the catalytic domains of the molecules shown in Table I. Said GST-PTPase fusion proteins are used to assess the potency and selectivity of PTPase inhibitor essentially as described for PTP1B above. To further illustrate 49 these assays, a non-limiting example using PTPα domain 1 will be given. Similar procedures may be used for other PTPase domains. Half of a 96-well plate was used for this experiment, p-nitrophenyl phosphate (pNPP) was used as substrate. The following final assay concentrations of pNPP were used: 20 mM, 10 mM, 5 mM, 2.5 mM, 1.25 mM, 0.63 mM, 0.31 mM. The compound, 5-(1 ,3-dioxo-1 ,3-dihydro-isoindol- 2-ylmethyl)-2-(oxalyl-amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid, dissolved in dimethyisulfoxide (DMSO) was used as inhibitor and used at the following final assay concentrations: 200 μM, 66.6 μM; 22.2 μM; 7.4 μM. Assay buffer instead of enzyme, and/or substrate was added to appropriate control wells as de- scribed in detail for PTP1 B above. Assay buffer (final assay concentration): 100 mM sodium acetate pH 5.5, 50 mM NaCl, 5 mM glutathione, 1 mM EDTA, and 0.1 % bovine serum albumin. The reaction was started by addition of the enzyme, GST-PTPα domain 1 (final dilution 1 :10000). The assay total volume in each well was 100 μl, including 10 μl of inhibitor dissolved in DMSO or 10 μl DMSO added to the control wells that did not receive inhibitor. The temperature was 25 °C. After 60 minutes, 10 μl of a 0.5 M sodium hydroxide solution (in 50 percent (vol/vol) ethanol) was added to each well and the absorbance was read at 405 nm. The results are shown in Figure 6A. The calculated K, value is 4 μM (median value). Figure 6B shows the results when the same compound (5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-2-(oxalyl- amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid) is tested against PTPα (final dilution 1 :2000) in the following buffer: 50 mM HEPES pH 7.0, 100 mM NaCl, 5 mM glutathione, 1 mM EDTA, and 0.1 % bovine serum albumin. After 60 minutes, 20 μl of a 0.5 M sodium hydroxide solution (in 50 percent (vol/vol) ethanol) was added to each well and the absorbance was read at 405 nm. Otherwise, the conditions are as described for Figure 6A. The calculated K, value under these conditions is about 70 mM (median value). Table 9
PTPase Vector Amino acids Nucleotides GenBank Forward PCR primer Reverse PCR primer
*- no. no. Acc.no.
PTP1 B pGEX 1-321 92-1052 M31724 5' CG CCCTGGCCCCATATGGA- 5' AACTCTAGAGGATCC- GATGGAAAAGGAGTTCGAG 3' TAATTGTGTGGCTCCAGGATTCG 3'
PTPα dopGEX-4T-1 (M)R206-499 649-1531 X54130 5' CCCCCCGGGCATATGAG- main 1 GAAATACCCACCCCTGC 3' CTAGAGATCTCACTTACAGTTCTGTAT C
PTPε dopGEX-5X-2 (M)K 110-402 379-1257 X54234 5' TCACGGATCCGGATGAAGAAG- 5' AGGGAGAAGCTTCA- cn main 1 TA I I I I CCCATCCCCGTGG 3' CAGCTCTGTGTCCCCGTAGAGCATC
CD cn 3*
H
H PTPβ pGEX-5X-2 (M)Q 1644- 4961-6021 X54131 5' GTTGCCTTACATATGGGGATC- 5' CCGCTCGA-
C σi H 1998 CAGAAAGTGAGCCATGGTCGAG 3' GATCTCAATGCCTTGAATAGACTGGA o cn TC 3'
X m CD45 dopGEX-5X-2 467-1145 1539-3575 Y00062 5' GAGAGATCTCTCATAT- 5' CCGCTCGAGATCTAT-
H main 1+2 GAATGTGGAGCCAATCCATGC 3" GAACCTTGATTTAAGGCTGG 3'
"53
Figure imgf000052_0001
c m ro cn
n g
<_> o _-*
51
A selective inhibitor is defined as an inhibitor that shows selectivity.
A non-selective inhibitor is defined as an inhibitor that does not show selectivity.
A selective modulator is defined as a modulator that shows selectivity.
To further illustrate the concept of selective and non-selective PTPase inhibitors an example of a non-selective and a selective inhibitor, respectively, is provided in Table 10. It should emphasized that the examples in Table 10 are not intended in any way to limit the scope of the invention.
Table 10
Analysis of selectivity of PTPase inhibitors. Assay conditions are essentially the same as those used in Figure 4. The numbers given are K, values (μM).
Compound of Example 82 Compound of Example 83
PTP1B 10 2
PTP-LAR 1000 >1000
PTPε 50 1000
CD45 50 300
PTPβ 30 >1000
Figure imgf000053_0001
It appears from Table 10 that the compound of example 82 is an example of a non-selective inhibitor, whereas the compound of example 83 behaves like a selective inhibitor. It should be noted that the compound in example 83 when tested against other PTPases might be inhibitory against these. Yet, according to the present definition, the compound in example 83 is a selective inhibitor due to the fact that it inhibits PTP1B with little effect on the other PTPases tested in Table 10. Also, according to the present definition, the compound in example 82 is a non-selective inhibitor due to its inhibitory capacity against several PTPases, even though it has weak activity, if any, against PTP-LAR. 52 A chemical group is defined as any single atom or any group of covalently linked atoms or any molecule, including any radical thereof.
The terms "halogen" or "halo" include fluorine, chlorine, bromine, and iodine.
The term "alkyl" includes C C6 straight chain saturated and C2-C6 unsaturated aliphatic hydrocarbon groups, C C6 branched saturated and C2-C6 unsaturated aliphatic hydrocarbon groups, C3-C6 cyclic saturated and C5-C6 unsaturated aliphatic hydrocarbon groups, and C C6 straight chain or branched saturated and C2-C6 straight chain or branched unsaturated aliphatic hydrocarbon groups substituted with C3-C6 cyclic saturated and unsaturated aliphatic hydrocarbon groups having the specified number of carbon atoms. For example, this definition shall include but is not limited to methyl (Me), ethyl (Et), propyl (Pr), butyl (Bu), pentyl, hexyl, heptyl, ethenyl, propenyl, butenyl, penentyl, hexenyl, isopropyl (i-Pr), isobutyl (i-Bu), tert-butyl (t-B ), sec-butyl (s-Bu), isopentyl, neopentyl, cyclopropyl, cyclobutyl, cy- clopentyl, cyclohexyl, cyclopentenyl, cyclohexenyl, methylcyclopropyl, ethylcyclohexenyl, butenylcyclopentyl, and the like.
The term "substituted alkyl" represents an alkyl group as defined above wherein the substi- tutents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, hy- droxy, COR5, C^Ceaikyl, C Cβalkyloxy, aryloxy, arylC Cealkyloxy, thio, C^Cβalkylthio, arylthio, arylC^Cealkylthio, NR7R8, CrCgalkylamino, arylamino, arylC^Cβalkylamino, di(arylC1-C6alkyl)amino, C^Cealkylcarbonyl, arylCrC6alkylcarbonyl, C^Cgalkyl-carboxy, arylCrC6alkylcarboxy, CrC6alkylcarbonylamino, -C Cealkyl-aminoCORn, arylCr C6alkyicarbonylamino, tetrahydrofuranyl, morpholinyl, piperazinyl, -CONR7R8, -Cr C6alkylCONR7R8, or a saturated or partial saturated cyclic 5, 6 or 7 membered amine or lac- tam; wherein R„ is hydroxy, Chalky!, aryl, arylCrCealkyl, CrC6alkyloxy, aryloxy, arylCr C6alkyloxy and R5 is defined as above or NR7R8, wherein R7, R8 are defined as above.
The term "alkyloxy" (e.g. methoxy, ethoxy, propyloxy, allyioxy, cyclohexyloxy) represents an "alkyl" group as defined above having the indicated number of carbon atoms attached through an oxygen bridge. The term "alkyloxyalkyl" represents an "alkyloxy" group attached through an alkyl group as defined above having the indicated number of carbon atoms. 53 The term "aryloxy" (e.g. phenoxy, naphthyloxy and the like) represents an aryl group as defined below attached through an oxygen bridge.
The term "arylalkyioxy" (e.g. phenethyloxy, naphthylmethyloxy and the like) represents an "arylalkyl" group as defined below attached through an oxygen bridge.
The term "arylalkyloxyalkyl" represents an "arylalkyioxy" group as defined above attached through an "alkyl" group defined above having the indicated number of carbon atoms.
The term "arylthio" (e.g. phenylthio, naphthylthio and the like) represents an "aryl" group as defined below attached through an sulfur bridge.
The term "alkyloxycarbonyl" (e.g. methylformiat, ethylformiat and the like) represents an "alkyloxy" group as defined above attached through a carbonyl group.
The term "aryloxycarbonyl" (e.g. phenylformiat, 2-thiazolylformiat and the like) represents an "aryloxy" group as defined above attached through a carbonyl group.
The term "arylalkyloxycarbonyl" (e.g. benzylformiat, phenyletylformiat and the like) repre- sents an "arylalkyioxy" group as defined above attached through a carbonyl group.
The term "alkyloxycarbonyialkyl" represents an "alkyloxycarbonyl" group as defined above attached through an "alkyl" group as defined above having the indicated number of carbon atoms.
The term "arylalkyloxycarbonylalkyl" represents an "arylalkyloxycarbonyl" group as defined above attached through an "alkyl" group as defined above having the indicated number of carbon atoms.
The term "alkylthio" (e.g. methylthio, ethylthio, propylthio, cyclohexenylthio and the like) represents an "alkyl" group as defined above having the indicated number of carbon atoms attached through a sulfur bridge. 54 The term "arylalkylthio" (e.g. phenylmethylthio, phenylethylthio, and the like) represents an "arylalkyl" group as defined above having the indicated number of carbon atoms attached through a sulfur bridge.
The term "alkylthioalkyl" represents an "alkylthio" group attached through an alkyl group as defined above having the indicated number of carbon atoms.
The term "arylalkylthioalkyl" represents an "arylalkylthio" group attached through an alkyl group as defined above having the indicated number of carbon atoms.
The term "alkylamino" (e.g. methylamino, diethylamino, butylamino, N-propyl-N-hexylamino, (2-cyclopentyl)propylamino, hexenylamino, pyrrolidinyl, piperidinyl and the like) represents one or two "alkyl" groups as defined above having the indicated number of carbon atoms attached through an amine bridge. The two alkyl groups may be taken together with the nitrogen to which they are attached forming a saturated, partially saturated or aromatic cyclic, bicyclic or tricyciic ring system containing 3 to 14 carbon atoms and 0 to 3 additional heteroatoms selected from nitrogen, oxygen or sulfur, the ring system can optionally be substituted with at least one d-Cβalkyl, aryl, aryld-Cealkyl, hydroxy, oxo, d-Cealkyloxy, Cr CealkyloxyCrCealkyl, NR9R10, C1-C6alkylaminoC1-C6alkyl substituent wherein the alkyl and aryl groups are optionally substituted as defined in the definition section and R9 and R10 are defined as above.
The term "arylalkylamino" (e.g. benzylamino, diphenylethylamino and the like) represents one or two "arylalkyl" groups as defined above having the indicated number of carbon atoms attached through an amine bridge. The two "arylalkyl" groups may be taken together with the nitrogen to which they are attached forming a saturated, partially saturated or aromatic cyclic, bicyclic or tricyciic ring system containing 3 to 14 carbon atoms and 0 to 3 additional heteroatoms selected from nitrogen, oxygen or sulfur, the ring system can optionally be substituted with at least one C Cealkyl, aryl, arylCrCealkyl, hydroxy, oxo, CrCealkyloxy, Cr C6alkyloxyCrC6alkyl, NR9R10, C CealkylaminoC Cgalkyl substituent wherein the alkyl and aryl groups are optionally substituted as defined in the definition section and R9 and R10 are defined as above.
The term "alkylaminoalkyl" represents an "alkylamino" group attached through an alkyl group as defined above having the indicated number of carbon atoms. 55
The term "arylalkyla inoalkyl" represents an "arylalkylamino" group attached through an alkyl group as defined above having the indicated number of carbon atoms.
The term "arylalkyl" (e.g. benzyl, phenylethyl) represents an "aryl" group as defined below attached through an alkyl having the indicated number of carbon atoms or substituted alkyl group as defined above.
The term "alkylcarbonyl" (e.g. cyclooctylcarbonyl, pentylcarbonyl, 3-hexenylcarbonyi) repre- sents an "alkyl" group as defined above having the indicated number of carbon atoms attached through a carbonyl group.
The term "arylalkylcarbonyl" (e.g. phenylcyclopropylcarbonyl, phenylethylcarbonyl and the like) represents an "arylalkyl" group as defined above having the indicated number of carbon atoms attached through a carbonyl group.
The term "alkylcarbonylalkyl" represents an "alkylcarbonyl" group attached through an "alkyl" group as defined above having the indicated number of carbon atoms.
The term "arylalkylcarbonylalkyi" represents an "arylalkylcarbonyl" group attached through an alkyl group as defined above having the indicated number of carbon atoms.
The term "alkylcarboxy" (e.g. heptylcarboxy, cyclopropylcarboxy, 3-pentenylcarboxy) represents an "alkylcarbonyl" group as defined above wherein the carbonyl is in turn attached through an oxygen bridge.
The term "arylalkylcarboxy" (e.g. benzylcarboxy, phenylcyclopropylcarboxy and the like) represents an "arylalkylcarbonyl" group as defined above wherein the carbonyl is in turn attached through an oxygen bridge.
The term "alkylcarboxyalkyl" represents an "alkylcarboxy" group attached through an "alkyl" group as defined above having the indicated number of carbon atoms. The term "arylalkylcarboxyalkyl" represents an "arylalkylcarboxy" group attached through an "alkyl" group as defined above having the indicated number of carbon atoms. 56
The term "alkylcarbonylamino" (e.g. hexylcarbonylamino, cyclopentylcarbonyl-aminomethyl, methylcarbonylaminophenyl) represents an "alkylcarbonyl" group as defined above wherein the carbonyl is in turn attached through the nitrogen atom of an amino group. The nitrogen atom may itself be substituted with an alkyl or aryl group.
The term "arylalkylcarbonylamino" (e.g. benzylcarbonylamino and the like) represents an "arylalkylcarbonyl" group as defined above wherein the carbonyl is in turn attached through the nitrogen atom of an amino group. The nitrogen atom may itself be substituted with an alkyl or aryl group.
The term "alkylcarbonylaminoalkyl" represents an "alkylcarbonylamino" group attached through an "alkyl" group as defined above having the indicated number of carbon atoms. The nitrogen atom may itself be substituted with an alkyl or aryl group.
The term "arylalkylcarbonylaminoalkyl" represents an "arylalkylcarbonylamino" group attached through an "alkyl" group as defined above having the indicated number of carbon atoms. The nitrogen atom may itself be substituted with an alkyl or aryl group.
The term "alkylcarbonylaminoalkylcarbonyl" represents an alkylcarbonylaminoalkyl group attached through a carbonyl group. The nitrogen atom may be further substituted with an "alkyl" or "aryl" group.
The term "aryl" represents an unsubstituted, mono-, di- or trisubstituted monocyclic, polycy- die, biaryl and heterocyclic aromatic groups covalently attached at any ring position capable of forming a stable covalent bond, certain preferred points of attachment being apparent to those skilled in the art (e.g., 3-indolyl, 4-imidazolyl). The aryl substituents are independently selected from the group consisting of halo, nitro, cyano, trihalomethyl, CrC6alkyl, aryl, arylCrCealkyl, hydroxy, COR5, CrC-βalkyloxy, d-CealkyloxyCrC-βalkyl, aryloxy, arylC,- C6alkyloxy, aryld-CealkyloxyCrCealkyl, thio, d-Cgalkylthio, C CβalkylthioC Cβal yl, arylthio, arylCrC6alkylthio, arylCrCsalkylthioC Cβalkyl, NR8R9, CrC6-alkylamino, CrCβalkylaminoC C6alkyl, arylamino, arylC C6alkylamino, arylCrCgalkylaminod-Cealkyl, di(arylCrC6alkyl)- aminoCrC6alkyl, CrC6alkylcarbonyl, d-CealkylcarbonylC Cealkyl, arylCrC6alkyl-carbonyl, arylCrCealkylcarbonylCrCealkyl, CrC6alkylcarboxy, C CealkylcarboxyC Cgalkyl, arylCr 57 C6alkylcarboxy, arylCrCgalkylcarboxyCrCealkyl, carboxyCrCsalkyloxy, Cr C6alkylcarbonylamino, d-CealkylcarbonylaminoC Cealkyl, -carbonylNR^-CealkylCORn, arylC C6alkylcarbonyl-amino, aryiC CealkylcarbonylaminoC Cβalkyl, -CONR8R9, or -Cr C6alkyl-CONR8R9; wherein R7, R8, R9, and R„ are defined as above and the alkyl and aryl groups are optionally substituted as defined in the definition section;
The definition of aryl includes but is not limited to phenyl, biphenyl, indenyl, fluorenyl, naphthyl (1-naphthyl, 2-naphthyl), pyrrolyl (2-pyrrolyl), pyrazolyl (3-pyrazolyl), imidazolyl (1- imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl), triazolyl (1 ,2,3-triazoM-yl, 1 ,2,3-triazol-2- yl 1 ,2,3-triazol-4-yl, 1 ,2,4-triazol-3-yl), oxazolyl (2-oxazolyl, 4-oxazolyl, 5-oxazolyl), isoxazolyl (3-isoxazolyl, 4-isoxazoiyl, 5-isoxazolyl), thiazolyl (2-thiazolyl, 4-thiazolyl, 5-thiazolyl), thio- phenyl, (2-thiophenyl, 3-thiophenyl, 4-thiophenyl, 5-thiophenyl), furanyl (2-furanyl, 3-furanyl, 4-furanyl, 5-furanyl), pyridyl (2-pyridyl, 3-pyridyl, 4-pyridyl, 5-pyridyl), pyrimidinyl (2- pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 6-pyrimidinyl), pyrazinyl, pyridazinyl (3-pyridazinyl, 4- pyridazinyl, 5-pyridazinyl), quinolyl (2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 6-quinolyl, 7- quinolyl, 8-quinolyl), isoquinolyl (1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 6- isoquinolyl, 7-isoquinolyl, 8-isoquinolyl), benzo[b]furanyl (2-benzo[b]furanyl, 3- benzo[b]furanyl, 4-benzo[b]furanyl, 5-benzo[b]furanyl, 6-benzo[b]furanyl, 7-benzo[b]furanyl), 2,3-dihydro-benzo[b]furanyl (2-(2,3-dihydro-benzo[b]furanyl), 3-(2,3-dihydro- benzo[b]furanyl), 4-(2,3-dihydro-benzo[b]furanyl), 5-(2,3-dihydro-benzo[b]furanyl), 6-(2,3- dihydro-benzo[b]furanyl), 7-(2,3-dihydro-benzo[b]furanyl)), benzo[b]thiophenyl (2- benzo[b]thiophenyl, 3-benzo[b]thiophenyl, 4-benzo[b]thiophenyl, 5-benzo[b]thiophenyl, 6- benzo[b]thiophenyl, 7-benzo[b]thiophenyl), 2,3-dihydro-benzo[b]-thiophenyl (2-(2,3-dihydro- benzo[b]thiophenyl), 3-(2,3-dihydro-benzo[b]-thiophenyl), 4-(2,3-dihydro-benzo[b]thiophenyl), 5-(2,3-dihydro-benzo[b]-thiophenyl), 6-(2,3-dihydro-benzo[b]thiophenyl), 7-(2,3-dihydro- benzo[b]-thiophenyl)), 4,5,6, 7-tetrahydro-benzo[b]thiophenyl (2-(4,5,6,7-tetrahydro- benzo[b]thiophenyl), 3-(4,5,6,7-tetrahydro-benzo-[b]thiophenyl), 4-(4,5,6,7-tetrahydro- benzo[b]thiophenyl), 5-(4,5,6,7-tetrahydro-benzo-[b]thiophenyl), 6-(4,5,6,7-tetrahydro- benzo[b]thiophenyl), 7-(4,5,6,7-tetrahydro-benzo[b]thiophenyl)), 4,5,6, 7-tetrahydro- thieno[2,3-c]pyridyl (4-(4,5,6,7-tetrahydro-thieno[2,3-c]pyridyl), 5-4,5,6,7-tetrahydro- thieno[2,3-c]pyridyl), 6-(4,5,6,7-tetrahydro-thieno[2,3-c]pyridyl), 7-(4,5,6,7-tetra-hydro- thieno[2,3-c]pyridyl)), indolyl (1-indolyl, 2-indolyl, 3-indolyl, 4-indolyl, 5-indolyl, 6-indolyl, 7- indolyl), indazole (1-indazolyl, 3-indazolyl, 4-indazolyl, 5-indazolyl, 6-indazolyl, 7-indazolyl), benzimidazolyl (1-benzimidazolyl, 2-benzimidazolyl, 4-benzimidazolyl, 5-benzimidazolyl, 6- 58 benzimidazolyl, 7-benzimidazolyl, 8-benzimidazolyl), benzoxazolyl (1-benzoxazolyl, 2- benzoxazolyl), benzothiazolyl (1-benzothiazolyl, 2-benzothiazolyl, 4-benzothiazolyl, 5- benzothiazolyl, 6-benzothiazolyl, 7-benzothiazolyl), carbazolyl (1-carbazolyl, 2-carbazolyl, 3- carbazolyl, 4-carbazolyl), 5H-dibenz[b,f]azepine (5H-dibenz[b,f]azepin-1-yl, 5H- dibenz[b,f]azepine-2-yl, 5H-dibenz[b,f]azepine-3-yl, 5H-dibenz-[b,f]azepine-4-yl, 5H- dibenz[b,f]-azepine-5-yl), 10,11-dihydro-5H-dibenz[b,f]azepine (10,11-dihydro-5H- dibenz[b,f]azepine-1 -yl, 10,11 -dihydro-5H-dibenz[b,f]azepine-2-yl, 10,11 -dihydro-5H- dibenz[b,f]azepine-3-yl, 10,11-dihydro-5H-dibenz[b,f]azepine-4-yl, 10,11-dihydro-5H- dibenz[b,f]azepine-5-yl), piperidinyl (2-piperidinyl, 3-piperidinyl, 4-piperidinyl), pyrrolidinyl (1- pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl), phenylpyridyl (2-phenyl-pyridyl, 3-phenylpyridyl, 4- phenylpyridyl), phenylpyrimidinyl (2-phenylpyrimidinyl, 4-phenylpyrimidinyl, 5- phenylpyrimidinyl, 6-phenylpyrimidinyl), phenylpyrazinyl, phenylpyridazinyl (3- phenylpyridazinyl, 4-phenylpyridazinyl, 5-phenyl-pyridazinyl).
The term "arylcarbonyl" (e.g. 2-thiophenyicarbonyl, 3-methoxy-anthrylcarbonyl, oxazolylcar- bonyl) represents an "aryl" group as defined above attached through a carbonyl group.
The term "arylalkylcarbonyl" (e.g. (2,3-dimethoxyphenyl)-propylcarbonyl, (2- chloronaphthyl)pentenylcarbonyl, imidazolylcyclo-pentylcarbonyl) represents an "arylalkyl" group as defined above wherein the "alkyl" group is in turn attached through a carbonyl.
The compounds of the present invention which have asymmetric centers may occur as ra- cemates, racemic mixtures, and as individual enantiomers or diastereoisomers, with all iso- meric forms being included in the present invention as well as mixtures thereof.
Pharmaceutically acceptable salts of the compounds of the invention, where a basic or acidic group is present in the structure, are also included within the scope of this invention. When an acidic substituent is present, such as -COOH, 5-tetrazolyl and P(O)(OH)2, there can be formed the ammonium, sodium, potassium, calcium salt, and the like, for use as the dosage form. When a basic group is present, such as amino or a basic heteroaryl radical, such as pyridyl, an acidic salt, such as hydrochloride, hydrobromide, acetate, maleate, palmoate, methanesulfonate, p-toluenesulfonate, and the like, can be used as the dosage form. 59 Also, in the case of the -COOH or -P(O)(OH)2 being present, pharmaceutically acceptable esters can be employed, e.g., methyl, tert-butyl, pivaloyioxymethyl, and the like, and those esters known in the art for modifying solubility or hydrolysis characteristics for use as sustained release or prodrug formulations.
In addition, some of the compounds of the instant invention may form solvates with water or common organic solvents. Such solvates are encompassed within the scope of the invention.
The term "therapeutically effective amount" shall mean that amount of drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal, or human that is being sought by a researcher, veterinarian, medical doctor or other.
DESCRIPTION OF THE INVENTION
It has surprisingly been shown that compounds comprising a certain structural fragment show inhibitory or modulatory capacity against one or more PTPases or other molecules with phosphotyrosine recognition unit(s).
Accordingly, the present invention relates to compounds that fulfills all of the following 3 criteria:
(1) has a structure represented by Formula I:
N 4
Figure imgf000061_0001
Formula I
wherein R, R and R4 are any chemical group or combination of chemical groups; 60
(2) acts as a phosphotyrosine recognition unit ligand, preferably an inhibitor or modulator of one or more PTPases or proteins that contain SH2 domains; and
(3) has a molecular weight below or equal to 2500 daltons;
In a preferred embodiment the compounds of the invention has a structure represented by Formula II
N 4
O
Figure imgf000062_0001
OR
Formula II
where R, R,and R4 are any chemical group or combination of chemical groups, and R- preferably is H.
In another preferred embodiment the compounds that fulfills all of the following 3 criteria:
(1) has a structure represented by Formula III:
R5\ / R1 R5\^R1
,R4
RX "N IM" * Or -N
R2OC
Figure imgf000062_0002
Formula III
wherein R1 ? R2, R3, R4 and R5 are any chemical group or combination of chemical groups, and R3 and R5 may be covalently linked to each other; 61
(2) acts as a phosphotyrosine recognition unit ligand, preferably an inhibitor or modulator of one or more PTPases or proteins that contain SH2 domains; and
(3) has a molecular weight below or equal to 2500 daltons.
In another preferred embodiment the compounds of the invention has a structure represented by Formula IV
R5\ _/R1
O
Figure imgf000063_0001
OR
Formula IV
where R,, R3, R4 and R5 are any chemical group or combination of chemical groups, and R3 and R5 may be covalently linked to each other, and R preferably is H.
In another preferred embodiment the compounds of the invention has a structure represented by Formula V
O
CO^
or
Figure imgf000063_0002
Figure imgf000063_0003
Formula V
where R1 t R3, R4 and R5 are any chemical group or combination of chemical groups, and R3 and R5 may be covalently linked to each other, and R is preferably H. 62 In another preferred embodiment the compounds of the invention has a structure represented by Formula VI
RR^ ^COOH
4
N
Figure imgf000064_0001
OR
Formula VI
where R3, R4 and R5 are any chemical group or combination of chemical groups, and R3 and R5 may be covalently linked to each other, and R is preferably H.
In another preferred embodiment the compounds of the invention has a structure represented by Formula VII
R1 _
R
N or
^COR,
O O
Formula VII
wherein A together with the double bond in formula VII represents any aryl as defined above, and R,, R2, R3 and R4 are any chemical group or combination of chemical groups.
In another preferred embodiment the compounds of the invention has a structure repre- sented by Formula VIII fc
«& -
Formula VIII 63 wherein A together with the double bond in formula VIII represents any aryl as defined above, and R, R1 f R3 and R4 are any chemical group or combination of chemical groups, and R preferably is H.
In another preferred embodiment the compounds of the invention has a structure represented by Formula IX
Figure imgf000065_0001
Formula IX
wherein A together with the double bond in formula IX represents any aryl as defined above, and R R2, R3 and R4 are any chemical group or combination of chemical groups.
In another preferred embodiment the compounds of the invention has a structure represented by Formula X
COOH
R^ C°R2
Formula X
wherein A together with the double bond in formula X represents any aryl as defined above, and R2, R3 and R4 are any chemical group or combination of chemical groups.
In another preferred embodiment the compounds of the invention has a structure represented by Formula XI
Figure imgf000065_0002
64 Formula XI
wherein A together with the double bond in formula XI represents any aryl as defined above, and R, R3 and R4 are any chemical group or combination of chemical groups, and R prefera- bly is H.
In another preferred embodiment the compounds of the invention has a structure represented by Formula XII
R1 R4 O
R3 ^ o'-
R2 O Formula XII
wherein R, is a chemical group capable of being a proton donor and/or a proton acceptor, preferably -COOH, 5-tetrazolyl, -NH2, -CONH2, and R, R2, R3 and R4 are any chemical group or combination of chemical groups.
In another preferred embodiment the structure of the compounds of the invention is represented by the following Formula XX
Figure imgf000066_0001
Formula XX
wherein:
A is together with the double bond in Formula 1 phenyl, biphenyl, indenyl, fluorenyl, fluo- renyl-9-one, naphthyl, pyridyl, pyridazinyl, pyrimidyl or pyrazinyl;
or A is together with the double bond in Formula 1 indolyl, benzo[b]thiophenyl, benzo[b]furanyl, indazolyl, benzo[b]isoxazolyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, 9H-thieno[2,3-c]chromenyl, 4,5,6,7-tetrahydro-benzo[b]thiophenyl, 4,5,6, 7-tetrahydro- 65 thieno[2,3-b]pyridyl, 4,5,6,7-tetrahydro-thieno[2,3-c]pyr.dyl, 4,5,6,7-tetrahydro-thieno[3,2- cjpyridyl, 4,5,6,7-tetrahydro-thieno[3,2-b]pyridyl, 4,7-dihydro-5H-thieno[2,3-c]pyranyl, 4,7- dihydro-5H-thieno[2,3-c]thiopyranyl or 4,5,6,7-tetrahydro-4,7-ethanon-thieno[2,3-b]pyridyl;
or A is together with the double bond in Formula 1 furanyl, thiophenyl, pyrrolyl, oxazolyl, thiazolyl, imidazoiyl, pyrazolyl, isoxazolyl, isothiazolyl, 1 ,2,3-oxadiazolyl, furazanyl or 1 ,2,3- triazolyl;
or A is together with the double bond in Formula 1 furo[2,3-b]pyridyl, thieno[2,3-b]pyridyl, pyrrolo[2,3-b]pyridyl, furo[2,3-c]pyridyl, thieno[2,3-c]pyridyl, pyrrolo[2,3-c]pyridyl, furo[3,2- yridyl, thieno[3,2-c]pyridyl, pyrrolo[3,2-c]pyridyl, furo[3,2-d]pyridyl, thieno[3,2-d]pyridyl, pyrrolo[3,2-d]pyridyl, furo[2,3-d]pyrimidyl, thieno[2,3-d]pyrimidyl, pyrrolo[2,3-d]pyrimidyl, furo[2,3-b]pyrazinyl, thieno[2,3-b]pyrazinyi, pyrrolo[2,3-b]pyrazinyl, furo[2,3-c]pyridazinyl, thieno[2,3-c]pyridazinyl, pyrrolo[2,3-c]pyridazinyl, furo[2,3-d]pyridazinyl, thieno[2,3- djpyridazinyl, pyrrolo[2,3-d]pyridazinyl, furo[3,2-c]pyridazinyl, thieno[3,2-c]pyridazinyl, pyr- rolo[3,2-c]pyridazinyl, quinolizinyl, quinolinyl, isoquinolinyl, cinnolinyl, phthalazinyl, quinazoli- nyl, quinoxalinyl, 1 ,8-naphthyridinyl, chromanyl, thiochromanyl, isochromanyl, isothio- chromanyl, 2,3-dihydro-thieno[2,3-b]furanyl, 4,6-dihydro-thieno[2,3-c]furanyl, 2,3-dihydro- thieno[3,2-b]furanyl, 4,5-dihydro-thieno[2,3-b]thiophenyl, 4,6-dihydro-thieno[3,4-b]thiophenyl, 5,6-dihydro-thieno[3,2-b]thiophenyl, 4,5-dihydro-thieno[2,3-b]pyrrolyl, thieno[3,2- djisothiazolyl, thieno[3,2-d]thiazolyl, thieno[2,3-d]thiazolyl, thieno[2,3-c]pyrrolyl-4,6-dione, 1 H-thieno[2,3-d]imidazolyl, 6H-thieno[2,3-b]pyrrolyl, 5,6-dihydro-4H-thieno[2,3-c]pyrrolyl or 4H-thieno[3,2-b]pyrrolyl;
R, and R2 are independently selected from the group consisting of COR5, OR6, CF3, nitro, cyano, SO3H, SO2NR7R8, PO(OH)2, CH2PO(OH)2, CHFPO(OH)2, CF2PO(OH)2, C(=NH)NH2, NR7R8, and the following 5-membered heterocycles 66
H
-N. N N OH ,N OH ° s9 w J: Hf O
Figure imgf000068_0001
N'N^--0 o V°H S'V0H N'V0H N' SH
)-ό = )=H -o ό
N-V0H HN-V0H cV0H (V0H (τ °
p
HN'έ'0
R3, R16 and R17are hydrogen, halo, nitro, cyano, trihalomethyl, Chalky!, aryl, arylCrC6- alkyl, hydroxy, carboxy, carboxyC^Cgalkyl, C1-C6alkyioxycarbonyl, aryloxycarbonyl, arylCr C6alkyloxycarbonyl, C Cgalkyioxy, CrCβalkyloxyd-Cβalkyl, aryloxy, arylC C6alkyloxy, arylCrCealkyloxyCrCβalkyl, thio, CrC6alkylthio, d-CealkylthioCrCealkyl, arylthio, arylCr C6alkylthio, arylC CealkylthioC Cealkyl, NR7R8, d-Cealkyl-aminod-Cβalkyl, arylC,- C6alkylaminoCrC6alkyl, di(arylC1-C6alkyl)aminoC1-C6alkyl, C C6alkylcarbonyl, Cr CβalkylcarbonylC Cealkyl, arylCrCgalkylcarbonyl, aryld-CealkylcarbonylCrCealkyl, Cr C6alkylcarboxy, C Cβalkylcarboxyd-Ce-alkyl, arylcarboxy, arylCrCealkylcarboxy, arylC CealkylcarboxyC Cgalkyl, C Cgalkylcarbonyl-amino, C1-C6alkylcarbonylaminoC1-C6alkyl, -carbonylNR C CealkylCORn, arylCrC6alkylcarbonyiamino, arylC CgalkylcarbonylaminoCr C6alkyl, CONR7R8, or d-CgalkylCONR^a wherein the alkyl and aryl groups are optionally substituted and R„ is NR7R8, or CrC6alkylNR7R8; or, when R16 and R17are hydrogen, R3 is
A-B-C-D-CrC6alkyl, wherein A is CrCβalkyl, aryl or arylCrC6alkyl; B is amino, thio, SO, SO2 or oxo; C is C Cβalkyl, amino; D is a chemical bond, amino or C^Cgalkyl wherein the alkyl and aryl groups are optionally substituted; or 67
O R13 H
R12 0
wherein R12, R13, and R14 are independently hydrogen, CrC6alkyl, aryl, arylCrC6alkyl and the alkyl and aryl groups are optionally substituted;
R4 is hydrogen, hydroxy, d-C6alkyl, aryl, aryld-C6alkyl, NR7R8, d-C6alkyloxy; wherein the alkyl and aryl groups are optionally substituted;
R5 is hydroxy, d-C6alkyl, aryl, aryld-C6alkyl, CF3, NR7R8; wherein the alkyl and aryl groups are optionally substituted;
R6 is hydrogen, CrC6alkyl, aryl, aryld-C6alkyl; wherein the alkyl and aryl groups are optionally substituted;
R7 and R8 are independently selected from hydrogen, CrC6alkyl, aryl, aryld-C6alkyl, C-- C6alkylcarbonyl, arylcarbonyl, aryld-C6alkyicarbonyl, d-C6alkyl-carboxy or arylCr C6alkylcarboxy wherein the alkyl and aryl groups are optionally substituted; or R7 and R8 are together with the nitrogen to which they are attached forming a saturated, partially saturated or aromatic cyclic, bicyclic or tricyciic ring system containing from 3 to 14 carbon atoms and from 0 to 3 additional heteroatoms selected from nitrogen, oxygen or sulfur, the ring system can optionally be substituted with at least one C1-C6alkyl, aryl, aryld-C6alkyl, hydroxy, oxo, CrC6alkyloxy, aryld-C6alkyloxy, d-dalkyloxyd-dalkyl, NR9R10 or Cr C6alkylaminoCrC6alkyl, wherein R9 and R10 are independently selected from hydrogen, Cr C6alkyl, aryl, arylCrC6alkyl, d-C6alkylcarbonyl, arylcarbonyl, aryld-C6alkylcarbonyl, Cr C6alkylcarboxy or aryld-C6alkylcarboxy; wherein the alkyl and aryl groups are optionally substituted; or
R7 and R8 are independently a saturated or partial saturated cyclic 5, 6 or 7 membered amine, imide or lactam; 68 Compounds of the invention may modulate or inhibit the activity of protein tyrosine phosphatases or other molecules with phosphotyrosine recognition unit(s) via different mechanisms of action. Examples of such mechanism of actions, which are not intended in any way to limit the scope of the invention, are (a) classical competitive inhibition; (b) uncom- petitive inhibition; (c) mixed-type inhibition as defined above.
The invention furthermore relates to compounds which after uptake in cells or mammals has a structure as defined above.
In one preferred embodiment, the compounds of the invention act as classical, competitive inhibitors of one or more PTPases.
In another preferred embodiment, the compounds of the invention act as mixed-type inhibitors of one or more PTPases.
In one preferred embodiment, the compounds of the invention substantially act as an inhibitor of one or more PTPases involved in regulation of tyrosine kinase signalling pathways.
In another preferred embodiment, the compounds of the invention substantially inhibit or modulate receptor-tyrosine kinase signalling pathways via interaction with one or more regulatory PTPases, preferably the signalling pathways of the insulin receptor, the IGF-I receptor and/or other members of the insulin receptor family, the EGF-receptor family, the platelet-derived growth factor receptor family, the nerve growth factor receptor family, the hepatocyte growth factor receptor family, the growth hormone receptor family and/or members of other receptor-type tyrosine kinase families.
In another preferred embodiment, the compounds of the invention substantially inhibit or modulate non-receptor tyrosine kinase signalling through modulation of one or more regulatory PTPases, preferably modulation of members of the Src kinase family or other intracellular kinases. 69 in another preferred embodiment, the compounds of the invention substantially inhibit or modulate the activity of one or more PTPases that negatively regulate signal transduction pathways.
In another preferred embodiment, the compounds of the invention inhibit or modulate the activity of one or more PTPases that positively regulate signal transduction pathways, preferably CD45.
In another preferred embodiment, the compounds of the invention inhibit or modulate the activity of one or more PTPases that positively regulate signal transduction pathways in immune ceils.
In another preferred embodiment, the compounds of the invention inhibit or modulate the activity of one or more PTPases that negatively regulate signal transduction pathway.
In another preferred embodiment, the compounds of the invention inhibit one or more PTPases via binding to the active site of said PTPase(s) or to other sites that negatively influences the binding of substrate to said PTPase(s), an allosteric modulator.
In another preferred embodiment, the compounds of the invention modulate the activity of one or more PTPases via interaction with structures positioned outside of the active sites of the enzymes, preferably SH2 domains.
In another preferred embodiment, the compounds of the invention modulate the signal trans- duction pathways via binding of the compounds of the invention to SH2 domains or PTB domains of non-PTPase signalling molecules.
In one embodiment, the compounds of the invention are characterized by being selective PTPase inhibitors or compounds that are selective phosphotyrosine recognition unit ligands. The compound of the invention can e.g. be selective for a PTPase not described herein or, preferably, a PTPase listed in Table 1. 70 In another preferred embodiment, the compounds of the invention are characterized by being non-selective PTPase inhibitors such as inhibitors or modulators of at least 4 PTPases or 4 PTPase families.
In one preferred embodiment, the compounds of the invention are selective for the PTPα family.
In another preferred embodiment, the compounds of the invention are selective for PTPα.
In another preferred embodiment, the compounds of the invention are selective for PTPε.
In another preferred embodiment, the compounds of the invention are selective for CD45.
In one preferred embodiment, the compounds of the invention are selective for PTPβfam- ily.
In another preferred embodiment, the compounds of the invention are selective for PTPβ.
In another preferred embodiment, the compounds of the invention are selective for PTP- DEP1.
In one preferred embodiment, the compounds of the invention are selective for PTP-LAR family.
In one preferred embodiment, the compounds of the invention are selective for PTP-LAR.
In one preferred embodiment, the compounds of the invention are selective for PTPσ.
In one preferred embodiment, the compounds of the invention are selective for PTPδ.
In one preferred embodiment, the compounds of the invention are selective for PTPμ family. 71 In one preferred embodiment, the compounds of the invention are selective for PTPμ.
In one preferred embodiment, the compounds of the invention are selective for PTPK.
In one preferred embodiment, the compounds of the invention are selective for PTP1 B family.
In one preferred embodiment, the compounds of the invention are selective for PTP1B.
In one preferred embodiment, the compounds of the invention are selective for TC-PTP.
In one preferred embodiment, the compounds of the invention are selective for SHP-PTP family.
In one preferred embodiment, the compounds of the invention are selective for SHP-1.
In one preferred embodiment, the compounds of the invention are selective for SHP-2.
In one preferred embodiment, the compounds of the invention are selective for PTPζ fam- ily.
In another preferred embodiment, the compounds of the invention are selective for PTPγ.
In one preferred embodiment, the compounds of the invention are selective for PTP-PEST family.
In one preferred embodiment, the compounds of the invention are selective for PTPH1 family.
In one preferred embodiment, the compounds of the invention are selective for PTPH1.
In one preferred embodiment, the compounds of the invention are selective for PTPD1. 72 In one preferred embodiment, the compounds of the invention are selective for PTPD2.
In one preferred embodiment, the compounds of the invention are selective for PTPMEG1.
In one preferred embodiment, the compounds of the invention are selective for IA-2 family.
In one preferred embodiment, the compounds of the invention are selective for IA-2.
In one preferred embodiment, the compounds of the invention are selective for IA-2β.
In one preferred embodiment, the compounds of the invention are selective for the PTPψ family.
In another preferred embodiment, the compounds of the invention are selective for PTPψ.
In another preferred embodiment, the compounds of the invention are selective for PTPp.
In another preferred embodiment, the compounds of the invention are selective for PTPφ.
In another preferred embodiment, the compounds of the invention have a molecular weight of less than 1000 Daltons, and preferably of more than 100 Daltons.
In one preferred embodiment, the compounds of the invention have K, values of less than 200 μM against one or more PTPases.
In another preferred embodiment, the compounds of the invention have Kj values of less than 2 μM against one or more PTPases.
In another preferred embodiment, the compounds of the invention have Kj values of less than 100 nM against one or more PTPases. 73 In another preferred embodiment, the compounds of the invention have a Kj value of < 2 μM against one or two PTPase or PTPase families and a Kj value of > 50 μM against at least two other PTPases or PTPase families.
In another preferred embodiment, the compounds of the invention have a K, value of <
100 nM against one or two PTPase or PTPase families and a Kj value of > 10 μM against at least two other PTPases or PTPase families.
In one preferred embodiment, the compounds of the invention have a IC50 value of less than 200 M against one or more molecules with phosphotyrosine recognition unit(s).
In another preferred embodiment, the compounds of the invention have a IC50 value of less than 2 M against one or more molecules with phosphotyrosine recognition unit(s).
In another preferred embodiment, the compounds of the invention have a IC50 value of less than 100 nM against one or more molecules with phosphotyrosine recognition unit(s).
In one preferred embodiment, the compounds of the invention act as inhibitors of one or more PTPases, e.g. protein tyrosine phosphatases involved in regulation of tyrosine kinase signalling pathways. Preferred embodiments include modulation of receptor- tyrosine kinase signalling pathways via interaction with regulatory PTPases, e.g. the signalling pathways of the insulin receptor, the IGF-I receptor and other members of the insulin receptor family, the EGF-receptor family, the platelet-derived growth factor receptor family, the nerve growth factor receptor family, the hepatocyte growth factor receptor family, the growth hormone receptor family and members of other receptor-type tyrosine kinase families. Further preferred embodiments of the inventions is modulation of non- receptor tyrosine kinase signalling through modulation of regulatory PTPases, e.g. modulation of members of the Src kinase family and other non-receptor tyrosine kinases. One type of preferred embodiment of the inventions relates to modulation of the activity of PTPases that negatively regulate signal transduction pathways. An example, which is not intended in any way to limit the scope of the invention, is SHP-1 that negatively regulates 74 the erythropoietin signalling pathway. Another type of preferred embodiments of the inventions relate to modulation of the activity of PTPases that positively regulate signal transduction pathways. An example of the latter, which is not intended in any way to limit the scope of the invention, is CD45 which dephosphorylates tyrosine kinase of the Src family and thereby plays a positive role in signalling in cells from the hematopoietic system. One type of preferred CD45 inhibitor can be used to regulate the activity of lymphocytes, including T- and/or B-lymphocytes.
In a preferred embodiment the compounds of the invention act as modulators or inhibitors of the active site of one or more PTPases. In another preferred embodiment the compounds of the invention modulate the activity of one or more PTPases via interaction with structures positioned outside of the active sites of the enzymes, preferably SH2 domains. Further preferred embodiments include modulation of signal transduction pathways via binding of the compounds of the invention to SH2 domains or PTB domains of non- PTPase signalling molecules.
In preferred embodiments the compounds of the invention are selective inhibitors that are more than 10-fold potent against one PTPase family than against another PTP family.
In one embodiment, the compounds of the invention can be used for managing, treating or preventing type I diabetes, type II diabetes, impaired glucose tolerance, insulin resistance, obesity, immune dysfunctions including autoimmunity and AIDS, diseases with dysfunctions of the coagulation system, allergic diseases, osteoporosis, proliferative disorders including cancer and psoriasis, diseases with decreased or increased synthesis or effects of growth hormone, diseases with decreased or increased synthesis of hormones or cytokines that regulate the release of/or response to growth hormone, diseases of the brain including Alzheimer's disease and schizophrenia, and infectious diseases.
In another embodiment, the compounds of the invention can be used for
In another embodiment, the compounds of the invention can be used for managing, treating or preventing type I diabetes, type II diabetes, impaired glucose tolerance, insulin resistance, and/or obesity. 75 In another embodiment, the compounds of the invention can be used for managing, treating or preventing conditions with immune dysfunctions, including autoimmunity such as rheumatoid arthritis, systemic lupus erythematosus.
In another embodiment, the compounds of the invention can be used as immunosuppres- sants.
In another embodiment, the compounds of the invention can be used for managing or treating conditions with immune dysfunctions including AIDS.
In another embodiment, the compounds of the invention can be used for managing, treating or preventing allergic diseases, including asthma and allergic skin diseases.
In another embodiment, the compounds of the invention can be used for managing, treat- ing or preventing proliferative disorders, including cancer.
In another embodiment, the compounds of the invention can be used for managing, treating or preventing osteoporosis.
In another embodiment, the compounds of the invention can be used for managing, treating or preventing psoriasis.
In another embodiment, the compounds of the invention can be used for managing, treating or preventing diseases with decreased or increased synthesis or effects of growth hormone, diseases with decreased or increased synthesis of hormones or cytokines that regulate the release of/or response to growth hormone.
In another embodiment, the compounds of the invention can be used for managing, treating or preventing diseases with dysfunctions of the coagulation system.
In another embodiment, the compounds of the invention can be used for managing, treating or preventing diseases of the brain including Alzheimer's disease and schizophrenia. 76 In another embodiment, the compounds of the invention can be used for managing, treating or preventing infectious diseases.
The compounds of the invention can furthermore be used to manufacture of medicaments for managing, treating or preventing the above-mentioned diseases and disorders.
Other preferred embodiments include use of the compounds of the invention for modulation of cell-cell interactions as well as cell-matrix interactions.
The present invention is furthermore concerned with pharmaceutical compositions comprising, as an active ingredient, at least one of the compounds of the present invention in association with a pharmaceutical carrier or diluent. Optionally, the pharmaceutical composition can comprise at least one of the compounds of the invention combined with compounds exhibiting a different activity, e.g. an antibiotic or other pharmacologically active material.
As a preferred embodiment, the compounds of the invention may be used as therapeuti- cals to inhibit or modulate one or more PTPases involved in regulation of the insulin receptor tyrosine kinase signalling pathway in patients with type I diabetes, type II diabetes, impaired glucose tolerance, insulin resistance, and obesity. Further preferred embodiments include use of the compounds of the invention for management of disorders with general or specific dysfunctions of PTPase activity, e.g. proliferarive disorders such as psoriasis and neopiastic diseases. As another embodiment, the compounds of the invention may be used in pharmaceutical preparations for management of osteoporosis.
Preferred embodiments of the invention further include use of compound of the invention in pharmaceutical preparations to increase the secretion or action of growth hormone and its analogous or somatomedins including IGF-1 and IGF-2 by modulating the activity of one or more PTPases or other signal transduction molecules with affinity for phosphotyro- sine involved controlling or inducing the action of these hormones or any regulating molecule.
The compounds of the invention may be used in pharmaceutical preparations for management of various disorders of the immune system, either as a stimulant or suppressor 77 of normal or perturbed immune functions, including autoimmune reactions. Further embodiments of the invention include use of the compounds of the invention for management of allergic reactions, e.g. asthma, dermal reactions, conjunctivitis.
In another embodiment, the compounds of the invention may be used in pharmaceutical preparations used for immunosuppression. A non-limiting example of such use is in connection with management of organ and/or tissue transplantation.
In another embodiment, compounds of the invention may be used in pharmaceutical preparations for prevention or induction of platelet aggregation.
In yet another embodiment, compounds of the invention may be used in pharmaceutical preparations for management of infectious disorders, in particular, the compounds of the invention may be used for management of infectious disorders caused by Yersinia and other bacteria as well as disorders caused by viruses or other micro-organisms.
Compounds of the invention may additionally be used for management or prevention of diseases in animals, including commercially important animals.
Also included in the present invention is a process for isolation of PTPases via affinity purification procedures based on the use of immobilized compounds of the invention using procedures well-known to those skilled in the art. Such methods, well-known to those skilled in the arts, may be used to identify novel PTPases or other molecules with phosphotyrosine recognition units. As a non-limiting example, compounds of the invention may be immobilized by coupling to a solid-phase. A tissue sample or a sample from a cell line prepared as a lysate by methods well-known to those skilled in the art may be passed over said solid-phase coupled with a compound of the invention. After appropriate washing procedures designed to remove material that binds unspecifically to said solid-phase, using standard procedures well known to those skilled in the art, mostly PTPases or other molecules with phosphotyrosine recognition units will be bound to the compounds of the invention coupled to the solid phase. Said PTPases or other molecules with phosphotyrosine recognition units may in turn be released by procedures well-known in the art and further subjected to amino acid sequence analysis according to standard procedures well- known to those skilled in the art. By back-translation of said amino acid sequence into a 78 nucleotide sequence of the corresponding cDNA can be deduced using the appropriate genetic code. Said nucleotide sequence can be used to design and produce an equivalent oligonucleotide, which in turn can be used to identify partial or full-length cDNA clones from appropriate cDNA libraries encoding a protein or glycoprotein corresponding to or similar to the isolated PTPase or molecule with pTyr recognition units. Said oligonucleotide or isolated cDNA clone(s) can similariy be used to isolate genomic clones corresponding to said cDNA clones. Said partial or full-length cDNA can be inserted into appropriate vectors and expressed and purified proteins with procedures well known to those skilled in the arts. Said purified proteins, in particular PTPases, may be used to further analyze the inhibitory capacity and selectivity of compounds of the invention as described.
The invention is further directed to compounds of the invention coupled to a suitable solid- phase matrix such as a Wang-resin or a Rink-resin
The invention is further diected to a method for isolating a protein or a glycoprotein with affinity for a compound according to the invention from a biological sample, comprising:
• contacting a compound of the invention immobilized by coupling to a suitable solid- phase matrix with said biological sample in order for said immobilized compound to form a complex by binding said protein or glycoprotein, • removing unbound material from said biological sample and isolating said complex, and
• extracting said protein or glycoprotein from said complex.
The invention is further directed to a method for isolating a protein-tyrosine phosphatase with affinity for a compound according to the invention from a biological sample, compris- ing
• contacting a compound of the invention immobilized by coupling to a suitable solid- phase matrix with said biological sample in order for said immobilized compound to form a complex by binding said protein-tyrosine phosphatase
• removing unbound material from said biological sample and isolating said complex • extracting said protein-tyrosine phosphatase.
The invention is further directed to a method for isolating a Src-homology 2 domain containing protein or a phosphotyrosine binding domain containing protein with affinity for a compound of the present invention from a biological sample, comprising 79
• contacting a compound of the invention immobilized by coupling to a suitable solid- phase matrix with said biological sample in order for said immobilized compound to form a complex by binding said Src-homology 2 domain containing protein or a phosphotyrosine binding domain containing protein • removing unbound material from said biological sample and isolating said complex
• extracting said Src-homology 2 domain containing protein or a phosphotyrosine binding domain containing protein from said complex.
The present invention also relates to a compound of the invention coupled to a fluorescent or radioactive molecule.
The invention furthermore relates to a method for coupling a fluorescent or radioactive molecule to a compound of the invention comprising
• contacting said compound with said fluorescent or radioactive molecule in a reaction mixture to produce a complex
• removing uncomplexed material and isolating said complex from said reaction mixture.
The invention is further directed to a method for detecting protein-tyrosine phosphatase or other molecules with phosphotyrosine recognition unit(s) in a cell or in a subject using a compound of the invention coupled to a fluorescent or radioactive molecule comprising
• contacting said cell or an extract thereof or a biological sample from said subject or by injecting said compound into said subject in order for said compound to produce a complex with said protein-tyrosine phosphatase or said molecules with phosphotyrosine recognition unit(s) • detecting said complex, thereby detecting the presence of said protein tyrosine phosphatase or said other molecules with phosphotyrosine recognition unit(s).
The invention is further directed to a method for quantifying the amount of protein-tyrosine phosphatases or other molecules with phosphotyrosine recognition unit(s) in a cell or in a subject using a compound of the invention coupled to a fluorescent or radioactive molecule comprising
• contacting said cell or an extract thereof or a biological sample from said subject or by injecting said compound into said subject in order for said compound to produce a 80 complex with said protein-tyrosine phosphatase or said molecules with phosphotyrosine recognition unit(s)
• measuring the amount of said complex, thereby detecting the presence of said protein tyrosine phosphatase or said molecules with phosphotyrosine recognition unit(s).
The invention is also concerned with a method for determining the function of a given protein-tyrosine phosphatase or group of protein-tyrosine phosphatases or said molecules with phosphotyrosine recognition unit(s) in a cell or a subject using a compound of the invention coupled to a fluorescent or radioactive molecule comprising • contacting said cell or an extract thereof or a biological sample from said subject or by injecting said compound into said subject in order for said compound to produce a complex with said protein-tyrosine phosphatase or said molecules with phosphotyrosine recognition unit(s)
• measuring the biological effects induced by said complex.
Pharmacological Methods
For the above indications the dosage will vary depending on the compound of the invention employed, on the mode of administration and on the therapy desired. However, in general, satisfactory results are obtained with a dosage of from about 0.5 mg to about 1000 mg, preferably from about 1 mg to about 500 mg of compounds of the invention, conveniently given from 1 to 5 times daily, optionally in sustained release form. Usually, dosage forms suitable for oral administration comprise from about 0.5 mg to about 1000 mg, preferably from about 1 mg to about 500 mg of the compounds of the invention ad- mixed with a pharmaceutical carrier or diluent.
The compounds of the invention may be administered in a pharmaceutically acceptable acid addition salt form or where possible as a metal or a C^-aikylammonium salt. Such salt forms exhibit approximately the same order of activity as the free acid forms.
This invention also relates to pharmaceutical compositions comprising a compound of the invention or a pharmaceutically acceptable salt thereof and, usually, such compositions also contain a pharmaceutical carrier or diluent. The compositions containing the com- 81 pounds of this invention may be prepared by conventional techniques and appear in conventional forms, for example capsules, tablets, solutions or suspensions.
The pharmaceutical carrier employed may be a conventional solid or liquid carrier. Exam- pies of solid carriers are lactose, terra alba, sucrose, talc, gelatine, agar, pectin, acacia, magnesium stearate and stearic acid. Examples of liquid carriers are syrup, peanut oil, olive oil and water.
Similariy, the carrier or diluent may include any time delay material known to the art, such as glyceryl monostearate or glyceryl distearate, alone or mixed with a wax.
If a solid carrier for oral administration is used, the preparation can be tabletted, placed in a hard gelatine capsule in powder or pellet form or it can be in the form of a troche or lozenge. The amount of solid carrier will vary widely but will usually be from about 25 mg to about 1 g. If a liquid carrier is used, the preparation may be in the form of a syrup, emulsion, soft gelatin capsule or sterile injectable liquid such as an aqueous or non-aqueous liquid suspension or solution.
Generally, the compounds of this invention are dispensed in unit dosage form comprising 10-200 mg of active ingredient in or together with a pharmaceutically acceptable carrier per unit dosage.
The dosage of the compounds according to this invention is 1-500 mg/day, e.g. about 100 mg per dose, when administered to patients, e.g. humans, as a drug.
A typical tablet that may be prepared by conventional tabletting techniques contains
Core:
Active compound (as free compound 100 mg or salt thereof) Colloidal silicon dioxide (Areosil®) 1.5 mg
Cellulose, microcryst. (Avicel®) 70 mg
Modified cellulose gum (Ac-Di-Sol®) 7.5 mg
Magnesium stearate 82
Coatinα:
HPMC approx. 9 mg
Figure imgf000084_0001
'Mywacett® 9-40 T approx. 0.9 mg
Acylated monogiyceride used as plasticiser for film coating.
The route of administration may be any route which effectively transports the active compound to the appropriate or desired site of action, such as oral or parenteral e.g. redal, transdermal, subcutaneous, intranasal, intramuscular, topical, intravenous, intraurethrai, ophthalmic solution or an ointment, the oral route being preferred.
The process for preparing compounds of the invemtion is further illustrated in the following examples, which, however, are not to be construed as limiting.
EXAMPLES
Hereinafter, TLC is thin layer chromatography, CDCI3 is deuterio chloroform, CD3OD is tetradeuterio methanol and DMSO-d6 is hexadeuterio dimethylsulfoxide. The structures of the compounds are confirmed by either elemental analysis or NMR, where peaks as- signed to characteristic protons in the title compounds are presented where appropriate.
1H NMR shifts (δH) are given in parts per million (ppm) downfield from tetramethylsiiane as internal reference standard. M.p.: is melting point and is given in °C and is not corrected.
Column chromatography was carried out using the technique described by W.C. Still et al., J. Org. Chem. 43: 2923 (1978) on Merck silica gel 60 (Art. 9385). HPLC analyses are performed using 5μm C18 4 x 250 mm column eluted with various mixtures of water and acetonitrile, flow = 1 ml/min, as described in the experimental section.
Compounds used as starting material are either known compounds or compounds which can readily be prepared by methods known per se.
Wang-resin is polystyrene with a 4-hydroxymethylphenol ether linker. 2-Aminothiophenes are prepared according to Gewald et al, Chem. Ber. 99: 94 (1966).
3-Aminothiophenes are prepared according to H. Hartmann and J. Liebseher, Synthesis 275
(1984). 83
EXAMPLE 1
Figure imgf000085_0001
2-(Oxalyl-amino)benzoic acid
To a stirred solution of anthranilic acid (20.1 g, 0.15 mol) in dry tetrahydrofuran (250 ml) was added dropwise ethyl oxalyl chloride (10.0 g, 0.073 mol). The resulting reaction mixture was stirred at room temperature for 15 min. filtered and the solvent evaporated in vacuo affording crude 16.4 g (94%) of 2-(ethoxyoxalyl-amino)benzoic acid as an oil.
To a solution of the above benzoic acid (10.0 g, 0.042 mol) in ethanol (350 ml) was added a solution of sodium hydroxide (3.7 g, 0.092 mol) in water (100 ml). The resulting reaction mixture was stirred at room temperature for 60 h. Concentrated hydrochloric acid was added to pH = 1 and the precipitate was filtered off and washed with water (3 x 100 ml), diethyl ether (3 x 80 ml) and dried in vacuo affording 7.1 g (81%) of the title compound as a solid.
M.p.: 214 - 215 °C:
Calculated for C9H7NO5, 0.2 H2O;
C, 51.68 %; H, 3.37 %; N, 6.70 %. Found: C, 50.96 %; H, 3.32 %; N, 6.52 %.
By a similar procedure as described in Example 1 the following compounds have been prepared. EXAMPLE 2
Figure imgf000085_0002
84 3-(Oxalyl-amino)naphthalene-2-carboxylic acid;
M.p.: 227 - 228 °C: Calculated for C13H9NO5; C, 60.24 %; H, 3.50 %; N, 5.40 %. Found: C, 59.98 %; H, 3.46 %; N, 5.25 %.
Figure imgf000086_0001
2-(Oxalyl-aminoV5-iodo-benzoic acid:
MS(ES): m/z = 326 (M+1) Calculated for C9H6NIO5, 0.75 x H2O;
C, 31.01 %; H, 2.17 %; N, 4.02 %. Found: C, 31.14 %; H, 2.33 %; N, 3.76 %.
EXAMPLE 4
Figure imgf000086_0002
4-(Oxalyl-amino biphenyl-3-carboxylic acid:
To a suspension of 5-bromo-2-amino-benzoic acid methyl ester (3.0 g, 13,04 mmol), tetrakis(triphenylphosphine)palladium(0) (0.5 g, 0.44 mmol), toluene (40 ml) and 2N aqueous sodium carbonate (14.8 ml) was added a solution of phenylboronic acid (2.2 g, 17.73 mmol) in methanol (10 ml) at room temperature. The resulting reaction mixture was heated at reflux temperature for 4 h. cooled and diluted with water (50 ml). The insoluble matter was filtered off and the phases were separated. The aqueous phase was extracted with ethyl acetate 85 (100 ml) and the combined organic phases were washed with water (2 x 80 ml), diluted aqueous ammoniac (80 ml) and saturated aqueous sodium chloride (80 ml). The organic phase was dried (MgSO4), filtered and evaporated in vacuo affording 3.4 g of crude 4-amino- biphenyl-3-carboxylic acid methyl ester which was purified on silicagel (1 I) using a mixture of ethyl acetate and heptane (1 :3) as eluent. Pure fractions were collected and evaporated in vacuo affording 2.7 g (91 %) of 4-amino-biphenyl-3-carboxylic acid methyl ester.
4-Amino-biphenyl-3-carboxylic acid methyl ester was converted into the title compound by a similar procedure as described in Example 1.
M.p.: 223 - 224 °C.
Calculated for C^HnNOg, 0.5 x H2O; C, 61.23 %; H, 4.11 %; N, 4.76 %. Found: C, 60.96 %; H, 4.01 %; N, 4.62 %.
EXAMPLE 5
Figure imgf000087_0001
4-Bromo-2-(oxalyl-amino)-benzoic acid:
1H NMR (400 MHz, CD3OD) δ 8.71 (d, J = 7.5 Hz, 1 H), 8.25 (s, 1 H), 7.80 (d, J = 7.5 Hz, 1 H). MS: ESI (-): 288 [M-1 (81Br)), 287 (M-1(80Br)].
EXAMPLE 6 O θH
0_ ~i_H OH
— o o o 86
4,5-Dimethoxy-2-(oxalyl-amino)-benzoicacid;
Η NMR (400 MHz, CD3OD) δ 8.42 (s, 1H), 7.60 (s, 1H), 3.95 (s, 3H), 3.86 (s, 3H). MS:ESI(-): 268 [M-1].
EXAMPLE 7
~ύ- OH hi
5-Nitro-2-(oxalyl-amino)-benzoic acid;
1H NMR (400 MHz, CD3OD) δ 8.90 (d, J = 7.5Hz, 2H), 8.42 (s, 1H). MS:ESI(-):253[M-1].
EXAMPLE 8
OH OH
Figure imgf000088_0001
O _-N, . O hi O
4-Nitro-2-(oxalyl-aminoVbenzoic acid:
1H NMR (400 MHz, CD3OD) δ 9.60 (s, 1H), 8.36 (m, 1H), 8.02 (m, 1H). MS:ESI(-):253[M-1].
EXAMPLE 9
l—i XH OH
O O 87 5-Chloro-2-(oxalyl-amino -benzoic acid:
Η NMR (400 MHz, CD3OD) δ 8.72 (d, J = 7.5 Hz, 1 H), 8.10 (s, 1 H), 7.60 (d, J = 7.5 Hz, 1 H). MS: ESI (-): 242 [M-1 (35CI)], 244 [M-1(37CI)].
EXAMPLE 10
O, oH
Cl o o
4-Chloro-2-(oxalyl-amino)-benzoic acid:
Η NMR (400 MHz, CD3OD) δ 8.80 (s, 1H), 8.10 (d, J = 7.5 Hz, 1H), 7.22 (d, J = 7.5 Hz,
1H).
MS: ESI (-): 242 [M-1(35CI)], 244 [M-1(37CI)].
EXAMPLE 11
' OH iK o x O OH
3-Methyl-2-(oxalyl-amino)-benzoic acid:
Η NMR(400 MHz, DMSO-d6) δ 2.2 (s, 3H), 7.2 - 7.7 (m, 3H), 10.5 (s, 1 H), 12.9 (s, 1H).
EXAMPLE 12 o -OH
>-i F>u O ° OH
4.5-Difluoro-2-(oxalyl-amino)-benzoic acid; 88
1H NMR (300 MHz, DMSO-d6) δ 8.03 (m, 1H), 8.61 (dd, 1H), 12.55 (s, 1H, NHCO).
EXAMPLE 13 o fyw o
0 OH
N-(2-Carbamoyl-phenyl)-oxalamicacid:
Η NMR (300 MHz, DMSO-d6) δ 7.20 (t, 1H), 7.55 (t, 1H), 7.73 (bs, 1H, CONH2), 7.83 (d,
1H), 8.30 (bs, 1H, CONH2), 8.52 (d, 1H), 12.9 (s, 1H, NHCO).
EXAMPLE 14 o OH B o 0 X O-7,
2-(Ethoxyoxalyl-amino)-benzoic acid:
Η NMR (300 MHz, DMSO-d6) δ 1.33 (t, 3H), 4.30 (q, 2H), 7.24 (t, 1H), 7.65 (t, 1H), 8.03 (d, 1H), 8.56 (d, 1H), 12.6 (s, 1H, NHCO).
EXAMPLE 15
O Cl oH
o o
6-Chloro-2-(oxalyl-amino)-benzoicacid:
1H NMR (400 MHz, DMSO-d6) δ 10.68 (bs, 1H), 8.06 (d, J = 9 Hz, 1H), 7.43 (t, J = 9 Hz, 1H), 7.27 (d, J = 9Hz, 1H). 89
EXAMPLE 16 ox yn OH
M o o o
3-Methoxy-2-(oxalyl-amino)-benzoicacid:
Η NMR (400 MHz, DMSO-d6) δ 9.98 (bs, 1H), 7.37 - 7.25 (m, 3H), 3.80 (s, 3H).
EXAMPLE 17 o VθH
o= o o
OH
2-(Oxalyl-amino)-terephthalic acid:
1H NMR (400 MHz, DMSO-d6) δ 7.28 (s, 1H), 8.22 (d, J = 9 Hz, 1H), 7.75 (d, J = 9 Hz, 1H).
EXAMPLE 18 o
~ θH μ<pχ o m o 5-Fluoro-2-(oxalyl-amino)-benzoic acid;
1H NMR (400 MHz, CD3OD) δ 7.50 (m, 1H), 7.25 (m, 1H), 7.22 (m, 1H).
MS m/z 227.2 (M-1). 90
EXAMPLE 19
Br- -_^<? 0H
Br O O
3.5-Dibromo-2-(oxalyt-amino)-benzoic acid;
Η NMR (400 MHz, CD3OD) δ 8.08 (s, 1 H), 8.05 (s, 1 H).
MS m/z 366.1 (M-1).
EXAMPLE 20
θH i— (\ / - OH
. Iι oo x~i o 3.5-Diiodo-2-(oxalyl-amino)-benzoic acid:
Η NMR (400 MHz, CD3OD) δ 8.45 (s, 1 H), 8.25 (s, 1 H). MS m/z 460.1 (M-1).
EXAMPLE 21
Figure imgf000092_0001
2-(Oxalyl-amino)-5-(3-thiophen-3-yl-isoxazol-5-yl)-benzoic acid:
To a solution of thiophene-3-carboxaldehyde (2.0 g, 18 mmol) in 1 ,4-dioxane (6.0 ml) was added hydroxylamine hydrochloride (1.24 g, 18 mmol) and triethylamine (2.5 ml, 18 mmol). The mixture was sonicated for 0.5 h and stirred at room temperature for 116 h and at 35 °C for 48 hour. The solvent was removed in vacuo and the residue was dissolved in di- 91 chioromethane and washed with water, dried (MgSO4), filtered and evaporated in vacuo affording 1.97 g (87 %) of thiophene-3-carbaldehyde oxime as an oil.
To a solution of the above thiophene-3-carbaldehyde oxime (120 mg, 0.99 mmol) and 2- (tetf-butoxyoxalyl-amino)-5-ethynyl-benzoic acid methyl ester (100 mg, 0.33 mmol) in tetra- hydrofuran (2.5 ml) stirred at room temperature was added 0.75 M bleach (1.3 ml, 0.99 mmol). The solution was first stirred at room temperature for 24 h and then at 35 °C for 24 h. The solvent was evaporated in vacuo and the residue was dissolved in dichloromethane, washed with water, brine and dried (MgSO4), filtered and evaporated in vacuo. The residual film was purified by preparative TLC affording 21 mg, (15 %) of 2-(tert-butoxyoxalyl-amino)- 5-(3-thiophen-3-yl-isoxazol-5-yl)-benzoic acid methyl ester as an oil. 1H NMR (400 MHz, CDCI3) δ 12.75 (s, 1 H), 8.92 (d, 1 H, J = 11 Hz), 8.59 (s, 1 H), 8.06 (d, 1 H, J = 11 Hz), 7.91 (s, 1 H), 7.59 (d, 1 H, J = 7 Hz), 7.28 (d, 1 H, J = 7 Hz), 6.90 (s, 1 H), 4.07 (s 3H), 1.65 (s, 9H).
The above 2-(tetf-butoxyoxalyl-amino)-5-(3-thiophen-3-yl-isoxazol-5-yl)-benzoic acid methyl ester (10 mg, 0.023 mmol) was dissolved in 20 % trifluoroacetic acid/dichloromethane (0.3 mi) and stirred at room temperature for 21 h. The solvent was removed in vacuo affording 8.4 mg (98 %) of 2-(oxalyl-amino)-5-(3-thiophen-3-yl- isoxazol-5-yl)-benzoic acid methyl ester as a solid.
Η NMR (400 MHz, CD3OD) δ 12.75 (s, 1 H), 8.95 (d, 1 H, J = 11 Hz), 8.62 (s, 1 H), 8.18 (d, 1 H, J = 11 Hz), 7.75 (m, 1 H), 7.65 (m, 1 H), 7.60 (s, 1 H), 4.07 (s, 3H).
To a solution of 2-(oxalyl-amino)-5-(3-thiophen-3-yl-isoxazol-5-yl)-benzoic acid methyl ester (8.4 mg, 0.023 mmol) in methanol (1.5 ml) and tetrahydrofuran (0.5 ml) at room temperature was added 1 N lithium hydroxide (90 μl, 0.090 mmol). The solution was stirred for 48 h. The solvent was removed in vacuo and the residue was redissolved in water. The solution was acidified with 1 N hydrochloric acid to pH = 1 and extracted with ethyl acetate. The combined extracts were washed with brine, dried (MgSO4), filtered and the solvent evaporated in vacuo affording 6.4 mg (79 %) of the title compound as a solid.
Η NMR (400 MHz, CD3OD) δ 8.75 (d, 1H, J=11 Hz), 8.70 (s, 1H), 7.95 (s, 1 H), 7.82 (d, 1 H, J = 11 Hz), 7.70 (m, 1 H), 7.60 (m, 1 H). 92
MS m/z: 357(M-1 ).
Figure imgf000094_0001
2-(Oxalyl-amino)-5-(3-phenyl-isoxazol-5-yl)-benzoic acid;
To a solution of benzaldehyde (2.0 g, 19 mmol) in 1 ,4-dioxane (6.0 ml) was added hydroxylamine hydrochloride (1.3 g, 19 mmol) and triethylamine (2.6 ml, 19 mmol). The mixture was sonicated for 0.5 h and stirred at room temperature for 116 h and at 35 °C for 24 h. The solvent was removed in vacuo and the residue was dissolved in dichloromethane and washed with water, dried (MgSO4), filtered and evaporated in vacuo affording 1.9 g (84 %) of benzal- dehyde oxime as an oil.
Η NMR (400 MHz, CDCI3) δ 8.18 (s, 1 H), 7.60 (m, 2H), 7.41 (m, 3H).
To a solution of benzaldehyde oxime (120 mg, 0.99 mmol) and 2-(tert-butoxyoxalyi- amino)-5-ethynyl-benzoic acid methyl ester (100 mg, 0.33 mmol) in tetrahydrofuran (2.5 ml) stirred at room temperature was added 0.75 M bleach (1.3 ml, 0.99 mmol). The solution was first stirred at room temperature for 24 h and then at 35 °C for 24 h. The solvent was evaporated in vacuo and the residue was dissolved in dichloromethane. The solution was washed with water, brine, dried (MgSO4), filtered and the solvent evapo- rated in vacuo. The residue was washed with diethyl ether to get a solid precipitate which was filtered off yielding 59 mg (42 %) of 2-(tert-butoxyoxalyl-amino)-5-(3-phenyl- isoxazoi-5-yl)-benzoic acid methyl ester as a solid.
1H NMR (400 MHz, CDCI3) δ 12.75 (s, 1 H), 8.85 (d, 1H, J = 11 Hz), 8.62 (s, 1H), 8.06 (d, 1 H, J = 11 Hz), 7.91 (m, 2H), 7.52 (m, 3H), 6.90 (s, 1 H), 4.07 (s 3H), 1.65 (s, 9H).
The above 2-(tett-butoxyoxalyl-amino)-5-(3-phenyl-isoxazol-5-yl)-benzoic acid methyl ester (28 mg, 0.07 mmol) was dissolved in 20 % trifluoroacetic acid/dichloromethane 93 (0.5 ml) and stirred at room temperature for 6 h. The solvent was removed in vacuo affording 25 mg (100 %) of 2-amino-5-(3-phenyl-isoxazol-5-yl)-benzoic acid methyl ester as a solid.
Η NMR (400 MHz, CDCI3) δ 12.75 (s, 1 H), 8.85 (d, 1 H, J = 11 Hz), 8.62 (s, 1 H), 8.15 (d, 1 H, J = 11 Hz), 7.91 (m, 2H), 7.52 (m, 3H), 6.90 (s, 1 H), 4.07 (s 3H)
To a solution of the above 2-amino-5-(3-phenyi-isoxazol-5-yl)-benzoic acid methyl ester (12.5 mg, 0.034 mmol) in methanol (2.5 ml) and tetrahydrofuran (1.0 ml) at room temperature was added 1 N lithium hydroxide (1.4 ml, 0.136 mmol). The solution was stirred for 12 h and the solvent was removed jn vacuo. The residue was dissolved in water acidified with 1 N hydrochloric acid to pH = 1 and extracted with ethyl acetate. The organic extract was washed with brine, dried (MgSO4), filtered and the solvent evaporated in vacuo affording 7.7 mg (64 %) of the tjfle compound as a solid. Η NMR (400 MHz, CD3OD) δ 8.91 (d, 1 H, J = 11 Hz), 8.62 (s, 1 H), 8.15 (d, 1 H, J = 11 Hz), 7.91 (m, 2H), 7.49 (m, 3H), 7.25 (s, 1 H), 4.07 (s 3H). LC/MS m/z: 351(M-1).
EXAMPLE 23
Figure imgf000095_0001
5-Ethynyl-2-(oxalyl-amino)-benzoic acid:
A solution of 2-(tetf-butoxyoxalyl-amino)-5-iodo-benzoic acid (5.0 g, 12.8 mmol) and N,N- dimethylformamide di-tertbutylacetal (12 ml, 51.2 mmol) in toluene (100 ml) was heated at reflux for 20 h. The reaction was cooled to room temperature, concentrated in vacuo and the residue dissolved in ethyl acetate (150 ml). The ethyl acetate phase was washed with water (3 x 35 ml), brine (20 ml) and the volatiies evaporated in vacuo. The residue was purified by silica gel chromatography using 25 % ethyl acetate/hexane as eluent. Pure fractions were combined and concentrated in vacuo to yield 2.3 g of 2-(tert-butoxyoxalyl-amino)-5-iodo- benzoic acid tert-butyl ester as an oil. 94 Η NMR (400 MHz, CDCI3) δ 8.54 (d, J = 9 Hz, 1 H), 8.27 (s, 1 H), 7.83 (d, J = 9 Hz, 1 H), 1.62 (s, 18H).
2-(tert-Butoxyoxalyl-amino)-5-iodo-benzoic acid tert-butyl ester (0.83 g, 1.86 mmol), trimethylsilyl acetylene (2 ml), and triethylamine (1 ml, 7.44 mmol) were dissolved in N,N- dimethylformamide (5 ml) and the solution purged with argon. Dichlorobis- (triphenylphosphine)palladium(ll) (26 mg, 0.15 mmol) and copper(l)iodide (4 mg, 0.15 mmol) were added and the reaction stirred at 60 °C under argon for 5 h. The crude mixture was di- luted with ethyl acetate (40 ml) and washed with water (3 x 10 ml) and brine (2 x 10 ml). The solvent was evaporated in vacuo to yield 0.77 g (99 %) of 2-(tert-butoxyoxalyl-amino)-5- trimethylsiianylethyny-benzoic acid tert-butyl ester.
1H NMR (400 MHz, CDCI3) δ 12.59 (s, 1H), 8.71 (d, J = 9 Hz, 1H), 8.07 (d, J = 9 Hz, 1H), 1.62 (s, 9H), 1.61 (s, 9H), 0.25 (s, 9H).
2-(tert-Butoxyoxalyl-amino)-5-trimethylsilanylethyny-benzoic acid tetf-butyl ester (0.57 g, 1.37 mmol) was dissolved in tetrahydrofuran (5 ml) and treated with a 0.9 M solution of tetrabutylammonium fluoride and acetic acid (2:3) in tetrahydrofuran (1.7 ml, 1.51 mmol) for 3 h. The volatiles were evaporated in vacuo and the crude material extracted into ethyl acetate (35 ml). The ethyl acetate extract was washed with 1 M hydrochloric acid (5 ml), saturated sodium bicarbonate (5 ml), brine (5 ml) and evaporated in vacuo affording 0.36 g (76 %) of 2-(terf-butoxyoxalyl-amino)-5-ethynyl-benzoic acid tert-butyl ester as an oil. Η NMR (400 MHz, CDCI3) δ 8.74 (d, J = 10 Hz, 1 H), 8.12 (s, 1 H), 7.65 (d, J = 10 Hz, 1 H), 3.08 (s, 1 H), 1.62 (s, 9H), 1.58 (s, 9H).
2-(tert-Butoxyoxalyl-amino)-5-ethynyl-benzoic acid tert-butyl ester (0.36 g, 1.04 mmol) was treated with 50 % trifluoroacetic acid/dichloromethane (15 ml) at room temperature for 3 h. The reaction mixture was concentrated in vacuo and the residue was washed with water and diethyl ether affording after drying 0.21 g (86 %) of the title compound.
Η NMR (400 MHz, DMSO-d6) δ 8.23 (d, J = 10 Hz, 1 H), 8.05 (s, 1 H), 7.76 (d, J = 10 Hz, 1H), 4.24 (s, 1 H).
LC/MS [M-H]-: 232.07 95
HPLC (254.4 nm): 3.112 s, (49 %).
EXAMPLE 24
Figure imgf000097_0001
5-(3-Dimethylamino-prop-1 -yny0-2-(oxalyl-amino)-benzoic acid: To a solution of 5-lodoanthranilic acid (3.0 g, 11.4 mmol) and N,N-diisopropylethylamine (4 ml, 22.8 mmol) in anhydrous tetrahydrofuran (40 ml) was added imidazol-1-yl-oxo-acetic acid tert-butyl ester (4.47g, 22.8 mmol). The reaction was stirred at room temperature for 3 h. The solvents were evaporated in vacuo and the crude mixture extracted into ethyl acetate (70 ml). The organic extract was washed with 1% hydrochloric acid (2 x 15 ml) and brine (10 ml) and the solvent was evaporated in vacuo affording 2.8 g (63 %) of 2-(tert-butoxyoxalyl- amino)-5-iodo-benzoic acid as a solid.
Η NMR (400 MHz, CDCI3) δ 8.57 (d, J = 9 Hz, 1 H), 8.43 (d, J = 2 Hz, 1 H), 8.00 (dd, J = 9 Hz, 2 Hz, 1 H), 1.59 (s, 9H).
To a solution of 2-(tert-butoxyoxalyl-amino)-5-iodo-benzoic acid (2.1 g, 5.37 mmol) in dichloromethane (15 ml) under nitrogen was added triethylamine (3.75 ml, 26.85 mmol) and N,N-dimethylaminopyridine (0.1 g). Methoxymethyl chloride (1.2 ml, 16.11 mmol) was added and the reaction mixture was stirred for 4 h and concentrated in vacuo to a minimum volume which was loaded directly onto a silica gel column, eluting with 50 % ethyl acetate/hexane. Pure fractions were combined and concentrated to give 1.5 g (64 %) of 2-(tert-butoxyoxalyl- amino)-5-iodo-benzoic acid methoxymethyl ester as a solid.
Η NMR (400 MHz, CDCI3) δ 8.56 (d, J = 9 Hz, 1H), 8.42 (s, 1 H), 7.89 (d, J = 9 Hz, 1 H), 5.54 (s, 2H), 3.60 (s, 3H), 1.61 (s, 9H).
A solution of 2-(tert-butoxyoxalyl-amino)-5-iodo-benzoic acid methoxymethyl ester (0.16 g, 0.37 mmol), triethylamine (51 μl, 0.37 mmol) and 1-dimethylamino-2-propyne (0.12 ml, 1.11 mmol) was prepared in anhydrous acetonitrile (3 ml) and purged with argon. Dichlorobis- 96 (triphenyiphosphine)palladium (II) (5 mg, 0.0074 mmol) and copper(l) iodide (1 mg, 0.0074 mmol) were added and the reaction stirred at 60 °C under argon for 18 h. The volatiles were evaporated in vacuo and the residue redissolved in ethyl acetate (10 ml). The organic phase was washed with 1% hydrochloric acid (5 ml) and the aqueous phase extracted with addi- tional ethyl acetate. The combined organic extracts were washed with brine (5 ml), dried (Na2SO4) and concentrated to an oil. The crude oil was dissolved in dichloromethane and purified by silica gel chromatography using 5 % methanol/dichloromethane/0.1 % triethylamine as eluent. Pure fractions were combined to give 81 mg (60 %) of 2-(tert-butoxyoxalyl- amino)-5-(3-dimethylamino-prop-1-ynyl)-benzoic acid methoxymethyl ester as an oil. Η NMR (400 MHz, CDCI3) δ 12.52 (s, 1H), 8.75 (d, J = 9 Hz, 1H), 8.21 (s, 1H), 7.64 (d, J = 9 Hz, 1H), 5.53 (s, 2H), 3.59 (s, 3H), 3.46 (s, 2H), 2.38 (s, 6H), 1.61 (s, 9H).
2-(tert-Butoxyoxalyl-amino)-5-(3-dimethylamino-prop-1 -ynyl)-benzoic acid methoxymethyl ester (32.3 mg) was treated with 50 % trifluoroacetic acid/dichloromethane (3 ml) at room temperature for 2 h. The mixture was concentrated to a solid in vacuo and the resulting solid was washed with dichloromethane which afforded 20 mg (83 %) of the tills compound as a solid.
Η NMR (400 MHz, DMSO-d6) δ 8.60 (d, J = 9 Hz, 1 H), 8.05 (s, 1 H), 7.60 (d, J = 9 Hz, 1H), 4.07 (s, 2H), 2.73 (s, 6H).
EXAMPLE 25
O // (\ >— N OH
// \
5-(2-((1-Benzylcarbamoyl-3-methyl-butvn-isopropyl-carbamoyl vinvπ-2-(oxalyl-amino - benzoic acid:
5-(2-((1-Benzyicarbamoyl-3-methyl-butyl)-isopropyl-carbamoyl)-vinyl)-2-(tert-butoxyoxalyl- amino)-benzoic acid methoxymethyl ester (0.14 g, 0.22 mmol) was treated with a solution of 97 50 % trifluoroacetic acid/dichloromethane (6 ml) for 2.5 h. The mixture was concentrated in vacuo and precipitated from water. The resulting crystalline solid was filtered off and dried in vacuo to give 0.10 g (85 %) of the title compound as a solid.
Η NMR (400 MHz, CD3OD) δ 8.76 (d, J = 9 Hz, 1 H), 8.31 (s, 1 H), 7.94 (d, J = 9 Hz, 1 H), 7.49 (d, J = 16 Hz, 1 H), 7.46 - 7.38 (m, 5H), 7.13 (d, J = 16 Hz, 1H), 4.49 (m, 1H), 4.10 (s, 2H), 3.95 (m, 1 H), 2.49 (m, 1 H), 1.90 (m, 1 H), 1.56 (m, 1 H), 1.38 (d, J = 6 Hz, 3H), 1.35 (d, J = 7 Hz, 3H), 0.97 (d, J = 6 Hz, 6H).
LC/MS [M-H]-: 522.55.
The following compounds were prepared in a similar way as described in Example 1.
EXAMPLE 26
o
" OH
F O O
4-Fluoro-2-(oxalyl-amino)-benzoic acid:
Η NMR (300 MHz, DMSO-d6) δ 7.11 (m, 1H), 8.12 (m, 1H), 8.42 (dd, 1 H), 12.62 (s, 1H, NHCO).
EXAMPLE 27
HO→ ~ \ x -0H
0 o
5-Hydroxy-2-(oxalyl-amino)-benzoic acid:
1H NMR (400 MHz, DMSO-d6) δ 12.19 (s, 1H) 9.78 (bs, 1H) 8.44 (d, J = 10 Hz, 1H), 7.42 (d, J = 2 Hz, 1 H), 7.05 (dd, J = 10 Hz, 2 Hz). 98
EXAMPLE 28
VθH
W // OH
X 5-Methyl-2-(oxalyl-amino)-benzoic acid:
Η NMR (400 MHz, DMSO-d6) δ 12.20 (s, 1H), 8.51 (d, J = 10 Hz, 1 H), 7.83 (d, J = 2 Hz, 1H), 7.42 (dd, J = 10 Hz, 2 Hz, 1 H), 2.29 (s, 3H).
EXAMPLE 29
Figure imgf000100_0001
5-(3-Octyl-isoxazol-5-yl)-2-(oxalyl-amino benzoic acid;
To a solution of 2-(tert-butoxyoxalyl-amino)-5-iodo-benzoic acid (1.8 g, 4.6 mmol) and potassium carbonate (1.6 g, 11.5 mmol) in acetone (15 ml) was added iodomethane (3 g). The reaction was heated at reflux for 2 h. after which it was judged complete by tic analysis. The crude mixture was diluted with ethyl acetate (75 ml), washed with water (2 x 15 ml), and brine (10 ml). The organic phase was concentrated in vacuo to give 1.8 g (94 %) of 2-(tert- butoxyoxalyl-amino)-5-iodo-benzoic acid methyl ester. 1H NMR (400 MHz, CDCI3) δ 12.52 (s, 1 H), 8.53 (d, J = 9 Hz, 1 H), 8.39 (s, 1 H), 8.87 (d, J = 9 Hz, 1 H), 3.98 (s, 3H), 1.61 (s, 9H).
2-(tert-Butoxyoxalyl-amino)-5-iodo-benzoic acid methyl ester (0.86 g, 2.12 mmol), trimethyl- silyl acetylene (2 ml), and triethylamine (1.2 ml, 8.48 mmol) were dissolved in N,N- dimethylformamide (5 ml) and the solution purged with argon. Dichiorobis- 99 (triphenylphosphine)palladium (II) (30 mg, 0.042 mmol) and copper(l)iodide (4 mg, 0.021 mmol) were added and the reaction stirred at 60 °C under argon for 3 h. The crude mixture was diluted with ethyl acetate (40 ml) and washed with water (3 x 10 ml) and brine (2 x 10 ml). The organic phase was evaporated in vacuo to yield 0.8 g (99 %) of 2-(tert- Butoxyoxalyl-amino)-5-trimethylsilanylethyny-benzoic acid methyl ester which was used without further purification.
2-(tert-Butoxyoxalyl-amino)-5-trimethylsilanylethyny-benzoic acid methyl ester (0.15 g, 0.4 mmol) was dissolved in tetrahydrofuran (2 ml) and treated with a 0.9 M solution of tetrabuty- lammonium fluoride and acetic acid (2:3) in tetrahydrofuran (0.44 ml, 0.4 mmol) for 3 h. The volatiles were evaporated in vacuo and the crude material extracted into ethyl acetate (25 ml). The ethyl acetate extract was washed with 1M hydrochloric acid (5 ml), saturated sodium bicarbonate (5 ml), brine (5 ml) and evaporated in vacuo affording 0.1 g (83 %) of 2- (tert-butoxyoxalyl-amino)-5-ethynyl-benzoic acid methyl ester as an oil.
A solution of 2-(tert-butoxyoxalyl-amino)-5-ethynyl-benzoic acid methyl ester (0.1 g, 0.33 mmol) and nonaldoxime (0.15 g, 0.99 mmol) in tetrahydrofuran (3 ml) was treated with bleach (0.75 M, 1.3 ml, 0.99 mmol). The reaction was stirred at room temperature for 24 h. Tic analysis showed presence of starting material so the reaction was heated to 35 °C for 12 h. The solvents were removed in vacuo and the crude material was dissolved in ethyl ace- tate (35 ml), washed with water (2 x 10 ml) and brine (10 ml). The organic extract was evaporated in vacuo affording 0.1 g (66 %) of 2-(tert-butoxyoxalyl-amino)-5-(3-octyl-isoxazol- 4-yl)-benzoic acid methyl ester as an oil.
Η NMR (400 MHz, CDCI3) δ 8.89 (d, J = 10 Hz, 1H), 8.52 (d, J = 1 Hz, 1H), 7.97 (dd, J = 10, 1 Hz, 1 H), 6.41 (s, 1 H), 4.02 (s, 3H), 2.73 (t, J = 8 Hz, 2H), 1.70 (m, 2H), 1.62 (s, 9H), 1.37 - 1.25 (bm, 12H), 0.89 (t, J = 8 Hz, 3H).
To a solution of the above (isoxazol-4-yl)-benzoic acid methyl ester (9.1 mg, 0.02 mmol) in 50 % methanol/tetrahydrofuran (2 ml) was added 1 N lithium hydroxide (60 μl, 0.06 mmol) and the resulting mixture was stirred at room temperature for 48 h. The reaction was judged to be incomplete by tic analysis (30 % methanol/dichloromethane) and additional 1 N lithium hydroxide was added (20 μl, 0.02 mmol). The reaction was stirred for another 72 hours. pH of the reaction mixture was adjusted to around 0 by addition of 1 N hydrochloric acid. The mixture was concentrated in vacuo and the crude material was dissolved in ethyl acetate (20 100 ml). The organic layer was washed with brine (2 x 5 ml) and concentrated in yaeue affording 5.4 mg (70 %) of the title compound as a soild.
1H NMR (400 MHz, CD3OD) δ 8.87 (d, J = 10 Hz, 1 H), 8.55 (s, 1 H), 8.04 (d, J = 10 Hz, 1H), 6.74 (s, 1 H), 2.70 (t, J = 8 Hz, 2H), 1.72 (m, 2H), 1.38 -1.20 (bm, 12H), 0.90 (t, J = 8 Hz, 3H).
EXAMPLE 30
Figure imgf000102_0001
5-(2-((1-Benzylcarbamoyl-3-methyl-butyh-isopropyl-carbamoyl)-ethyπ-2-(oxalyl-amino - benzoic acid:
To a solution of isopropyiamine (0.43 ml, 5.0 mmol) in methanol (5 ml) was added isovaler- aldehyde (0.54 ml, 5.0 mmol). After 15 minutes of stirring a solution of benzylisocyanide in tetrahydrofuran (1 M, 5 ml, 5.0 mmol) was added followed by acrylic acid (0.34 ml, 5.0 mmol). The reaction was stirred at room temperature for 72 h, the volatiles were removed in vacuo and the resulting oil dissolved in ethyl acetate (40 ml). The organic mixture was washed with 1 N hydrochloric acid (10 ml) and brine (10 ml), dried (Na2SO4) and the solvent evaporated in vacuo. The crude residue was purified by chromatography using a gradient from 30 % ethyl acetate/hexane to 50 % ethyl acetate/hexane. Pure fraction were collected and the solvent evaporated in vacuo which afforded 1.5 g (100 %) of N-(1-benzylcarbamoyl- 3-methyl-butyl)-N-isopropyl-acrylamide as an oil.
1H NMR (400 MHz, CDCI3) δ 8.13 (bs, 1 H), 7.30 - 7.19 (m, 5H), 6.49 (dd, J = 16 Hz, 12 Hz, 1 H), 6.25 (d, J = 16 Hz, 1 H), 5.66 (d, J = 12 Hz, 1 H), 4.38 (d, J = 6 Hz, 2H), 4.10 - 4.02 (m, 1 H), 2.22 - 2.13 (m, 1 H), 1.76 - 1.70 (m, 1 H), 1.62 - 1.54 (m, 2H), 1.25 (d, J = 7 Hz, 3H), 1.20 (d, J = 7 Hz, 3H), 0.94 (d, J = 7 Hz, 3H), 0.90 (d, J = 7 Hz, 3H). 101 A solution of N-(1-benzylcarbamoyl-3-methyl-butyl)-N-isopropyl-acrylamide (0.55 g, 1.74 mmol), 2-(tert-butoxyoxalyl-amino)-5-iodo-benzoic acid methoxymethyl ester (0.5 g, 1.15 mmol), palladium acetate (3.0 mg, 0.023 mmol) and tri(o-tolyl)phosphine (10.0 mg, 0.07 mmol) in N,N-dimethylformamide under argon and heated to 100 °C with stirring for 3 h. The reaction was cooled to room temperature and diluted in ethyl acetate (50 ml). The organic phase was washed with water (2 x 15 ml) and brine (10 ml), dried (Na2SO4) and evaporated in vacuo. The crude oily material was purified by chromatography using 30 % ethyl acetate/hexane as eluent. Pure fractions were collects and the solvent evaporated in vacuo affording 0.15 g (20 %) of 5-(2-((1-Benzylcarbamoyl-3-methyl-butyl)-isopropyl-carbamoyl)- vinyl)-2-(tert-butoxyoxalyi-amino)-benzoic acid methoxymethyl ester as an oil.
Η NMR (400 MHz, CDCI3) δ 12.58 (s, 1H), 8.82 (d, J = 9 Hz, 1H), 8.22 (s, 1H), 7.80 (d, J = 9 Hz, 1 H), 7.60 (d, J = 16 Hz, 1 H), 7.30 - 7.22 (m, 5H), 6.80 (d, J = 16 Hz, 1H), 5.58 (s, 2H), 4.43 (bs, 2H), 4.21 - 4.15 (m, 1 H), 3.60 (s, 3H), 2.21 -2.16 (m, 1 H), 1.82 - 1.78 (m, 1 H), 1.61 (s, 9H), 1.61 - 1.58 (m, 1 H), 1.35 (d, J = 7 Hz, 3H), 1.24 (t, J = 7 Hz, 3H), 0.99 (d, J = 7 Hz, 3H), 0.94 (d, J = 7 Hz, 3H).
To a solution of 5-(2-((1-benzylcarbamoyl-3-methyl-butyl)-isopropyl-carbamoyl)-vinyl)-2-(tert- butoxyoxalyl-amino)-benzoic acid methoxymethyl ester (10.7 mg, 0.017 mmol) in methanol (1 ml) was added 5 % palladium/carbon (2.2 mg) and the resulting mixture was stirred under hydrogen gas (30 psi) for 3 h. The mixture was filtered through celite and evaporated in vacuo. NMR indicated that the reaction was not complete so it was subjected to the hydrogenation conditions for another 4 h. The mixture was filtered and evaporated in vacuo again affording 8.9 mg (83 %) of 5-(2-((1-benzylcarbamoyl-3-methyl-butyl)-isopropyl-carbamoyl)- ethyl)-2-(tert-butoxyoxalyl-amino)-benzoic acid methoxymethyl ester as an oil. 1H NMR (400 MHz, CDCI3) δ 12.41 (s, 1H), 8.68 (d, J = 9 Hz, 1H), 8.07 (bs, 1H), 7.98 (s, 1 H), 7.43 (d, J = 9 Hz, 1 H), 7.30 - 7.22 (m, 5H), 5.52 (s, 2H), 4.45 - 4.33 (m, 2H), 4.04 - 3.96 (m, 2H), 3.58 (s, 3H), 2.95 (t, J = 7 Hz, 2H), 2.72 - 2.61 (m, 2H), 2.30 (m, 1 H), 1.62 (s, 9H), 1.59 (m, 1 H partially obscured by neighboring singlet), 1.22 (d, J = 6 Hz, 6H), 0.95 (d, J = 7 Hz, 3H), 0.91 (d, J = 7 Hz, 3H).
5-(2-((1-Benzylcarbamoyl-3-methyl-butyl)-isopropyl-carbamoyl)-ethyl)-2-(tert-butoxyoxalyl- amino)-benzoic acid methoxymethyl ester (4 mg, 0.0064 mmol) was dissolved in acetone (3 ml) and treated with 3 drops of 1 N hydrochloric acid. The reaction was stirred for 2 days, after which the acetone was evaporated in vacuo. The residue was dissolved in ethyl acetate 102 (10 ml), washed with brine (2 x 2ml) and evaporated in vacuo. The resulting oil was treated with 20 % trifluoroacetic acid/dichloromethane (3 ml) for 3 h. The volatiles were evaporated in vacuo affording 2 mg (61 %) of the titie compound as an oil.
Η NMR (400 MHz, CD3OD) δ 8.64 (d, J = 9 Hz, 1 H), 8.00 (s, 1 H), 7.51 (d, J = 9 Hz, 1 H), 7.50 - 7.40 (m, 5H), 4.17 (t, J = 8 Hz, 1 H), 4.14 (s, 2H), 3.73 (m, 1 H), 2.95 (t, J = 6 Hz, 2H), 2.82 - 2.63 (m, 2H), 2.42 (m, 1 H), 1.80 (m, 1 H), 1.30 (m, 1 H), 1.26 (d, J = 6 Hz, 3H), 1.10 (d, J = 6 Hz, 3H), 0.90 (d, J = 6 Hz, 6H).
LC/MS [M-H]-: 524.74
EXAMPLE 31
0
> -OH N OH
V y/- - -N O hi O
Figure imgf000104_0001
0 '
5-(2-((1-Carbamoyl-3-methyl-butvπ-isopropyl-carbamoylVethvn-2-(oxalyl-aminoVbenzoic acid:
5-(2-((1-Benzylcarbamoyl-3-methyl-butyl)-isopropyl-carbamoyl)-vinyl)-2-(oxalyl-amino)- benzoic acid (33 mg, 0.063 mmol) and 10 % palladium/carbon was mixed in methanol (3 ml) and stirred under hydrogen gas (1 atm) for 18 h. The mixture was filtered through celite and the volatiles were evaporated in vacuo affording 27 mg (99 %) of the title compound. 1H NMR (400 MHz, CD3OD) δ 8.64 (d, J = 9 Hz, 1 H), 8.00 (s, 1 H), 7.51 (d, J = 9 Hz, 1H), 4.17 (t, J = 8 Hz, 1 H), 3.72 (m, 1 H), 2.96 (t, J = 6 Hz, 2H), 2.82-2.63 (m, 2H), 2.41 (m, 1 H), 1.80 (m, 1 H), 1.30 (m, 1 H), 1.25 (d, J = 6 Hz, 3H), 1.13 (d, J = 6 Hz, 3H), 0.90 (d, J = 6 Hz, 6H).
LC/MS [M-H]": 435.66 103 EXAMPLE 32
Figure imgf000105_0001
2-((5-Mercapto-[1.3.4loxadiazole-2-carbonyl)-amino)-benzoic acid:
To a solution of 2-(Ethoxyoxalyl-amino)-benzoic acid (2.0 g, 8.43 mmol) in ethanol (75 ml) was added hydrazine hydrate (0.8 g, 16.86 mmol). The resulting mixture was stirred at reflux temperature for 3 h. To the cooled reaction was added water (200 ml) and the mixture was acidified with 1 N hydrochloric acid to pH = 4. The precipitate was filtered off, washed with water and dried in vacuo at 50 °C for 16 h which afforded 1.4 g (69 %) of 2-(hydrazinooxalyl- amino)-benzoic acid as a solid.
To a solution of the above 2-(hydrazinooxalyl-amino)-benzoic acid (1.0 g, 4.15 mmol) in methanol (20 ml) cooled to 0 °C was added potassium hydroxide (0.5 g, 8.72 mmol) and carbondisulfide (0.7 g, 9.54 mmol). The resulting mixture was stirred at reflux temperature for 6 h. To the cooled reaction was added water (100 ml) and the mixture was acidified with 1 N hydrochloric acid to pH = 1. The precipitate was filtered off, washed with water and heptane and dried in vacuo at 50 °C. The dried product (0.65 g) was purified by silica gel (400 ml) chromatography using 5 % acetic acid in ethyl acetate as eluent. Pure fractions were collected and the volatiles were evaporated in vacuo. The residue was washed with water and dried in vacuo at 50 °C for 16 h affording 0.4 g (36 %) of the tjtle compound as a solid.
M.p.: 236 - 237 °C Calculated for C10H7N3O4S; C, 45.28 %; H, 2.66 %; N, 15.84 %. Found: C, 45.48 %; H, 2.66 %; N, 15.36 %.
EXAMPLE 33 104
Figure imgf000106_0001
3-(Oxalyl-amino isonicotinic acid:
To a stirred solution of 3-amino-isonicotinic acid (0.5 g, 3.62 mmol) and triethylamine (1 ml) in dry tetrahydrofuran (50 ml) at 0 °C was added dropwise ethyl oxalyl chloride (0.5 g, 3.69 mmol). The resulting reaction mixture was stirred at room temperature for 3 h, filtered and the volatiles were evaporated in vacuo. To the residue was added water (50 ml) and the resulting mixture was extracted with diethyl ether (2 x 50 ml). The organic phase was washed with saturated aqueous sodium chloride (50 ml), dried (MgSO4), filtered and the solvent evaporated in vacuo affording 0.4 g (46 %) of 3-(ethoxyoxalyl-amino)-isonicotinic acid as a solid.
To a solution of the above isonicotinic acid (0.4 g, 1.7 mmol) in ethanol (25 ml) was added a solution of sodium hydroxide (141 mg, 3.53 mmol) in water (10 ml). The resulting reaction mixture was stirred at room temperature for 18 h. The volatiles were evaporated in asue and the residue dissolved in water (50 ml) and washed with diethyl ether (50 ml). To the aqueous phase was added 1 N hydrochloric acid to pH = 1. The precipitate was filtered off and dried in vacuo at 50 °C for 18 h. The dried solid residue was washed with boiling ace- tone (50 ml) for 5 min. filtered off and dried in vacuo at 50 °C affording 80 mg (22 %) of the title compound as a solid. M.p.: > 250 °C;
Calculated for C8H6N205 ; C, 45.72 %; H, 2.88 %; N, 13.33 %. Found: C, 45.62 %; H, 2.98 %; N, 13.04 %.
EXAMPLE 34 105
0 H OH
H O O OH
5-(Oxalyl-amino 2.6-dioxo-1.2.3.6-tetrahvdro-pyrimidine-4-carboxylic acid;
To a solution of 5-Aminoorotic acid (61.1mg, 0.36 mmol) in tetrahydrofuran (1 ml) was added imidazol-1-yl-oxo-acetic acid tert-butyl ester (140 mg, 0.71 mmol) and triethylamine (50 μl, 0.36 mmol). The mixture was stirred at room temperature for 20 h. The solvent was removed in vacuo and the residue was dissolved in ethyl acetate (5.0 ml) and washed with 1 % hydrochloric acid (2 x 2 ml) then water (2 x 2 ml). The organic phase was dried (MgS04), filtered and the solvent evaporated in vacuo. The residue was purified by preparative TLC (Kieselgel 60F254, 0.5 mm, hexane:ethyl acetate, 80:20) which afforded 30 mg (28 %) of 5-(tert- butoxyoxalyl-amino)-2,6-dioxo-1 ,2,3,6-tetrahydro-pyrimidine-4-carboxylic acid as a solid. Η NMR (400 MHz, CDCI3) δ 1.80 (s, 9H), 7.56 (s, 2H), 8.96 (s, 1H).
5-(tert-Butoxyoxalyl-amino)-2,6-dioxo-1 ,2,3,6-tetrahydro-pyrimidine-4-carboxylic acid (28 mg, 0.094 mmol) was stirred in 20 % trifluoroacetic acid in dichloromethane (1.0 ml) at room temperature for 2 h. The reaction mixture was co-evaporated in vacuo with toluene to complete dryness which afforded 22.6 mg (100 %) of the title compound as a solid. Η NMR (400 MHz, CD3OD) δ 7.30 (s, 2H).
EXAMPLE 35
O OH
O OH
3-(Oxalyl-amino)-pyrazine-2-carboxylic acid;
To a solution of 3-aminopyrazine-2-carboxylic acid (64.2 mg, 0.46 mmol) in tetrahydrofuran (1 ml) was added imidazol-1-yl-oxo-acetic acid tert-butyl ester (181mg, 0.92 mmol) and triethylamine (64.3 μl, 0.46 mmol). The mixture was stirred at room temperature for 20 h. The solvent was removed in vacuo and the residue was dissolved in ethyl acetate (5.0 ml) and washed with 1 % hydrochloric acid (2 x 2 ml) then water (2 x 2 ml). The organic phase was dried (MgS04), filtered and the solvent evaporated in vacuo. The residue was washed 106 with diethyl ether (4 x 1.0 ml) affording 48 mg (39 %) of 3-(tert-butoxyoxalyl-amino)-pyrazine- 2-carboxylic acid as a solid. Η NMR (CDCI3 + CD3OD) δ 1.70 (s, 9H), 8.02 (d, 1 H, J = 1.5 Hz), 8.36 (d, 1 H, J = 1.5 Hz).
3-(tert-Butoxyoxalyl-amino)-pyrazine-2-carboxylic acid (31.7 mg, 0.12 mmol) was stirred in 20 % trifluoroacetic acid in dichloromethane (1 ml) at room temperature for 2 h. The volatiles were evaporated in vacuo and the residue co-evaporated with toluene in vacuo affording 25 mg (100 %) of the title compound as a solid. 1H NMR (400 MHz, CDCI3) δ 7.80 (d, 1H, J = 1.5 Hz), 8.15 (d, 1H, J = 1.5 Hz), 8.62 (s, 1H).
EXAMPLE 36
O. OH -B o
O OH
2-(Oxalyl-amino)-nicotinic acid:
To a solution of 2-aminonicotinic acid (61.4 mg, 0.45 mmol) in tetrahydrofuran (1 ml) was added imidazol-1-yl-oxo-acetic acid tert-butyl ester (174.2mg, 0.89 mmol) and triethylamine (62 μl, 0.45 mmol). The mixture was stirred at room temperature for 2 h. The solvent was removed in vacuo and the residue was dissolved in ethyl acetate (5.0 ml) and washed with 1% hydrochloric acid (2 x 2 ml) then water (2 x 2 ml). The organic phase was dried (MgSO4), filtered and the solvent evaporated in vacuo. The residue (125 mg) was purified by preparative TLC (Kieselgel 60F254, 1mm, CH2CI2/MeOH, 80/20) affording 7.9 mg (7 %) of 2-(tert- butoxyoxalyl-amino)-nicotinic acid as a solid. Η NMR (400 MHz, CD3OD) δ 1.80 (s, 9H), 7.40 (m, 1H), 8.50 - 8.70 (m, 2H).
2-(tert-Butoxyoxalyl-amino)-nicotinic acid (7.1 mg, 0.03 mmol) was stirred in 20 % trifluoroacetic acid in dichloromethane (0.5 ml) at room temperature for 2 h. The volatiles were evaporated to dryness in vacuo affording 5.6 mg (100 %) of the title compound as a solid. Η NMR (400 MHz, CD3OD) δ 7.40 (m, 1 H), 8.50 - 8.70 (m, 2H). 107 EXAMPLE 37
Vo- i*
N-
Cl- Jl -H o θ" LI
6-Chloro-5-isopropylamino-3-(oxalyl-amino)-pyrazine-2-carboxylic acid, dilithium salt:
To a solution of 3-amino-6-chloro-5-isopropyiamino-pyrazine-2-carboxylic acid (65.4 mg, 0.27 mmol) in tetrahydrofuran (1 ml) was added imidazol-1-yl-oxo-acetic acid tert-butyl ester (104.8 mg, 0.54 mmol) and triethylamine (37.4 μl, 0.27 mmol). The mixture was stirred at room temperature for 20 h followed by heating to 50 °C for 1.5 h. The solvent was removed in vacuo and the residue was dissolved in ethyl acetate (5.0 ml) and washed with 1 % hydrochloric acid (2 x 2 ml) then water (2 x 2 ml). The organic phase was dried (MgS04), filtered and the solvent evaporated in vacuo affording crude 97 mg (97 %) of 3-(tert-butoxyoxalyl- amino)-6-chloro-5-isopropylamino-pyrazine-2-carboxylic acid as an oil. Η NMR (400 MHz, CDCI3) δ 1.50 (d, 6H), 1.80 (s, 9H), 4.10 (s, 3H), 4.40 (m, 1 H).
3-(tert-Butoxyoxalyl-amino)-6-chloro-5-isopropylamino-pyrazine-2-carboxylic acid (30 mg, 0.1 mmol) was dissolved in tetrahydrofuran (1 ml) and 1.0 N lithium hydroxide (1 ml, 1 mmol) was added at room temperature. The reaction mixture was stirred for 3 days at room tem- perature. After removing the solvent in vacuo. the residue was dissolved in ethyl acetate (20 ml) and washed with water (4 x 3.0 ml). The organic phase was dried (Na2S04), filtered and the solvent evaporation in vacuo affording 21 mg (82 %) of the title compound as a solid. Η NMR (400 MHz, CD3OD) δ 1.42 (d, 6H), 4.50 (m, 1H). MS m/z 228 (M-74).
EXAMPLE 38
o- f cι- M O
Cl y* O x O Li ♦ 108
5.6-Dichloro-3-(oxalyl-amino.-pyrazine-2-carboxylic acid, dilithium salt:
To a solution of 3-amino-5,6-dichloro-pyrazine-2-carboxylic acid (57 mg, 0.26 mmol) in tetra- hydrofuran (0.5 ml) was added imidazol-1-yl-oxo-acetic acid tert-butyl ester (100.6 mg, 0.513 mmol) and triethylamine (35.8 μl, 0.26 mmol). The mixture was stirred at room temperature for 20 h followed by heating at 40 °C for 4 h. The solvent was removed in vacuo and the residue was dissolved in ethyl acetate (5.0 ml) and washed with 1 % hydrochloric acid (2 x 2 ml) then water (2 x 2 ml). The organic phase was dried (MgSO4), filtered and the solvent evaporated in vacuo. The residual oil was purified by preparative tic (Kieselgel 60F254, 1 mm, hexane: ethyl acetate, 1 :1 ) affording 23.6 mg (26 %) of 3-(tert-butoxyoxalyl-amino)-5,6- dichloro-pyrazine-2-carboxylic acid as an oil. Η NMR (400 MHz, CDCI3) δ 1.58 (s, 9H), 1.80 (s, 9H), 3.90 (s, 3H).
To a solution of 3-(tert-butoxyoxalyl-amino)-5,6-dichloro-pyrazine-2-carboxylic acid (23 mg, 0.07 mmol) in tetrahydrofuran (0.5 ml) was added a1.0 N aqueous solution of lithium hydroxide (0.5 ml) and the resulting mixture was stirred for 3 days. After removing the solvent in vacuo. the residue was dissolved in ethyl acetate (20 ml) and washed with water (4 x 3.0 ml). The organic phase was dried (Na2S04), filtered and the solvent evaporation in vacue affording 14 mg (80 %) of the title compound as a solid. MS m/z 290.3 (M-74).
EXAMPLE 39
,0H H ~OH
H °
2-Methyl-4-(oxalyl-amino)-1 H-pyrrole-3-carboxylic acid:
To a stirred solution of 4-(methoxyoxalyl-amino)-2-methyl-1 H-pyrrole-3-carboxylic acid tert- butyl ester (2.0 g, 7.09 mmol) in dichloromethane (20 ml) was added trifluoro acetic acid (10 ml). The resulting reaction mixture was stirred at room temperature for 2 h. The volatiles 109 were evaporated in vacuo affording 1.6 g (100 %) of 4-(methoxyoxalyl-amino)-2-methyl-1 H- pyrroie-3-carboxylic acid as a solid.
To a solution of the above pyrrole-3-carboxylic acid (1.2 g, 5.31 mmol) in ethanol (100 ml) was added a solution of sodium hydroxide (0.47 g, 11.7 mmol) in water (50 ml). The resulting reaction mixture was stirred at room temperature for 18 h. The volatiles were evaporated in vacuo and the residue dissolved in water (100 ml). To the aqueous phase was added concentrated hydrochloric acid to pH = 1. The suspension was washed with ethyl acetate (50 ml) and dichloromethane (50 ml) and the precipitate was filtered off and dried in yacj o at 50 °C for 2 h. The solid was dissolved in isopropanol (100 ml), filtered and evaporated in vacuo affording 0.4 g (36%) of the title compound as a solid.
Calculated for C8H8N205, 0.1 x H20 ; C, 44.91 %; H, 3.86 %; N, 12.98 %. Found: C, 45.06 %; H, 3.89 %; N, 12.72 %.
EXAMPLE 40
^ o
O OH
1-Benzyl-3-(oxalyl-amino)-1 H-pyrazole-4-carboxylic acid:
To a stirred solution of 3-amino-1 H-pyrazoie-4-carboxylic acid ethyl ester (5.0 g, 0.032 mol) and triethylamine (9 ml) in dry tetrahydrofuran (150 ml) at 0 °C was added dropwise ethyl oxalyl chloride (5.3 g, 0.039 mol). The resulting reaction mixture was stirred at room temperature for 18 h. An additional portion of ethyl oxalyl chloride (5.3 g, 0.039 mol) was added dropwise and the reaction mixture was stirred at room temperature for an additional 18 h. The volatiles were evaporated in vacuo and the residue dissolved in a mixture of water (200 ml) and ethyl acetate (200 ml). Undissolved matter was filtered off and dried in vacuo at 50 110 °C for 18 h affording 4.0 g (49 %) of 3-(ethoxyoxalyl-amino)-1 H-pyrazole-4-carboxylic acid ethyl ester as a solid. The organic phase separated and washed with saturated aqueous sodium chloride (100 ml), dried (MgS04), filtered and the solvent evaporated in vacuo affording 3.7 g (45%) of 3-(ethoxyoxalyl-amino)-1H-pyrazole-4-carboxylic acid ethyl ester as a solid. A total yield of 7.7 g (94 %) was obtained.
To a solution of the above pyrazole-4-carboxylic acid ethyl ester (3.7 g, 0.015 mol) in dry N,N-dimethylformamide (75 ml) was added sodium hydride (640 mg, 0.016 mol, 60 % in mineral oil). The resulting reaction mixture was stirred at room temperature for 0.5 h. To the reaction mixture was added benzyl bromide (2.7 g, 0.016 mol) and the mixture was stirred at 50 °C for 4 h. Water (100 ml) was added and the reaction mixture was extracted with diethyl ether (2 x 100 ml). The combined organic extracts were washed with water (100 ml) saturated aqueous sodium chloride (2 x 50 ml), dried (MgS04), filtered and the solvent evaporated in vacua The residue (3.8 g) was purified on silicagel (800 ml) using a mixture of ethyl acetate and heptane (1 :1) as eluent. Pure fractions were collected and the solvent evaporated in vacuo affording 0.9 g (18 %) of 1-benzoyl-3-(ethoxyoxaiyl-amino)-1 H-pyrazole-4- carboxylic acid ethyl ester as a solid.
Unpure fraction were collected and the solvent evaporated in vacuo. The residue (1.0 g) was crystallised from diethyl ether (30 ml), filtered off and dried in vacuo at 50 °C for 2 h affording 0.9 g (18 %) of 1-benzoyl-3-(ethoxyoxaiyi-amino)-1 H-pyrazole-4-carboxylic acid ethyl ester as a solid. A total yield of 1.8 g (36 %) were collected.
To a solution of the above 1 H-pyrazole-4-carboxylic acid ethyl ester (0.9 g, 2.61 mmol) in ethanol (50 ml) was added a solution of sodium hydroxide (0.26 g, 6.51 mmol) in water (25 ml). The resulting reaction mixture was stirred at room temperature for 60 h. The volatiles were evaporated in vacuo and the residue dissolved in water (100 ml). To the aqueous phase was added concentrated hydrochloric acid to pH = 1. The precipitate was filtered off and dried in vacuo at 50 °C for 18 h. affording 0.55 g (73 %) of the title compound as a solid.
M.p.: 189 - 191 °C:
Calculated for C^H^N^s, 1.75 x H20; C, 48.68 %; H, 4.56 %; N, 13.10 %. Found: C, 48.81 %; H, 4.17 %; N, 12.84 %. 111
EXAMPLE 41
Figure imgf000113_0001
4-Cyclohexyl-2-(oxalyl-amino)-thiophene-3-carboxylic acid:
To a solution of 4-cyclohexyi-2-(ethoxyoxalyl-amino)-thiophene-3-carboxylic acid (60 mg, 0.18 mmol) in ethanol (10 ml) was added a solution of 1N sodium hydroxide (0.5 ml) in water (5 ml). The resulting reaction mixture was stirred at room temperature for 18 h. To the reaction mixture was added concentrated hydrochloric acid to pH = 1. The precipitate was filtered off and dried in vacuo at 50 °C for 18 h. affording 30 mg (55 %) of the title compound as a solid.
M.p.: > 250 °C:
Calculated for C13H15NO5S, 1.5 x H20; C, 48.14 %; H, 5.59 %; N, 4.32 %. Found: C, 47.84 %; H, 9.92 %; N, 4.21 %.
EXAMPLE 42
Figure imgf000113_0002
2-(Oxalyl-amino -phenyl-thiophene-3-carboxylic acid: 112 To a solution of 4-phenyl-2-(ethoxyoxalyl-amιno)-thιophene-3-carboxylιc acid ethyl ester (2 2 g, 6 33 mmol) in ethanol (50 ml) was added sodium hydroxide (630 mg, 15 83 mmol) in water (25 ml) The resulting reaction mixture was stirred at room temperature for 18 h , the volatiles were evaporated in vacuo and the residue was dissolved in water (100 ml) and washed with diethyl ether (2 x 100 ml) To the aqueous phase was added concentrated hydrochloric acid to pH = 1 and the resulting mixture was extracted with diethyl ether (2 x 100 ml) The combined organic phases were washed with saturated aqueous sodium chloride (100 ml), dried (MgS04), filtered and evaporated in vacuo affording 0 8 g of a mixture of mono ethyl ester and title compound according to NMR The product mixture was dissolved in a mixture of ethanol (40 ml), water (20 ml) and sodium hydroxide (400 mg) and the resulting mixture was stirred at room temperature for 18 h, the volatiles were evaporated m vacuo and the residue was dissolved in water (50 ml) and washed with diethyl ether (50 ml) To the aqueous phase was added concentrated hydrochloric acid to pH = 1 and the precipitate was filtered off, washed with diethyl ether and dissolved in 2-propanol (25 ml) Undis- solved matter was filtered off and the organic phase evaporated in vacuo affording 180 mg (10 %) of the title compound as a solid M p 196 - 198 °C Calculated for C13H9N05S, 0 5 H20, C, 52 00 %, H, 3 36 %, N, 4 66 % Found C, 52 21 %, H, 3 44 %, N, 4 50 %
EXAMPLE 43
Figure imgf000114_0001
5-(4-Fluoro-phenylV3-(oxalyl-amιno)-thιophene-2-carboxylιc acid.
A solution of 5-(4-fluorophenyl)-3-amιnothιophene-2-carboxylιc acid methyl ester (1 0 g, 4 0 mmol) and triethylamine (11 1 , 80 mmol) in dry tetrahydrofuran (40 ml) was cooled on ice and dropwise added ethyl oxalyl chloride (1 2 g, 9 0 mmol) After stirring for 2h, the reaction mixture was filtered and the solvent evaporated m vacuo The residue was dissolved in dichloromethane, washed with 0 1 N hydrochloric acid (2 x-dicared) The organic phase was 113 dried (MgS04), filtered and the solvent evaporated in vacuo. The residue was submitted to flash chromatography using toluene/ethyl acetate (19:1) as eluent, to give 1.19 g (85 %) of 5-(4-fluorophenyl)-3-(ethoxyoxalylamino)-thiophene-2-carboxylic acid ethyl ester.
To a solution of 5-(4-fluorophenyl)-3-(ethoxyoxalylamino)-thiophene-2-carboxylic acid ethyl ester (1.19 g, 3.4 mmol) in methanol (150 ml) was added 2 N sodium hydroxide (20 ml). The reaction mixture was stirred at 60 °C for 18 h. The volatiles were evaporated in vacuo. The residue was added water and 1 N hydrochloric acid (pH = 1 ), and the product extracted with a mixture of dichloromethane/2-propanol. The organic phases were dried (MgS04), filtered and the solvent evaporated in vacuo. The product was recrystallised from methanol/water to give 619 mg (67 %) of the title compound as a solid.
Calculated for C13H8FN05S, 0.5 H20; C, 49.06 %; H, 2.83%; N, 4.40 %. Found: C, 49.06 %; H, 2.72%; N, 4.31%.
In a similar way as described in Example 43 the following compounds were prepared.
EXAMPLE 44
Figure imgf000115_0001
5-(4-lsobutyl-phenyD-3-(oxalyl-aminoHhiophene-2-carboxylic acid: Calculated for C17H17N05S, 0.33 x H20; C, 57.79 %; H, 5.00 %; N, 3.96 %. Found: C, 57.79 %; H, 5.08 %; N, 3.89 %.
EXAMPLE 45 1 14
Figure imgf000116_0001
5-(4-Chloro-phenyπ-3-(oxalyl-amino thiophene-2-carboxylic acid, mono sodium salt:
M.p.: > 250 °C:
Calculated for C13H7CIN05SNa, 1x H20; C, 42.63 %; H, 2.52 %; N, 3.55 %. Found: C, 42.69 %; H, 2.48 %; N, 3.83 %.
EXAMPLE 46
Figure imgf000116_0002
4-(Oxalyl-amino)-[2.3]-bithiophenyl-5-carboxylic acid;
M.p.: 220 - 222 °C: Calculated for d , H7N05S2;
C, 44.44 %; H, 2.37 %; N, 4.71 %. Found: C, 44.17 %; H, 2.43 %; N, 4.54 %.
EXAMPLE 47 1 15
Figure imgf000117_0001
3-(Oxalyl-amino)-5-phenyl-thiophene-2-carboxylic acid, mono sodium salt;
M.p.: > 250 °C:
Calculated for C13H8N05SNa, 1.6 x H20; C, 45.64 %; H, 3.30 %; N, 4.09 %. Found: C, 45.25 %; H, 2.93 %; N, 3.92 %.
EXAMPLE 48
X -^ °~Na* o o 3-(Oxalyl-aminoVthiophene-2-carboxylic acid, mono sodium salt:
M.p.: > 250 °C: Calculated for C7H7N05SNa, 1.5 x H2O; C, 31.83 %; H, 2.67 %; N, 5.30 %. Found: C, 32.23 %; H, 3.14 %; N, 5.15 %.
EXAMPLE 49 116 o
-OH
VH O
0 X O Na .
4-Methyl-3-(oxalyl-aminoHhiophene-2-carboxylic acid, mono sodium salt:
M.p.: 232 - 234 °C: Calculated for C8H6N05SNa, 1.5 x H20; C, 34.54 %; H, 3.26 %; N, 5.03 %. Found: C, 34.58 %; H, 3.30 %; N, 4.81 %.
EXAMPLE 50
Figure imgf000118_0001
3-(Oxalyl-amino)-5-(4-phenoxy-phenyl)-thiophene-2-carboxylic acid
M.p.: 230 °C (decomp.) Calculated for C19H13N06S, 1.25 x H20 C, 56.22 %; H, 3.85 %; N, 3.45 %. Found: C, 56.00 %; H, 3.57 %; N, 3.39 %.
EXAMPLE 51
cr
Figure imgf000118_0002
117 5-(4-Benzyloxy-phenyl)-3-(oxalyl-amino)-thiophene-2-carboxylic acid
M.p.: 210 °C (decomp.) Calculated for C20H15NO6S C, 60.45 %; H, 3.80 %; N, 3.52 %. Found: C, 59.94 %; H, 3.79 %; N, 4.45 %.
EXAMPLE 52
Figure imgf000119_0001
5-(4-(4-Methoxy-phenoxy)-phenyl)-3-(oxalyl-aminoVthiophene-2-carboxylic acid
M.p.: 215 °C (decomp.)
Calculated for C20H15NO7S, 1.5 H20
C, 54.54 %; H, 4.12 %; N, 3.18 %. Found:
C, 54.80 %; H, 3.88 %; N, 3.15 %.
EXAMPLE 53
Na
HO
Figure imgf000119_0002
5-(4-Hydroxy-phenyO-3-(oxalyl-amino)-thiophene-2-carboxylic acid, mono sodium salt
M.p.: 205 - 206 °C
Calculated for C^HgNOgSNa,, 0.75 x H20 C, 45.42 %; H, 3.08 %; N, 4.07 %. Found: C, 45.11 %; H, 3.16 %; N, 3.98 %. 1 18
EXAMPLE 54
Figure imgf000120_0001
O" ,p w ^ \\ ^s O X On
XX
5-(3-Nitro-phenyl)-2-(oxalyl-amino)-thiophene-3-carboxylic acid:
To 3-nitrophenethyl alcohol (102 mg, 0.61 mmol) in dichloromethane (2.2 ml) at room temperature under nitrogen was added a solution of Dess-Martin periodinane reagent (285 mg, 0.67 mmol) in dichloromethane (2.1 ml). The reaction was stirred at room temperature under nitrogen for 45 minutes, at which time tic analysis (hexane/ethyl acetate, 50/50) indicated the reaction was complete. Diethyl ether (5.0 ml) was added followed by a solution of 10 % sodium sulfite/saturated sodium bicarbonate (1 :1 , 5.0 ml). The emulsion gradually turned to a clear heterogeneous solution after standing for 10 minutes. Additional dichloromethane was added and the organic phase was washed with water (5 ml), dried (MgS04), filtered and evaporated in vacuo which afforded 100 mg (100 %) of 3-nitrophenyl-acetaldehyde as a clear oil. The aldehyde was used without further purification in the next step. 1H NMR (400 MHz, CDCI3) δ 3.90 (s, 2H), 7.65 (d, 2H), 8.20 (s, 1 H), 8.25 (m, 1 H), 9.90 (s, 1 H).
A mixture of tert-butyl cyanoacetate (67 mg, 0.48 mmol), 3-nitrophenyl acetaldehyde (86 mg, 0.52 mmol ), triethylamine (73 μl, 0.52 mmol) and elemental sulfur (17 mg, 0.52 mmol) in N,N-dimethylformamide (0.5 ml) was stirred at 60 °C for 1.5 h. After cooling to room temperature, the dark solution was diluted with ethyl acetate and washed with water (3 x 5 ml). The organic layer was dried (MgS04), filtered and the solvent evaporated in vacuo which afforded crude 2-amino-5-(3-nitro-phenyl)-thiophene-3-carboxylic acid tert-butyl ester (191 mg). Purification by preparative TLC (hexane/ethyl acetate, 80/20) afforded 74 mg (49 %) of 2-amino-5-(3-nitro-phenyl)-thiophene-3-carboxylic acid tert-butyl ester as a solid. Η NMR (400 MHz, CDCI3) δ 1.56 (s, 9H), 6.05 (s, 2H), 7.20 (s, 1 H), 7.40 (t, 1 H), 7.68 (d, 1 H), 7.90 (d, 1 H), 8.25 (s, 1 H). 119 A solution of 2-amino-5-(3-nitro-phenyl)-thiophene-3-carboxylic acid tert-butyl ester (66 mg, 0.21 mmol), imidazol-1-yl-oxoacetic acid tert-butyl ester (202 mg, 1.03 mmol) and triethylamine (40.4 μl, 0.21 mmol) in tetrahydrofuran (0.5 ml) was stirred at room temperature for 3 h. The volatiles were evaporated in vacuo and the residue was dissolved in ethyl acetate and washed successively with water (3 x 5 ml) and brine (5ml). The organic layer was dried (Na2S04), filtered and the solvent evaporated in vacuo affording crude product. Purification by preparative TLC gave 91 mg (98 %) of 2-(tert-butoxyoxalyl-amino)-5-(3-nitrophenyl)- thiophene-3-carboxylic acid tert-butyl ester as a solid.
1H NMR (400 MHz, CDCI3) δ 1.54 (s, 9H), 1.62 (s, 9H), 7.5 (s, 1 H), 7.55 (t, 1 H, J = 8.4 Hz), 7.84 (d, 2H, J = 8.4 Hz), 8.16 (d, 1 H, J = 8.4 Hz), 8.45 (s, 1 H).
MS m/z: 447 (M-1 ).
The above 3-nitrophenyl-thiophene (85 mg, 0.19 mmol) was dissolved in a 20 % solution of trifluoroacetic acid in dichloromethane (3.0 ml) and stirred at room temperature for 6 h. The solution was co-evaporated in vacuo with toluene affording 64 mg (100 %) of the title compound.
Η-NMR (400 MHz, CD3OD) δ 7.71 (t, 1H, J = 8.25 Hz), 7.8 (s, 1H), 8.1 (d, 1H, J = 7.5 Hz), 8.2 (d, 1 H, J = 9 Hz), 7.86 (m, 1 H). MS m/z: 335 (M-1 ).
The following examples were prepared in a similar way as described in Example 54.
Figure imgf000121_0001
2-(Oxalyl-amino)-5-(phenyl-methyπthiophene-3-carboxylic adri
M.p.: 230 - 231 °C Calculated for C^HnNOgS.
C, 54.89 %; H, 3.63 %; N, 4.40 %. Found: 120
C, 54.94 %; H, 3.63 %; N, 4.43 %.
EXAMPLE 56
Figure imgf000122_0001
5-(Naphthalen-2-yl)-2-(oxalyl-amino)-thiophene-3-carboxylic acid:
Η NMR (400 MHz, CD3OD) δ 7.42 - 7.49 (m, 2H), 7.66 (d, 1H, J = 4.5 Hz), 7.75 (m, 1 H), 7.8 - 7.9 (m, 3H), 8.04 (d, 1 H ,J = 7.5 Hz).
MS tr7/z: 340 (M-1).
EXAMPLE 57 o
Figure imgf000122_0002
2-(Oxalyl-amino)-5-phenyl-thiophene-3-carboxylic acid; M.p.: 238 - 240 °C
1H NMR (400 MHz, CD3OD) δ 7.3 (t, 1 H, J = 4.5 Hz), 7.38 (t, 1 H, J = 4.5Hz), 7.54 (s, 1 H), 7.61 (m, 3H).
Calculated for C13H9N05S, 1 x H20; C, 47.13 %; H, 3.04 %; N, 4.23 %. Found: C, 47.34 %; H, 3.53 %; N, 4.20 %. 121
EXAMPLE 58
Figure imgf000123_0001
5-.2-Fluoro-phenyl.-2-(oxalyl-amino)-thiophene-3-carboxylic acid:
Η NMR (400 MHz, CD3OD) δ 7.18 - 7.23 (m, 2H), 7.30 (m, 1 H), 7.63 -7.69 (m, 2H).
MS m/z: 308 (M-1).
EXAMPLE 59
Figure imgf000123_0002
5-(3-Chloro-phenyπ-2-(oxalyl-amino thiophene-3-carboxylic acid:
Yield: 99 %.
1H NMR (400 MHz, CD3OD) δ 7.28 (m, 1 H), 7.38 (m, 1 H), 7.52 - 7.61 (m, 3H).
MS m/z: 324 (M-1).
EXAMPLE 60 122
0 γ -OH
Cl -N 0
O O UHI
Cl
Figure imgf000124_0001
Figure imgf000124_0004
5-(2.4-Dichloro-phenyl)-2-(oxalyl-amino.-thiophene-3-carboxylicacid:
1H NMR (400 MHz, CD3OD) δ 7.37 (m, 1H), 7.39 (m, 1H), 7.52-7.58 (m, 3H). MSm/z:358(M-1).
EXAMPLE 61
Figure imgf000124_0002
5-(4-Bromo-phenyl)-2-(oxalyl-amino)-thiophene-3-carboxylic acid:
Η NMR (400 MHz, CD3OD) δ 7.51 (s, 4H), 7.54 (s, 1H).
MS/77/z:370(M-1).
EXAMPLE 62
Figure imgf000124_0003
5-Ethyl-2-(oxalyl-amino)-thiophene-3-carboxylic acid:
Η NMR (400 MHz, CD3OD) δ 1.35 ( t, 3H, J = 3.75), 2.95 (q, 2H), 7.05 (s, 1H).
MS m/z: 170.2 (M-73) (-COCOOH), 228.1 (M-1). 123
EXAMPLE 63
O -OH Xχ O ° OH
5-Methyl-2-(oxalyl-amino)-thiophene-3-carboxylic acid: 1H NMR (400 MHz, CD3OD) δ 2.6 (s, 3H), 7.05 (s, 1 H).
MS m/z: 228 (M-1).
EXAMPLE 64
Figure imgf000125_0001
5-(3-Methyl-phenyl)-2-(oxalyl-amino)-thiophene-3-carboxylic acid:
Η NMR (400 MHz, CD3OD) δ 2.39 (s, 3H), 7.12 (d, 1 H, J = 8 Hz), 7.25 (t, 1 H, J = 7.5 Hz), 7.4 (m, 2H), 7.5 (s, 1 H).
MS m/z 304, 232 (M-1).
EXAMPLE 65
Figure imgf000125_0002
5-Dibenzofuran-2-yl-2-(oxalyl-aminoHhiophene-3-carboxylic acid: 124 Η NMR (400 MHz, CD3C0CD3) δ 7.4 (t, 1H , J = 2 Hz), 7.52 (t, 1H, J = 2 Hz), 7.7 (m, 3H), 7.9 (t, 1H, J = 2 Hz), 8.25 (d, 1H, J = 2 Hz), 8.5 (s, 1H).
MS m/z 380.5 (M-1).
EXAMPLE 66
Figure imgf000126_0001
5-(2-(4-Chloro-phenylVethyl)-2-(oxalyl-amino)-thiophene-3-carboxylic acid, mono sodium salt
M.p.: >250°C Calculated for dsHn^CI S.Na,, 0.75 x H20 C, 46.28 %; H, 3.24 %; N, 3.60 %. Found: C, 46.17 %; H, 3.38 %; N, 3.40 %.
EXAMPLE 67
o
V-OH
H -N hi OH
2-(Oxalyl-amino)-thiophene-3-carboxylicacid: M.p.: 225- 228 °C
Calculated for CyHsN S,, 1.25 x H20 C, 35.37 %; H, 3.18 %; N, 5.89 %. Found: 125 C, 35.53 %; H, 2.82 %; N, 5.72 %.
EXAMPLE 68
Figure imgf000127_0001
5-(1 ,3-Dioxo-1.3-dihydro-isoindol-2-ylmethyl)-2-(oxalyl-amino)thiophene-3-carboxylic acid:
To a stirred mixture at 0 °C of 2-(3-hydroxy-propyl)-isoindole-1 ,3-dione (0.2 g, 0.97 mmol), 0.7 N sodium bromide (0.70 ml, 0.46 mmol), 2,2,6,6-tetramethyl-1-piperidinyloxy, free radical) TEMPO (3.0 mg, 0.02 mmol) in dichloromethane (1 ml) was added dropwise a solution of bleach (2.1 ml, 4.9 mmol) and sodium hydrogencarbonate (117 mg, 1.4 mmol). The mix- ture was stirred at 0 °C for 2 h after the addition was finished. The mixture was extracted with ethyl acetate (3 x 20 ml). The combined organic extracts were washed with 10% sodium thiosulfate (3 x 10 ml), brine (10 ml), dried (MgS04), filtered and the solvent was evaporated in vacuo. The residue was washed with ethyl acetate (2 x 1 ml) affording after drying 161 mg (81 %) of 3-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-yl)-propionaldehyde as a solid.
Η NMR (400 MHz, CDCI3) δ 9.82 (s, 1H), 7.85 (dd, 2H, J = 5.6, 2.8 Hz), 7.73 (dd, 2H, J = 5.6, 2.8 Hz), 4.04 (t, 2H, J = 7.2 Hz), 2.89 (t, 2H, J = 7.2 Hz).
To a solution of the above aldehyde (150 mg, 0.74 mmol), triethylamine (113 ml, 0.81 mmol) and sulfur (24 mg, 0.81 mmol) in dichloromethane (10 ml) at room temperature was added tert-butyl cyanoacetate (114 mg, 0.81 mmol). The mixture was stirred and heated at reflux temperature under nitrogen for 2 h. After cooled to room temperature the precipitate was filtered off affording 189 mg of 2-amino-5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)- thiophene-3-carboxylic acid tert-butyl ester as a solid. The filtrate was evaporated in vacuo. the residue was taken into ethyl acetate (50 ml), washed with 0.5 N hydrochloric acid (2 x 10 ml), saturated sodium bicarbonate (2 x 10 ml), 126 brine (10 ml), dried (MgS04) and filtered. The solvent was evaporated in vacuo and the residue was washed with cold ethyl acetate (2 x 1 ml) affording 52 mg of 2-amino-5-(1 ,3-dioxo- 1 ,3-dihydro-isoindol-2-ylmethyl)-thiophene-3-carboxylic acid tert-butyl ester as a solid. A total yield of 241 mg (91 %) was obtained. 1H NMR (400 MHz, CDCI3) δ 7.86 (dd, 2H, J = 7.2, 4 Hz), 7.72 (dd, 2H, J = 7.2, 4 Hz), 6.97 (s, 1 H), 5.83 (s, 2H, NH2), 4.78 (s, 2H), 1.56 (s, 9H)
To a stirred solution of the above thiophene (100 mg, 0.28 mmol) in tetrahydrofuran (2 ml) was added a solution of imidazol-1-yl-oxo-acetic acid tert-butyl ester (60 mg, 0.31 mmol) in tetrahydrofuran (1 ml). The mixture was stirred at room temperature for 3 h. The solvent was evaporated in vacuo. The residue was dissolved in ethyl acetate (50 ml), washed with 0.5 N hydrochloric acid (2 x 5 ml), saturated sodium bicarbonate (2 x 5 ml), brine (5 ml), dried (MgS04) and filtered. The solvent was evaporated in vacuo affording 130 mg (96 %) of 2- (tert-butoxyoxalyl-amino)-5-(1 ,3-dioxo-1,3-dihydro-isoindol-2-ylmethyl)-thiophene-3- carboxylic acid tert-butyl ester as a solid.
Η NMR (400 MHz, CDCI3) δ 12.23 (s, 1 H), 7.87 (dd, 2H, J = 7.2, 4 Hz), 7.73 (dd, 2H, J = 7.2, 4 Hz), 7.24 (s, 1H), 4.93 (s, 2H), 1.60 (s, 9H), 1.57 (s, 9H).
To a solution of trifluoroacetic acid (1 ml) in dichloromethane (1 ml) was added the above di- tert-butyl ester (100 mg, 0.21 mmol). The solution was stirred at room temperature for 1 h. The solvent was evaporated in vacuo. The residue was washed with dichloromethane (3 x 1 ml) which afforded 63 mg (82 %) of the title compound as a solid.
Η NMR (400 MHz, DMSO-d6) δ 12.05 (s, 1 H), 7.89 (m, 2H), 7.87 (m, 2H), 7.10 (s, 1 H), 4.83 (s, 2H).
MS m/z: 373 (M-1).
In a similar way as described in Example 43 the following compounds were prepared.
EXAMPLE 69 127
Figure imgf000129_0001
5-(3.4-Dimethoxy-phenyl)-3-(oxalyl-amino)-thiophene-2-carboxylic acid
M.p.: 230 - 231 °C
Calculated for sH^N S,, 1 x H20
C, 48.78 %; H, 4.09 %; N, 3.79 %. Found:
C, 49.01 %; H, 3.75 %; N, 3.79 %.
EXAMPLE 70
Figure imgf000129_0002
5-(3-Methoxy-phenyO-3-(oxalyl-amino)-thiophene-2-carboxylic acid
M.p.: 217 - 218 °C
Calculated for C Hn^OeS,, 0.75 x H20 C, 50.22 %; H, 3.76 %; N, 4.18 %. Found: C, 50.02 %; H, 3.73 %; N, 4.16 %.
EXAMPLE 71 128
Figure imgf000130_0001
5-(3.5-Dimethoxy-phenyO-3-(oxalyl-amino hiophene-2-carboxylic acid
M.p.: 223 - 225 °C
Calculated for C^H^O^, 1.25 x H20 C, 48.19 %; H, 4.18 %; N, 3.75 %. Found: C, 48.25 %; H, 4.10 %; N, 3.39 %.
EXAMPLE 72
Figure imgf000130_0002
5-(3-Nitro-phenyπ-3-(oxalyl-amino)-thiophene-2-carboxylic acid
M.p.: > 250 °C
Calculated for C^N S^a,, 1.25 x H20 C, 41.01 %; H, 2.51 %; N, 7.36 %. Found: C, 41.03 %; H, 2.38 %; N, 7.17 %.
EXAMPLE 73 129
Figure imgf000131_0001
5-(3-Amino-phenyD-3-(oxalyl-amino)-thiophene-2-carboxylic acid
M.p.: > 250 °C
Calculated for aH.oNAS., 0.5 x H20 C, 49.52 %; H, 3.52 %; N, 8.88 %. Found: C, 49.48 %; H, 3.44 %; N, 8.71 %.
EXAMPLE 74
Figure imgf000131_0002
5-(4-Methoxy-phenyπ-3-(oxalyl-amino)-thiophene-2-carboxylic acid
M.p.: 220 - 221 °C Calculated for C^Hn^O^, 0.4 x H20 C, 51.19 %; H, 3.62 %; N, 4.62 %. Found: C, 51.29 %; H, 3.53 %; N, 3.96 %.
EXAMPLE 75
H,N
Figure imgf000131_0003
5-(4-Amino-phenyl)-3-(oxalyl-amino)-thiophene-2-carboxylic acid: 130 Calculated for C^H^N- S,, 0 5 x H20 C, 49 52 %, H, 3 52 %, N, 8 88 % Found C, 49 40 %, H, 3 87 %, N, 8 23 %
EXAMPLE 76
Figure imgf000132_0001
5-(4-(2-(2-Methoxy-phenyl)-2-oxo-ethoxy)-phenyl)-3-(oxalyl-amιno)-thιophene-2-carboxylιc acid, disodium salt
To a solution of 3-(ethoxyoxalylamιno)-5-(4-hydroxyphenyl)thιophene-2-carboxylιc acid methyl ester (524 mg, 1 5 mmol) and potassium carbonate (275 mg, 2 0 mmol) in N,N- dimethylformamide (35 ml) was under an nitrogen atmosphere added ω-brom-2- methoxyacetophenon (460 mg, 2 0 mmol) After stirring for 3 h, the precipitate crude 3-
(ethoxyoxalylamιno)-5-(4-(2-(2-methoxyphenyl)-2-oxy-ethoxy)phenyl)-thιophene-2-carboxylιc acid methyl ester (1 0 g) was filtered off
To a solution of crude 3-(ethoxyoxalylamιno)-5-(4-(2-(2-methoxyphenyl)-2-oxy- ethoxy)phenyl)-thιophene-2-carboxylιc acid methyl ester (0 5 g) in methanol (15 ml) was added 1 N sodium hydroxide (10 ml) After stirring at 65 °C for 3h, the product was isolated by filtration and washed with a mixture of water and ethanol (1 1) affording after drying 290 mg of the title compound as a solid
M p 286 - 287 °C
Calculated for C22H18N109S1Na2,
C, 50 19 %, H, 3 42 %, N, 2 66 % Found
C, 51 18 %, H, 3 42 %, N, 2 58 % 131
EXAMPLE 77
Na
Na O
Figure imgf000133_0001
O
5-(4-Carboxymethoxy-phenyl)-3-(oxalyl-amino)-thiophene-2-carboxylic acid, trisodium salt:
To a solution of 3-(ethoxyoxalylamino)-5-(4-hydroxyphenyl)thiophene-2-carboxylic acid methyl ester (307 mg, 1.0 mmol) and potassium carbonate (166 mg, 1.2 mmol) in N,N- dimethylformamide (5 ml) was added 2-bromoacetamide (165 mg, 1.2 mmol). After stirring at 50 °C for 16 h, the reaction mixture was quenched by addition of water, and the precipitate 5-(4-carbamoylmethoxy-phenyl)-3-(ethoxyoxalylamino)-thiophene-2-carboxylic acid methyl ester (70 mg) was isolated by filtration. The pH of the filtrate was adjusted to 1-2 with 1 N hydrochloric and the semi hydrolysed product, 5-(4-carbamoylmethoxy-phenyl)-3-(oxalylamino)-thiophene-2-carboxylic acid methyl ester (300 mg), was isolated by filtration. To a suspension of 5-(4-carbamoylmethoxy- phenyl)-3-(oxalylamino)-thiophene-2-carboxylic acid methyl ester (295 mg, 0.78 mmol) in methanol (5 ml) and water (5 ml) was added 1 N sodium hydroxide (2 ml). After stirring for 5 days the precipitate was filtered of affording 105 mg (88 %) of the title compound as a solid.
M.p.: > 300 °C.
Calculated for C^H^N^^S^a-j;
C, 38.56 %; H, 2.59 %; N, 3.00 %. Found:
C, 38.73 %; H, 2.74 %; N, 3.06 %.
In a similar way as described in Example 77 the following compound was prepared: 132 EXAMPLE 78
Figure imgf000134_0001
F 5-(4-(4-Fluoro-benzyloxyVphenyl.-3-(oxalyl-amino.-thinphene-2-carboxylic acid:
1H NMR (300 MHz, DMSO-d6) δ 5.15 (s, 2H), 7.1 (d, 2H), 7.25 (t, 2H), 7.55 (q, 2H), 7.7 (d, 2H), 8.2 (s, 1 H).
SP/MS: 415 (M+, 12%), 372, 353, 299, 218, 190, 162, 109 (100%).
EXAMPLE 79
Figure imgf000134_0002
fPPP 5-((2-(1 ,3-Dioxo-1 ,3-dihvdro-isoindol-2-vn-acetylamino methvh-2-(oxalyl-aminoVthiophene- 3-carboxylic acid:
To a solution of 2-(tert-butoxyoxalyl-amino)-5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-yl-methyl)- thiophene-3-carboxylic acid tert-butyl ester (0.4 g, 0.82 mmol, prepared as described in ex- ample 30) in dichloromethane (2 ml) was added anhydrous hydrazine (28 ml, 0.9 mmol) and the mixture stirred at ambient temperature for 19 h under nitrogen. An additional portion of hydrazine (84 ml, 2.7 mmol) and dichloromethane (5.5 ml) was added and stirring was continued for an additional 88 h. Dichloromethane (50 ml) was added and the reaction mixture was placed in a sonicator for 20 min and filtered through Celite. The filtrate was evaporated in vacuo affording 0.24 g (82 %) of 5-aminomethyl-2-(tert-butoxyoxalyl-amino)-thiophene-3- 133 carboxylic acid tert-butyl ester as a solid which was used without further purification in the next step
To a solution of (1 ,3-dιoxo-1 ,3-dιhydro-ιsoιndol-2-yi)-acetιc acid (0 17 g, 0 82 mmol), 1- hydroxybenzotπazole (0 133 g, 0 98 mmol) and 2,6 lutidine (0 4 ml) in dry acetonitrile (10 ml) under nitrogen cooled in an ice bath was added 1-(3-dιmethylamιnopropyl)-3- ethylcarbodnmide hydrochloride (0 21 g, 1 1 mmol) and the solution was stirred for 0 5 h 5- Amιnomethyl-2-(tert-butoxyoxalyl-amιno)-thιophene-3-carboxylιc acid tert-butyl ester (0 24 g, 0 68 mmol) was added, the cooling bath removed, and the solution stirred at ambient tem- perature for 20 h The volatiles were evaporated in vacuo and the residue dissolved in dichloromethane and washed with saturated aqueous sodium bicarbonate and 1 N hydrochloric acid, dried (Na2S04) and the solvent evaporated in vacuo The residue (0 18 g) was dissolved in dry tetrahydrofuran (6 ml) under nitrogen, ιmιdazol-1-yl-oxo-acetιc acid tert-butyl ester (0 25 g, 1 3 mmol) was added and the solution stirred at ambient temperature for 17 h, the solvent evaporated m vacuo and the residue dissolved in a mixture of dichloromethane and saturated aqueous sodium bicarbonate solution The organic layer was dried (Na2S04) and the solvent evaporated in vacuo The residue was subjected to chromatography on silica gel affording 0 1 g of 2-(tert-butoxyoxalyl-amιno)-5-((2-(1 ,3-dιoxo-1 ,3-dιhydro-ιsoιndol-2-yl)- acetylamιno)-methyl)-thιophene-3-carboxylιc acid tert-butyl ester 1H NMR (400 MHz, CDCI3) δ 12 3 (bs, 1 H), 7 9 (m, 2H), 7 8 (m, 2H), 7 1 (s, 1H), 6 5 (m, 1 H), 4 6 (m, 2H), 4 4 (s, 2H,), 1 8 (s, 9H), 1 6 (s, 9H)
To 2-(tert-butoxyoxalyl-amιno)-5-((2-(1 ,3-dιoxo-1 ,3-dιhydro-ιsoιndol-2-yl)-acetyl-amι-no)- methyl)-thιophene-3-carboxylιc acid tert-butyl ester (0 1 g, 0 18 mmol) was added 20 % trifluoroacetic acid in dichloromethane (4 ml) and the reaction mixture was stirred at ambient temperature under nitrogen for 14 h The volatiles were evaporated in vacuo and the residue chased with dichloromethane until a solid remained The precipitate was filtered off and dried in vacuo for 18 h affording in quantitative yield the title compound as a solid Mp 243 - 244 °C (dec) MS m/z 430 (M-1)
1H NMR (400 MHz, DMSO-d6) δ 12 1 (s, 1 H), 8 9 (s, 1 H), 7 8 - 7 9 (m, 4H), 7 1 (s, 1 H), 4 4 (m, 2H), 4 2 (s, 2H) 134
EXAMPLE 80
Using a solid phase chemistry approach a 64 member library was synthesised according to the following scheme
TEMPO NX0k
OH HCl
Figure imgf000136_0001
NH-
90%
Figure imgf000136_0002
-CHO
Figure imgf000136_0004
TEA/DCM
Figure imgf000136_0003
_ ==. in-OMs
NH, o Wang-Res »
Figure imgf000136_0006
THF
Figure imgf000136_0008
Figure imgf000136_0005
Figure imgf000136_0007
X Cs2C03, NMP
Wang
Wang
H,NNH,
Figure imgf000136_0010
CH,CI, H,N ,o
Figure imgf000136_0009
O O
Figure imgf000136_0011
O X O
R1-NCO TFA
CH,CI2
R2-0-CO-CI TFA
0
2,6-lutidine CHJCIJ -OH
X 0 OH
Figure imgf000136_0012
R3-S02-CI TFA
TEA CHJCIJ
R -SO,-NCO TFA
CH,CI2
X, indicate point of attachment for the R-group.
The percentage means the area of the peak of the HPLC at 220 nm. 135
R-group Formula Mw LC/MS
0
C13H15N3O8S 373.34 No hit 5 H
I °
C13H17N306S 343.36 No hit
H
0
C11H13N306S 315.31 No hit
C15H12N408S 408.35 407 (M-H,44%)
N02 H
X o
C16H15N307S 393.38 No hit H
γ 0 O H , C17H15N307S 405.39 No hit
0
C12H15N306S 329.33 No hit
B,X N Hχ C15H12BrN3O6S 442.25 442 (M-H, 50%)
^N^X, C21 H25N306S 447.51 446 (M-H, 92%)
1 H
Figure imgf000137_0001
136 2N
O
Figure imgf000138_0001
A C15H12N408S 408.35 407 (M-H, 48%)
O
A C19H15N306S 413.41 412 (M-H, 49%)
Figure imgf000138_0002
0
N A H C21 H17N306S 439.45 438 (M-H, 81 %)
Figure imgf000138_0003
CF,
O C17H11 F6N306S 499.35 498 (M-H, 83%)
CF
Figure imgf000138_0004
.A
C16H12F3N3O6S 431.35 No hit
Figure imgf000138_0005
CF,
Figure imgf000138_0006
C16H12F3N306S 431.35 430 (M-H.48%)
H
O
•N , C12H15N306S 329.33 328 (M-H, 94%)
H
O
Figure imgf000138_0007
C15H19N306S 369.40 368 (M-H, 85%)
N A H
C16H15N307S 393.38 No hit
Figure imgf000138_0008
H
O
376 (M-H, 86%) H
Figure imgf000138_0009
|Λ. C16H15N3O6S 377.38 137
C17H17N308S 423.40 422 (M-H,39%)
^0 H
X , C19H23N306S 421.48 420 (M-H, 29%)
H
^x C15H13N306S 363.35 362 (M-H,26%)
H
O.NJ^NA. C15H12N4O8S 408.35 407 (M-H, 44%)
H
X -ox X C18H
H , 19N309S 453.43 452 (M-H, 34%)
Cl o o
XX C15H13N308S2 427.41 426 (M-H,62%) o H ■
9A, C16H15N308S2 441.44 440 (M-H, 89%)
c Y Xl°° C15H12CIN308S2 461.86 460(M-H,41%)
0 H 1 Brrχ0o C15H11BrN207S 443.23 442 (M-H, 71%)
0 6'S'; HNΛX, 1
F Xι 0° H° C15H11FN207S 382.33 381 (M-H, 82%) 1
Figure imgf000139_0001
138
0
> oAx, C14H18N2O7S 358.37 357 (M-H,70%)
ζ x, C15H11N3O9S 409.33 408 (M-H, 87%)
N02
Tloo
X N308S2 441.44 No Hit 0» C16H15 H 1
0
C17H24N207S 400.45 399 (M-H,68%)
Q-X C16H14N207S 378.36 377 (M-H.63%)
0
C12H14N2O7S 330.32 329 (M-H, 54%)
I °
C12H14N207S 330.32 329 (M-H.76%)
°*Nγ^ o
C15H11N309S 409.33 408 (M-H, 82%)
0
P^X^o , C16H13N309S 423.36 422 (M-H,63%) O2N^
°- -0^Xl C16H14N208S 394.36 393 (M-H,78%)
0 c^c—-c^0 Xι
C17H24N207S 400.45 399 (M-H, 78%)
0
^ A C12H10N2O7S 326.29 325 (M-H, 92%)
Figure imgf000140_0001
139
0
C11H12N207S 316.29 315(M-H,70%)
0
Y"oAx, C13H16N207S 344.35 343 (M-H, 86%)
0
^^0- C12H12N207S 328.30 327 (M-H.73%)
0 X^^o C13H14N207S 342.33 341 (M-H, 74%)
Br-^ / — \- °g-X, C14H11BrN207S2 463.28 362 (M-H.45%)
0
C10H10N2O7S 302.26 301 (M-H, 72%)
0i0Xx, C15H12N207S 364.34 363 (M-H,82%)
X C15H13N309S2 443.41 442 (M-H, 94%)
0,N ^S-X. 0
CF v C15H11F3N208S2 468.39 467 (M-H,62%)
0
aXXx C14H11CIN207S2 418.83 417 (M-H, 31%)
0
\ ° ' C11H14N207S2 350.37 349 (M-H, 89%)
*X- C14H11FN207S2 402.38 401 (M-H, 34%)
0 II
— s II-x, η C9H10N2O7S2 322.32 321 (M-H, 50%)
0
Figure imgf000141_0001
140
, v °x ° C18H14N207S2 434.45 433 (M-H,42%)
II 1 C10H12N2O7S2 336.34 335 (M-H,46%)
0 •
C15H11 F3N207S2 452.39 451 (M-H, 82%)
C 3 7
C16H15N3O8S2 441.44 440 (M-H,42%)
0
^s I I-x. η C11 H14N207S2 350.37 349 (M-H, 57%)
0
> C18H20N2O7S2 440.50 439(M-H,42%)
CF /^ — \ °S' -X,
C15H10F3N3O9S2 497.38 496 (M-H, 68%)
N02
CF, 3. 0 II
^s II-x, ' C10H9F3N2O7S2 390.32 389 (M-H, 92%)
0
(X - C16H14N207S2 410.43 409 (M-H,46%)
II η
0
Xh C14H12N207S2 384.39 383 (M-H,42%)
Figure imgf000142_0001
141 EXAMPLE 81
o -OH
<
\ O" Na
-s o X o
6-Benzoyl-2-(oxalyl-amino)-4.5.6.7-tetrahydro-thieno[2.3-c]pyridine-3-carboxylic acid. mono sodium salt;
A mixture of N-benzoyl-4-piperidone (20.0 g, 0.1 mol), ethyl cyanoacetate (10.9 ml, 0.1 mol), ammonium acetate (2.0 g) and acetic acid (6 ml) in benzene (100 ml) was heated at reflux temperature in a 3-nacked reaction flask equipped with a Dean-Stark water trap for 1 h. The cooled reaction mixture was diluted with ethyl acetate (100 ml) washed with water (3 x 100 ml), saturated aqueous sodium chloride (80 ml), dried (MgS04) filtered and evaporated in vacuo affording quantitative yield of (1-benzoyl-piperidin-4-ylidene)-cyano-acetic acid ethyl ester as a slowly crystallising oil.
A mixture of the above benzoyl-piperidin-4-ylidene (10.0 g, 0.034 mol), sulphur (1.13 g, 0.035 mol), morpholin (6.5 ml) in ethanol (35 ml) was heated at 50 °C for 2 h and stirred at room temperature over night. The precipitate was filtered off and washed with 96 % ethanol (3 x 50 ml), diethyl ether (3 x 50 ml) and dried in vacuo which afforded 9.27 g (84 %) of 2- amino-6-benzoyl-4,5,6,7-tetrahydro-thieno[2,3-c]pyridine-3-carboxylic acid ethyl ester as a solid.
To a stirred solution of the above 4,5,6,7-tetrahydro-thieno[2,3-c]pyridine-3-carboxylic acid ethyl ester (5.0 g, 0.015 mol), triethylamine (4.21 ml, 0.03 mol) in dry tetrahydrofuran (30 ml) at 0 °C was added dropwise a solution of ethyl oxalyl chloride (1.9 ml, 0.017 mol) in dry tetrahydrofuran (20 ml). The resulting reaction mixture was stirred at room temperature for 18 h, pored into ice water (300 ml) and extracted with ethyl acetate (3 x 100 ml). The combined organic extracts were washed with saturated aqueous sodium chloride (100 ml), dried (MgS04) filtered and evaporated in vacuo affording 4.2 g (84 %) of 6-benzoyl-2- (ethoxyoxalyl-amino)-4,5,6,7-tetrahydro-thieno[2,3-c]pyridine-3-carboxylic acid ethyl ester as a crystallising oil. 142
To a solution of the above thieno[2,3-c]pyridine-3-carboxylic acid ethyl ester (4.2 g, 9.76 mmol) in ethanol (100 ml) was added a solution of sodium hydroxide (0.9 g, 21.46 mmol) in water (100 ml). The resulting reaction mixture was stirred at room temperature for 18 h. The volatiles were evaporated in vacuo and the residue dissolved in water (100 ml) and washed with ethyl acetate (2 x 100 ml). To the aqueous phase was added concentrated hydrochloric acid to pH = 1 and the precipitate was filtered off and washed with water (2 x 50 ml), diethyl ether (2 x 30 ml) and dried in vacuo at 50 °C affording 2.9 g (79 %) of the title compound as a solid.
M.p.: Amorph:
Calculated for C^H^NzOβS^a,, 1 x H20 ; C, 49.28 %; H, 3.65 %; N, 6.76%. Found: C, 49.31 %; H, 3.86 %; N, 6.53%.
By a similar procedure as described in Example 81 the following compounds have been prepared.
EXAMPLE 82
o
V-OH
o o 2-(Oxalyl-amino)-4.5.6.7-tetrahydro-benzo[b]thiophene-3-carboxylic acid:
M.p.: 230 - 231 °C:
Calculated for CnHnNOgS; C, 49.07 %; H, 4.12 %; N, 5.20%. Found: C, 49.87 %; H, 4.37 %; N, 5.06%. 143
EXAMPLE 83
o
-OH
Figure imgf000145_0002
(x > -N OH
O hi 0
6-Benzyl-2-(oxalyl-amino 4.5.6.7-tetrahvdro-thieno[2.3-clpyridine-3-carboxylicacid:
Calculated for C17H16N205S, 1.75 H20; C, 52.10 %; H, 5.01 %; N, 7.15 %. Found: C, 52.11 %; H, 4.81 %; N, 7.01 %.
EXAMPLE 84
Figure imgf000145_0001
6-Methyl-2-(oxalyl-amino)-4.5.6.7-tetrahvdro-thieno[2.3-c]pyridine-3-carboxylicacid: M.p.: >250°C Calculated for C^H^N^S, 0.6 H20;
C, 44.77 %; H, 4.51 %; N, 9.49 %. Found: C, 44.54 %; H, 4.17 %; N, 9.21 %.
EXAMPLE 85
-OH
O" aτ
-s X
2-(Oxalyl-amino 4.7-dihydro-5H-thienof2.3-c|pyran-3-carboxylicacid. mono sodium salt:
M.p.:>250°C
Calculated for oHβN SNa, 0.75 x H20; 144 C, 39.16 %; H, 3.12 %; N, 4.57 %. Found: C, 39.29 %; H, 3.67 %; N, 4.41 %.
EXAMPLE 86
Figure imgf000146_0001
2-(Oxalyl-amino06-phenethyl-4.5.6.7-tetrahvdro-thieno[2.3-c]pyridine-3-carboxylic acid:
Calculated for C18H18N205S, 1 x H20; C, 55.09 %; H, 5.14 %; N, 7.14 %. Found: C, 55.47 %; H, 5.04 %; N, 7.07 %. EXAMPLE 87
Figure imgf000146_0002
2-(Oxalyl-amino)-4.5,6.7-tetrahydro-4.7-ethano-thieno[2,3-b]pyridine-3-carboxylic acid:
Calculated for C12H12N205S, 0.75 x H2O; C, 46.52 %; H, 4.39 %; N, 9.04 %. Found: C, 46.48 %; H, 4.79 %; N, 8.87 %. 145
EXAMPLE 88
Figure imgf000147_0001
tt p o cι 0 OH
2-(Oxalvl-amino .5.6.7-tetrahvdro-thieno_2.3-c]pyridine-3-πarboxylic acid. hydrochloride:
4-Oxo-l -piperidine carboxylic acid tert-butyl ester was used as starting material. The Boc- group was removed using 25 % trifluoroacetic acid in dichloromethane. M.p.: > 250 °C
Calculated for C10H10N2O5S, 1 HCl, 0.5 x H20; C, 38.35 %; H, 4.34 %; N, 8.64 %. Found: C, 38.04 %; H, 3.83 %; N, 8.87 %.
EXAMPLE 89
" OH
^N'
Figure imgf000147_0002
2-(Oxalyl-amino 6-pyridin-2-ylmethyl-4.5.6.7-tetrahvdro-thienof2.3-clpyridine-3-carboxylic acid;
To a mixture of 2-(ethoxyoxalyl-amino)-4,5,6,7-tetrahydro-thieno[2,3-c]pyridine-3-carboxylic acid ethyl ester trifluoroacetic acid salt (1.5 g, 3.40 mmol), potassium carbonate (2.4 g, 17.1 mmol), potassium iodine (100 mg) in acetone (40 ml) was added 2-picolyl chloride hydrochloride (0.61 g, 3.7 mmol). The resulting mixture was stirred at reflux temperature for 18 h, filtered and evaporated in vacuo. The residue was trituated with diethyl ether and the solid was filtered off and purified on silicagel (300 ml) using a mixture of ethyl ace- 146 tate/ethanol/triethyl amine (3:1 :0.4) as eluent. Pure fractions were collected and the eluent evaporated in vacuo affording 650 mg (39 %) of 2-(ethoxyoxalyi-amino)-6-pyridin-2-ylmethyl- 4,5,6,7-tetrahydro-thieno[2,3-c]pyridine-3-carboxylic acid triethyl ammonium salt as a solid.
To a solution of the above triethyl ammonium salt (650 mg, 1.40 mmol) in ethanol (15 ml) was added 1 N aqueous sodium hydroxide (4.1 ml, 4.1 mmol) followed by water (15 ml). The resulting reaction mixture was stirred at room temperature for 18 h. The volatiles were evaporated in vacuo and the residue dissolved in water (20 ml) and washed with diethyl ether (2 x 10 ml). To the aqueous phase was added 1 N hydrochloric acid to pH = 1 and the aqueous phase was evaporated in vacuo. The residue was suspended in a mixture of 2- propanol/water (1 :1 , 40 ml), stirred for 1 h., the solid filtered off and washed with 2-propanol (2 x 15 ml) and dried in vacuo at 50 °C affording 181 mg (38 %) of crude title compound. The crude product (181 mg) was dissolved in a mixture of water (10 ml) and5 N sodium hydroxide (10 ml) and washed with diethyl ether (2 x 10 ml). The aqueous phase was acidified to pH = 3 with 1 N hydrochloric acid and the precipitate filtered off and washed with water (3 x 20 ml), dried in vacuo at 50 °C for 18 h which afforded 51 mg (11 %) of the title compound as a solid.
M.p.: 238 - 244 °C
Calculated for C16H15N305S, 2.5 x H20; C, 47.29 %; H, 4.96 %; N, 10.34 %. Found: C, 47.43 %; H, 4.84 %; N, 10.00 %.
By a similar procedure as described in Example 89 the following compounds were prepared.
147
EXAMPLE 90
OH
Figure imgf000149_0001
Figure imgf000149_0002
0 x o 6-(3-Methoxy-benzyl)-2-(oxalyl-amino)-4.5.6.7-tetrahydro-thieno[2.3-c]pyridine-3-carboxylic acid:
M.p.: 233 - 237 °C
Calculated for C18H18N206S, 1 x H20; C, 52.93 %; H, 4.94 %; N, 6.86 %. Found: C, 52.79 %; H, 4.99 %; N, 6.42 %.
EXAMPLE 91
OH
-s X cr ° 0H
2-(Oxalyl-amino)-6-pyridin-3-ylmethyl-4.5.6.7-tetrahydro-thieno[2.3-c]pyridine-3-carboxylic acid, hydrochloride:
M.p.: 234 - 238 °C
Calculated for C16H15N305S, 1 x HCl, 0.5 x H20; C, 47.24 %; H, 4.21 %; N, 10.33 %. Found: C, 47.35 %; H, 4.10 %; N, 10.35 %. 148
EXAMPLE 92
Figure imgf000150_0001
2-(Oxalyl-amino)-6-quinolin-2-ylmethyl-4.5.6.7-tetrahydro-thieno[2.3-c]pyridine-3-carboxylic acid:
M.p.: > 250 °C
Calculated for C20H17N3O5S, 1 x H2O; C, 55.95 %; H, 4.22 %; N, 9.61 %. Found: C, 55.94 %; H, 4.46 %; N, 9.78 %.
EXAMPLE 93
Figure imgf000150_0002
2-(Oxalyl-amino)-6-pyridin-4-ylmethyl-4.5.6.7-tetrahvdro-thieno[2.3-c]pyridine-3-carboxylic acid, hydrochloride:
M.p.: 230 - 235 °C
Calculated for C16H15N305S, 1 x HCl, 1 x H20; C, 46.21 %; H, 4.36 %; N, 10.10 %. Found: C, 45.82 %; H, 4.42 %; N, 10.02 %. 149 EXAMPLE 94
u HO u^S o
0 O Na
6-(Oxalyl-amino)-1 H-indole-7-carboxylic acid, mono sodium salt:
To a stirred solution of 6-amino-1H-indole-7-carboxylic acid ethyl ester (1.5 g, 7.3 mmol, prepared as described in J Org. Chem. 61 , 1155-1158 (1996)), triethylamine (1.55 ml, 11.0 mmol) in dry tetrahydrofuran (100 ml) at 0 °C was added dropwise a solution of ethyl oxalyl chloride (980 ul, 88.0 mmol) in dry tetrahydrofuran (10 ml). The resulting reaction mixture was stirred at room temperature for 2 h. pored into ice water (300 ml) and the precipitate filtered off and dried in vacuo at 50 °C affording 2.25 g (100 %) of 6- (ethoxyoxalyl-amino)-1H-indole-7-carboxylic acid ethyl ester as an oil. To a solution of the above 1 H-indole-7-carboxylic acid ethyl ester (2.0 g, 6.60 mmol) in etha- nol (30 ml) was added 1 N aqueous sodium hydroxide (16.4 ml, 16.4 mmol) in water (30 ml). The resulting reaction mixture was stirred at room temperature for 18 h. The volatiles were evaporated in vacuo and to the residual aqueous phase was added 1 N hydrochloric acid to pH = 1. The precipitate was filtered off and washed with water (2 x 50 ml), diethyl ether (2 x 30 ml) and dried in vacuo at 50 °C affording 1.34 g (82 %) of the title compound as a solid.
M.p.: > 250 °C
Calculated for CnH^ -Na, 1.5 x H20; C, 44.46 %; H, 3.39 %; N, 9.43 %. Found: C, 44.31 %; H, 3.34 %; N, 9.00 %.
By a similar procedure as described in Example 94 the following compound was prepared. 150
EXAMPLE 95
Figure imgf000152_0001
6-(Qxalyl-amino)-1 H-indole-5-carboxylic acid, mono sodium salt:
6-amino-1 H-indole-5-carboxylic acid ethyl ester was prepared as described in J Org. Chem. 61 , 1155-1158 (1996)).
M.p.: > 250 °C
Calculated for CnH^OsNa, 1.5 x H20; C, 44.46 %; H, 3.39 %; N, 9.43 %. Found: C, 44.44 %; H, 3.68 %; N, 9.00 %.
EXAMPLE 96
Figure imgf000152_0002
3-[4-(3-Morpholin-4-yl-propionvn-piperazin-1-ylmethyl1-6-(oxalyl-amino 1 H-indole-5- carboxylic acid, mono sodium salt:
To a ice cooled solution of 37 % aqueous formaldehyde (2.7 g, 33.0 mmol) in acetic acid (8 mi) was added dropwise a solution of piperazine-1 -carboxylic acid tert-butyl ester (2.7 g, 15 mmol). After stirring for 15 min. a solution of 6-(ethoxyoxalyl-amino)-1H-indole-5-carboxylic acid (4.0 g, 13.0 mmol) in a mixture of acetic acid (80 ml) and tetrahydrofuran (80 ml) was added and the resulting reaction mixture was stirred for 18 h. at room temperature. The volatiles were evaporated in vacuo and to the residue was added water (100 ml). The aqueous phase was extracted with ethyl acetate (2 x 100 ml), the combined organic extracts were 151 washed with water (2 x 100 ml), saturated aqueous ammonium chloride (1 x 80 ml), dried (MgS04), filtered and evaporated in vacuo. The residue was trituated with diethyl ether (50 ml) and the precipitate was filtered off and washed with diethyl ether, dried in vacuo at 50°C which afforded 3.4 g (51 %) of 3-(4-tert-butoxycarbonyl-piperazin-1-ylmethyl)-6- (ethoxyoxalyl-amino)-l H-indole-5-carboxylic acid ethyl ester as a solid.
To a solution of the above 6-(ethoxyoxalyl-amino)-1 H-indole-5-carboxylic acid ethyl ester in dichloromethane (20 ml) was added trifluoroacetic acid (20 ml) at room temperature. The resulting mixture was stirred for 1 h., the volatiles were evaporated in vacuo and to the resi- due was added water (50 ml) and the resulting mixture was stirred for ! h. The precipitate was filtered off and washed with water (50 ml), diethyl ether (50 ml) and in vacuo at 50 °C which afforded 3.6 g (100 %) of 6-(ethoxyoxalyl-amino)-3-piperazin-1-ylmethyl-1 H-indole-5- carboxylic acid ethyl ester trifluoroacetic acid salt as a solid.
To a ice cooled mixture of the above piperazin (3.0 g, 5.81 mmol) in dichloromethane (100 ml) and triethylamine (2.5 ml) was added dropwise a mixture of chloropropionyl chloride (0.6 ml, 6.39 mmol) in dichloromethane (10 ml). The resulting mixture was stirred for 1 h. at room temperature, washed with water (50 ml), dried (MgS04), filtered and evaporated in vacuo affording 1.8 g (68 %) of 3-(4-acryloyl-piperazin-1-ylmethyl)-6-(ethoxyoxalyl-amino)-1 H- indole-5-carboxylic acid ethyl ester as a oil.
To a solution of the above acryloyl-piperazin (0.5 g, 1.1 mmol) in ethanol (50 ml) was added morpholin (0.24 g, 2.74 mmol). The resulting mixture was stirred at reflux temperature for 18 h. and the volatiles were evaporated in vacuo. The residue was dissolved in water (50 ml), pH was adjusted to 2 with 1 N hydrochloric acid and washed with ethyl acetate (2 x 50 ml). The aqueous phase was neutralised with 1 N sodium hydroxide, the precipitate was filtered off, washed with water and dried in vacuo at 50 °C for 3h which afforded 0.3 g (50 %) of 6- (ethoxyoxalyl-amino)-3-[4-(3-morpholin-4-yl-propionyl)-piperazin-1-ylmethyl]-1 H-indole-5- carboxylic acid ethyl ester as a solid.
To a solution of the above 1 H-indole-5-carboxylic acid ethyl ester (0.2 g, 0.37 mmol) in ethanol (5 ml) was added sodium hydroxide (45 mg, 1.10 mmol) in water (15 ml). The resulting reaction mixture was stirred at room temperature for 18 h, pH adjusted to 1 by addition of 1N 152 hydrochloric acid. The aqueous phase was washed with ethyl acetate (2 x 25 ml) and pH adjusted to 5 by addition of 1 N sodium hydroxide, followed by addition of dichloromethane (25 ml). The precipitate was filtered off and washed with water (50 ml) and dried in vacuo at 50 °C affording 30 mg (17 %) of the title compound as a solid.
M.p.: > 250 °C LC-MS (E+) M/Z 488
EXAMPLE 97
o
O-H
Figure imgf000154_0001
1 -(3-Methoxy-benzyl)-6-(oxalyl-amino)-1 H-indole-5-carboxylic acid: To a solution of 6-amino-1 H-indole-5-carboxylic acid ethyl ester (1.0 g, 3.3o mmol; prepared as described in J Org. Chem. 61 , 1155-1158 (1996)) in dry N,N-dimethylformamide (40 ml) was added sodium hydride (0.28 g, 7.3 mmol; 60 % in mineral oil). The reaction mixture was stirred for 1.5 h and a solution of 3-methoxybenzylchloride (0.5 ml, 3.6 mmol) in dry N,N- dimethylformamide (2.5 ml) was added dropwise. The resulting reaction mixture was stirred for 1.5 h, poured into water (300 ml) and washed with diethyl ether (3 x 100 ml). Undissolved matter was filtered off and the aqueous phase was acidified to pH = 4 by addition of 1N hydrochloric acid. The precipitate was filtered off and washed with water, dried in vacuo at 50 °C affording 400 mg (29 %) of 6-(ethoxyoxalyl-amino)-1-(3-methoxy-benzyl)-1 H-indole-5- carboxyiic acid ethyl ester as a solid.
To a solution of the above 1H-indole-5-carboxylic acid ethyl ester (0.3 g, 0.7 mmol) in ethanol (10 ml) was added 1 N sodium hydroxide (2.1 ml, 2.1 mmol) and water (10 ml). The resulting reaction mixture was stirred at room temperature for 18 h. The volatiles were evaporated in vacuo, pH adjusted to 2 by addition of 1N hydrochloric acid, the precipitate filtered 153 off and washed with water, dried in vacuo at 50 °C affording 230 mg (89 %) of the title com¬ pound as a solid. M.p.: 222 - 226 °C
Calculated for C19H16N206, 0.4 x H20; C, 60.77 %; H, 4.51 %; N, 7.46 %. Found: C, 60.96 %; H, 4.44 %; N, 7.28 %.
By a similar procedure as described in Example 81 the following compound was prepared.
EXAMPLE 98
o
Figure imgf000155_0001
O X OH
2-(Oxalyl-amino)-4.7-dihydro-5H-thieno[2.3-c1thiopyran-3-carboxylic acid:
Calculated for C10H9NO5S2;
C, 41.80 %; H, 3.16 %; N, 4.88 %. Found:
C, 41.97 %; H, 3.20 %; N, 4.69 %.
EXAMPLE 99
Figure imgf000155_0002
θ" Naτ
2-(Oxalyl-amino)-9H-thieno[2.3-c]chromen-3-carboxylic acid, mono sodium salt To a solution of 4-cromanone (20 g, 0.14 mol), ethyl cyanoacetate (16.8 g, 0.15 mol) and ammonium acetate (11.4 g, 0.15 mol) in benzene (500 ml) was added acetic acid (5 ml), the 154 resulting reaction mixture was heated at reflux temperature for 18 h and the formed water was collected in a Dean-Stark water trap. An additional portion of ammonium acetate (10 g, 0.13 mol) was added and heating at reflux temperature was continued for an additional 8 h. The volatiles were evaporated in vacuo. to the residue was added water (500 ml) and the aqueous phase was extracted with ethyl acetate (2 x 200 ml). The combined organic extracts were washed with water (2 x 100 ml), saturated aqueous sodium chloride (100 ml), dried (MgS04), filtered and evaporated in vacuo afforded 28 g of a 1 :1 mixture of unchanged starting material and chroman-4-ylidene-cyano-acetic acid ethyl ester as an oil. To a solution of the crude product in ethanol (250 ml) was added sulphur (2.5 g, 0.08 mol) and morpholin (15 ml). The resulting reaction mixture was stirred at 50 °C for 4 h cooled to room temperature and filtered. The volatiles were evaporated in vacuo affording 30 g of crude product.
The product was divided into two portions which was semi purified on silica gel (900 ml) using a mixture of ethyl acetate/heptane (1 :3). Semi pure fractions were collected and the sol- vent evaporated in vacuo affording a crude oil which was dissolved in diethyl ether (80 ml) and crystallised by addition of heptane (125 ml). The precipitated was filtered off, washed with heptane and dried in vacuo at 50 °C for 18 h affording 8.9 g (24 %) of 2-amino-9H- thieno[2,3-c]chromen-3-carboxylic acid ethyl ester as a solid.
To a stirred solution of the above 2-amino-6H-thieno[2,3-c]chromen-3-carboxylic acid ethyl ester (2.9 g, 10.53 mmol), triethylamine (3 ml) in dry tetrahydrofuran (100 ml) at 0 °C was added dropwise a solution of ethyl oxalyl chloride (1.6 g, 11.6 mmol) in dry tetrahydrofuran (20 ml). The resulting reaction mixture was stirred at room temperature for 1.5 h. pored into ice water (200 ml) and the precipitate filtered off and dried in vacuo at 50 °C affording 2.6 g (66 %) of 2-(ethoxyoxalyl-amino)-9H-thieno[2,3-c]chromen-3-carboxylic acid ethyl ester as a solid.
To a solution of the above ethyl ester (1.5 g, 4.0 mmol) in ethanol (25 ml) was added sodium hydroxide (480 mg, 12 mmol) and water (50 ml). The resulting reaction mixture was stirred at room temperature for 42 h. Water (100 ml) was added and the mixture was washed with diethyl ether (100 ml). pH of the aqueous phase was adjusted to 1 by addition of concentrated hydrochloric acid, the precipitate was filtered off, washed with water and dried in vacuo at 50 °C for 6 h affording 0.6 g (47 %) of the title compound as a solid. 155
M.p.: 227 - 228 °C
Calculated for C14H9N06SNa, 0.5 H20;
C, 48.01 %; H, 2.59 %; N, 4.00 %. Found:
C, 48.39 %; H, 2.93 %; N, 3.93 %.
EXAMPLE 100
o
^OH n °^rs^H yc N-NH
Figure imgf000157_0001
O N-N 2-((2-H-Tetrazol-5-carbonyl)amino)-4.7-dihydro-5H-thieno[2.3-c]pyran-3-carboxylic acid: To a mixture of N,N-dimethylformamide (1.6 ml) and acetonitrile (5 ml) cooled to -20 °C was added dropwise a mixture of oxalyl chloride (0.8 g, 6.31 mmol) in acetonitrile (1 ml). The resulting mixture was stirred for 15 min. and tetrazole-5-carboxylic acid dipotassium salt (1 g, 5.25 mmol, prepared as described in J Med. Chem. 29, 538-549 (1986) ) was added and the resulting mixture was stirred for an additional 20 min. To the mixture was added dropwise a solution of 2-amino-4,5-dihydro-7H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (1.3 g, 5.25 mmol), pyridine (2.2 ml) and acetonitrile (2.5 ml) during 10 min. The reaction mixture was allowed to reach room temperature where after it was heated at reflux temperature for 0.5 h. The cooled reaction mixture was pored into water (100 ml) and pH was adjusted to 1 by addition of concentrated hydrochloric acid. The precipitate was filtered off, washed with heptane and dried in vacuo at 50 °C for 18 h affording 1.3 g (70 %) of 2-((1 H- tetrazole-5-carbonyl)-amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as a solid. The above tert-butyl ester (0.6 g, 1.71 mmol) was dissolved in dichloromethane (5 ml) and trifluoroacetic acid (5 ml) was added. The resulting mixture was stirred for 40 min. at room temperature. The volatiles were evaporated in vacuo and to the residue was added diethyl ether (50 ml), water (25 ml) and 1 N sodium hydroxide (2 ml). The phases were separated and the aqueous phase was washed with diethyl ether (50 ml) and pH was adjusted to 1 by addition of concentrated hydrochloric acid. The precipitate was filtered off, washed with wa- ter (25 ml) and dried in vacuo at 50 °C for 18 h which afforded 190 mg (38 %) of the title compound as a solid. 156 M.p.: > 250 °C
Calculated for C10H9N5O4S, 0.25 x H20; C, 40.07 %; H, 3.19 %; N, 23.36 %. Found: C, 40.39 %; H, 3.18 %; N, 22.92 %.
EXAMPLE 101
Na
Figure imgf000158_0001
Na
N-(3-(2H-Tetrazol-5-yl)-4,7-dihydro-5H-thieno[2.3-c]pyran-2-yπoxalamic acid, di sodium salt
2-Amino-4,5-dihydro-7H-thieno[2,3-c]pyran-3-carboxylic acid ethyl ester (26 g, 0.114 mol) was dissolved in formamide (200 ml) and the resulting mixture was heated at reflux temperature for 1.5 h. After cooling to room temperature the precipitate was filtered off, washed with water (2 x 80 ml) and dried in vacuo at 50 °C for 18 h which afforded 10.0 g (42 %) of 5,6-dihydro-8H-pyrano[4',3':4,5]thieno[2,3-d]pyrimidin-4-one as a solid.
To phosphorus oxychloride (70 ml) was added the above pyrimidin-4-one (7.0 g, 0.04 mol) and N,N-dimethylaniline (0.2 ml). The resulting mixture was heated at reflux temperature for 2 h, cooled and pored onto ice water (700 ml). The precipitate was filtered off, suspended in a mixture of ethyl acetate (400 ml) and water (250 ml) and stirred for 15 min. The aqueous phase was separated off and the organic phase was washed with saturated aqueous sodium chloride (100 ml), dried (MgS04), filtered and evaporated in vacuo which afforded 5.2 g (68 %) of 4-chloro-5,6-dihydro-8H-pyrano[4',3':4,5]thieno[2,3-d]pyrimidine as a solid.
To a warm solution of the above thieno-pyrimidine (4.5 g, 0.02 mol) in ethanol (40 ml) was added dropwise a solution of hydrazine hydrate (10.0 ml) in ethanol (20 ml). The resulting solution was heated at reflux temperature for 2 h, cooled to room temperature, the precipitate filtered off, washed with ethanol (20 ml) and dried in vacuo at 50 °C for 1.5 h affording 157 3.2 g (73 %) of 5,6-dihydro-8H-pyrano[4',3':4,5]thieno[2,3-d]pyrimidin-4-yl hydrazine as a solid.
To a solution of the above hydrazine (3.0 g, 0.014 mol) in 50 % aqueous acetic acid (100 ml) cooled in a ice bath was added dropwise a solution of sodium nitrite (1.0 g, 0.015 mol) in water (10 ml). The reaction mixture was stirred for 2 h, the precipitate filtered off, washed with water (25 ml) and dried in vacuo at 50 °C for 1 h affording 3.0 g (95 %) of 10,11- dihydro-8H-pyrano[4',3':4,5]thieno[3,2-e]tetrazolo[5,1-c]pyrimidine as a solid.
To a solution of the above tetrazol (2.5 g, 0.011 mol) in dioxane (30 ml) was added dropwise 1 N sodium hydroxide (25 ml). The reaction mixture was stirred for 3 h, pored into ice cooled water (100 ml) and pH was adjusted to 4 by addition of acetic acid. The precipitate was filtered off, washed with water (25 ml) and dried in vacuo at 50 °C for 18 h affording 2.2 g (82 %) of N-(3-(2H-tetrazol-5-yl)-4,7-dihydro-5H-thieno[2,3-c]pyran-2-yl)formamide as a solid.
The above formamide (0.6 g, 2.7 mmol) was dissolved in dry tetrahydrofuran (50 mi) and triethylamine (1 ml) was added. To the resulting mixture cooled in a ice bath was added dropwise a solution of ethyl oxalylchloride (0.4 g, 2.96 mmol) in dry tetrahydrofuran (5 ml). The resulting reaction mixture was stirred for 2 h at room temperature, the volatiles were evaporated in vacuo. To the residue was added water (50 ml), diethyl ether (50 ml) and 1 N hydrochloric acid to pH = 2 and a small precipitate was filtered off. The organic phase was separated, dried (Na2S04), filtered and evaporated in vacuo. The residue (0.4 g) was suspended in dichloromethane (20 ml) and stirred for 1 h, the solid matter was filtered off and dried in vacuo at 50 °C affording 0.16 g (18 %) of N-(3-(2H-tetrazol-5-yl)-4,7-dihydro-5H- thieno[2,3-c]pyran-2-yl)oxalamic acid ethyl ester as a solid.
To a solution of the above oxalamic acid ethyl ester (0.16 g, 0.49 mmol) in ethanol (15 ml) was added 1 N sodium hydroxide (1.0 ml, 1.01 mmol). The resulting reaction mixture was stirred at room temperature for 2 h. The precipitate was filtered off and washed with ethanol (10 ml), dried in vacuo at 50 °C for 48 h affording 140 mg (83 %) of the title compound as a solid.
M.p.: > 250 °C
Calculated for C10H9N5O4SNa2, 3 x H20; 158 C, 30.54 %; H, 3.33 %; N, 17.81 %. Found: C, 30.70 %; H, 3.35 %; N, 17.49 %.
By a similar procedure as described in Example 81 the following compounds were prepared.
EXAMPLE 102
O
T -OH /°γ N-^ O
Figure imgf000160_0002
O i ~ ° OH 2-(Oxalyl-amino)-4.7-dihydro-5H-thieno[2.3-c]pyridine-3.6-dicarboxylic acid 6-benzyl ester
M.p.: >250 °C
Calculated for C18H16N207S; C, 53.46 %; H, 3.99 %; N, 6.93 %. Found: C, 53.44 %; H, 4.15 %; N, 6.69 %.
EXAMPLE 103
Figure imgf000160_0001
H
,0 N . ■s
O OH
2-(Oxalyl-amino)-4.7-dihydro-5H-thieno[2.3-c1pyridine-3.6-dicarboxylic acid 6-ethyl ester
M.p.: 245 - 247 °C Calculated for C13H14N2O7S; C, 45.61 %; H, 4.12 %; N, 8.18 %. Found: C, 45.71 %; H, 4.31 %; N, 7.86 %. 159 EXAMPLE 104
Figure imgf000161_0001
0 OH
6-Acetyl-2-(oxalyl-amino)-4.5.6.7-tetrahydro-thieno[2.3-c]pyridine-3-carboxylic acid
M.p.: 242 - 244 °C
Calculated for Cl2H12N206S, 0.25 x H20; C, 45.50 %; H, 3.98 %; N, 8.84 %. Found: C, 45.64 %; H, 3.97 %; N, 8.51 %.
EXAMPLE 105
o
C-OH
H X O OH 2-(Oxalyl-amino)-6-phenylcarbamoylmethyl-4.5.6.7-tetrahydro-thieno[2.3-c]pyridine-3- carboxylic acid
M.p.: 244 - 246 °C
Calculated for C18H17N306S, 1 x H20; C, 51.30 %; H, 4.54 %; N, 9.97 %. Found: C, 51.08 %; H, 4.52 %; N, 9.63 %.
EXAMPLE 106
Figure imgf000161_0002
160 5-(1.3-Dioxo-1.3-dihvdro-isoindol-2-ylmethyl.-2-(oxalyl-amino)-4.7-dihvdro-5H-thienof2.3- c]pyran-3-carboxylic acid:
To a mixture of benzyloxyacetaldehyde (8.3 g, 0.06 mol) in benzene (80 mL) was added 1- methoxy-3-trimethylsilyloxy-1 ,3-butadiene (10.6 g, 0.06 mol). The reaction mixture was stirred under nitrogen for 15 min., cooled to 0 °C and a solution of 0.5 M zinc chloride (55 ml, 0.03 mol) was added dropwise. The reaction mixture was allowed to warm to room temperature over 16 h and evaporated in vacuo. The resultant oil was diluted with ethyl acetate (100 ml), washed with 1 N hydrochloric acid (3 x 50ml), saturated sodium bicarbonate (3 x 50 ml), brine (3 x 50 ml), dried (MgS04) and evaporated in vacuo. The resulting oil was subjected to flash chromatography using a mixture of ethyl acetate/hexanes (1 :2) as eluent. Pure fractions were collected affording after evaporation in vacuo 7.1 g (60 %) of benzyloxy- methyl-2,3-dihydro-pyran-4-one as an oil. 1H NMR (400 MHz, CDCI3) δ 7.39 - 7.31 (m, 6H), 5.42 (dd, J = 6,1 Hz, 1 H), 4.61 (d, J = 3 Hz, 1 H), 4,57 (m, 1 H), 3.70 (m, 2H), 2.74 (dd, J = 17 Hz, 14 Hz, 1 H), 2.41 (ddd, J = 17 Hz, 2 Hz, 1 Hz, 1 H).
The above 2,3-dihydro-pyran-4-one (7.1 g, 0.032 mol) and 10 % palladium on carbon (0.4 g) in ethyl acetate (50 ml) were placed in a Parr bomb shaker and hydrogenated at 30 psi. The reaction mixture was shaken for 2 h, at which time TLC analysis (methanol/dichloromethane 1 :9) indicated the reaction was complete. The reaction mixture was filtered through a pad of Celite and the volatiles evaporated in vacuo. The residue was subjected to flash column chromatography using ethyl acetate as eluent. Pure fractions were collected affording after evaporation in vacuo 3.0 g (75 %) of 2-hydroxymethyl-tetrahydro-pyran-4-one as an oil. 1H NMR (400 MHz, CDCI3) δ 4.36 - 4.29 (m, 1 H), 3.77 - 3.66 (m, 3H), 3.61 - 3.54 (m, 1 H), 2.65 - 2.43 (m, 2H), 2.34 - 2.27 (m, 2H), 2.04 (bs, 1 H, CH2OH).
The above tetrahydro-pyran-4-one (1.90 g, 0.015 mol), tert-butyl cyanoacetate (2.7 g, 0.019 mol), sulfur (0.51 g, 0.016 mol) and morpholine (2.55 ml, 0.03 mol) were dissolved in abso- lute ethanol (20 ml), and heated to 50 °C for 16 h. The reaction mixture was cooled, filtered and the filtrate evaporated in vacuo. The resultant oil was dissolved in ethyl acetate (50 ml), washed with water (2 x 50 ml), brine (2 x 50 m) and dried (MgS04). The solvent was evaporated in vacuo and the residue was subjected to flash column chromatography using ethyl acetate/hexanes (1 :1) as eluent. Pure fractions were collected affording after evaporation in 161 vacuo 3.7 g (90 %) of 2-amino-5-hydroxymethyl-4,7-dihydro-5H-thieno[2,3-c]pyran-3- carboxylic acid tert-butyl ester as a solid.
1H NMR (400 MHz, CDCI3) δ 4.64 (s, 2H), 3.80 - 3.67 (m, 3H), 2.77 - 2.72 (m, 1 H), 2.57 - 2.53 (m, 1 H), 1.54 (s, 9H).
The above carboxylic acid tert-butyl ester (3.0 g, 0.015 mol), phthalimide (2.10 g, 0.014 mol) and triphenylphosphine (3.68 g, 0.014) were dissolved in dry tetrahydrofuran (60 ml) and cooled to 0 °C under a nitrogen atmosphere. Diisopropyl azodicarboxylate (DIAD) (2.71 ml, 0.014 mol) was added dropwise at 0 °C and the solution allowed to stir overnight, slowly warming to room temperature. The volatiles were evaporated in vacuo and the resultant solid dissolved in ethyl acetate (60 ml). The organic phase was washed with brine (2 x 50 ml), dried (MgS04) and evaporated in vacuo. The residue was subjected to flash column chromatography initially eluted with a mixture of ethyl acetate/hexanes (1 :3). Once the product began to elute, the eluent mixture was switched to ethyl acetate/hexanes (1 :2). Pure fractions were collected affording after evaporation in vacuo 2.90 g (47 %) of 2-amino-5-(1 ,3- dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as a solid.
1H NMR (400 MHz, CDCI3) δ 7.87 - 7.85 (m, 2H), 7.83 - 7.71 (m, 2H), 5.94 (bs, 2H), 4.59 (d, J = 14 Hz, 1 H), 4.52 (d, J = 14 Hz, 1 H), 4.0 - 3.98 (m, 2H), 3.83 - 3.79 (m, 1 H), 2.87 (d, J = 17 Hz, 1 H), 2.58 (dd, J = 17 Hz, 9 Hz, 1 H), 1.50 (s, 9H).
To the above 4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert butyl ester (0.5 g, 1.2 mmol) dissolved in dichloromethane (5 mi), was added triethylamine (0.33 ml, 2.4 mmol) and imidazol-1-yl-oxo-acetic acid tert butyl ester (0.47 g, 2.4 mmol) under nitrogen. The reaction mixture was allowed to stir at room temperature for 18 hours. The volatiles were evaporated in vacuo and the solid residue dissolved in ethyl acetate (20 ml). The organic phase was washed with 1 % hydrochloric acid (2 x 10 ml), brine (2 x 10 ml), dried (MgS04). The organic phase was evaporated in vacuo affording 0.64 g (99 %) of 2-(tert-butoxyoxalyl-amino)-5- (1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as a solid.
1H NMR (400 MHz, CDCI3) δ 12.48 (s, 1 H, NHCO), 7.88 - 7.86 (m, 2H), 7.74 - 7.72 (m, 2H), 4.78 (d, J = 19 Hz, 1 H), 4.65 (d, J = 19 Hz, 1 H), 4.07 -3.90 (m, 2H), 3.88 - 3.80 (m, 1 H), 2.97 (d, J = 17 Hz, 1 H), 2.68 (dd, J = 17 Hz, 9 Hz, 1 H), 1.58 (s, 9H), 1.54 (s, 9H). 162
The above di-tert-butyl ester (2.8 g, 5.16 mmol) was dissolved in a mixture of trifluoroacetic acid and dichloromethane (1 :5) (36 ml). The reaction was stirred at room temperature for 6 hr. The precipitate was filtered off, washed with diethyl ether, dried in vacuo at 50 °C which afforded 1.26 g (57 %) of the title compound as a solid.
M.p.: 245.2 - 245.6 °C.
Η NMR (300 MHz, DMSO-d6) δ 12.32 (s, 1 H, NHCO), 7.95 - 7.80 (m, 4H), 4.75 (d, J = 20 Hz, 1H), 4.62 (d, J = 20 Hz, 1H), 3.96 - 3.69 (m, 3H), 3.01 (d, J = 18 Hz, 1H), 2.60 (dd, J = 18 Hz, 9 Hz, 1 H).
Calculated for C19H14N208S;
C, 53.02 %; H, 3.28 %; N, 6.51 %. Found:
C, 53.01 %; H, 3.31 %; N, 6.41 %.
EXAMPLE 107
o
NH
Figure imgf000164_0001
Figure imgf000164_0002
C O OH
5-(Benzoylamino-methyl)-2-(oxalyl-amino)-4J-dihvdro-5H-thieno[2.3-c]pyran-3-carboxylic acid
2-(tert-Butoxyoxalyl-amino)-5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H- thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (0.33 g, 0.60 mmol) was dissolved in a solution of ethanol (2 ml) and dichloromethane (3 ml). Hydrazine (28 μl, 0.9 mmol) was added and the reaction stirred under nitrogen at room temperature for 24 h. TLC analysis indicated that starting material was still present. An additional portion of hydrazine (28 μl, 0.9 mmol) was added and the reaction stirred at room temperature for another 16 h, then at 45 °C for 5 h. The mixture was concentrated in vacuo. redissolved in dichloromethane and the insoluble material filtered off. The filtrate was collected and concentrated in vacuo affording 163 crude 5-aminomethyl-2-(tert-butoxyoxalyl-amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3- carboxylic acid tert-butyl ester as a solid, which was carried through to the next step without further purification.
The above crude 5H-thieno[2,3-c]pyran-3-carboxyiic acid tert-butyl ester (0.25 g, 0.60 mmol) was suspended in a mixture of dichloromethane and acetonitrile (1 :1 , 5 ml). Triethylamine (0.25 ml, 1.8 mmol) was added followed by 1-hydroxy-benzotriazole hydrate (0.10 g, 0.72 mmol) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.14 g, 0.72 mmol) as solids. The heterogeneous reaction mixture was allowed to stir at room temperature for 2 days, after which the mixture was homogenous. The solvents were evaporated in vacuo. the residue dissolved in dichloromethane washed twice with 1M hydrochloric acid, then with saturated sodium bicarbonate. The organic phase was dried (Na2S04), filtered and concentrated in vacuo affording a solid which was purified by flash chromatography using a mixture of ethyl acetate and hexanes (1 :1) as eluent. Pure fractions were collected and evaporated in vacuo affording 50 mg (16 % over two steps) of 5-(benzoyiamino-methyl)-2-(tert- butoxyoxalyl-amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxyiic acid tert-butyl ester as a solid.
Η NMR (400 MHz, CDCI3) δ 12.46 (s, 1 H), 7.81 (d, J = 7 Hz, 2 H), 7.51 -7.42 (m, 3H), 6.72 (bs, 1 H), 4.83 (d, J = 17 Hz, 1 H), 4.74 (d, J = 17 Hz, 1 H), 4.05 - 3.98 (m, 1 H), 3.86 - 3.78 (m, 1 H), 3.45 - 3.38 (m, 1 H), 2.97 (d, J = 19 Hz, 1 H), 2.68 (dd, J = 19 Hz, 9 Hz, 1 H), 1.61 (s, 9H), 1.58 (s, 9H).
The above benzoylamino-methyl-thieno[2,3-c]pyran (40 mg, 0.078 mmol) was treated with 20 % trifluoroacetic acid in dichloromethane (2 ml) for 4 h. The volatiles were evaporated in vacuo and chased twice with dichloromethane, forming a precipitate which was filtered off and dried yielding 30 mg (95 %) of the title compound as a solid.
1H NMR (400 MHz, DMSO-d6) δ 12.31 (s, 1 H), 8.63 (t, J = 4 Hz, 1 H), 7.86 (d, J = 7 Hz, 2H), 7.51 - 7.43 (m, 3H), 4.80 (d, J = 17 Hz, 1 H), 4.64 (d, J = 17 Hz, 1 H), 3.82 (m, 1 H), 3.44 (m, 2H), 2.95 (d, J = 18, 1 H), 2.52 (dd, J = 18 Hz, 9 Hz, 1 H). LC/MS [M-H]: 403.39.
HPLC (254.4nm): 2.99 s, 84 %. 164
EXAMPLE 108
0 nø? V -OH
Figure imgf000166_0001
σ X ~ OH
5-Benzoyloxymethyl-2-(oxalyl-amino)-4,7-dihydro-5H-thieno[2.3-c]pyran-3-carboxylic acid
2-Amino-5-hydroxymethyl-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (0.23 g, 0.87 mmol) benzoic acid (0.10 g, 0.96 mmol) and triethylamine (0.23 ml, 1.7 mmol) were dissolved in dichloromethane (4 ml) and stirred under nitrogen. 1-(3- Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.17 g, 0.96 mmol) and 1-hydroxy- benzotriazole hydrate (0.12 g, 0.96 mmol) were added as solids. The reaction mixture was stirred at room temperature for 2 days, after which the solvents were evaporated in vacuo. The crude mixture was dissolved in ethyl acetate and washed with 1 N hydrochloric acid, saturated sodium bicarbonate, brine and dried (Na2S04). The solvent was evaporated in vacuo. yielding a yellow solid that was purified by flash chromatography using a mixture of ethyl acetate and hexanes (1 :2) as eluent. Pure fractions were collected and evaporated in vacuo affording 0.22 g (70 %) of 2-amino-5-benzoyloxymethyl-4,7-dihydro-5H-thieno[2,3- c]pyran-3-carboxylic acid tert-butyl ester as a solid.
Η NMR (400 MHz, CDCI3) δ 8.06 (d, J = 7 Hz, 2H), 7.55 (t, J = 7 Hz, 1 H), 7.42 (t, J = 7 Hz, 2H), 4.64 (s, 2H), 4.44 (d, J = 5 Hz, 2H), 4.03 - 3.97 (m, 1 H), 2.88 (d, J = 18 Hz, 1 H), 2.64 (dd, J = 17 Hz, 10 Hz, 1 H), 1.50 (s, 9H).
LC/MS [M+H]: 390.48
To the above carboxylic acid tert-butyl ester (0.18 g, 0.45 mmol) dissolved in dry tetrahy- drofuran (5 ml), was added triethylamine (0.18 ml, 1.4 mmol) and imidazol-1-yl-oxo-acetic acid tert-butyl ester (0.26 g, 1.4 mmol) under nitrogen. The reaction mixture was stirred at 165 room temperature for 3 h. The volatiles were evaporated in vacuo and the resultant solid reconstituted in ethyl acetate (10 ml). The organic layer was washed with 1 % hydrochloric acid (2 x 10 ml), brine (2 x 10 ml), dried (Na2S04), filtered and the solvent evaporated in vacuo. The resulting oil was purified by flash chromatography using a mixture of ethyl acetate and hexane (1 :2) as eluent affording ester 0.20 g (90 %) of 5-benzoyloxymethyl-2-(tert- butoxyoxalyl-amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxyiic acid tert-butyl ester as a solid.
1H NMR (400 MHz, CDCI3) δ 8.07 (d, J = 7 Hz, 2H), 7.56 (t, J = 7 Hz, 1 H), 7.44 (t, J = 7 Hz, 2H), 4.85 (d, J = 15 Hz, 1 H), 4.77 (d, J = 15 Hz, 1 H), 4.49 (d, J = 5 Hz, 2H), 4.03 - 3.99 (m, 1 H), 2.99 (d, J = 17 Hz, 1 H), 2.72 (dd, J = 17 Hz, 11 Hz, 1H), 1.58 (s, 9H), 1.60 (s, 9H).
The above di-tert butyl ester (0.15 g, 0.29 mmol) was dissolved in a solution of 20 % trifluoroacetic acid in dichloromethane (3 ml). Immediately the solution developed a dark orange color that quickly became red. The reaction was stirred for 1.5 h at room tempera- ture. The volatiles were evaporated in vacuo affording a brown solid which was washed twice with diethyl ether and water and filtered off. The resulting solid was dried in vacuo. yielding 30 mg (25 %) of the title compound as a solid.
Η NMR (400 MHz, DMSO-d6) δ 12.40 (s, 1H), 7.98 (d, J = 7 Hz, 2H), 7.67 (t, J = 7 Hz, 1 H), 7.54 (t, J = 7 Hz, 2H), 4.83 (d, J = 15 Hz, 1H), 4.70 (d, J = 15 Hz, 1 H), 4.44 (d, J = 5 Hz, 2H), 4.02 - 3.99 (m, 1 H), 2.99 (d, J = 16 Hz, 1 H), 2.70 (dd, J = 16 Hz, 9 Hz, 1 H).
LC/MS [M-H]: 404.05.
HPLC (254.4 nm): 7.16 s, 90 %.
EXAMPLE 109
Figure imgf000167_0001
2-(Oxalyl-amino 5-(1-oxo-1.3-dihvdro-isoindol-2-ylmethvπ-4.7-dihvdro-5H-thieno[2.3- c]pyran-3-carboxylic acid 166
To a solution of 2-amino-5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H- thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (0.308 g, 0.74 mmol) in absolute ethanol (5 ml) was added hydrazine (47 μl, 1.48 mmol). The reaction was stirred at 80 °C for 4 h and then at room temperature for another 12 h. The precipitate formed was filtered off and the filtrate concentrated in vacuo. To the oily residue was added dichloromethane (15 ml) and the precipitate formed was filtered off. The filtrate was concentrated in vacuo to give 2- amino-5-aminomethyl-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester 0.19 g (90 %) as a solid. Η NMR (400 MHz, CDCI3) δ 5.91 (bs, 2H), 4.62 (s, 2H), 3.64 - 3.60 (m, 1 H), 2.92 - 2.84 (m, 2H), 2.80 - 2.75 (m, 1 H), 2.52 - 2.45 (m, 1 H), 1.53 (s, 9H). LC-MS [M+H]+: 285
Phthalic dicarboxaldehyde (52 mg, 0.36 mmol) was dissolved in a mixture of anhydrous acetonitrile (2 ml) and acetic acid (44 μl, 0.72 mmol). The above 2-amino-5-aminomethyl- 4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (0.11 g, 0.36 mmol) was added and the reaction stirred for 20 minutes at room temperature. The volatiles were evaporated in vacuo and the residue dissolved in ethyl acetate (25 ml). The organic mixture was washed with saturated sodium bicarbonate (5 ml), 1 % hydrochloric acid (5 ml), brine (5 ml), dried (Na2S04), filtered and evaporated in vacuo. The residue was purified by chromatography using a gradient from 15 % ethyl acetate/dichloromethane to 17 % ethyl ace- tate/dichloromethane as eluent affording 45 mg (30 %) of 2-amino-5-(1-oxo-1 ,3-dihydro- isoindol-2-ylmethyl)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as a solid. 1H NMR (400 MHz, CDCI3) δ 7.85 (d, J = 7 Hz, 1 H), 7.53 (t, J = 7 Hz, 1 H), 7.47 - 7.43 (m, 2H), 4.68 (d, J = 17 Hz, 1H), 4.58 - 4.51 (m, 3H), 3.99 (dd, J = 14 Hz, 3 Hz, 1H), 3.93 - 3.89 (m, 1H), 3.66 - 3.61 (m, 1H), 2.88 (d, J = 17 Hz, 1H), 2.55 (dd, J = 17 Hz, 11 Hz, 1H), 1.52 (s, 9H).
To a solution of 2-amino-5-(1-oxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H-thieno[2,3- c]pyran-3-carboxylic acid tert-butyl ester (45 mg, 1.1 mmol) in anhydrous dichloromethane (4 ml) was added imidazol-1-yl-oxo-acetic acid tert-butyl ester (73 mg, 3.3 mmol) and triethylamine (17 μl, 1.1 mmol). The reaction was stirred under nitrogen at room temperature for 5 h. The solvent was evaporated in vacuo and the crude material was dissolved in ethyl ace- 167 tate (20 ml). The organic solution was washed with 0.5 N hydrochloric acid (3 ml), saturated sodium bicarbonate (3 ml), brine (5 ml), dried (Na2S04), filtered and the solvent evaporated in vacuo. The residue was purified by chromatography using dichloromethane (100 %) followed by 17 % ethyl acetate/dichloromethane as eluents affording 54 mg (91 %) of 2-(tert- butoxyoxalyl-amino)-5-(1-oxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H-thieno[2,3- c]pyran-3-carboxylic acid tert-butyl ester as a solid.
Η NMR (400 MHz, CDCI3) δ 12.50 (s, 1 H), 7.84 (d, J = 8 Hz, 1 H), 7.53 (t, J = 7 Hz, 1 H), 7.47 - 7.43 (m, 2H), 4.81 - 4.65 (m, 3H), 4.53 (d, J = 17 Hz, 1 H), 4.01 (dd, J = 14 Hz, 3 Hz, 1 H), 3.96 - 3.89 (m, 1 H), 3.69 - 3.62 (m, 1 H), 2.97 (d, J = 17 Hz, 1 H), 2.63 (dd, J = 17 Hz, 11 Hz, 1 H), 1.59 (s, 9H), 1.56 (s, 9H). APCI-MS [M+H]+: 529.5
The above 2-(tert-butoxyoxalyl-amino)-5-(1-oxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro- 5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (52 mg, 0.098 mmol) was treated with a solution of 50 % trifluoroacetic acid/dichloromethane (3 ml) for 4.5 h at room temperature. The volatiles were evaporated in vacuo and the residue chased three times with dichloromethane (10 ml). The solid formed was filtered off and washed with dichloromethane affording 28 mg (70 %) of the title compound as a solid. Η NMR (400 MHz, DMSO-d6) δ 12.32 (s, 1 H), 7.69 (d, J = 8 Hz, 1 H), 7.61 - 7.59 (m, 2H), 7.51 - 7.45 (m, 1 H), 4.81 (d, J = 15 Hz, 1 H), 4.65 (d, J = 15 Hz, 1 H), 4.60 (s, 2H), 3.95 - 3.92 (m, 1 H), 3.75 (d, J = 5 Hz, 2H), 2.94 (d, J = 16 Hz, 1 H), 2.56 (dd, J = 16 Hz, 10 Hz, 1 H).
APCI-MS [M+H]+: 417.3
HPLC (254.4nm): 3.079 s (100 %)
EXAMPLE 110
Figure imgf000169_0001
168 2-(Oxalyl-amino)-6-oxo-4.5.6.7-tetrahvdro-benzo[b]thiophene-3-carboxylic acid
2-(Ethoxyoxalyl-amino)-6-oxo-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid (3.0 g, 0.013 mol) was dissolved in a mixture of water (40 ml), ethanol (20 ml) and tetrahydrofuran (20 ml) at room temperature. To the resulting mixture was added 1 N sodium hydroxide (20.24 ml, 20.24 mmol). The resulting reaction mixture was stirred at room temperature for 72 h, pH was adjusted to 3 by addition of concentrated hydrochloric acid. The precipitate was filtered off and washed with water (2 x 15 ml), diethyl ether (2 x 15 ml) and dried in vacuo at 50 °C affording 1.96 g (73 %) of the title compound as a solid. M.p.: > 230 °C
Calculated for d^NOgS;
C, 46.64 %; H, 3.30 %; N, 4.94 %. Found:
C, 46.97 %; H, 3.30 %; N, 5.80 %.
By a similar procedure as described in Example 81 the following compounds have been prepared.
EXAMPLE 111
OH ^X -OH f if y-M o
Figure imgf000170_0001
O OH
4-Carboxymethyl-2-(oxalyl-aminoV4.5.6.7-tetrahvdro-benzo-[b]thienophene-3-carboxylic acid:
2-Carbmethoxymethylcyclohexanone was prepared in the same way as described in J. Am. Chem. Soc. 81 , 3955-3959 (1959) for 2-carbethoxy-methylcyclohexanone.
M.p.: > 250 °C
Calculated for C^H^N^S,, 0.75 H20; C, 45.81 %; H, 4.29 %; N, 4.11 %. Found: C, 45.79 %; H, 4.02 %; N, 4,08 %. 169
EXAMPLE 112
0
-OH
/
-H 0
Figure imgf000171_0001
0 X OH 2-(Oxalyl-amino)-6-oxo-4.7-dihydro-5H-thieno[2.3-c]thiopyran-3-carboxylic acid:
1-Oxo-2,3,5,6-tetrahydro-4H-thiopyran-4-one was prepared as described in J. Org. Chem. 27, 282-284 (1962).
M.p.: > 250 °C.
Calculated for C10H9N1O6S2, 0.2 x NaCl; C, 38.13 %; H, 2.88 %; N, 4.45 %. Found: C, 37.98 %; H, 2.82 %; N, 4,29 %.
EXAMPLE 113 o y-oH rγv« o
O O" Na
2-(Oxalyl-amino)-6.6-dioxo-4.7-dihydro-5H-thienof2.3-c]thiopyran-3-carboxylic acid. mono sodium salt:
1 ,1-Dioxide-2,3,5,6-tetrahydro-4H-thiopyran-4-one was prepared as described in J. Org. Chem. 60, 1665-1673 (1995).
M.p.: > 250 °C
Calculated for C^HgN^^Na,, 1 x H2O; C, 33.43 %; H, 2.81 %; N, 3.90 %. Found: C, 33.43 %; H, 2.78 %; N, 3,76 %. 170
By a similar procedure as described in Example 107 the following compounds have been prepared.
EXAMPLE 114
Figure imgf000172_0001
2-(Oxalyl-amino)-5-(((4-oxo-chromene-4H-3-carbonynamino)methyh-4.7-dihydro-5H- thieno[2.3-c]pyran-3-carboxylic acid:
1H NMR (400 MHz, DMSO-d6) δ 12.32 (s, 1 H), 9.47 (t, J = 4 Hz, 1H), 9.08 (s, 1H), 8.19 (dd, J = 8 Hz, 2 Hz, 1 H), 7.90 (dt, J = 8 Hz, 2 Hz, 1 H), 7.78 (d, J = 8 Hz, 1 H), 7.60 (t, J = 8 Hz, 1 H), 4.88 (d, J = 15 Hz, 1 H), 4.70 (d, J = 15 Hz, 1 H), 3.83 - 3.79 (m, 1H), 3.72 - 3.66 (m, 1 H), 3.55 - 3.48 (m, 1 H), 2.95 (d, J = 15 Hz, 1 H), 2.60 (dd, J = 15 Hz, 8 Hz, 1 H).
LC/MS [M-H]": 471.4
HPLC (254.4 nm): 3.105 s, 94%.
EXAMPLE 115
2-(Oxalyl-amino)-5-(((4-oxo-chromene-4H-2-carbonvhamino)methyl)-4.7-dihydro-5H- thieno[2.3-c]pyran-3-carboxylic acid: 171 Η NMR (400 MHz, DMSO-d6) δ 12.32 (s, 1H), 9.33 (t, J =4 Hz, 1H), 8.05 (d, J = 8 Hz, 1H), 7.89 (t, J = 8 Hz, 1H), 7.76 (d, J = 8 Hz, 1H), 7.53 (t, J = 8 Hz, 1H), 6.84 (s, 1H), 4.83 (d, J = 15 Hz, 1H), 4.66 (d, J = 15 Hz, 1H), 3.89 - 3.84 (m, 1H), 3.56 - 3.45 (m, 2H), 2.98 (d, J = 18 Hz, 1H), 2.63 - 2.52 (m, 1H, partially obscured by DMSO). LC/MS [M-H]": 471.4
HPLC (254.4 nm): 2.886 s, 95 %.
EXAMPLE 116
Figure imgf000173_0001
Figure imgf000173_0002
OU OH
5-((3-Furan-3-yl-acryloylamino-methyl)-2-(oxalyl-amino)-4,7-dihydro-5H-thieno[2.3-c]pyran- 3-carboxylic acid: Η NMR (400 MHz, DMSO-d6) δ 12.32 (s, 1H), 8.20 (t, J = 5 Hz, 1H), 7.99 (s, 1H), 7.71 (s, 1H), 7.33 (d, J = 15 Hz, 1H), 6.68 (s, 1H), 6.42 (d, J = 15 Hz, 1H), 4.81 (d, J = 15 Hz, 1H), 4.65 (d, J = 15 Hz, 1H), 3.74 - 3.67 (m, 1H), 3.44 - 3.34 (m, 2H), 2.91 (d, J = 17 Hz, 1H), 2.53 (dd, 1H, partially obscured by DMSO).
LC/MS [M-H]": 419.4
HPLC (254.4 nm): 2.822 s, 91%
EXAMPLE 117
< NH -OH
° OH OH 172 5-((3-Furan-2-yl-acryloylamino)-methvh-2-(oxalyl-aminoV4.7-dihvdro-5H-thieno[2.3-c]pyran- 3-carboxylic acid:
Η NMR (400 MHz, DMSO-d6) δ 12.32 (s, 1 H), 8.37 (t, 1H), 7.77 (s, 1 H), 7.23 (d, J = 15 Hz, 1 H), 6.76 (d, J = 3 Hz, 1 H), 6.57 (dd, J = 3 Hz, 2 Hz, 1 H), 6.50 (d, J = 15 Hz, 1 H), 4.81 (d, J = 15 Hz, 1H), 4.65 (d, J = 15 Hz, 1H), 3.74 - 3.67 (m, 1 H), 3.48 - 3.32 (m, 2H), 2.91 (d, J = 17 Hz, 1 H), 2.53 (dd, 1 H, partially obscured by DMSO). [M-H] : 419.3
HPLC (254.4 nm): 2.815 s, 86%
EXAMPLE 118
Figure imgf000174_0001
2-(Oxalyl-amino05-(((3-oxo-indane-1-carbonyπamino^methyl)-4.7-dihydro-5H-thieno[2.3- c]pyran-3-carboxylic acid:
Η NMR (400 MHz, DMSO-d6) δ 12.33 (s, 1 H), 8.81 (bs, 1 H), 7.74 - 7.62 (m, 3H), 7.47 (t, J = 7 Hz, 1 H), 4.83 (d, J = 15 Hz, 1 H), 4.67 (d, J = 15 Hz, 1 H), 4.29 (t, J = 5 Hz, 1 H), 3.41 - 3.25 (m, 3H), 2.91 (d, J = 15 Hz, 1 H), 2.77 (d, J = 5 Hz, 2H), 2.58 - 2.51 (m, 1 H, partially obscured by DMSO).
LC/MS [M-H]": 457.5
HPLC (254.4 nm): 2.634 s, 97 %.
By a similar procedure as described in Example 106 the following compound was prepared. 173
EXAMPLE 119
V0H y -W o
-s 0 OH
5-(2.4-Dioxo-thiazolidin-3-ylmethyl)-2-(oxalyl-amino04.7-dihydro-5H-thieno[2.3-c]pyran-3- carboxylic acid:
1H NMR (400 MHz, CD3OD and DMSO-d6) δ 4.88 (m, 2H), 3.97 - 3.89 (m, 3H), 3.72 - 3.69 (m, 2H), 3.08 (m, 1 H), 3.02 (m, 1 H).
MS (ESI (-)): 399.
HPLC (254.4nm): 2.67, s, 100%.
By a similar procedure as described in Example 81 the following compounds have been prepared.
EXAMPLE 120
-OH i yn o
» O x OH
2-(Oxalyl-amino)-5-(2'-spiro[1'.3']dioxolane)-6.7-dihydro-4H-benzo[b]thiophen-3-carboxylic acid:
M.p.: 232 - 234 °C
Calculated for C13H13N07S, 1 x H20;
C, 45.22 %; H, 4.38 %; N, 4.06 %. Found:
C, 45.24 %; H, 4.39 %; N, 3.98 %. 174
By a similar procedure as described in Example 107 the following compounds have been prepared.
EXAMPLE 121
0 o H I
Figure imgf000176_0002
o
Figure imgf000176_0001
0 0 X OH
5-((3.5-Dimethoxy-benzoylamino)-methyl)-2-(oxalyl-amino)-4.7-dihydro-5H-thieno[2.3- c]pyran-3-carboxylic acid:
1H NMR (400 MHz, DMSO-d6) δ 12.31 (s, 1 H), 8.63 (t, J = 5 Hz, 1 H), 7.02 (s, 2H), 6.62 (s, 1 H), 4.80 (d, J = 15 Hz, 1 H), 4.64 (d, J = 15 Hz, 1 H), 3.82 - 3.79 (m, 1 H), 3.77 (s, 6H), 3.47 3.45 (m, 2H), 2.94 (d, J = 17 Hz, 1 H), 2.53 (dd, J = 17 Hz, 11 Hz, 1 H).
LC/MS [M-H]": 463.4
HPLC (254.4 nm): 3.161 s, 93%
EXAMPLE 122
Figure imgf000176_0003
Cl"
5-(5.6-Dichloro-1 ,3-dioxo-1.3-dihydro-isoindol-2-ylmethyl)-2-(oxalyl-amino)-4.7-dihydro-5H- thieno[2.3-c]pyran-3-carboxylic acid:
To a solution of 2-hydroxymethyl-tetrahydro-pyran-4-one (625 mg, 4.81 mmol) in a mixture of pyridine (778 μl, 9.62 mmol) and chloroform (6.0 ml) at 0 °C under nitrogen was slowly added 4-nitrobenzenesulfonyl chloride (1.60 g, 7.22 mmol). The mixture was allowed to 175 warm to room temperature and stirred for 3 h. Chloroform (30 ml) was added and the solution washed with 2.0 N hydrochloric acid (3 x 10 ml), 5 % NaHC03 (3 x 10 ml) and water (3 x 10 ml). The organic phase was dried (Na2S04), filtered and the solvent evaporated in vacuo. The solid residue was purified by column chromatography on silica gel using a gradient of dichloromethane:hexane:ethyl acetate (1 :1 :0 to 8:0:2) as eluent. Pure fractions were collected and the volatiles were evaporated in vacuo affording 0.98 g (65 %) of 4-nitro- benzenesulfonic acid 4-oxo-tetrahydro-pyran-2-ylmethyl ester as a solid. 1H NMR (400 MHz, CDCI3) δ 2.37 (d, 2H, J = 7.8 Hz), 2.57 (m, 1 H), 3.63 (m, 1 H), 3.89 (m, 1 H), 4.20 - 4.26 (m, 3H), 8.14 (dd, 2H, J = 0.6 Hz, J = 9 Hz), 8.42 (dd, 2H, J = 0.6 Hz, J = 9 Hz).
MS m/z: 315.3 (M+).
4-Nitro-benzenesulfonic acid 4-oxo-tetrahydro-pyran-2-ylmethyl ester (0.5 g, 1.59 mmol), ethylene glycol (986 mg, 15.9 mmol) and p-toluene sulfonic acid (61 mg, 0.32 mmol) were refluxed in benzene (20 ml) for 20 h. The solvent was removed in vacuo to afford a solid. The solid was dissolved in dichloromethane (30 ml) and successively washed with a saturated aqueous solution of sodium bicarbonate (2 x 5 ml) and water (2 x 5 ml). The organic phase was dried (Na2S04), filtered and the solvent removal in vacuo afforded 582 mg (100 %) of 4-nitro-benzenesulfonic acid 1 ,4,8-trioxa-spiro[4.5]dec-7-ylmethyl ester as a solid. 1H NMR (400 MHz, CDCI3) δ 1.53 - 1.73 (m, 4H), 3.54 (m, 1 H), 3.8 (m, 2H), 3.96 (m, 4H), 4.15 (m, 2H), 8.12 (dd, 2H, J = 1.5 Hz, J = 9.0 Hz), 8.40 (dd, 4H, J = 1.5 Hz, J = 9.0 Hz).
MS m/z: 359.3.
3,4-Dichlorophthalimide (90.2 mg, 0.42 mmol) was dissolved in N,N-dimethylformamide (2.0 ml) at room temperature. Sodium hydride (17 mg, 0.42 mmol) was added under nitrogen. 4- Nitro-benzenesulfonic acid 1 ,4,8-trioxa-spiro[4.5]dec-7-ylmethyl ester (100 mg, 0.28 mmol) was added and the mixture heated to 140 °C for 3 h. After cooling to room temperature the reaction mixture was added to ice water (5 ml) and the mixture extracted with ethyl acetate (3 x 15 ml). The combined ethyl acetate extracts were washed with 1.0 N hydrochloric acid (2 x 5 ml), water (2 x 5 ml), saturated sodium bicarbonate (2 x 5 ml) and water (2 x 5 ml). After drying (Na2S04) followed by filtration, the solvent was removed in vacuo affording 97 176 mg (94 %) of 5,6-dichloro-2-(1 ,4,8-trioxa-spiro[4.5]dec-7-ylmethyl)-isoindole-1 ,3-dione as a solid.
Η NMR (400 MHz, CDCI3) δ 1.60 (m, 2H), 1.78 (m, 2H), 3.54 (m, 1 H), 3.64 (m, 1 H), 3.88 (m, 2H), 3.95 (m, 4H), 7.95 (d, 2H, J = 3 Hz). MS m/z: 373.7 (M+).
5,6-Dichloro-2-(1 ,4,8-trioxa-spiro[4.5]dec-7-ylmethyl)-isoindole-1 ,3-dione (87 mg, 0.234 mmol) was dissolved in tetrahydrofuran (2.5 ml). 1.0 N hydrochloric acid (1.0 ml) was added to the solution and the mixture was heated at 75 °C for 20 h. The heterogeneous mixture was evaporated to dryness in vacuo and the resulting solid was dissolved in dichloromethane (10 ml) and washed with water (3 x 2 ml). The organic layer was dried (MgS04), filtered and the solvent evaporated in vacuo affording 62.1 mg (81 %) of 5,6- dichloro-2-(4-oxo-tetrahydro-pyran-2-ylmethyl)-isoindole-1 ,3-dione as a solid. 1H NMR (400 MHz, CDCI3) δ 2.31 - 2.41 (m, 2H), 2.48 (t, 1 H, J = 2.0 Hz), 2.62 (m, 1 H), 3.60 (m, 1 H), 3.72 (m, 1 H), 3.99 (m, 2H), 4.29 (m, 1 H), 7.96 (d, 2H, J = 2.7 Hz).
MS m/z: 331.1 (M+).
5,6-Dichloro-2-(4-oxo-tetrahydro-pyran-2-ylmethyl)-isoindole-1 ,3-dione (60 mg, 0.18 mmol) was stirred with tert-butyl cyanoacetate (33.5 mg, 0.24 mmol), elemental sulfur (6.44 mg, 0.20 mmol) and morpholine (32.4 μl, 0.37 mmol) in ethanol for 20 h at 50 °C. The volatiles were evaporated in vacuo and the resulting solid was dissolved in dichloromethane (30 ml) and washed with water (2 x 10 ml). The organic phase was dried (MgS04), filtered and the solvent evaporated in vacuo. The residue (111 mg) was purified by preparative TLC
(Kieselgel 60F254, 1 mm) using a mixture of hexane and ethyl acetate (1:1) as eluent. Pure compound was obtained after evaporation of the solvent in vacuo affording 28 mg (32 %) of 2-amino-5-(5,6-dichloro-1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H- thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as a solid. 1H NMR (400 MHz, CDCI3) δ 1.54 (s, 9H), 2.90 (m, 1 H), 3.35 (m, 2H), 2.60 (m, 2H), 2.90 (m, 1H), 4.62 (m, 1 H), 7.95 (d, 2H, J = 1.8 Hz). MS m/z: 483.3 (M+), 427 (M-57). 177 A mixture of 2-amino-5-(5,6-dichloro-1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro- 5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (27.5 mg, 0.057 mmol), imidazol-1-yl- oxo-acetic acid tert-butyl ester (55.8 mg, 0.29 mmol) and triethylamine (16 μl, 0.114 mmol) in tetrahydrofuran (2 ml) was stirred at room temperature for 20 h. The volatiles were evapo- rated in vacuo and the resulting syrup was dissolved in dichloromethane (15 ml) and washed with water (3 x 3 ml). The organic phase was dried (MgS04), filtered and the solvent evaporated in vacuo. The residue (35.7 mg) was purified by preparative TLC (Kieselgel 60F254, 0.5 mm) using a mixture of hexane and ethyl acetate (8:2) as eluent. After isolation 8.5 mg (24 %) of 2-(tert-butoxyoxalyl-amino)-5-(5,6-dichioro-1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)- 4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester was obtained.
Η NMR (400 MHz, CDCI3) δ 1.58 (s, 18H), 2.68 (m, 1 H), 2.97 - 3.02 (m, 1 H), 3.82 (m, 1 H), 4.63 - 4.68 (m, 1 H), 4.77 - 4.82 (m, 1 H), 7.97 (d, 2H, J = 2.1 Hz).
MS m/z 611.4 (M+). 2-(tert-Butoxyoxalyl-amino)-5-(5,6-dichloro-1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7- dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (3.5 mg, 5.7x10-3 mmol) was dissolved in 20 % trifluoroacetic acid in dichloromethane (1.0 ml) and stirred for 2 h at room temperature. The volatiles were evaporated in vacuo which afforded 2.7 mg (95 %) of the title compound as a solid. 1H NMR (400 MHz, CD3OD) δ 2.66 (m, 1H), 3.10 (m, 1H), 3.80 (m, 1 H), 3.98 (m, 2H), 4.66 (m, 1 H), 4.74 (m, 1 H).
MS m/z 498.3 (M-).
The following compounds were prepared in a similar way as described in example 122.
EXAMPLE 123
0
0 C-OH u
Figure imgf000179_0001
(XX C OM OH 178 5-(1.3-Dioxo-1.3.4.5.6.7-hexahydro-isoindol-2-ylmethyl)-2-(oxalyl-amino)-4.7-dihydro-5H- thieno[2.3-c]pyran-3-carboxylic acid:
2-(1 ,4,8-Trioxa-spiro[4.5]dec-7-ylmethyl)-4,5,6,7-tetrahydro-isoindole-1 ,3-dione 73.1 mg (62 %) as an oil.
1H NMR (400 MHz, CDCI3) δ 1.42 - 1.58 (m, 2H), 2.24 (m, 2H), 2.62 (m, 2H), 3.10 (m, 2H), 3.50 (m, 2H), 3.71 (m, 3H), 3.94 (m, 6H), 5.9 (m, 2H).
2-(4-Oxo-tetrahydro-pyran-2-ylmethyl)-4,5,6,7-tetrahydro-isoindole-1 ,3-dione 50 mg (92 %) as a solid. Η NMR (400 MHz, CDCI3) δ 0.86 (m, 2H), 1.64 (m, 2H), 2.22 (m, 1 H), 2.34 (m, 2H), 2.61 (m, 3H), 3.13 (m, 2H), 3.79 (m, 1 H), 3.95 (m, 1 H), 4.28 (m, 1 H), 5.92 (m, 2H). 2-Amino-5-(1 ,3-dioxo-1 ,3,4,5,6,7-hexahydro-isoindol-2-ylmethyl)-4,7-dihydro-5H-thieno[2,3- c]pyran-3-carboxylic acid tert-butyl ester was obtained as a solid after purification by preparative TLC (Kieselgel 60F254, 1 mm, hexane: ethyl acetate, 1 :1 ) (36 mg, 47 %). 1H NMR (400 MHz, CDCI3) δ 1.53 (s, 9H), 2.22 (m, 2H), 2.62 (m, 2H), 2.83 (m, 1 H), 3.11 (m, 2H), 3.56 (m, 1 H), 3.83 (m, 2H), 4.50 (m, 2H), 5.89 (m, 2H).
MS m/z 419.5 (M+), 363.4 (M-57).
2-(tert-Butoxyoxalyl-amino)-5-(1 ,3-dioxo-1 ,3,4,5,6,7-hexahydro-isoindol-2-ylmethyl)-4,7- dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester was obtained after purification by preparative TLC (Kieselgel 60F254, 0.5 mm, hexane: ethyl acetate, 8:2). 1H NMR (400 MHz, CDCI3) δ 1.60 (s, 18H), 2.24 (m, 2H), 2.92 (m, 3H), 3.14 (m, 2H), 3.90 (m, 2H), 4.11 (m, 1 H), 4.63 (m, 1 H), 4.78 (m, 1H), 5.91 (m, 2H).
MS m/z 545.4 (M-), 489.4 (M-57).
The title compound was obtained as a solid (17.2 mg, quantitative yield). 1H NMR (400 MHz, CD3OD) δ 2.28 (m, 2H), 2.55 (m, 2H), 2.97 (m, 2H), 3.31 (m, 2H), 3.56 3.93 (m, 3H), 4.70 (m, 2H), 5.91 (m, 2H). MS m/z 433.3 (M-). 179
EXAMPLE 124
Figure imgf000181_0001
2-(Oxalyl-amino)-5-(1.1.3-trioxo-1 ,3-dihydro-1 H-benzo[d]isothiazol-2-ylmethyl -4.7-dihydro- 5H-thieno[2.3-c]pyran-3-carboxylic acid:
Η NMR (400 MHz, CD3OD) δ 8.09 - 7.8 (m, 4H), 4.85 - 4.67 (m, 3H), 4.21 - 4.12 (m, 1H), 4.02 - 3.94 (m, 1 H), 3.11 - 3.06 (m, 1H), 2.90 - 2.80 (m, 1H).
MS (ESI (-)): 465.
HPLC (254.4nm): 2.31 , s, 99%.
EXAMPLE 125
0
"O C-OH
Figure imgf000181_0002
άX X 0x OH
5-[(4-Methoxy-benzenesulfonylamino)-methyl]-2-(oxalyl-amino)-4.7-dihydro-5H-thieno[2.3- c]pyran-3-carboxylic acid:
To a solution of 2-amino-5-aminomethyl-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (101 mg, 0.35 mmol) in dichloromethane (1 ml) was added pyridine (32 μl, 0.39 mmol) and 4-methoxybenzenesulfonyl chloride (82 mg, 0.39 mmol). The reaction mixture was stirred at room temperature for 48 h. The reaction mixture was diluted with dichloromethane (2 ml) and subjected to preparative TLC (1 :1 hexanes/ethyl acetate) affording 180 10 mg, (10 %) of 2-amino-5-((4-methoxy-benzenesulfonylamino)-methyl)-4,7-dihydro-5H- thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as a solid.
1H NMR (400 MHz, CDCI3) δ 7.82 (d, J = 9Hz, 2H), 6.93 (d, J = 9Hz, 2H), 5.3 (bs, 2H), 4.57 (s, 2H), 3.84 (s, 3H), 3.72 (m, 1 H), 3.10 - 3.06 (m, 1 H), 2.95 - 2.87 (m, 1 H), 2.69 - 2.64 (m, 1 H), 2.41 - 2.32 (m, 1 H), 1.47 (s, 9H).
MS: APCI (-): 453 [M-H].
To a solution of 2-amino-5-((4-methoxy-benzenesulfonylamino)-methyl)-4,7-dihydro-5H- thieno[2,3-c]pyran-3-carboxylic acid tert-butyi ester (8 mg, 0.017 mmol) in dichloromethane (1 ml) was added triethylamine (7.4 μl, 0.051 mmol), and imidazol-1-yl-oxo-acetic acid tert- butyl ester (10 mg, 0.051 mmol) and stirred at room temperature for 16 h. The volatiles were removed in vacuo and to the residue was added dichloromethane (2 ml). The solution was purified by preparative TLC (10 % methanol/90 % dichloromethane) affording 10 mg (100 %) of 2-(tert-butoxyoxalyl-amino)-5-((4-methoxy-benzenesulfonylamino)-methyl)-4,7-dihydro- 5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as a solid. 1H NMR (400 MHz, CDCI3) δ 7.83 (d, J = 9 Hz, 2H), 6.93 (d, J = 9 Hz, 2H), 4.68 (m, 2H), 3.85 (s, 3H), 3.7 (m, 3H), 3.29 - 3.22 (m, 1 H), 2.80 - 2.75 (m, 1 H), 2.53 - 2.43 (m, 1 H), 1.56 (s, 18H).
MSAPCI (+): 582.8 [M+H], 527 (-1 tert-Bu).
2-(tert-Butoxyoxalyl-amino)-5-((4-methoxy-benzenesulfonylamino)-methyl)-4,7-dihydro-5H- thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (10 mg, 0.017 mmol) was added to a solution of 25 % trifluoroacetic acid in dichloromethane (2 ml). The reaction mixture was stirred at room temperature for 2 h, at which time, the solvent was removed in vacuo. The residue was precipitated by addition of diethyl ether and washed two times with diethyl ether affording after drying 2 mg (25 %) of the title compound as a solid. Η NMR (400 MHz, CD3OD) δ 7.78 (d, J = 9 Hz, 2H), 7.02 (d, J = 9 Hz, 2H), 4.76 - 4.63 (m, 2H), 3.84 (s, 3H), 3.75 (m, 1 H), 3.50 - 3.47 (m, 2H), 2.89 - 2.83 (m, 1 H), 2.52 - 2.42 (m, 1 H).
MS: APCI (+): 471 [M+H]; 181
EXAMPLE 126
.-OH
X O
HO » O X OH
N-(6-Hydroxy-3-hydroxymethyl-4.5.6.7-tetrahydro-benzo[b]thiophen-2-yπ-oxalamic acid: 2-(Ethoxyoxalyl-amino)-6-(2'-spiro[1 ',3']dioxolane)-6,7-dihydro-4H-benzo[b]thiophen-3- carboxylic acid tert butyl ester (20 g, 0.05 mol) was dissolved in a (1 :4) mixture of trifluoroacetic acid and dichloromethane (200 ml) containing water (1 ml) at 0 °C. The reac- tion mixture was stirred at 0 °C for 1 h and at room temperature for 20 h. The volatiles were evaporated in vacuo and the solid residue was trituated with diethyl ether (2 x 100 ml) and dried in vacuo affording 15.08 g (100 %) of 2-(ethoxyoxalyl-amino)-6-oxo-4,5,6,7-tetrahydro- benzo[b] thiophene-3-carboxylic acid as a solid.
To a mixture of ethanol (50 ml) and dichloromethane (50 ml) was added 2-(ethoxyoxalyl- amino)-6-oxo-4,5,6,7-tetrahydro-benzo[b] thiophene-3-carboxylic acid (2.0 g, 6.43 mmol) followed by sodium borhydride (124 mg, pellets). The resulting mixture was stirred at room temperature for 1 h and an additional sodium borhydride pellet was added. After stirring for an addition 4 h the reaction mixture was quenched by addition of a mixture of water (100 ml) and formic acid (100 ml) at 0 °C. The aqueous phase was extracted with ethyl acetate (2 x 100 ml) and the combined organic phases were washed with brine (100 ml), dried Na2S04, filtered and evaporated in vacuo affording 860 mg (43 %) of the title compound as a solid. After standing for 18 h the aqueous phase was filtered and the filter cake was washed with water (2 x 15 ml), diethyl ether (2 x 15 ml) and dried in vacuo affording an additional portion 710 mg (48 %) of the title compound as a solid.
Calculated for CnH^ S,, 0.5 x H20 C, 47.14 %; H, 5.03 %; N, 5.00 %. Found: C, 47.19 %; H, 5.00 %; N, 4.94 %.
The following compound was prepared in a similar way as described in example 81. 182
EXAMPLE 127
Figure imgf000184_0001
2-(Oxalyl-amino06-(2'-spiro[1 '.3']dioxolane)-6.7-dihydro-4H-benzo[b]thiophen-3-carboxylic acid:
M.p.: > 250 °C.
Calculated for C13H13NO7S;
C, 47.70 %; H, 4.00 %; N, 4.28 %. Found:
C, 47.93 %; H, 4.09 %; N, 4.27 %.
EXAMPLE 128
Figure imgf000184_0002
6-Hydroxy-2-(oxalyl-aminoV4.5.6.7-tetrahydro-benzo[b]thiophen-3-carboxylic acid;
2-(Ethoxyoxalyl-amino)-6-(2'-spiro[1 ',3']dioxolane)-6,7-dihydro-4H-benzo[b]thiophen-3- carboxylic acid ethyl ester (8.7 g, 22.7 mmol) was dissolved in a ice bath cooled mixture of 25 % trifluoroacetic acid in dichloromethane (100 ml) and water (0.5 ml) was added. The reaction mixture was stirred at 0 °C for 2 h and at room temperature for 48 h. The volatiles were evaporated in vacuo and the residue dissolved in ethanol (100 ml) and evaporated in vacuo (2 times). The solid residue was washed with diethyl ether (80 ml) and dried in vacuo at 50 °C affording 6.68 g (88 %) of 2-(ethoxyoxalyi-amino)-6-oxo-4,5,6,7-tetrahydro- benzo[b]thiophene-3-carboxylic acid ethyl ester as a solid.
To a solution of 2-(ethoxyoxalyl-amino)-6-oxo-4,5,6,7-tetrahydro-benzo[b]thiophene-3- carboxylic acid ethyl ester (2.0 g, 5.89 mmol) in a mixture of dichloromethane (40 mi) and ethanol (40 ml) was added sodium borohydride (64 mg, 1.77 mmol). The reaction mixture 183 was stirred at room temperature for 64 h, additional sodium borohydride (22.3 mg, 0.59 mmol) was added and stirring was continued for an additional 18 h. Two more portions of sodium borohydride (23 mg and 15 mg) was added during the next 6 h of stirring. To the reaction mixture was added ice cooled saturated ammonium chloride (50 ml) and the resulting mixture was extracted with ethyl acetate (3 x 50 ml). The combined organic extracts were dried (Na2S04), filtered and evaporated in vacuo. The residue was dissolved twice in ethyl acetate (100 ml) and evaporated in vacuo. The solid residue was washed with diethyl ether (80 ml) and dried in vacuo at 50 °C affording 1.46 g (75 %) of 2-(ethoxyoxalyl-amino)-6- hydroxy-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester as a solid. 1.35 g of this material was subjected to column chromatography (slilca gel) using a mixture of ethyl acetate and heptane (1 :1) as eluent. Pure fractions were collected and the solvent evaporated in vacuo affording 0.9 g of pure 2-(ethoxyoxaiyl-amino)-6-hydroxy-4,5,6,7-tetrahydro- benzo[b]thiophene-3-carboxylic acid ethyl ester as a solid.
Η NMR (300 MHz, CDCI3) δ 1.42 (m, 6H), 1.86 (m, 2H), 2.02 (m, 1 H), 2.71 (dd, 1 H), 2.85 (m, 1 H), 3.00 (m, 2H), 4.19 (bs, 1 H), 4.40 (dq, 4H), 12.45 (bs, 1 H, NHCO).
To a solution of the above di-ethyl ester (0.3 g, 0.88 mmol) in water (10 ml) was added 1 N sodium hydroxide (3.1 ml, 3.08 mmol). The resulting reaction mixture was stirred at room temperature for 16 h. The aqueous phase was acidified by addition of concentrated hydrochloric acid to pH = 1 and the reaction mixture was evaporated in vacuo to VT. the original volume. The precipitate was filtered off, washed with a small portion of diethyl ether and dried in vacuo at 50 °C for 16 h affording 130 mg (52 %) of the title compound as a solid. M.p.: amorph
1H NMR (300 MHz, DMSO-d6) δ 1.63 (m, 1 H), 1.86 (m, 1 H), 2.5 (m, 1 H, partly obscured by DMSO), 2.71 (m, 1 H), 2.86 (m, 2H), 3.91 (m, 1 H), 4.87 (bs, 1 H), 12.35 (bs, 1 H, NHCO).
The following compound was prepared in a similar way as described in example 107. 184
EXAMPLE 129
Figure imgf000186_0001
5-(2-Methyl-4-oxo-4H-quinazolin-3-ylmethyl)-2-(oxalyl-amino)-4.7-dihydro-5H-thieno[2.3- c]pyran-3-carboxylic acid:
1H NMR (400 MHz, DMSO-d6) δ 12.32 (s, 1 H), 8.10 (d, J = 8 Hz, 1 H), 7.80 (t, J = 7 Hz, 1 H), 7.59 (d, J = 8 Hz, 1 H), 7.49 (t, J = 7 Hz, 1H), 4.78 (d, J = 15 Hz, 1 H), 4.53 (d, J = 15 Hz, 1 H), 4.39 (d, J = 15 Hz, 1 H), 4.21 (dd, J = 15 Hz, 9Hz, 1 H), 4.00 - 3.94 (m, 1 H), 3.05 (d, J = 17 Hz, 1 H), 2.74 - 2.65 (m, 1 H, partially obscured by neighboring singlet), 2.68 (s, 3H).
13C NMR (100.6 MHz, DMSO-d6) δ 167.7, 162.8, 161.6, 157.6, 156.1 , 148.3, 146.9, 136.0, 130.5, 127.9, 127.8, 126.5, 121.4, 115.0, 74.4, 65.9, 49.8, 31.4, 25.0.
[M-H] : 442.1
HPLC (254.4 nm): 2.631 s, 81 %.
EXAMPLE 130
Figure imgf000186_0002
185 7-(1.3-Dioxo-1.3-dihvdro-isoindol-2-ylmethylV2-(oxalyl-amino)-4.7-dihvdro-5H-thienol2.3- c]pyran-3-carboxylic acid:
Phthalimidoacetaldehyde diethyl acetal (100 g, 0.38 mol) and 1 N hydrochloric acid (600 ml) was mixture was stirred at reflux temperature for 5 min. or until a homogeneous solution is obtained. The reaction mixture was cooled and the precipitate was filtered off and dried in vacuo at 50 °C for 16 h which afforded 63.3 g (88 %) of phthalimido-acetaldehyde as a solid. 1H NMR (300 MHz, CDCI3) δ 4.58 (s, 2H), 7.76 - 7.78(m, 2H), 7.90 - 7.92 (m, 2H), 9.67 (s, 1 H).
To a mixture of phthalimidoacetaldehyde (64 g, 0.34 mol) and trans-1-methoxy-3-
(trimethylsilyloxy)-1 ,3-butadiene (81.5 g, 0.38 mol) in benzene (600 ml) stirred for 15 min. under nitrogen was added dropwise a 45 % solution of zinc chloride diethyl ether complex in dichloromethane (55.5 ml, 0.17 mol) at 0 °C. The reaction was allowed warm up to room temperature overnight. To the reaction mixture was added water (500 ml) and the resulting mixture was extracted with ethyl acetate (200 ml). The organic extract was washed successively with 1.0 N hydrochloric acid (2 x 200 ml) and brine (200 ml). The organic phase was dried (Na2S04), filtered and the solvent evaporated in vacuo which afforded a slowly crystallising oil (98 g). To the solid was added a mixture of ethyl acetate and diethyl ether (400 ml, 1 :1) and the resulting precipitate was filtered off, washed with a small portion of diethyl ether and dried at 50 °C for 1 h affording 59.8 g (69 %) of 2-(4-oxo-3,4-dihydro-2H-pyran-2- ylmethyl)-isoindole-1 ,3-dione as a solid. The filtrate was evaporated in vacuo and the residue purified by column chromatography on silica gel (1 L) using a mixture of ethyl acetate and heptane (1 :2) as eluent. Pure fractions were collected and the solvent evaporated in vacuo to almost dryness, the solid was filtered off and dried in vacuo at 50 °C for 16 h affording an additional 15 g (17 %) of 2-(4-oxo-3,4-dihydro-2H-pyran-2-ylmethyl)-isoindole-1 ,3-dione as a solid.
1H NMR (300 MHz, CDCI3) δ 2.61 (d, 2H), 3.85 (dd, 1H), 4.18 (dd, 1H), 4.76 (m, 1H), 5.43 (d, 1 H), 7.28 (d, 1 H), 7.69 - 7.77 (m, 2H), 7.84 - 7.88 (m, 2H).
2-(4-Oxo-3,4-dihydro-2H-pyran-2-ylmethyl)-isoindole-1 ,3-dione (13 g, 0.051 mol) was dissolved in ethyl acetate (250 ml) and placed in a Parr bottle. 10 % Pd/C (1.5 g) was carefully added and the mixture was shaken under a pressure of 30 psi of hydrogen for 6.5 h (Parr apparatus). Filtration followed by evaporation of the ethyl acetate in vacuo afforded a crude 11.5 g of 2-(4-oxo-tetrahydro-pyran-2-ylmethyl)-isoindole-1 ,3-dione pure enough for the next 186 step. Analytical pure compound could be obtained by purification of a small sample (250 mg) by column chromatography on silica gel, utilising hexane/ethyl acetate as a gradient (from 100/0 to 50/50). Pure fractions were collected and the solvent evaporated in vacuo affording 142 mg (55 %) 2-(4-oxo-tetrahydro-pyran-2-ylmethyl)-isoindole-1 ,3-dione as a solid. 1H NMR (400 MHz, CDCI3) δ 2.30 - 2.68 (m, 4H), 3.62 (m, 1 H), 3.74 (m, 1 H), 4.00 (m, 2H), 7.75 (m, 2H), 7.88 (m, 2H).
To a mixture of 2-(4-oxo-tetrahydro-pyran-2-ylmethyl)-isoindole-1 ,3-dione (18.7 g, 0.072 mol), tert-butyl cyanoacetate (11.2 g, 0.079 mol) and elemental sulfur (2.5 g, 0.079 mol) in ethanol was added morpholin (20 ml) and the resulting mixture was stirred at 50 °C for 3 h. The cooled reaction mixture was filtered and the volatiles were evaporated in vacuo. To the residue was added water (200 ml) and diethyl ether 100 ml. A precipitate was filtered off and dried in vacuo at 50 °C affording 9.1 g (30 %) of 2-amino-5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2- ylmethyl)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as a solid. The filtrate was extracted with ethyi acetate (2 x 150 ml) and washed with brine (100 ml), dried (Na2S04), filtered and the solvent evaporated in vacuo. The residue (20 g) was purified by column chromatography on silica gel (1 L) using as mixture of hexane and ethyl acetate (1 :2) as eluent. Pure fractions were collected and the solvent evaporated in vacuo. The residue was washed with diethyl ether and the solid was filtered off and dried in vacuo at 50 °C affording an additional 2.2 g (7 %) of 2-amino-5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)- 4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as a solid. The filtrate was evaporated in vacuo affording almost pure 10.2 g (34 %) of 2-amino-7-(1 ,3- dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as an oil.
2-amino-5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H-thieno[2,3-c]pyran-3- carboxylic acid tert-butyl ester
Η NMR (300 MHz, CDCI3) δ 1.50 (s, 9H), 2.54 - 2.63 (m, 1 H), 2.84 - 2.90 (m, 1H), 3.79 (q, 1H), 3.96 - 4.04 (m, 2H), 4.48 - 4.62 (m, 2H), 5.91 (bs, 2H, NH2), 7.70 (m, 2H), 7.84 (m, 2H).
2-amino-7-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H-thieno[2,3-c]pyran-3- carboxylic acid tert-butyl ester
Η NMR (300 MHz, CDCI3) δ 1.50 (s, 9H), 2.71 - 2.90 (m, 2H), 3.67 - 3.77 (m, 2H), 4.02 - 4.15 (m, 2H), 4.90 (m, 1 H), 6.04 (bs, 2H, NH2), 7.70 (m, 2H), 7.84 (m, 2H). 187
A mixture of 2-amino-7-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H- thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (10.2 g, 0.25 mol), imidazol-1-yl-oxo- acetic acid tert-butyl ester (7.2 g, 0.037 mol) in dry tetrahydrofuran (150 ml) was stirred at room temperature for 4 h. An additional portion of imidazol-1-yl-oxo-acetic acid tert-butyl ester (2.0 g, 0.01 mol) was added and the resulting mixture was stirred for 16 h at room temperature. The precipitate was filtered off and washed with small portions of diethyl ether and dried in vacuo affording 3.5 g (26 %) of 2-(tert-butoxyoxalyl-amino)-7-(1 ,3-dioxo-1 ,3- dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as a solid.
The filtrate was evaporated in vacuo and to the residue was added water (100 ml) and ethyl acetate (100 ml). The precipitate was filtered off and dried in vacuo at 50 °C affording an additional 0.8 g (6 %) of 2-(tert-butoxyoxalyl-amino)-7-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2- ylmethyl)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as a solid. 1H NMR (300 MHz, CDCI3) δ 1.60 (s, 9H), 1.62 (s, 9H), 2.79 - 2.97 (m, 2H), 3.73 (m, 1 H), 3.83 - 3.88 (dd, 1H), 4.07 - 4.16 (m, 2H), 5.09 (m, 1 H), 7.71 (m, 2H), 7.85 (m, 2H), 12.55 (bs, 1 H, NHCO).
The above 2-(tert-butoxyoxalyl-amino)-7-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7- dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (0.8 g, 1.47 mmol) was added to a solution of 25 % trifluoroacetic acid in dichloromethane (30 ml). The reaction mixture was stirred at room temperature for 6 h, at which time, the solvent was removed in vacuo. The residue was precipitated by addition of diethyl ether, filtered off and dried in vacuo at 50 °C affording 0.5 g (79 %) of the title compound as a solid.
M.p.: > 250 °C.
Calculated for C19H14N208S, 0.5 x H20; C, 51.94 %; H, 3.44 %; N, 6.38 %. Found: C, 52.02 %; H, 3.37 %; N, 6.48 %. 188 EXAMPLE 131
Figure imgf000190_0001
7-(Acetylamino-methyl -2-(oxalyl-amino)-4.7-dihydro-5H-thieno[2.3-c1pyran-3-carboxylic acid:
To a mixture of 2-amino-7-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyi)-4,7-dihydro-5H- thieno[2,3-c]pyran-3-carboxyiic acid tert-butyl ester (6.0 g, 0.014 mol) in ethanol (100 ml) was added hydrazine hydrate (1.4 ml, 0.028 mol). The reaction mixture was heated at reflux for 1 h, cooled and the precipitate filtered off. The filtrate was evaporated in vacuo and to the residue was added water (100 ml) and the resulting mixture was extracted with diethyl ether (2 x 100 ml). The combined organic extracts were washed with brine (100 ml), dried (Na2S04), filtered and the solvent evaporated in vacuo affording 2.9 g (71 %) of 2-amino-7- aminomethyl-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as an oil. 1H NMR (300 MHz, CDCI3) δ 1.55 (s, 9H), 2.70 - 2.97 (m, 4H), 3.69 - 3.78 (m, 1 H), 4.13 (m, 1 H), 4.50 (m, 1 H), 6.09 (bs, 2H, thiophen-NH2).
To a ice water cooled solution of the above 2-amino-7-aminomethyl-4,7-dihydro-5H- thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester (1.5 g, 5.27 mmol) and triethylamine (1.5 ml) in dichloromethane (50 ml) was added dropwise acetylchloride (0.46 g, 5.80 mmol). The reaction mixture was allowed to reach room temperature and stirred for an additional 0.5 h. The reaction mixture was washed with water (2 x 25 ml), dried (Na2S04), filtered and the solvent evaporated in vacuo. The residue was purified by column chromatography on silicagel (1 L) using first ethyl acetate and later on a mixture of ethyl acetate and ethanol (20:1) as eluents. Pure fractions were collected and the solvent evaporated in vacuo affording 0.3 g (17 %) of 7-(acetylamino-methyl)-2-amino-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as a solid.
1H NMR (300 MHz, CDCI3) δ 1.56 (s, 9H), 1.99 (s, 3H), 2.77 (m, 2H), 3.19 (m, 1 H), 3.67 - 3.79 (m, 2H), 4.09 - 4.16 (m, 1 H), 4.63 (m, 1 H), 5.91 (bs, 1 H), 6.10 (bs, 2H). 189 To a mixture of the above 7-(acetylamino-methyl)-2-amino-4,7-dihydro-5H-thieno[2,3- c]pyran-3-carboxylic acid tert-butyi ester (0.3 g, 0.92 mmol) in dry tetrahydrofuran (40 ml) was added dropwise a mixture of imidazol-1-yl-oxo-acetic acid tert-butyl ester (0.22 g, 1.10 mmol) in dry tetrahydrofuran (5 ml). The mixture was stirred at room temperature for 3 h. The volatiles were evaporated in vacuo and the residue was dissolved in ethyl acetate (100 ml) and washed with water (50 ml) and brine (50 ml). The organic phase was dried (Na2S04), filtered and evaporated in vacuo. The residue (0.4 g) was stirred with a mixture of diisopropyl ether (5 ml) and diethyl ether (5 ml). The precipitate was filtered off and the filtrate evaporated in vacuo affording 0.25 g (60 %) of 7-(acetylamino-methyl)-2-(tert-butoxyoxalyl-amino)- 4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid tert-butyl ester as an oil.
1H NMR (300 MHz, CDCI3) δ 1.64 (s, 9H), 1.65 (s, 9H), 2.02 (s, 3H), 2.87 (m, 2H), 3.29 (m, 1 H), 3.74 (m, 1 H), 3.89 (ddd, 1 H), 4.18 (m, 1 H), 4.78 (m, 1 H), 5.93 (bs, 1 H, NHCOMe), 12.5 (s, 1 H, NHCOCOOH).
The above 7-(acetylamino-methyl)-2-(tert-butoxyoxalyl-amino)-4,7-dihydro-5H-thieno[2,3- c]pyran-3-carboxylic acid tert-butyl ester (0.2 g, 0.44 mmol) was added to a solution of 25 % trifluoroacetic acid in dichloromethane (20 ml). The reaction mixture was stirred at room temperature for 4 h, at which time, the solvent was removed in vacuo. The residue was precipitated by addition of diethyl ether, filtered off and dried in vacuo at 50 °C affording 0.11 g (73 %) of the title compound as a solid.
M.p.: 220 - 222 °C.
Η NMR (300 MHz, DMSO-d6) δ 1.87 (s, 3H), 2.82 (bs, 2H), 3.19 (m, 1H), 3.51 (m, 1H), 3.67
(m, 1 H), 4.07 (m, 1 H), 4.69 (m, 1 H), 8.14 (t, 1 H, NHCOMe), 12.3 (s, 1 H, NHCOCOOH).
190
EXAMPLE 132
Fmoc-CI NaHCO,
Figure imgf000192_0001
HjO/CHjCI;, x XK. 20 % TFA
II
Wang Resin-OMs, \=J fmoc Cs2C03 NMP THF
Figure imgf000192_0002
Figure imgf000192_0003
80 different o
H2NNH2 H2N AθH
EDC , HOBT, TEA, DMF
Figure imgf000192_0004
Figure imgf000192_0005
Resin
0 "CO
Λ»x fi-H o s -y o 0 VθH o X °X /- 1 °)A " N^N
+ o^
2) 20 % TFA A
_ Resin in CH2CI2 O ^; OH -o c ]T NH2
Figure imgf000192_0006
To 2-amino-5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H-thieno[2,3-c]pyran- 3-carboxylic acid tert-butyl ester (4.5 g, 0.011 mole) dissolved in dichloromethane (30 ml), was added sodium bicarbonate (1.0 g, 0.011 mole) dissolved in water (16 ml). The reaction mixture was cooled to 0 °C and 9-fluorenylmethyl chloroformate (3.0 g, 0.012 mole) was added. After stirring for 5 minutes the reaction mixture was warmed to room temperature and stirred vigorously for 16 h. The organic layer was separated and washed with brine (10 ml). The aqueous phase was extracted with dichloromethane (2 x 20 ml) and the combined organic phases were dried (MgS04), filtered and evaporated in vacuo to give an orange solid which was purified by flash chromatography using dichloromethane as eluent. Pure fractions 191 were collected and evaporated in vacuo affording 5.6 g (81 %) of 5-(1 ,3-dioxo-1 ,3-dihydro- isoindol-2-ylmethyl)-2-(9H-fluoren-9-ylmethoxycarbonylamino)-4,7-dihydro-5H-thieno[2,3- c]pyran-3-carboxylic acid tert-butyl ester as a solid.
Η NMR (400 MHz, CDCI3) δ 10.60 (bs, 1 H), 7.87 - 7.84 (m, 2H), 7.75 (d, J = 8 Hz, 2H), 7.73 - 7.70 (m, 2H), 7.60 (d, J = 8 Hz, 2H), 7.39 (t, J = 8 Hz, 2H), 7.30 (t, J = 8 Hz, 2H), 4.74 (d, J = 14 Hz, 1H), 4.62 (d, J = 14 Hz, 1H), 4.48 (d, J = 7 Hz, 2H), 4.27 (t, J = 7 Hz, 1H), 4.05 - 4.00 (m, 2H), 3.86 - 3.80 (m, 1H), 2.92 (d, J = 17 Hz, 1H), 2.64 (dd, J = 17, 9 Hz, 1H), 1.52 (s, 9H).
LC/MS [M+H]+: 637.49
The above F-moc protected thieno[2,3-c]pyran (5.5 g, 8.6 mmole) was added at 0 °C to a solution of 20 % trifluoroacetic acid in dichloromethane (30 ml). The reaction was stirred for 4 h at room temperature. The volatiles were evaporated in vacuo and the residue was precipitated with diethyl ether, filtered off and dried, which afforded 4.2 g (85 %) of 5-(1 ,3-dioxo- 1 ,3-dihydro-isoindol-2-ylmethyl)-2-(9H-fiuoren-9-ylmethoxy-carbonylamino)-4,7-dihydro-5H- thieno[2,3-c]pyran-3-carboxylic acid as a solid. Η NMR (400 MHz, DMSO-d6) δ 10.22 (br s, 1 H), 7.88 (d , J = 5 Hz, 2H), 7.88 - 7.82 (m, 4H), 7.66 (d, J = 5 Hz, 2H), 7.40 (t, J = 5 Hz, 2H), 7.32 (t, J = 5 Hz, 2H), 4.68 - 4.48 (m, 4H), 4.34 (t, J = 5 Hz, 1H), 3.90 - 3.81 (m, 2H), 3.72 - 3.67 (m, 1H), 2.87 (m, 1H), 2.51 (m, 1H).
To Wang-Resin (3.75 g, 4.5 mmol) was added dichloromethane (50 ml) and the mixture was cooled to 0 °C under nitrogen. Diisopropylethylamine (25 ml) was added followed by methanesulfonyl chloride (2.25 ml, 29 mmol). The reaction was stirred at 0 °C for 0.5 h, then at room temperature for another 0.5 h. The resin was filtered off and washed with dichloromethane (2 x 30 ml), N-methylpyrrolidinone (20 ml) and again with dichloromethane (2 x 30 ml). The Wang-resin methansulfonyl ester was dried in vacuo for 2 h and used directly in the next step.
To the above Wang-Resin methansulfonyl ester and 5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2- ylmethyl)-2-(9H-fluoren-9-ylmethoxy-carbonylamino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3- carboxylic acid (4.85 g, 8.4 mmol) was added N-methylpyrrolidinone (45 ml). Cesium car- 192 bonate (2.2 g, 6.7 mmol) was added and the reaction stirred under nitrogen for 16 h and then at 80 °C for 36 h. The mixture was cooled to room temperature, the resin filtered off, washed with water, methanol, and dichloromethane repeatedly and dried in vacuo for 2 h affording 5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-2-(9H-fluoren-9-ylmethoxy- carbonylamino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid Wang-Resin ester.
The above Wang-Resin ester (4.85 g) was stirred in a solution of 20 % piperidine in tetrahydrofuran (20 ml) for 45 minutes. The resin was then filtered off, washed with tetrahydrofuran (2 x 20 ml), methanol (2 x 20 ml), and dichloromethane (3 x 20 ml) and dried in vacuo for 3 h affording 2-amino-5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyi)-4,7-dihydro-5H-thieno[2,3- c]pyran-3-carboxylic acid Wang-Resin ester.
The above Wang-Resin ester (4.85 g) was suspended in a mixture of dichloromethane (50 ml) and triethylamine (3.0 ml), lmidazol-1-yl-oxo-acetic acid tert-butyl ester (4.2 g, 0.021 mol) was added under nitrogen and the reaction stirred at room temperature for 16 h. The resin was filtered off, washed with methanol (30 ml) then dichloromethane (30 ml) and this process was repeated twice. The resin was dried in vacuo for several hours affording 2-(tert- butoxyoxalyl-amino)-5-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-ylmethyl)-4,7-dihydro-5H-thieno[2,3- c]pyran-3-carboxylic acid Wang Resin.
A small sample of the above Wang-Resin ester was treated with 20 % trifluoroacetic acid in dichloromethane (3 ml) for 1 h. The resin was filtered off and the filtrate concentrated in vacuo. The residue was evaporated twice from dichloromethane yielding 30 mg of a solid, which had 1H NMR and MS consistent with the compound synthesized in example 106. The loading of the Wang-Resin was thus determined to be 0.6 mmol/g.
The above Wang Resin ester (3.0 g, 1.8 mmol) was suspended in dichloromethane (25 ml). Hydrazine (0.14 ml, 4.5 mmol) was added and the reaction stirred under nitrogen at room temperature for 24 hours. The resin was filtered off and washed multiple times, alternating between methanol and dichloromethane. The filtrate was collected and concentrated to yield 260 mg of a solid. The reaction was determined to be incomplete by analysis of the byproduct, at which time the resin was suspended again in dichloromethane (15 mi) and treated with hydrazine (50 μl) for an additional 16 h. The resin was filtered off and washed as before, yielding an additional 30 mg of byproduct from the filtrate. At this point the reaction was 193 judged to be complete and the resin was dried in vacuo for 3 h, yielding 2.67 g of 5- aminomethyl-2-(tert-butoxyoxalyl-amino)-4,7-dihydro-5H-thieno[2,3-c]pyran-3-carboxylic acid Wang-Resin. The resin gave a positive ninhydrin test for amines.
The above Wang Resin ester (2.67 g) was suspended in a mixture of tetrahydrofuran and dichloromethane (1 :1 , 90 ml) and distributed to the OntoBlock (80 wells, 0.02 mmol per well). The blocks were drained. Meanwhile, 80 carboxylic acids were weighed into individual vials (0.044 mmol per vial). A solution of 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.85 g, 4.4 mmol), 1 -hydroxy-benzotriazole hydrate (0.6 g, 4.4 mmol), and triethy- lamine (1.1 ml, 8.0 mmol) was prepared in N,N-dimethylformamide (100 ml). This solution was added to each vial (1 ml per vial) and then the contents of each viai were transferred to a well of the OntoBlock (occasionally the vials were sonicated to achieve full solubility). The blocks were then shooked for 2 days. After this time the blocks were drained and washed using methanol and dichloromethane. The blocks were then placed in a vacuum dessicator for 2 h, after which 1 ml of a solution of imidazol-1-yl-oxo-acetic acid tert-butyl ester (0.2 M in dichloromethane) was added to each well. The blocks were then shooked for 16 h. Again the blocks were washed using the above method. After washing, 1 ml of a solution of 20 % trifluoroacetic acid in dichloromethane was added to each well and allowed to sit for 45 minutes. The block was drained and the filtrates collected in a microtiter plate. The wells were treated with an additional 0.5 ml solution of 20 % trifluoroacetic acid in dichloromethane and the filtrate again collected. The volatiles were evaporated in vacuo, yielding 80 compounds as solids in the microtiter plate. The plate was analyzed by Mass Spectrometry in which 66 of the wells showed the expected product as the molecular ion.
X- is point of attachment.
The percentage means the area of the peak of the HPLC at 220 nm.
R Formula Mw LC/MS
A C24H20N2O8S 4 x, A 96,50 495 (M-H,21 %)
c /*.. P v C20H20N2O9S 464,45 463 (M-H,30%) x,
Figure imgf000195_0001
194
X C20H14F6N2O7S 540,40 539 (M-H, 16%) f C18H22N207S 410,45 409 (M-H,33%)
C20H21 N3O7S 447,47 446 (M-H,39%) x,
n-Q-χ' C20H19N3O8S 461 ,45 460 (M-H, 38%)
C18H20N2O7S 408,43 407 (M-H,40%)
A C19H18N208S 434,43 433 (M-H,49%) x,
Φ C20H21 N3O7S 447,47 446 (M-H,38%)
øV" o ό C24H20N2O8S 496,50 495 (M-H,47%)
0 -_* C20H18N2O9S 462,44 444 (M-H20) x,
C15H16N207S 368,37 367 (M-H,33%)
H3C
σ " C21H20N2O8S 460,47 459 (M-H,31%)
•0 C17H20N2O8S 412,42 411 (M-H,30%) x,
Figure imgf000196_0001
195
Figure imgf000197_0001
C17H16N207S2 424,45 423 (M-H, 16%)
Figure imgf000197_0002
/X' C20H17N3O7S 443,44 557 (M+TFA, 36%)
C20H17N3O7S 443,44 442 (M-H, 37%)
Figure imgf000197_0003
Figure imgf000197_0004
C20H17N3O7S 443,44 425 (M-H20,23%)
C19H17N307S 431 ,43 430 (M-H,48%)
C21 H18N208S 458,45 414 (M-C02,24%)
Figure imgf000197_0005
C26H24N209S 540,55 539 (M-H, 17%)
C21 H16N209S 472,43 471 (M-H, 35%)
Figure imgf000197_0006
//-*•
C27H23N308S 549,56 663 (M+TFA,36%)
Figure imgf000197_0007
C18H16N207S2 436,47 437 (M+H,45%)
Figure imgf000197_0008
W // C20H20N2O7S 432,46 431 (M-H,20%)
C16H14N208S 394,36 393 (M-H.43%) 196
C22H18N207S 454,46 453 (M-H, 42%)
X' C19H18N208S 434,43 433 (M-H,22%)
C19H18N207S 418,43 417 (M-H,28%)
Figure imgf000198_0001
:XA- C21 H22N209S 478,48 477 (M-H.25%)
C21 H22N208S 462,48 461 (M-H,33%)
C20H18N2O7S 430,44 429 (M-H, 57%)
— o
C22H22N209S 490,49 446 (M-C02,42%)
Figure imgf000198_0002
H
C16H17N308S 411 ,39 410 (M-H, 14%)
C16H14N208S 394,36 393 (M-H, 39%)
C16H14N207S2 410,43 409 (M-H, 51%)
C21H17N309S 487,45
Figure imgf000198_0003
486 (M-H, 17%)
\ S' P
C16H14N407S
: 406,38 405 (M-H, 17%)
C II.
C17H15N308S 421 ,39 420 (M-H, 18%) 197
X.
C17H15N307S 405,39 404 (M-H, 43%)
Figure imgf000199_0001
N -
C17H15N307S 405,39 404 (M-H, 41%)
C21 H16F6N207S
CC 554,43 553 (M-H, 18%)
o
0 C20H20N2O9S2 496,52 495 (M-H, 51%)
Figure imgf000199_0002
C20H16F2N2O7S 466,42 465 (M-H,43%)
C16H16N208S 396,38 510 (M+TFA,21%)
Figure imgf000199_0003
CH,
C22H19N309S 501 ,48 500 (M-H,23%)
Figure imgf000199_0004
C18H22N208S 426,45 425 (M-H,24%)
C21 H23N307S 461 ,50 460 (M-H,23%)
PC
C19H16N209S 448,41 447 (M-H, 42%) lf0Cx '
XX HN^ .0 C22H23N308S 489,51
T 488 (M-H,33%)
C20H18N2O9S 462,44 418 (M-C02,27%) 198
O C20H18N2O8S 446,44 445 (M-H, 16%)
X m C20H19N3O8S 461 ,45 460 (M-H,21%)
0
0^/CH3
C16H18N208S 398,39 380 (M-H20,25%) Xi
°~-X C18H16N208S 420,40 421 (M+H, 39%)
0 N^x. C15H17N308S H 1 399,38 398 (M-H, 19%)
9 C19H18N207S2 450,49 449 (M-H,23%) x, cø C20H20N2O7S2 464,52 463 (M-H, 31%) x,
X1 ^0
C21 H17N308S 471 ,45 470 (M-H, 32%) H
0 cA H " C22H19N308S 485,48 No hit
A C20H17N3O10S 491 ,44 No hit
X
Qc i C22H21 N308S 487,49 486 (M-H, 17%)
CH, C18H21 N308S 439,45 438 (M-H, 30%) 0
Figure imgf000200_0001
199
N C25H21 N5O9S 567,54 566 (M-H, 32%)
<"
Figure imgf000201_0001
N- ] \ I H
H,C _-^s, ^s f-
C23H22N2O10S 518,50 519 (M+H, 15%)
C21 H20N4O7S 472,48 471 (M-H,41%) -
C23H21 N309S 515,50 514 (M-H, 45%)
O" N
H C16H19N308S 413,41 412 (M-H,26%)
-S^^ ^ H C18H23N308S2 473,53 472 (M-H, 31%) x,
H,C__
Figure imgf000201_0002
C25H25N309S 543,56 542 (M-H,20%)
CH, X,
O P N C18H23N308S 441 ,46
Figure imgf000201_0003
440 (M-H,28%)
,^\
C28H23N309S 577,57 576 (M-H, 17%)
C18H16N208S 420,40 419 (M-H, 34%)
Figure imgf000201_0004
Figure imgf000201_0005
C22H22N207S 458,49 457 (M-H,22%)
C26H18N209S 534,51 No hit
V 200 y 1 .-^ ,0
C23H20N2O8S 484,49 No hit
C 1A ! °
°x C21 H16N209S 472,43 471 (M-H, 30%) x,
C21 H18N208S 458,45 457 (M-H,27%) x,
A cxN°γCH. C22H19N309S 501 ,48 500 (M-H, 30%)
0 X,
Figure imgf000202_0002
EXAMPLE 133
Figure imgf000202_0001
3-(Oxalyl-amino)-thieno[2.3-b]pyridine-2-carboxylic acid, mono sodium salt;
To a stirred solution of 3-amino-thieno[2,3-b]pyridine-2-carboxyiic acid methyl ester (1.0 g, 4.8 mmol), triethylamine (1.0 ml, 7.20 mmol) in dry tetrahydrofuran (50 ml) at 0 °C was added dropwise a solution of ethyl oxalyl chloride (0.8 g, 5.76 mmol) in dry tetrahydrofuran (5 ml). The resulting reaction mixture was stirred at room temperature for 3 h. pored into ice water (200 ml). The precipitate was filtered off and dried in vacuo at 50 °C which afforded 0.9 g (61 %) of 3-(ethoxyoxalyl-amino)-thieno[2,3-b]pyridine-2-carboxylic acid methyl ester as a solid.
The a solution of the above thieno[2,3-b]pyridine-2-carboxylic acid methyl ester (0.5 g, 1.62 mmol) in ethanol (20 ml) was added a solution of sodium hydroxide (0.2 g, 4.87 mmol) in water (10 ml). The resulting reaction mixture was stirred at room temperature for 18 h., acidified to pH « 4 by addition of 1 N aqueous hydrochloric acid the precipitate was filtered off 201 and washed with water (2 x 50 ml), diethyl ether (2 x 30 ml) and dried in vacuo at 50 °C affording 130 mg (30 %) of the title compound as a solid.
M.p.: > 250 °C
Calculated for doHsN ^Na,, 1 x H20 ; C, 39.22 %; H, 2.30 %; N, 9.15 %. Found: C, 39.32 %; H, 2.35 %; N, 8.89 %.
EXAMPLE 134
HO v_o ϊA-W OH
N WA^N O H O
7-.Oxalyl-amino0thieno[2,3-b]pyrazine-6-carboxylic acid;
To a solution of 6-amino-thieno[2,3-b]pyrazine-7-carboxylic acid methyl ester (62.7 mg, 0.3 mmol) in tetrahydrofuran (0.5 ml) was added imidazol-1-yl-oxo-acetic acid tert-butyl ester (117.6 mg, 0.6 mmol) and triethylamine (42 μl, 0.3 mmol). The resulting mixture was stirred for 20 h at room temperature. The volatiles were removed in vacuo and the residue was dissolved in ethyl acetate (5.0 ml), washed with 1 % hydrochloric acid (2 x 2 ml), water (2 x 2 ml), dried (MgS04), filtered and the solvent evaporated in vacuo affording 96 mg (95 %) of 6-(tert-butoxyoxalyl-amino)- thieno[2,3-b]pyrazine-7-carboxylic acid methyl ester as a solid.
Η NMR (400 MHz, CDCI3) δ 1.60 (s, 9H), 3.80 (s, 3H), 8.60 (d, 1 H, J = 1.5 Hz), 8.70 (d, 1 H, J = 1.5 Hz).
To a solution of the above 6-(tert-butoxyoxalyl-amino)-thieno[2,3-b]pyrazine-7-carboxylic acid methyl ester (37.8 mg, 0.112 mmol) in dioxane (1.2 ml) was added lithium hydroxide (45 mg) and water (0.6 ml) and the mixture was stirred for 20 h at room temperature. The volatiles were evaporated in vacuo and the residue dissolved in ethyl acetate (30 ml), washed with 1.0 N hydrochloric acid (3 x 3 ml), water (3 x 3 mi), dried (Na2S04), filtered and the solvent evaporated in vacuo affording 20 mg (67 %) of the title compound as a solid. 202 H NMR (400 MHz, CD3OD) δ 8.64 (d, 1 H, J = 1.5 Hz), 8.66 (1 H, d, J = 1.5 Hz). S m/z 150.0 (M-117) loose of COOH and COCOOH.
Figure imgf000204_0001
o OH 5-(Oxalyl-amino02.3-dihydro-thieno[2,3-b]furan-4-carboxylic acid:
To a solution of dihydro-furan-3-one (11.5 g, 0.134 mol, prepared as described in Org. Syn. Coll. Vol. 5, 866) in ethanol (200 ml) was added ethyl cyanoacetate (16.6 g, 0.147 mol), sulfur (4.7 g, 0.147 mol) and morpholine (15 ml). The moderate exothermic reaction was stirred at 45 °C for 1 h. The reaction mixture was cooled, filtered and the filtrate evaporated in vacuo. The resultant oil was dissolved in ethyl acetate (400 ml), washed with water (2 x 100 ml), brine (100 ml) and dried (Na2S04). The solvent was evaporated in vacuo and the resi- due (28 g) was subjected to flash column chromatography (1 I silicagel) using ethyl acetate/hexanes (1 :1) as eluent. Semi-pure fractions were collected affording after evaporation in vacuo crude 8.4 g of 5-amino-2,3-dihydro-thieno[2,3-b]furan-4-carboxylic acid ethyl ester as an oil.
To the above 5-amino-2,3-dihydro-thieno[2,3-b]furan-4-carboxylic acid ethyl ester (8.4 g, 0.039 mol) dissolved in dry tetrahydrofuran (150 ml), was added triethylamine (10 ml) and a mixture of ethyl oxalyl chloride (4.9 g, 0.043 mol) in dry tetrahydrofuran (25 ml) was added dropwise at 0 °C under nitrogen. The reaction mixture was allowed to stir at room temperature for 18 hours. The volatiles were evaporated in vacuo and the residue dissolved in ethyl acetate (400 ml). The organic phase was washed with water (200 ml), brine (100 ml), dried (Na2S04), filtered and the organic phase evaporated in vacua The residue was filtered through a path of silicagel using a mixture of ethyl acetate and heptane (1 :1) as eluent. The solvent was evaporated in vacuo and the residue was subjected to flash column chromatography (1 I silicagel) using ethyl acetate/hexanes (1 :2) as eluent. Pure fractions were collected affording after evaporation in vacuo and washing of the residue with diethyl ether 0.5 g (1.2 203 %) of 5-(ethoxyoxalyl-amino)-2,3-dihydro-thieno[2,3-b]furan-4-carboxylic acid ethyl ester as an oil.
To a solution of the above 5-(ethoxyoxalyl-amino)-2,3-dihydro-thieno[2,3-b]furan-4-carboxylic acid ethyl ester (0.4 g, 1.2 mmol) in a mixture of ethanol (10 ml) and water (25 ml) was added a solution of 1 N sodium hydroxide (3.8 ml, 3.8 mmol). The mixture was stirred for 20 h at room temperature. The reaction mixture was diluted with water (50 ml) and washed with ethyl acetate (50 ml). The aqueous phase was acidified with 1 N hydrochloric acid to pH = 2. The precipitate was filtered off and washed with water, dried in vacuo at 50 °C affording 0.2 g of 5-(oxalyl-amino)-2,3-dihydro-thieno[2,3-b]furan-4-carboxylic acid ethyl ester according to NMR. The mono-ester was dissolved in a mixture of water (40 ml) and ethanol (10 ml) and to this mixture was added 1 N sodium hydroxide (3 ml, 3 mmol). The mixture was stirred for 20 h at room temperature. The mixture was acidified with 1 N hydrochloric acid to pH = 2 and the precipitate was filtered off, washed with water and dried in vacuo at 50 °C affording 150 mg (46 %) of the title compound as a solid.
M.p.: > 250 °C.
Η NMR (300 MHz, DMSO-d6) δ 3.12 (t, 2H), 4.89 (t, 2H), 12.0 (bs, 1 H, NHCO).

Claims

204 Claims
1 A compound that fulfills all of the following 3 criteria
(1) has a structure represented by Formula I
R.N/ 4
Figure imgf000206_0001
R
Formula I
where R, R2 and R4 are any chemical group or combination of chemical groups,
(2) acts as a phosphotyrosine recognition unit ligand, preferably an inhibitor or modulator of one or more PTPases or proteins that contain SH2 domains, and
(3) has a molecular weight below or equal to 2500 daltons
2 A compound according to claim 1 which has a structure represented by Formula II \ S- -A
┬░╬│^o OR .
Formula II
where R, R,and R4 are any chemical group or combination of chemical groups, and R, preferably is H
3 A compound that fulfills all of the following 3 criteria 205
(1) has a structure represented by Formula III:
*6\ .
RX "N ,/"R' "4* Or -H
R2OC^ ^ O
Figure imgf000207_0001
R2
Formula III
where R,, R2, R3, R4 and R5 are any chemical group or combination of chemical groups, and R3 and R5 may be covalently linked to each other;
(2) acts as a phosphotyrosine recognition unit ligand, preferably an inhibitor or modulator of one or more PTPases or proteins that contain SH2 domains; and
(3) has a molecular weight below or equal to 2500 daltons.
4. A compound according to claim 3 which has a structure represented by Formula IV
R5\ /R. c /R4
O
Figure imgf000207_0002
OR
Formula IV
where R.,, R3, R4 and R5 are any chemical group or combination of chemical groups, and R3 and R5 may be covalently linked to each other, and R preferably is H.
5. A compound according to claim 4 which has a structure represented by Formula V 206 O /C0R1 .R,
~N' or ~N'
Figure imgf000208_0001
OR
OR
Formula V
where R1 f R3, R4 and R5 are any chemical group or combination of chemical groups, and R3 and R5 may be covalently linked to each other, and R is preferably H.
6. A compound according to claim 5 which has a structure represented by Formula VI R^ ^COOH
N
Figure imgf000208_0002
OR
Formula VI
where R3, R4 and R5 are any chemical group or combination of chemical groups, and R3 and R5 may be covalently linked to each other, and R is preferably H.
7. A compound according to claim 3, which has a structure represented by Formula VII
or
Figure imgf000208_0003
Figure imgf000208_0004
Formula VII
where A together with the double bond in formula VII represents any aryl as defined above, and R1 f R2, R3 and R4 are any chemical group or combination of chemical groups. 207
8. A compound according to claim 7, which has a structure represented by Formula VIII
R<
Figure imgf000209_0001
Formula VIII
where A together with the double bond in formula VIII represents any aryl as defined above, and R, R,, R3 and R4 are any chemical group or combination of chemical groups, and R preferably is H.
9. A compound according to claim 7 which has a structure represented by Formula IX
COOR1
R AP R >~CCCOR2
Formula IX
where A together with the double bond in formula IX represents any aryl as defined above, and R1 t R2, R3 and R4 are any chemical group or combination of chemical groups.
10. A compound according to claim 9 which has a structure represented by Formula X
COOH
RA AC A A! COR,
R3 ^-^ O
Formula X
where A together with the double bond in formula X represents any aryl as defined above, and R2, R3 and R4 are any chemical group or combination of chemical groups. 208
11. A compound according to claim 10 which has a structure represented by Formula XI
COOR
Figure imgf000210_0001
Formula XI
where A together with the double bond in formula XI represents any aryl as defined above, and R, R3 and R4 are any chemical group or combination of chemical groups, and R preferably is H.
12. A compound according to claim 3 which has a structure represented by Formula XII
R1 R4 0
R3 t- S~ 0 ~ R2 O
Formula XII
where R, is a chemical group capable of being a proton donor and/or a proton acceptor, preferably -COOH, 5-tetrazolyl, -NH2, -CONH2, and R, R2, R3 and R4 are any chemical group or combination of chemical groups.
13. A compound according to any one of the preceding claims which substantially acts as a classical, competitive inhibitor of one or more PTPases.
14. A compound according to any one of claims 1 to 12 which substantially acts as a mixed- type inhibitor of one or more PTPases.
15. A compound according to any one of claims 1 to 14 which substantially acts as an inhibi- tor of one or more PTPases involved in regulation of tyrosine kinase signalling pathways.
16. A compound according to any one of claims 1 to 14 which substantially inhibits or modulates receptor-tyrosine kinase signalling pathways via interaction with one or more regulatory PTPases, preferably the signalling pathways of the insulin receptor, the IGF-I receptor and/or other members of the insulin receptor family, the EGF-receptor family, the platelet-derived 209 growth factor receptor family, the nerve growth factor receptor family, the hepatocyte growth factor receptor family, the growth hormone receptor family and/or members of other receptor- type tyrosine kinase families.
17. A compound according to any one of claims 1 to 14 which substantially inhibits or modulates non-receptor tyrosine kinase signalling through modulation of one or more regulatory PTPases, preferably modulation of members of the Src kinase family or other intracellular kinases.
18. A compound according to any one of claims 1 to 14 which substantially inhibits or modulates the activity of one or more PTPases that negatively regulate signal transduction pathways.
19. A compound according to any one of claims 1 to 14 which inhibits or modulates the activ- ity of one or more PTPases that positively regulate signal transduction pathways, preferably
CD45.
20. A compound according to any one of claims 1 to 14 which inhibits or modulates the activity of one or more PTPases that positively regulate signal transduction pathways in immune cells.
21. A compound according to any one of claims 1 to 14 which inhibits or modulates the activity of one or more PTPases that negatively regulate signal transduction pathway.
22. A compound according to any one of claims 1 to 14 which inhibits one or more PTPases via binding to the active site of said PTPase(s) or to other sites that negatively influences the binding of substrate to said PTPase(s), an allosteric modulator.
23. A compound according to any one of claims 1 to 14 which modulates the activity of one or more PTPases via interaction with structures positioned outside of the active sites of the enzymes, preferably SH2 domains.
210 24. A compound according to any one of claims 1 to 14 which modulates the signal transduction pathways via binding of the compounds of the invention to SH2 domains or PTB domains of non-PTPase signalling molecules.
25. A compound according to any of the preceding claims characterized by being a selective PTPase inhibitor or a compound that is a selective phosphotyrosine recognition unit ligand.
26. A compound according to any of claims 1 to 24 characterized by being a non-selective PTPase inhibitor.
27. A compound according to claim 26 characterized by being an inhibitor or modulator of at least 4 PTPases or 4 PTPase families.
28. A compound according to claim 25 characterized by being selective for a PTPase not de- scribed herein.
29. A compound according to claim 25 characterized by being selective for a PTPase listed in Table 1.
30. A compound according to claim 25 characterized by being selective for the PTP╬▒ family.
31. A compound according to claim 25 characterized by being selective for PTP╬▒.
32. A compound according to claim 25 characterized by being selective for PTP╬╡.
33. A compound according to claim 25 characterized by being selective for CD45.
34. A compound according to claim 25 characterized by being selective for PTP╬▓ family.
35. A compound according to claim 25 characterized by being selective for PTP╬▓.
36. A compound according to claim 25 characterized by being selective for PTP-DEP1. 211
37. A compound according to claim 25 characterized by being selective for PTP-LAR family.
38. A compound according to claim 25 characterized by being selective for PTP-LAR.
39. A compound according to claim 25 characterized by being selective for PTPσ.
40. A compound according to claim 25 characterized by being selective for PTP╬┤.
41. A compound according to claim 25 characterized by being selective for PTP╬╝ family.
42. A compound according to claim 25 characterized by being selective for PTP╬╝.
43. A compound according to claim 25 characterized by being selective for PTPK.
44. A compound according to claim 25 characterized by being selective for PTP1B family.
45. A compound according to claim 25 characterized by being selective for PTP1B.
46. A compound according to claim 25 characterized by being selective for TC-PTP.
47. A compound according to claim 25 characterized by being selective for SHP-PTP family.
48. A compound according to claim 25 characterized by being selective for SHP-1.
49. A compound according to claim 25 characterized by being selective for SHP-2.
50. A compound according to claim 25 characterized by being selective for PTP╬╢ family.
51. A compound according to claim 25 characterized by being selective for PTP╬╢. 212
52. A compound according to claim 25 characterized by being selective for PTP╬│.
53. A compound according to claim 25 characterized by being selective for PTP-PEST family.
54. A compound according to claim 25 characterized by being selective for PTPH1 family.
55. A compound according to claim 25 characterized by being selective for PTPHl
56. A compound according to claim 25 characterized by being selective for PTPD1.
57. A compound according to claim 25 characterized by being selective for PTPD2.
58. A compound according to claim 25 characterized by being selective for PTPMEG1.
59. A compound according to claim 25 characterized by being selective for IA-2 family.
60. A compound according to claim 25 characterized by being selective for IA-2.
61. A compound according to claim 25 characterized by being selective for IA-2╬▓.
62. A compound according to claim 25 characterized by being selective for PTPψ family.
63. A compound according to claim 25 characterized by being selective for PTPψ.
64. A compound according to claim 25 characterized by being selective for PTPp.
65. A compound according to claim 25 characterized by being selective for PTPφ.
66. A compound according to any one of the preceding claims having a molecular weight of less than 1000 Daltons, and preferably of more than 100 Daltons. 213
67. A compound according to any one of the preceding claims having a Kj value of less than 200 ╬╝M against one or more PTPases.
68. A compound according to any one of the preceding claims having a K| value of less than 2 ╬╝M against one or more PTPases.
69. A compound according to any one of the preceding claims having a K( value of less than 100 nM against one or more PTPases.
70. A compound according to any one of the preceding claims having a IC50 value of less than 200 M against one or more molecules with phosphotyrosine recognition unit(s).
71. A compound according to any one of the preceding claims having a IC50 value of less than 2 M against one or more molecules with phosphotyrosine recognition unit(s).
72. A compound according to any one of the preceding claims having a IC50 value of less than 100 nM against one or more molecules with phosphotyrosine recognition unit(s).
73. A compound according to any one of claims 1 to 66 having a Kj value of < 2 ╬╝M against one or two PTPases or PTPase families and a K| value of > 50 ╬╝M against at least two other PTPases or PTPase families.
74. A compound according to any one of claims 1 to 66 having a K| value of < 100 nM against one or two PTPases or PTPase families and a Kj value of > 10 ╬╝M against at least two other PTPases or PTPase families.
75. The use of a compound according to any one of the preceding claims for preparing a medicament for modulating the activity of one or more PTPases or other molecules with phosphotyrosine recognition unit(s). 214
76. The use of a compound according to any one of claims 1 to 74 for preparing a medicament for managing, treating or preventing type I diabetes, type II diabetes, impaired glucose tolerance, insulin resistance, obesity, immune dysfunctions including autoimmunity and AIDS, diseases with dysfunctions of the coagulation system, allergic diseases, osteoporosis, proliferative disorders including cancer and psoriasis, diseases with decreased or increased synthesis or effects of growth hormone, diseases with decreased or increased synthesis of hormones or cytokines that regulate the release of/or response to growth hormone, diseases of the brain including Alzheimer's disease and schizophrenia, and infectious diseases.
77. The use of a compound according to any one of claims 1 to 74 for preparing a medicament for managing, treating or preventing type I diabetes, type II diabetes, impaired glucose tolerance, insulin resistance, and/or obesity.
78. The use of a compound according to any one of claims 1 to 74 for preparing a medicament for managing, treating or preventing conditions with immune dysfunctions, including autoimmunity such as rheumatoid arthritis, systemic lupus erythematosus.
79. The use of a compound according to any one of claims 1 to 74 for preparing a me- dicament for use as an immunosuppressant.
80. The use of a compound according to any one of claims 1 to 74 for preparing a medicament for managing or treating conditions with immune dysfunctions including AIDS.
81. The use of a compound according to any one of claims 1 to 74 for preparing a medicament for managing, treating or preventing allergic diseases, including asthma and allergic skin diseases.
82. The use of a compound according to any one of claims 1 to 74 for preparing a me- dicament for managing, treating or preventing proliferative disorders, including cancer.
83. The use of a compound according to any one of claims 1 to 74 for preparing a medicament for managing, treating or preventing osteoporosis. 215
84. The use of a compound according to any one of claims 1 to 74 for preparing a medicament for managing, treating or preventing psoriasis.
85. The use of a compound according to any one of claims 1 to 74 for preparing a me- dicament for managing, treating or preventing diseases with decreased or increased synthesis or effects of growth hormone, diseases with decreased or increased synthesis of hormones or cytokines that regulate the release of/or response to growth hormone.
86. The use of a compound according to any one of claims 1 to 74 for preparing a me- dicament for managing, treating or preventing diseases with dysfunctions of the coagulation system.
87. The use of a compound according to any one of claims 1 to 74 for preparing a medicament for managing, treating or preventing diseases of the brain including Alzheimer's disease and schizophrenia.
88. The use of a compound according to any one of claims 1 to 74 for preparing a medicament for managing, treating or preventing infectious diseases.
89. A pharmaceutical composition comprising an effective amount of a compound according to any one of claims 1 to 74 together with a pharmaceutically acceptable carrier or diluent.
90. The pharmaceutical composition according to claim 89 comprising between 0.5 mg and 1000 mg of a compound according to any one of the claims 1 to 74 per unit dose.
91. A method of modulating the activity of one or more PTPases or other molecules with phosphotyrosine recognition unit(s) in a subject in need of such management comprising administering to said subject an effective amount of a compound or composition according to any one of claims 1 to 74.
92. A compound according to any one of claims 1 to 74 coupled to a suitable solid-phase matrix. 216
93. A method for isolating a protein or a glycoprotein with affinity for a compound according to any one of claims 1 to 74 from a biological sample, comprising:
ΓÇó contacting an immobilized compound according to claim 89 with said biological sample in order for said immobilized compound to form a complex by binding said protein or glycoprotein,
ΓÇó removing unbound material from said biological sample and isolating said complex, and
ΓÇó extracting said protein or glycoprotein from said complex.
94. A method for isolating a protein-tyrosine phosphatase with affinity for a compound ac- cording to any one of claims 1 to 71 from a biological sample, comprising
ΓÇó contacting an immobilised compound according to claim 89 with said biological sample in order for said immobilised compound to form a complex by binding said protein- tyrosine phosphatase
ΓÇó removing unbound material from said biological sample and isolating said complex ΓÇó extracting said protein-tyrosine phosphatase.
95. A method for isolating a Src-homology 2 domain containing protein or a phosphotyrosine binding domain containing protein with affinity for a compound according to any one of the preceding compound claims from a biological sample, comprising ΓÇó contacting an immobilized compound according to claim 89 with said biological sample in order for said immobilized compound to form a complex by binding said Src- homology 2 domain containing protein or a phosphotyrosine binding domain containing protein
ΓÇó removing unbound material from said biological sample and isolating said complex ΓÇó extracting said Src-homology 2 domain containing protein or a phosphotyrosine binding domain containing protein from said complex.
96. A compound according to any one of claims 1 to 71 coupled to a fluorescent or radioactive molecule.
97. A method for coupling a fluorescent or radioactive molecule to a compound according to any one of claims 1 to 71 comprising
ΓÇó contacting said compound with said fluorescent or radioactive molecule in a reaction mixture to produce a complex 217
ΓÇó removing uncomplexed material and isolating said complex from said reaction mixture.
98. A method for detecting protein-tyrosine phosphatase or other molecules with phosphotyrosine recognition unit(s) in a cell or in a subject using a com- pound according to claim 93 comprising
ΓÇó contacting said cell or an extract thereof or a biological sample from said subject or by injecting said compound into said subject in order for said compound to produce a complex with said protein-tyrosine phosphatase or said molecules with phosphotyrosine recognition unit(s) ΓÇó detecting said complex, thereby detecting the presence of said protein tyrosine phosphatase or said other molecules with phosphotyrosine recognition unit(s).
99. A method for quantifying the amount of protein-tyrosine phosphatases or other molecules with phosphotyrosine recognition unit(s) in a cell or in a subject using a compound according to claim 93 comprising
ΓÇó contacting said ceil or an extract thereof or a biological sample from said subject or by injecting said compound into said subject in order for said compound to produce a complex with said protein-tyrosine phosphatase or said molecules with phosphotyrosine recognition unit(s) ΓÇó measuring the amount of said complex, thereby detecting the presence of said protein tyrosine phosphatase or said molecules with phosphotyrosine recognition unit(s).
100. A method for determining the function of a given protein-tyrosine phosphatase or group of protein-tyrosine phosphatases or said molecules with phosphotyrosine recogni- tion unit(s) in a cell or a subject using a compound according to claim 93 comprising
ΓÇó contacting said cell or an extract thereof or a biological sample from said subject or by injecting said compound into said subject in order for said compound to produce a complex with said protein-tyrosine phosphatase or said molecules with phosphotyrosine recognition unit(s) ΓÇó measuring the biological effects induced by said complex.
101. A compound which after uptake in cells or mammals has a structure and a function as defined in any one of claims 1 to 71.
PCT/DK1999/000126 1998-03-12 1999-03-12 Modulators of protein tyrosine phosphatases WO1999046237A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
HU0102612A HUP0102612A2 (en) 1998-03-12 1999-03-12 Modulators of protein tyrosine phosphatases
BR9908723-5A BR9908723A (en) 1998-03-12 1999-03-12 Compound, use of same, pharmaceutical composition, processes to modulate the activity of one or more ptpases or other molecules with phosphotyrosine recognition unit (s) in an individual in need of this control, to isolate a protein, to copulate a fluorescent molecule or radiation to a compound, to detect protein tyrosine phosphatase or other molecules, to quantify the amount of protein tyrosine phosphatase or other molecules, and, to determine the function of a given protein tyrosine phosphatase or protein tyrosine phosphatase group or said molecules .
IL13831899A IL138318A0 (en) 1998-03-12 1999-03-12 Modulators of protein tyrosine phosphatases
CA002323472A CA2323472A1 (en) 1998-03-12 1999-03-12 Modulators of protein tyrosine phosphatases
KR1020007010089A KR20010041811A (en) 1998-03-12 1999-03-12 Modulators of protein tyrosine phosphatases
JP2000535620A JP2004500308A (en) 1998-03-12 1999-03-12 Modulator of protein tyrosine phosphatase
EP99907336A EP1080068A1 (en) 1998-03-12 1999-03-12 Modulators of protein tyrosine phosphatases
MXPA00008921A MXPA00008921A (en) 1998-03-12 1999-03-12 Modulators of protein tyrosine phosphatases.
AU27139/99A AU2713999A (en) 1998-03-12 1999-03-12 Modulators of protein tyrosine phosphatases
NO20004526A NO20004526L (en) 1998-03-12 2000-09-11 Modulators for protein tyrosine phosphatases

Applications Claiming Priority (50)

Application Number Priority Date Filing Date Title
DK0344/98 1998-03-12
DK0345/98 1998-03-12
DK34398 1998-03-12
DK0342/98 1998-03-12
DK35098 1998-03-12
DK0347/98 1998-03-12
DK34598 1998-03-12
DK34498 1998-03-12
DK34898 1998-03-12
DK0350/98 1998-03-12
DK34298 1998-03-12
DK34698 1998-03-12
DK0346/98 1998-03-12
DK34798 1998-03-12
DK0348/98 1998-03-12
DK0475/98 1998-04-03
DK47898 1998-04-03
DK0480/98 1998-04-03
DK0472/98 1998-04-03
DK0479/98 1998-04-03
DK0474/98 1998-04-03
DK47398 1998-04-03
DK47298 1998-04-03
DK48098 1998-04-03
DK47498 1998-04-03
DK0478/98 1998-04-03
DK47998 1998-04-03
DK47598 1998-04-03
DK47698 1998-04-03
DK0476/98 1998-04-03
US8291298P 1998-04-24 1998-04-24
US60/082,912 1998-04-24
DK0667/98 1998-05-15
DK66798 1998-05-15
US8811598P 1998-06-05 1998-06-05
US60/088,115 1998-06-05
DK0938/98 1998-07-15
DKPA199800938 1998-07-15
DK0939/98 1998-07-15
DK0940/98 1998-07-15
DKPA199800939 1998-07-15
DKPA199800940 1998-07-15
DK1385/98 1998-10-28
DKPA199801385 1998-10-28
DKPA199801561 1998-11-26
DK0473/98 1998-11-26
DK1561/98 1998-11-26
DK0343/98 1998-11-26
DKPA199801612 1998-12-07
DK1612/98 1998-12-07

Publications (1)

Publication Number Publication Date
WO1999046237A1 true WO1999046237A1 (en) 1999-09-16

Family

ID=27586755

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK1999/000126 WO1999046237A1 (en) 1998-03-12 1999-03-12 Modulators of protein tyrosine phosphatases

Country Status (6)

Country Link
EP (1) EP1080068A1 (en)
JP (1) JP2004500308A (en)
KR (1) KR20010041811A (en)
HU (1) HUP0102612A2 (en)
NO (1) NO20004526L (en)
WO (1) WO1999046237A1 (en)

Cited By (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000061180A2 (en) * 1999-04-09 2000-10-19 Max-Planck-Gesellsschaft Zur Förderung Der Wissenschaften E.V. Products and methods for treating ptp lar related diseases
WO2001017516A2 (en) * 1999-09-10 2001-03-15 Novo Nordisk A/S Method of inhibiting protein tyrosine phosphatase 1b and/or t-cell protein tyrosine phosphatase and/or other ptpases with an asp residue at position 48
WO2001019831A1 (en) * 1999-09-10 2001-03-22 Novo Nordisk A/S MODULATORS OF PROTEIN TYROSINE PHOSPHATASES (PTPases)
WO2001019830A1 (en) * 1999-09-10 2001-03-22 Novo Nordisk A/S MODULATORS OF PROTEIN TYROSINE PHOSPHATASES (PTPases)
WO2001022954A2 (en) * 1999-09-28 2001-04-05 Baxter Healthcare Sa Indolyl-3-glyoxylic acid derivatives serving as antitumor agents
EP1127883A2 (en) * 2000-02-24 2001-08-29 F. Hoffmann-La Roche Ag Oxamides as IMPDH inhibitors
WO2002004458A1 (en) * 2000-07-07 2002-01-17 Novo Nordisk A/S Modulators of protein tyrosine phosphatases (ptpases)
WO2002004459A1 (en) * 2000-07-07 2002-01-17 Novo Nordisk A/S Modulators of protein tyrosine phosphatases (ptpases)
DE10038709A1 (en) * 2000-08-09 2002-02-28 Aventis Pharma Gmbh Substituted and unsubstituted benzooxathiazoles and compounds derived from them
WO2002045500A2 (en) * 2000-12-06 2002-06-13 Deltagen, Inc. Transgenic mice containing ptp36 tyrosine phosphatase disruptions
WO2002045497A2 (en) * 2000-12-06 2002-06-13 Deltagen, Inc. Transgenic mice containing dusp8 phosphatase gene disruptions
US6410556B1 (en) 1999-09-10 2002-06-25 Novo Nordisk A/S Modulators of protein tyrosine phosphateses (PTPases)
WO2003002569A1 (en) * 2001-06-29 2003-01-09 Novo Nordisk A/S Method of inhibiting ptp 1b and/or t-cell ptp and/or other ptpases with an asp residue at position 48
WO2003020688A1 (en) * 2001-08-29 2003-03-13 Abbott Laboratories Selective protein tyrosine phosphatase inhibitors
FR2829766A1 (en) * 2001-09-14 2003-03-21 Lipha Composition useful in the treatment of pathologies associated with e.g. hyperglycemia, diabetes, dyslipidemia, obesity, arterial hypertension, neuropathies, and nephropathies, comprises oxamate derivatives
US6613903B2 (en) 2000-07-07 2003-09-02 Novo Nordisk A/S Modulators of protein tyrosine phosphatases (PTPases)
WO2003072537A2 (en) * 2002-02-27 2003-09-04 Abbott Laboratories Selective protein tyrosine phosphatatase inhibitors
US6627767B2 (en) 2000-08-29 2003-09-30 Abbott Laboratories Amino(oxo) acetic acid protein tyrosine phosphatase inhibitors
US6693119B2 (en) 1998-04-02 2004-02-17 Baxter Healthcare Sa Indolyl-3-glyoxylic acid derivatives having therapeutically valuable properties
JP2005520480A (en) * 2000-06-29 2005-07-14 ノース ショア−ロング アイランド ジューイッシュ ヘルス システム Regulators of cell proliferation and angiogenesis, methods of use and identification thereof
US6951878B2 (en) 1998-03-12 2005-10-04 Novo Nordisk A/S Benzo[b]thiophenyl or tetrahydro-benzo[b]thiophenyl modulators of protein tyrosine phosphatases (PTPases)
US7115624B1 (en) 1999-09-10 2006-10-03 Novo Nordisk A/S Method of inhibiting protein tyrosine phosphatase 1B and/or T-cell protein tyrosine phosphatase 4 and/or other PTPases with an Asp residue at position 48
US7148216B2 (en) 2000-11-06 2006-12-12 Combinatorx, Inc. Combinations of drugs for the treatment of neoplastic disorders
EP1741446A2 (en) 2000-01-21 2007-01-10 Novartis AG Combinations comprising dipeptidylpeptidase-IV inhibitors and antidiabetic agents
WO2007033266A2 (en) 2005-09-14 2007-03-22 Takeda Pharmaceutical Company Limited Dipeptidyl peptidase inhibitors for treating diabetis
US7521473B2 (en) 2004-02-25 2009-04-21 Wyeth Inhibitors of protein tyrosine phosphatase 1B
US7579365B2 (en) 1998-04-02 2009-08-25 Ziophram Oncology, Inc. Indolyl-3-glyoxylic acid derivatives having antitumor action
WO2011041293A1 (en) 2009-09-30 2011-04-07 Takeda Pharmaceutical Company Limited Pyrazolo [1, 5-a] pyrimidine derivatives as apoptosis signal-regulating kinase 1 inhibitors
WO2011097079A1 (en) 2010-02-03 2011-08-11 Takeda Pharmaceutical Company Limited Apoptosis signal-regulating kinase 1 inhibitors
US8940721B2 (en) 2005-05-26 2015-01-27 Aldexa Therapeutics, Inc. Compositions and methods of treating retinal disease
US9133210B2 (en) 2013-08-08 2015-09-15 Galapagos Nv Compounds and pharmaceutical compositions thereof for the treatment of cystic fibrosis
US9351954B2 (en) 2009-12-04 2016-05-31 Sunovion Pharmaceuticals Inc. Multicyclic compounds and methods of use thereof
US9371287B2 (en) 2009-03-20 2016-06-21 Vertex Pharmaceuticals Incorporated Process for making modulators of cystic fibrosis transmembrane conductance regulator
US9604997B2 (en) 2012-12-20 2017-03-28 Aldeyra Therapeutics, Inc. Peri-carbinols
US9687481B2 (en) 2013-01-23 2017-06-27 Aldeyra Therapeutics, Inc. Toxic aldehyde related diseases and treatment
US9701639B2 (en) 2014-10-07 2017-07-11 Vertex Pharmaceuticals Incorporated Co-crystals of modulators of cystic fibrosis transmembrane conductance regulator
US9814701B2 (en) 2009-12-11 2017-11-14 Aldeyra Therapeutics, Inc. Compositions and methods for the treatment of macular degeneration
US9931334B2 (en) 2005-12-28 2018-04-03 Vertex Pharmaceuticals Incorporated Solid forms of N[2,4-bis(1,1-dimethylethyl)-5-hydroxyphenyl]-1,4-dihydro-4-oxoquinoline-3-carboxamide
US10111862B2 (en) 2013-01-25 2018-10-30 Aldeyra Therapeutics, Inc. Traps in the treatment of macular degeneration
US10196403B2 (en) 2016-07-29 2019-02-05 Sunovion Pharmaceuticals Inc. Compounds and compositions and uses thereof
US10272046B2 (en) 2012-02-27 2019-04-30 Vertex Pharmaceuticals Incorporated Pharmaceutical composition and administrations thereof
US10414732B2 (en) 2017-03-16 2019-09-17 Aldeyra Therapeutics, Inc. Polymorphic compounds and uses thereof
US10550085B2 (en) 2015-08-21 2020-02-04 Aldeyra Therapeutics, Inc. Deuterated compounds and uses thereof
US10646481B2 (en) 2008-08-13 2020-05-12 Vertex Pharmaceuticals Incorporated Pharmaceutical composition and administrations thereof
US10662192B2 (en) 2004-06-24 2020-05-26 Vertex Pharmaceuticals Incorporated Modulators of ATP-binding cassette transporters
US10780074B2 (en) 2017-08-02 2020-09-22 Sunovion Pharmaceuticals Inc. Compounds and uses thereof
US10815249B2 (en) 2018-02-16 2020-10-27 Sunovion Pharmaceuticals Inc. Salts, crystal forms, and production methods thereof
US11028232B2 (en) * 2017-12-19 2021-06-08 Wacker Chemie Ag Process for preparing siloxanes containing oxamido ester groups
US11040039B2 (en) 2017-10-10 2021-06-22 Aldeyra Therapeutics, Inc. Treatment of inflammatory disorders
US11077090B2 (en) 2016-07-29 2021-08-03 Sunovion Pharmaceuticals Inc. Compounds and compositions and uses thereof
US11129823B2 (en) 2016-05-09 2021-09-28 Aldeyra Therapeutics, Inc. Combination treatment of ocular inflammatory disorders and diseases
US11129807B2 (en) 2017-02-16 2021-09-28 Sunovion Pharmaceuticals Inc. Methods of treating schizophrenia
US11136304B2 (en) 2019-03-14 2021-10-05 Sunovion Pharmaceuticals Inc. Salts of a heterocyclic compound and crystalline forms, processes for preparing, therapeutic uses, and pharmaceutical compositions thereof
US11312692B1 (en) 2018-08-06 2022-04-26 Aldeyra Therapeutics, Inc. Polymorphic compounds and uses thereof
US11738002B2 (en) 2020-04-14 2023-08-29 Sunovion Pharmaceuticals Inc. Methods of treating neurological and psychiatric disorders
US11958862B2 (en) 2021-01-11 2024-04-16 Sumitomo Pharma America, Inc. Compounds and compositions and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996040113A2 (en) * 1995-06-07 1996-12-19 Sugen, Inc. Phosphatase inhibitors

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996040113A2 (en) * 1995-06-07 1996-12-19 Sugen, Inc. Phosphatase inhibitors

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
CANCER RESEARCH, Volume 52, No. 16, 1992, JOHANNA F. GEISSLER et al., "Benzopyranones and Benzothiopyranones: A Class of Tyrosine Protein Kinase Inhibitors with Selectivity for the V-Abl Kinase", pages 4492-4498. *

Cited By (104)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6951878B2 (en) 1998-03-12 2005-10-04 Novo Nordisk A/S Benzo[b]thiophenyl or tetrahydro-benzo[b]thiophenyl modulators of protein tyrosine phosphatases (PTPases)
US6693119B2 (en) 1998-04-02 2004-02-17 Baxter Healthcare Sa Indolyl-3-glyoxylic acid derivatives having therapeutically valuable properties
US7452910B2 (en) 1998-04-02 2008-11-18 Ziopharm Oncology, Inc. Indolyl-3-glyoxylic acid derivatives having therapeutically valuable properties
US7579365B2 (en) 1998-04-02 2009-08-25 Ziophram Oncology, Inc. Indolyl-3-glyoxylic acid derivatives having antitumor action
WO2000061180A3 (en) * 1999-04-09 2001-06-28 Max Planck Gesellschaft Products and methods for treating ptp lar related diseases
WO2000061180A2 (en) * 1999-04-09 2000-10-19 Max-Planck-Gesellsschaft Zur Förderung Der Wissenschaften E.V. Products and methods for treating ptp lar related diseases
US6410556B1 (en) 1999-09-10 2002-06-25 Novo Nordisk A/S Modulators of protein tyrosine phosphateses (PTPases)
WO2001017516A3 (en) * 1999-09-10 2001-11-08 Novo Nordisk As Method of inhibiting protein tyrosine phosphatase 1b and/or t-cell protein tyrosine phosphatase and/or other ptpases with an asp residue at position 48
WO2001017516A2 (en) * 1999-09-10 2001-03-15 Novo Nordisk A/S Method of inhibiting protein tyrosine phosphatase 1b and/or t-cell protein tyrosine phosphatase and/or other ptpases with an asp residue at position 48
WO2001019830A1 (en) * 1999-09-10 2001-03-22 Novo Nordisk A/S MODULATORS OF PROTEIN TYROSINE PHOSPHATASES (PTPases)
WO2001019831A1 (en) * 1999-09-10 2001-03-22 Novo Nordisk A/S MODULATORS OF PROTEIN TYROSINE PHOSPHATASES (PTPases)
US7019026B1 (en) 1999-09-10 2006-03-28 Novo Nordisk A/S Modulators of Protein Tyrosine Phosphatases (PTPases)
US7115624B1 (en) 1999-09-10 2006-10-03 Novo Nordisk A/S Method of inhibiting protein tyrosine phosphatase 1B and/or T-cell protein tyrosine phosphatase 4 and/or other PTPases with an Asp residue at position 48
CZ303246B6 (en) * 1999-09-28 2012-06-20 Ziopharm Oncology, Inc. Medicament for treating tumors exhibiting drug resistance
CN1301712C (en) * 1999-09-28 2007-02-28 巴克斯特保健股份有限公司 Indolyl-3-glyoxylic acid derivatives comprising therapeutically valuable properties
KR100759242B1 (en) * 1999-09-28 2007-09-18 박스터 헬쓰케어 에스.에이. Indolyl-3-glyoxylic acid derivatives comprising therapeutically valuable properties
WO2001022954A3 (en) * 1999-09-28 2002-03-28 Baxter Healthcare Sa Indolyl-3-glyoxylic acid derivatives serving as antitumor agents
WO2001022954A2 (en) * 1999-09-28 2001-04-05 Baxter Healthcare Sa Indolyl-3-glyoxylic acid derivatives serving as antitumor agents
EP1743655A1 (en) 2000-01-21 2007-01-17 Novartis AG Combinations comprising dipeptidylpeptidase-IV inhibitors and antidiabetic agents
EP1741446A2 (en) 2000-01-21 2007-01-10 Novartis AG Combinations comprising dipeptidylpeptidase-IV inhibitors and antidiabetic agents
US6867299B2 (en) 2000-02-24 2005-03-15 Hoffmann-La Roche Inc. Oxamide IMPDH inhibitors
EP1127883A2 (en) * 2000-02-24 2001-08-29 F. Hoffmann-La Roche Ag Oxamides as IMPDH inhibitors
EP1127883A3 (en) * 2000-02-24 2002-08-07 F. Hoffmann-La Roche Ag Oxamides as IMPDH inhibitors
JP2005520480A (en) * 2000-06-29 2005-07-14 ノース ショア−ロング アイランド ジューイッシュ ヘルス システム Regulators of cell proliferation and angiogenesis, methods of use and identification thereof
WO2002004458A1 (en) * 2000-07-07 2002-01-17 Novo Nordisk A/S Modulators of protein tyrosine phosphatases (ptpases)
WO2002004459A1 (en) * 2000-07-07 2002-01-17 Novo Nordisk A/S Modulators of protein tyrosine phosphatases (ptpases)
US6613903B2 (en) 2000-07-07 2003-09-02 Novo Nordisk A/S Modulators of protein tyrosine phosphatases (PTPases)
DE10038709A1 (en) * 2000-08-09 2002-02-28 Aventis Pharma Gmbh Substituted and unsubstituted benzooxathiazoles and compounds derived from them
US6972340B2 (en) 2000-08-29 2005-12-06 Abbott Laboratories Selective protein tyrosine phosphatatase inhibitors
US6627767B2 (en) 2000-08-29 2003-09-30 Abbott Laboratories Amino(oxo) acetic acid protein tyrosine phosphatase inhibitors
US7148216B2 (en) 2000-11-06 2006-12-12 Combinatorx, Inc. Combinations of drugs for the treatment of neoplastic disorders
WO2002045497A2 (en) * 2000-12-06 2002-06-13 Deltagen, Inc. Transgenic mice containing dusp8 phosphatase gene disruptions
WO2002045500A3 (en) * 2000-12-06 2003-04-24 Deltagen Inc Transgenic mice containing ptp36 tyrosine phosphatase disruptions
WO2002045497A3 (en) * 2000-12-06 2003-10-02 Deltagen Inc Transgenic mice containing dusp8 phosphatase gene disruptions
WO2002045500A2 (en) * 2000-12-06 2002-06-13 Deltagen, Inc. Transgenic mice containing ptp36 tyrosine phosphatase disruptions
WO2003002569A1 (en) * 2001-06-29 2003-01-09 Novo Nordisk A/S Method of inhibiting ptp 1b and/or t-cell ptp and/or other ptpases with an asp residue at position 48
WO2003020688A1 (en) * 2001-08-29 2003-03-13 Abbott Laboratories Selective protein tyrosine phosphatase inhibitors
WO2003024946A2 (en) * 2001-09-14 2003-03-27 Merck Patent Gmbh Oxamate derivatives containing a variously substituted nitrogen heterocycle
WO2003024946A3 (en) * 2001-09-14 2003-12-04 Merck Patent Gmbh Oxamate derivatives containing a variously substituted nitrogen heterocycle
FR2829766A1 (en) * 2001-09-14 2003-03-21 Lipha Composition useful in the treatment of pathologies associated with e.g. hyperglycemia, diabetes, dyslipidemia, obesity, arterial hypertension, neuropathies, and nephropathies, comprises oxamate derivatives
WO2003072537A3 (en) * 2002-02-27 2003-12-18 Abbott Lab Selective protein tyrosine phosphatatase inhibitors
WO2003072537A2 (en) * 2002-02-27 2003-09-04 Abbott Laboratories Selective protein tyrosine phosphatatase inhibitors
US7521473B2 (en) 2004-02-25 2009-04-21 Wyeth Inhibitors of protein tyrosine phosphatase 1B
US10662192B2 (en) 2004-06-24 2020-05-26 Vertex Pharmaceuticals Incorporated Modulators of ATP-binding cassette transporters
US11724987B2 (en) 2005-05-26 2023-08-15 Aldeyra Therapeutics, Inc. Compositions and methods of treating retinal disease
US9650342B2 (en) 2005-05-26 2017-05-16 Aldeyra Therapeutics, Inc. Compositions and methods of treating retinal disease
US8940721B2 (en) 2005-05-26 2015-01-27 Aldexa Therapeutics, Inc. Compositions and methods of treating retinal disease
US8940764B2 (en) 2005-05-26 2015-01-27 Aldexa Therapeutics, Inc. Compositions and methods of treating retinal disease
US10202348B2 (en) 2005-05-26 2019-02-12 Aldeyra Therapeutics, Inc. Compositions and methods of treating retinal disease
US9265759B2 (en) 2005-05-26 2016-02-23 Aldeyra Therapeutics, Inc. Compositions and methods of treating retinal disease
US10913722B2 (en) 2005-05-26 2021-02-09 Aldeyra Therapeutics, Inc. Compositions and methods of treating retinal disease
US9364471B2 (en) 2005-05-26 2016-06-14 Aldeyra Therapeutics, Inc. Compositions and methods of treating retinal disease
US9896419B2 (en) 2005-05-26 2018-02-20 Aldeyra Therapeutics, Inc. Compositions and methods of treating retinal disease
WO2007033266A2 (en) 2005-09-14 2007-03-22 Takeda Pharmaceutical Company Limited Dipeptidyl peptidase inhibitors for treating diabetis
US10537565B2 (en) 2005-12-28 2020-01-21 Vertex Pharmaceuticals Incorporated Solid forms of N-[2,4-bis(1,1-dimethylethyl)-5-hydroxyphenyl]-1,4-dihydro-4-oxoquinoline-3-carboxamide
US11291662B2 (en) 2005-12-28 2022-04-05 Vertex Pharmaceuticals Incorporated Solid forms of n-[2,4-bis(1,1-dimethylethyl)-5-hydroxyphenyl]-1,4-dihydro-4-oxoquinoline-3-carboxamide
US9931334B2 (en) 2005-12-28 2018-04-03 Vertex Pharmaceuticals Incorporated Solid forms of N[2,4-bis(1,1-dimethylethyl)-5-hydroxyphenyl]-1,4-dihydro-4-oxoquinoline-3-carboxamide
US11564916B2 (en) 2008-08-13 2023-01-31 Vertex Pharmaceuticals Incorporated Pharmaceutical composition and administrations thereof
US10646481B2 (en) 2008-08-13 2020-05-12 Vertex Pharmaceuticals Incorporated Pharmaceutical composition and administrations thereof
US9371287B2 (en) 2009-03-20 2016-06-21 Vertex Pharmaceuticals Incorporated Process for making modulators of cystic fibrosis transmembrane conductance regulator
US9751839B2 (en) 2009-03-20 2017-09-05 Vertex Pharmaceuticals Incorporated Process for making modulators of cystic fibrosis transmembrane conductance regulator
WO2011041293A1 (en) 2009-09-30 2011-04-07 Takeda Pharmaceutical Company Limited Pyrazolo [1, 5-a] pyrimidine derivatives as apoptosis signal-regulating kinase 1 inhibitors
US10085968B2 (en) 2009-12-04 2018-10-02 Sunovion Pharmaceuticals Inc. Multicyclic compounds and methods of use thereof
US9351954B2 (en) 2009-12-04 2016-05-31 Sunovion Pharmaceuticals Inc. Multicyclic compounds and methods of use thereof
US10894033B2 (en) 2009-12-04 2021-01-19 Sunovion Pharmaceuticals Inc. Multicyclic compounds and methods of use thereof
US9814701B2 (en) 2009-12-11 2017-11-14 Aldeyra Therapeutics, Inc. Compositions and methods for the treatment of macular degeneration
WO2011097079A1 (en) 2010-02-03 2011-08-11 Takeda Pharmaceutical Company Limited Apoptosis signal-regulating kinase 1 inhibitors
US10272046B2 (en) 2012-02-27 2019-04-30 Vertex Pharmaceuticals Incorporated Pharmaceutical composition and administrations thereof
US11752106B2 (en) 2012-02-27 2023-09-12 Vertex Pharmaceuticals Incorporated Pharmaceutical composition and administrations thereof
US11147770B2 (en) 2012-02-27 2021-10-19 Vertex Pharmaceuticals Incorporated Pharmaceutical composition and administrations thereof
US9604997B2 (en) 2012-12-20 2017-03-28 Aldeyra Therapeutics, Inc. Peri-carbinols
US10543181B2 (en) 2013-01-23 2020-01-28 Aldeyra Therapeutics, Inc. Toxic aldehyde related diseases and treatment
US10588874B2 (en) 2013-01-23 2020-03-17 Aldeyra Therapeutics, Inc. Toxic aldehyde related diseases and treatment
US9687481B2 (en) 2013-01-23 2017-06-27 Aldeyra Therapeutics, Inc. Toxic aldehyde related diseases and treatment
US11701331B2 (en) 2013-01-23 2023-07-18 Aldeyra Therapeutics, Inc. Toxic aldehyde related diseases and treatment
US10213395B2 (en) 2013-01-23 2019-02-26 Aldeyra Therapeutics, Inc. Toxic aldehyde related diseases and treatment
US11771664B2 (en) 2013-01-23 2023-10-03 Aldeyra Therapeutics, Inc. Toxic aldehyde related diseases and treatment
US11007157B2 (en) 2013-01-23 2021-05-18 Aldeyra Therapeutics, Inc. Toxic aldehyde related diseases and treatment
US10111862B2 (en) 2013-01-25 2018-10-30 Aldeyra Therapeutics, Inc. Traps in the treatment of macular degeneration
US10568867B2 (en) 2013-08-08 2020-02-25 Galapagos Nv Compounds and pharmaceutical compositions thereof for the treatment of cystic fibrosis
US9895347B2 (en) 2013-08-08 2018-02-20 Galapagos Nv Compounds and pharmaceutical compositions thereof for the treatment of cystic fibrosis
US9133210B2 (en) 2013-08-08 2015-09-15 Galapagos Nv Compounds and pharmaceutical compositions thereof for the treatment of cystic fibrosis
US9701639B2 (en) 2014-10-07 2017-07-11 Vertex Pharmaceuticals Incorporated Co-crystals of modulators of cystic fibrosis transmembrane conductance regulator
US11459300B2 (en) 2015-08-21 2022-10-04 Aldeyra Therapeutics, Inc. Deuterated compounds and uses thereof
US11845722B2 (en) 2015-08-21 2023-12-19 Aldeyra Therapeutics, Inc. Deuterated compounds and uses thereof
US11046650B2 (en) 2015-08-21 2021-06-29 Aldeyra Therapeutics, Inc. Deuterated compounds and uses thereof
US10550085B2 (en) 2015-08-21 2020-02-04 Aldeyra Therapeutics, Inc. Deuterated compounds and uses thereof
US11129823B2 (en) 2016-05-09 2021-09-28 Aldeyra Therapeutics, Inc. Combination treatment of ocular inflammatory disorders and diseases
US11077090B2 (en) 2016-07-29 2021-08-03 Sunovion Pharmaceuticals Inc. Compounds and compositions and uses thereof
US10196403B2 (en) 2016-07-29 2019-02-05 Sunovion Pharmaceuticals Inc. Compounds and compositions and uses thereof
US10927124B2 (en) 2016-07-29 2021-02-23 Sunovion Pharmaceuticals Inc. Compounds and compositions and uses thereof
US11129807B2 (en) 2017-02-16 2021-09-28 Sunovion Pharmaceuticals Inc. Methods of treating schizophrenia
US10414732B2 (en) 2017-03-16 2019-09-17 Aldeyra Therapeutics, Inc. Polymorphic compounds and uses thereof
US10780074B2 (en) 2017-08-02 2020-09-22 Sunovion Pharmaceuticals Inc. Compounds and uses thereof
US11491133B2 (en) 2017-08-02 2022-11-08 Sunovion Pharmaceuticals Inc. Heteroaryl-isochroman compounds and uses thereof
US11040039B2 (en) 2017-10-10 2021-06-22 Aldeyra Therapeutics, Inc. Treatment of inflammatory disorders
US11583529B2 (en) 2017-10-10 2023-02-21 Aldeyra Therapeutics, Inc. Treatment of inflammatory disorders
US11028232B2 (en) * 2017-12-19 2021-06-08 Wacker Chemie Ag Process for preparing siloxanes containing oxamido ester groups
US10815249B2 (en) 2018-02-16 2020-10-27 Sunovion Pharmaceuticals Inc. Salts, crystal forms, and production methods thereof
US11440921B2 (en) 2018-02-16 2022-09-13 Sunovion Pharmaceuticals Inc. Salts, crystal forms, and production methods thereof
US11312692B1 (en) 2018-08-06 2022-04-26 Aldeyra Therapeutics, Inc. Polymorphic compounds and uses thereof
US11136304B2 (en) 2019-03-14 2021-10-05 Sunovion Pharmaceuticals Inc. Salts of a heterocyclic compound and crystalline forms, processes for preparing, therapeutic uses, and pharmaceutical compositions thereof
US11738002B2 (en) 2020-04-14 2023-08-29 Sunovion Pharmaceuticals Inc. Methods of treating neurological and psychiatric disorders
US11958862B2 (en) 2021-01-11 2024-04-16 Sumitomo Pharma America, Inc. Compounds and compositions and uses thereof

Also Published As

Publication number Publication date
JP2004500308A (en) 2004-01-08
HUP0102612A2 (en) 2001-11-28
KR20010041811A (en) 2001-05-25
NO20004526D0 (en) 2000-09-11
NO20004526L (en) 2000-11-08
EP1080068A1 (en) 2001-03-07

Similar Documents

Publication Publication Date Title
EP1080068A1 (en) Modulators of protein tyrosine phosphatases
US6410586B1 (en) Modulators of protein tyrosine phosphatases (PTPases)
JP2004500308A5 (en)
WO1999046267A1 (en) Modulators of protein tyrosine phosphatases (ptpases)
US6225329B1 (en) Modulators of protein tyrosine phosphatases (PTPases)
US7019026B1 (en) Modulators of Protein Tyrosine Phosphatases (PTPases)
EP1080095A1 (en) Modulators of protein tyrosine phosphatases (ptpases)
EP1214324B1 (en) MODULATORS OF PROTEIN TYROSINE PHOSPHATASES (PTPases)
US6169087B1 (en) Modulators of protein tyrosine phosphatases (PTPases)
US20020019412A1 (en) Modulators of protein tyrosine phosphatases (ptpases)
EP1062218A1 (en) MODULATORS OF PROTEIN TYROSINE PHOSPHATASES (PTPases)
WO1999046236A1 (en) Modulators of protein tyrosine phosphatases (ptpases)
WO1999046244A1 (en) Modulators of protein tyrosine phosphatases (ptpases)
US20020002199A1 (en) Modulators of protein tyrosine phosphatases (ptpases)
WO2001017516A2 (en) Method of inhibiting protein tyrosine phosphatase 1b and/or t-cell protein tyrosine phosphatase and/or other ptpases with an asp residue at position 48
US6410556B1 (en) Modulators of protein tyrosine phosphateses (PTPases)
US7115624B1 (en) Method of inhibiting protein tyrosine phosphatase 1B and/or T-cell protein tyrosine phosphatase 4 and/or other PTPases with an Asp residue at position 48
AU2713999A (en) Modulators of protein tyrosine phosphatases
MXPA00008921A (en) Modulators of protein tyrosine phosphatases.
CZ20003229A3 (en) Compound and use thereof, pharmaceutical composition and use thereof, as well as method for adjusting activity, isolation, detection, amount determination and function of protein tyrosine phosphatases
EP1062199A1 (en) Modulators of protein tyrosine phosphatases (ptpases)
EP1062204A1 (en) Modulators of protein tyrosine phosphatases (ptpases)
CZ20003228A3 (en) Modulators of tyrosine phosphatase protein
MXPA00008927A (en) Modulators of protein tyrosine phosphatases (ptpases)

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 99806015.1

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 1999907336

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: PV2000-3229

Country of ref document: CZ

WWE Wipo information: entry into national phase

Ref document number: 138318

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 27139/99

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 1020007010089

Country of ref document: KR

ENP Entry into the national phase

Ref document number: 2323472

Country of ref document: CA

Ref document number: 2323472

Country of ref document: CA

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: PA/a/2000/008921

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: IN/PCT/2000/466/CHE

Country of ref document: IN

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1999907336

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1020007010089

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: PV2000-3229

Country of ref document: CZ

WWW Wipo information: withdrawn in national office

Ref document number: 1020007010089

Country of ref document: KR

WWW Wipo information: withdrawn in national office

Ref document number: 1999907336

Country of ref document: EP