WO1999037660A1 - Meth1 and meth2 polynucleotides and polypeptides - Google Patents

Meth1 and meth2 polynucleotides and polypeptides Download PDF

Info

Publication number
WO1999037660A1
WO1999037660A1 PCT/US1999/001313 US9901313W WO9937660A1 WO 1999037660 A1 WO1999037660 A1 WO 1999037660A1 US 9901313 W US9901313 W US 9901313W WO 9937660 A1 WO9937660 A1 WO 9937660A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polypeptide
amino acids
meth2
methl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1999/001313
Other languages
English (en)
French (fr)
Other versions
WO1999037660A9 (en
Inventor
Luisa Iruela-Arispe
Gregg A. Hastings
Steven M. Ruben
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Beth Israel Deaconess Medical Center Inc
Original Assignee
Human Genome Sciences Inc
Beth Israel Deaconess Medical Center Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020007008060A priority Critical patent/KR20010086224A/ko
Priority to EP99904190A priority patent/EP1049708A4/en
Priority to CA002319109A priority patent/CA2319109A1/en
Priority to NZ505855A priority patent/NZ505855A/en
Priority to MXPA00007165A priority patent/MXPA00007165A/es
Priority to AU24641/99A priority patent/AU766787B2/en
Application filed by Human Genome Sciences Inc, Beth Israel Deaconess Medical Center Inc filed Critical Human Genome Sciences Inc
Priority to JP2000528581A priority patent/JP2002501077A/ja
Publication of WO1999037660A1 publication Critical patent/WO1999037660A1/en
Publication of WO1999037660A9 publication Critical patent/WO1999037660A9/en
Anticipated expiration legal-status Critical
Priority to AU2004200046A priority patent/AU2004200046A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/78Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin or cold insoluble globulin [CIG]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/515Angiogenesic factors; Angiogenin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • the present invention relates to novel anti-angiogenic proteins, related to thrombospondin. More specifically, isolated nucleic acid molecules are provided encoding human METHl and METH2 (ME, for metalloprotease, and TH, for thrombospondin). METHl and METH2 polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same. Also provided are diagnostic methods for the prognosis of cancer and therapeutic methods for treating individuals in need of an increased amount of METHl or METH2.
  • Angiogenesis the formation of new blood vessels from pre-existing vasculature, is a tightly regulated process in normal adults. Under physiological circumstances, growth of new capillaries is tightly controlled by an interplay of growth regulatory proteins which act either to stimulate or to inhibit blood vessel growth. Normally, the balance between these forces is tipped in favor of inhibition and consequently blood vessel growth is restrained. Under certain pathological circumstances, however, local inhibitory controls are unable to restrain the
  • Angiogenesis is a key step in the metastasis of cancer (Folkman, Nature Med. 7:27-31 (1995)) and in abnormal wound healing, inflammation, rheumatoid arthritis, psoriasis, and diabetic retinopathy, it is integral to the pathology (Folkman et al, Science 235:442-441 (1987)), engendering the hope that these pathological entities could be regulated by pharmacological and/or genetic suppression of blood vessel growth (Iruela- Arispe et ⁇ /., Thromb. Haem. 75:672-677 1997)).
  • Thrombospondin- 1 is a 450 kDa, anti-angiogenic adhesive glycoprotein released from activated platelets and secreted by growing cells (reviewed in Adams, Int. J. Biochem. Cell. Biol. 29:861-865 (1997)).
  • TSP-1 is a homotrimer, with each subunit comprised of a 1152 amino acid residue polypeptide, post-translationally modified by N-linked glycosylation and beta- hydroxylation of asparagine residues.
  • TSP-1 protein and mR ⁇ A levels are regulated by a variety of factors.
  • TSP-1 protein levels are downregulated by IL-1 alpha and T ⁇ F alpha.
  • TSP-1 mR ⁇ A and protein levels are upregulated by polypeptide growth factors including PDGF, TGF-beta, and bFGF (Bornstein, Faseb J. 6: 3290-3299 (1992)) and are also regulated by the level of expression of the p53 tumor suppressor gene product (Dameron et al, Science 265: 1582-1584 (1994)).
  • PDGF PDGF
  • TGF-beta TGF-beta
  • bFGF Bornstein, Faseb J. 6: 3290-3299 (1992)
  • bFGF bFGF
  • At least four other members of the thrombospondin family have been identified: TSP-2, TSP-3, TSP-4, and
  • TSP-5 also called COMP.
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding the METHl polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence encoded by the cDNA clone deposited in a bacterial host as ATCC Deposit Number 209581 on
  • the present invention also provides isolated nucleic acid molecules comprising a polynucleotide encoding the METH2 polypeptide having the amino acid sequence shown in SEQ ID NO: 4 or the amino acid sequence encoded by the cDNA clone deposited in a bacterial host as ATCC Deposit Number 209582 on
  • the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of METHl or METH2 polypeptides or peptides by recombinant techniques.
  • the invention further provides an isolated METH 1 or METH2 polypeptide having an amino acid sequence encoded by a polynucleotide described herein.
  • the invention further provides a diagnostic method useful during diagnosis or prognosis of cancer.
  • An additional aspect of the invention is related to a method for treating an individual in need of an increased level of METHl or METH2 activity in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an isolated METHl or METH2 polypeptide of the invention or an agonist thereof.
  • Figure 1 shows the nucleotide (SEQ ID NO: l) and deduced amino acid (SEQ ID NO: 2) sequences of METHl .
  • the protein has a predicted leader sequence of about 28 amino acid residues (underlined).
  • Figure 2 shows the nucleotide (SEQ ID NO:3) and deduced amino acid
  • SEQ ID NO:4 sequences of METH2.
  • the protein has a predicted leader sequence of about 23 amino acid residues (underlined).
  • Figure 3 shows a comparison of the amino acid sequence of METHl (SEQ ID NO:2) and METH2 (SEQ ID NO:4) with that of their closest homologue, a bovine metalloprotease (pNPI) (SEQ ID NO:5). Identical amino acids are boxed.
  • FIG. 4 shows the primary structure of METHl, METH2 and pNPI which includes a prodomain, a catalytic metalloprotease domain, a cysteine rich disintegrin domain, a TSP-like domain, a spacer region and a different number of TSP-like domains, three for METHl, two for METH2, and four for pNPI.
  • Figure 5 shows a comparison of the TSP-like domain of METHl (SEQ ID
  • TSP1 SEQ ID NOs:6, 7, and 8
  • TSP2 SEQ ID NOs:9, 10, and 11
  • cysteines are numbered 1 to 6
  • tryptophans are marked by asterisks.
  • Figure 6 shows that peptides and recombinant protein derived from the TSP-like domain of METHl and METH2 block VEGF-induced angiogenesis.
  • Angiogenesis was induced on CAMs from 12-14-day-old embryos using a nylon mesh containing VEGF casted on matrigel and in the presence or absence of the peptides or recombinant protein. Capillary density was evaluated as described in Example 4. Positive and negative control included VEGF alone and vehicle alone, respectively.
  • A Quantification of the angiogenic response induced by VEGF in the presence of recombinant proteins. TSP1, purified platelet TSP1, GST, purified GST, GST-TSP1, GST-METH1, and GST-METH2 are described in Example 4.
  • the angiogenic index was expressed considering the vascular response from the VEGF -matrigel as 100% and subtracting the background levels (matrigel alone). Assays were repeated, at least, twice. Each treatment was done in triplicate. Values represent the mean, bars indicate standard deviations. *p ⁇ 0.001.
  • Figure 7 shows the effect of METHl and METH2 recombinant proteins on bFGF-stimulated cell proliferation.
  • Cells were cultured on 24-well plates in media containing bFGF and the recombinant protein to be tested (3 ⁇ g/ml, unless indicated in the graph).
  • Controls included vehicle or GST recombinant protein alone.
  • C HDF, human dermal fibroblasts;
  • D SMC, smooth muscle cells;
  • E Dose-response of GST-METH1 and GST-METH2 on HDEC proliferation. Experiments were repeated, at least, twice. Each treatment was done in triplicate. Values represent the mean, bars indicate standard deviations. *p ⁇ 0.01.
  • Figure 8 shows a schematic representation of the pHE4-5 expression vector (SEQ ID NO: 12) and the subcloned METHl or METH2 cDNA coding sequence. The locations of the kanamycin resistance marker gene, the METHl or METH2 coding sequence, the oriC sequence, and the laclq coding sequence are indicated.
  • Figure 9 shows the nucleotide sequence of the regulatory elements of the pHE promoter (SEQ ID NO: 13).
  • the two lac operator sequences, the Shine-Delgarno sequence (S D), and the terminal Hindlll and Ndel restriction sites (italicized) are indicated.
  • Figure 10 shows an analysis of the METHl amino acid sequence. Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown, and all were generated using the default settings. In the "Antigenic Index or
  • Figure 11 shows an analysis of the METH2 amino acid sequence.
  • Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown, and all were generated using the default settings.
  • the positive peaks indicate locations of the highly antigenic regions of the METHl or METH2 protein, i.e., regions from which epitope- bearing peptides of the invention can be obtained.
  • the domains defined by these graphs are contemplated by the present invention.
  • Tabular representation of the data summarized graphically in Figure 11 can be found in Table 2.
  • METHl and METH2 also called NEGA-1 and VEGA-2, respectively, for vascular endothelial growth antagonist
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding a METHl polypeptide having the amino acid sequence shown in SEQ ID NO: 2, which was determined by sequencing a cloned cDNA.
  • the METHl protein of the present invention shares sequence homology with thrombospondin- 1 and pNPI.
  • the nucleotide sequence shown in SEQ ID NO: 1 was obtained by sequencing a cDNA clone, which was deposited on January 15, 1998 at the American Type Culture Collection, 10801 University
  • the cDNA clone contained in ATCC Deposit No. 209581 contains a METHl sequence, encoding amino acids 1 to 950 of SEQ ID NO:2.
  • the present invention also provides isolated nucleic acid molecules comprising a polynucleotide encoding a METH2 polypeptide having the amino acid sequence shown in SEQ ID NO: 4, which was partially determined by sequencing a cloned cDNA.
  • the METH2 protein of the present invention shares sequence homology with thrombospondin- 1 and pNPI.
  • the nucleotide sequence shown in SEQ ID NO: 3 was partially obtained by sequencing a cDNA clone, which was deposited on January 15, 1998 at the American Type Culture
  • accession number 209582 The cDNA clone contained in ATCC Deposit No. 209582 contains a partial METH2 sequence, encoding amino acids 112-890 of SEQ ID NO:4. -33-
  • nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc.), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art.
  • a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
  • the information provided herein such as the nucleotide sequence in
  • a nucleic acid molecule of the present invention encoding a METHl or METH2 polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material.
  • the nucleic acid molecule described in SEQ ID NO : 1 was discovered in a cDN A library derived from human heart and the nucleic acid molecule described in SEQ ID NO: 3 was discovered in a cDNA library derived from human lung.
  • the determined nucleotide sequence of the METHl cDNA of SEQ ID NO: 1 contains an open reading frame encoding -34-
  • nucleotide sequence of the METH2 cDNA of SEQ ID NO 3 contains an open reading frame encoding a protein of about 890 amino acid residues, including a predicted leader sequence of about 23 amino acid residues
  • the present invention also provides the mature form(s) of the METHl and METH2 proteins of the present invention According to the signal hypothesis, proteins secreted by mammalian cells have a signal or secretory leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated Most mammalian cells and even insect cells cleave secreted proteins with the same specificity However, in some cases, cleavage of a secreted protein is not entirely uniform, which results in two or more mature species on the protein Further, it has long been known that the cleavage specificity of a secreted protein is ultimately determined by the primary structure of the complete protein, that is, it is inherent in the amino acid sequence of the polypeptide Therefore, the present invention provides a nucleotide sequence encoding the mature METHl polypeptide having the amino acid sequence encoded by the cDNA clone contained in the host identified as ATCC Deposit No 209581 and as shown in SEQ ID NO 2 The present
  • the predicted cleavage site based on computer analysis, and the mature METH2 may or may not differ from the predicted "mature" METH2 protein shown in SEQ ID NO 4 (amino acids from about 24 to about 890) depending on the accuracy of the predicted cleavage site based on computer analysis
  • Methods for predicting whether a protein has a secretory leader as well as the cleavage point for that leader sequence are available for instance, the methods of McGeoch (Virus Res. 3.271-286 (1985)) and von Heinje (Nucleic Acids Res.
  • the predicted amino acid sequence of the complete METHl and METH2 polypeptides of the present invention were analyzed by a computer program ("PSORT") (K NakaiandM Kanehisa, Genomics 14 897-911 (1992)), which is an expert system for predicting the cellular location of a protein based on the amino acid sequence
  • PSORT computer program
  • the analysis by the PSORT program predicted the cleavage site between amino acids 28 and 29 in SEQ ID NO 2 and amino acids 23 and 24 in SEQ ID NO 4
  • the complete amino acid sequences were further analyzed by visual inspection, applying a simple form of the (-1,-3) rule of von Heinje von Heinje, supra
  • the leader sequence for the METHl protein is predicted to consist of amino acid residues from about 1 to about 28 in SEQ ID NO 2
  • the mature METHl protein is predicted to consist of residues from about 29 to about 950
  • the predicted METHl polypeptide encoded by the deposited cDNA comprises about 950 amino acids, but may be anywhere in the range of 910-990 amino acids; and the predicted leader sequence of this protein is about
  • the predicted METH2 polypeptide comprises about 890 amino acids, but may be anywhere in the range of 850 to about 930 amino acids; and the predicted leader sequence of this protein is about 23 amino acids, but may be anywhere in the range of about 13 to about 33 amino acids.
  • nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically.
  • the DNA may be double-stranded or single-stranded.
  • Single-stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
  • isolated nucleic acid molecule(s) is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment.
  • recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention.
  • DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution.
  • Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention.
  • Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.
  • Isolated nucleic acid molecules of the present invention include DNA molecules comprising an open reading frame (ORF) shown in SEQ ID NO: l; DNA molecules comprising the coding sequence for the mature METHl protein; and DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode -37-
  • ORF open reading frame
  • DNA molecules comprising an open reading frame (ORF) shown in SEQ ID NO:3 are DNA molecules comprising the coding sequence for the mature METH2 protein; and DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the METH2 protein.
  • ORF open reading frame
  • DNA molecules comprising the coding sequence for the mature METH2 protein are DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the METH2 protein.
  • ORF open reading frame
  • the invention provides isolated nucleic acid molecules encoding the METHl or METH2 polypeptides having an amino acid sequence as encoded by the cDNA clones contained in the plasmids deposited as ATCC
  • nucleic acid molecules are provided encoding the mature METHl or METH2 polypeptide or the full- length METHl or METH2 polypeptide lacking the N-terminal methionine.
  • the invention also provides an isolated nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3 or the nucleotide sequence of the METHl or METH2 cDNA contained in the above-described deposited clones, or a nucleic acid molecule having a sequence complementary to one of the above sequences.
  • Such isolated molecules, particularly DNA molecules are useful as probes for gene mapping, by in situ hybridization with chromosomes, and for detecting expression of the METHl or METH2 gene in human tissue, for instance, by Northern blot analysis.
  • the present invention is further directed to fragments of the isolated nucleic acid molecules described herein.
  • a fragment of an isolated nucleic acid molecule having the nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3 is intended fragments at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt in length which are useful as diagnostic probes and primers as discussed herein.
  • 750, 800, 850, 900, 950, 1000, 1050, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, or 3000 nt in length are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequence of the deposited cDNA or as shown in SEQ ID NO: 1 or SEQ ID NO: 3.
  • fragments at least 20 nt in length are intended fragments which include 20 or more contiguous bases from the nucleotide sequence of the deposited cDNA or the nucleotide sequence as shown in SEQ ID NO: l or SEQ ID NO:3.
  • Preferred nucleic acid fragments of the present invention include nucleic acid molecules encoding epitope-bearing portions of the METHl or METH2 protein. Methods for determining epitope-bearing portions of the METHl and METH2 proteins are described in detail below.
  • nucleic acid fragments of the present invention include nucleic acid molecules encoding: the metalloprotease domain of METHl, amino acids 235 to 459 in SEQ ID NO:2; the disintegrin domain of METHl, amino acids 460 to 544 in SEQ ID NO:2; the first TSP-like domain of METHl, amino acids 545 to 598 in SEQ ID NO:2; the second TSP-like domain of METHl, amino acids 841 to 894 in SEQ ID NO:2; the third TSP-like domain of METHl, amino acids 895 to 934 in SEQ ID NO:2; amino acids 536 to 613 in SEQ ID NO:2; amino acids 549 to 563 in SEQ ID NO :2; the metalloprotease domain of METH2, amino acids 214 to 439 in SEQ ID NO:4; the disintegrin domain of METH2, amino acids 440 to 529 in SEQ ID NO:4; the first TSP-like domain of METH2, amino acids 530 to 583 in SEQ
  • HOUCQ 17RA SEQ ID NO: 14
  • HPLBM11R SEQ ID NO: 15
  • HGBI07R SEQ ID NO: 16
  • HNTMA49R SEQ ID NO: 17
  • HNALE27R SEQ ID NO: 18
  • HIBDB45R SEQ ID NO: 19
  • SEQ ID NO:20 The following public ESTs, which relate to portions of SEQ ID NO: l, have also been identified: D67076 (SEQ ID NO:20), AB001735 (SEQ ID NO:21), X14787 (SEQ ID NO:22), U64857 (SEQ ID NO:23), X04665 (SEQ ID NO:24), M64866 (SEQ ID NO:25), L07803 (SEQ ID NO:26), U08006 (SEQ ID NO:27), M16974 (SEQ ID NO:28), L13855 (SEQ ID NO:29), AL021529 (SEQ ID NO:20), AB001735 (SEQ ID NO:21), X14787 (SEQ ID NO:22), U64857 (SEQ ID NO:23), X04665 (SEQ ID NO:24), M64866 (SEQ ID NO:25), L07803 (SEQ ID NO:26), U08006 (SEQ ID NO:27), M16974 (SEQ ID
  • the present inventors have also identified the following cDNA clones related to portions of SEQ ID NO:3 : HCE4D69FP02 (SEQ ID NO:42), HIBDB45F (SEQ ID NO:43), HKIXH64R (SEQ ID NO:44), HIBDB45R (SEQ ID NO: 19), HCE3Z95R (SEQ ID NO:45), HTLEQ90R (SEQ ID NO:46), HMWEF45R (SEQ ID NO:47), HTOFC34RA (SEQ ID NO:48), HHFDI20R
  • the polynucleotides of the invention are less than 300 kb, 200 kb, 100 kb, 50 kb, 15 kb, 10 kb, or 7.5 kb in length.
  • polynucleotides of the invention comprise at least 15 contiguous nucleotides of METHl or METH2 coding sequence, but do not comprise all or a portion of any METHl or METH2 intron.
  • the nucleic acid comprising METHl or METH2 coding sequence does not contain coding sequences of a genomic flanking gene (i.e., 5 1 or 3' to the METHl or METH2 gene in the genome).
  • the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA clones contained in ATCC Deposit No. 209581 or ATCC Deposit No. 209582.
  • stringent hybridization conditions is intended overnight incubation at 42° C in a solution comprising: 50% formamide, 5x SSC (750 mM NaCI, 75mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 ⁇ g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1x SSC at about 65°C.
  • polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about
  • nucleotides and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30, 40, 50, 60 or 70 nt of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.
  • a polynucleotide which hybridizes only to a poly A sequence (such as the 3 ' terminal poly(A) tract of the METHl or METH2 cDNA shown in SEQ ID NO: l and SEQ ID NO:3, -41-
  • a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).
  • nucleic acid molecules that hybridize to the METHl or METH2 polynucleotides at moderately high stringency hybridization conditions. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature.
  • washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC).
  • Typical blocking reagents include
  • Denhardt's reagent BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations.
  • the inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
  • a polynucleotide which hybridizes only to polyA+ sequences may require modification of the hybridization conditions described above, due to problems with compatibility.
  • polynucleotide any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).
  • the METHl or METH2 polynucleotide can be composed of any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • METHl or METH2 polynucleotides can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded
  • RNA and RNA that is mixture of single- and double-stranded regions
  • hybrid molecules comprising DNA and RNA that may be single- stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • the METHl or METH2 polynucleotides can be composed of triple- stranded regions comprising RNA or DNA or both RNA and DNA.
  • METH2 polynucleotides may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritylated bases and unusual bases such as inosine.
  • a variety of modifications can be made to DNA and RNA; thus, “polynucleotide” embraces chemically, enzymatically, or metabolically modified forms.
  • SEQ ID NO: 1 refers to a METHl polynucleotide sequence while “SEQ ID NO:2” refers to a METHl polypeptide sequence.
  • SEQ ID NO:3 refers to a METH2 polynucleotide sequence while “SEQ ID NO:4" refers to a METH2 polypeptide sequence.
  • nucleic acid molecules of the present invention which encode a METHl or METH2 polypeptide may include, but are not limited to, those encoding the amino acid sequence of the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional sequences, such as those encoding the leader or secretory sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5 ' and 3 ' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; -43-
  • the sequence encoding the polypeptide may be fused to a marker sequence, such as a sequence encoding a peptide which facilitates purification of the fused polypeptide
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc ), among others, many of which are commercially available As described in Gentz etal, Proc. Natl. Acad. Sci.
  • hexa-histidine provides for convenient purification of the fusion protein
  • the "HA" tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein, which has been described by Wilson et al, Cell 37 161-118 (1984)
  • other such fusion proteins include the METHl or METH2 fused to Fc at the N- or C-terminus
  • the present invention further relates to variants of the nucleic acid molecules of the present invention, which encode portions, analogs or derivatives of the METHl or METH2 protein Variants may occur naturally, such as a natural allelic variant
  • allelic variant is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism Lewin, B , ed , Genes II, John Wiley & Sons, New York (1985)
  • Non-naturally occurring variants may be produced using art-known mutagenesis techniques
  • variants include those produced by nucleotide substitutions, deletions or additions, which may involve one or more nucleotides
  • the variants may be altered in coding regions, non-coding regions, or both Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the METHl or METH2 protein or portions thereof Also especially preferred in this regard are conservative substitutions
  • nucleic acid molecules comprising a polynucleotide having a nucleotide sequence at least 95% -44-
  • nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID NO 2 a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID NO 2, but lacking the N-terminal methionine, a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions from about 29 to about 950 in SEQ ID NO 2, a nucleotide sequence encoding the polypeptide having the amino acid sequence at position from about 30 to about 950 in SEQ ID NO 2, a nucleotide sequence encoding the polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No 209581, a nucleotide sequence encoding the mature METHl polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No 209581, a nucleotide sequence encoding amino acids
  • nucleotide sequence encoding amino acids 214 to 439 in SEQ ID NO 4 (the metalloprotease domain of METH2)
  • nucleotide sequence encoding amino acids 440 to 529 in SEQ ID NO 4 (the disintegrin domain of METH2)
  • nucleotide sequence encoding amino acids 530 to 583 in SEQ ID NO:4 (the first
  • TSP-like domain of METH2 a nucleotide sequence encoding amino acids 837 to 890 in SEQ ID NO 4 (the second TSP-like domain of METH2), a nucleotide sequence encoding amino acids 280 to 606 in SEQ ID NO 4, a nucleotide sequence encoding amino acids 529 to 548 in SEQ ID NO 4, or a nucleotide sequence complementary to any of the above nucleotide sequences
  • a polynucleotide having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence encoding a METHl or METH2 polypeptide is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the METHl or METH2 polypeptide
  • up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence
  • These mutations of the reference sequence may occur at the 5 ' or 3 ' terminal positions of
  • nucleic acid molecule is at least 95%, 96%, 97%, 98% or 99% identical to, for instance, the nucleotide sequence shown in SEQ ID NO 1 or SEQ ID NO 3 or to the nucleotide sequence of the deposited cDNA clones can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis -46-
  • Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of homology between two sequences.
  • Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
  • a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence can be determined using the FASTDB computer program based on the algorithm of Brutlag et al, Comp. Appl. Biosci. (5:237-245 (1990).
  • the query and subject sequences are both DNA sequences.
  • An RNA sequence can be compared by converting U's to T's. The result of said global sequence alignment is in percent identity.
  • the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is -47-
  • a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity
  • the deletions occur at the 5' end of the subject sequence and, therefore, the FASTDB alignment does not show a match/alignment of the first 10 bases at the 5' end
  • the 10 unpaired bases represent 10% of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases in the query sequence), so 10% is subtracted from the percent identity score calculated by the FASTDB program If the remaining
  • the present application is directed to nucleic acid molecules at least 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in SEQ ID NO:
  • nucleic acid sequence of the deposited cDNAs irrespective of whether they encode a polypeptide having METHl or METH2 activity This is because even where a particular nucleic acid molecule does not encode a polypeptide having METHl or METH2 activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a -48-
  • nucleic acid molecules of the present invention that do not encode a polypeptide having METHl or METH2 activity include, inter alia, (1) isolating the METHl or METH2 gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the METHl or METH2 gene, as described in Verma et al. , Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and (3) Northern Blot analysis for detecting METHl or METH2 mRNA expression in specific tissues.
  • a polypeptide having METHl activity is intended polypeptides exhibiting METHl activity in a particular biological assay.
  • METHl protein activity can be measured using the chorioallantoic membrane assay (Iruela-Arispe et al, Thrombosis and Haemostasis 78 (1): 672- 677 (1997)) or the cornea pocket assay (Tolsma et al, J. Cell. Biol. 122:491-511 (1993)), both described in Example 4, below.
  • a polypeptide having METH2 activity is intended polypeptides exhibiting METH2 activity in a particular biological assay.
  • METH2 protein activity can also be measured using the chorioallantoic membrane assay (Iruela-Arispe et al, Thrombosis and Haemostasis 78(1):612-611 (1997)) or the cornea pocket assay (Tolsma etal, J. Cell. Biol. 122:491-511 (1993)), both described in Example 4, below.
  • the potentially anti-angiogenic compound of interest is added to type I collagen pellets (Vitrogen), along with an angiogenic growth factor, such as bFGF.
  • the samples are mixed and placed onto nylon meshes, and allowed to polymerize. After polymerization is complete, the meshes are placed onto the chorioallantoic membrane of 12 day old chick embryos and placed at 37°C for 24 hours. The embryos then injected with a fluorescent -49-
  • FITC-dextran FITC-dextran
  • hydron pellets containing the compound of interest and an angiogenic growth factor, such as bFGF, are implanted 1 to 2mm from the limbus of the cornea of rats or mice. Response is examined after a period of time, for example 5 days. The extent of angiogenesis is evaluated by measuring the capillaries migrating from the limb of the cornea.
  • nucleic acid molecules having a sequence at least 95%, 96%, 97%, 98%, or 99% identical to a nucleic acid sequence of the deposited cDNAs or a nucleic acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3 will encode a polypeptide "having METHl or METH2 protein activity.”
  • degenerate variants of these nucleotide sequences all encode the same polypeptide, this will be clear to the skilled artisan even without performing the above described comparison assay.
  • the present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors, and the production of METHl or METH2 polypeptides or fragments thereof by recombinant techniques.
  • the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
  • a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
  • the DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
  • an appropriate promoter such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
  • Other suitable promoters will be known to the skilled artisan.
  • the expression constructs will further contain sites for transcription initiation, termination and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the mature transcripts expressed by the constructs will preferably include a translation initiating at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
  • the expression vectors will preferably include at least one selectable marker.
  • markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture and tetracycline or ampicillin resistance genes for culturing inE. coli and other bacteria.
  • Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art. -51-
  • vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from Qiagen, pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHl ⁇ a, pNH18A, pNH46A, available from Stratagene, and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia
  • preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene, and pSVK3, pBPV, pMSG and pSVL available from Pharmacia
  • Other suitable vectors will be readily apparent to the skilled artisan
  • the present invention further includes novel expression vectors comprising operator and promoter elements operatively linked to nucleotide sequences encoding a protein of interest
  • novel expression vectors comprising operator and promoter elements operatively linked to nucleotide sequences encoding a protein of interest
  • pHE4-5 is described in detail below
  • components of the pHE4-5 vector include 1) a neomycinphosphotransferase gene as a selection marker, 2) an E. coli origin of replication, 3) a T5 phage promoter sequence, 4) two lac operator sequences, 5) a Shine-Delgarno sequence, 6) the lactose operon repressor gene (laclq)
  • the origin of replication (oriC) is derived from pUC19 (LTI, Gaithersburg, MD)
  • the promoter sequence and operator sequences were made synthetically Synthetic production of nucleic acid sequences is well known in the art CLONTECH 95/96 Catalog, pages 215-216, CLONTECH, 1020 East Meadow Circle, Palo Alto, CA 94303
  • a nucleotide sequence encoding METHl (SEQ ID NO.2) or METH2 (SEQ ID NO 4) is operatively linked to the promoter and operator by inserting the nucleotide sequence between the Ndel and As
  • the pHE4-5 vector contains a laclq gene
  • L clq is an allele of the lacl gene which confers tight regulation of the lac operator Amann, E et al, Gene 69:301-3 5 (1988), Stark, M , Gene 51 255-267 (1987)
  • the laclq gene encodes a repressor protein which binds to lac operator sequences and blocks transcription of down-stream (;. e , 3 ') sequences
  • METHl or METH2 thus is not produced in appreciable quantities in uninduced host cells containing the pHE4-5 vector. Induction of these host cells by the addition of an agent such as IPTG, however, results in the expression of the
  • the promoter/operator sequences of thepHE4-5 vector comprise a T5 phage promoter and two lac operator sequences. One operator is located 5' to the transcriptional start site and the other is located 3' to the same site. These operators, when present in combination with the laclq gene product, confer tight repression of down-stream sequences in the absence of a lac operon inducer, e.g., IPTG. Expression of operatively linked sequences located downstream from the lac operators may be induced by the addition of a lac operon inducer, such as IPTG. Binding of a lac inducer to the laclq proteins results in their release from the lac operator sequences and the initiation of transcription of operatively linked sequences. Lac operon regulation of gene expression is reviewed in Devlin, T., TEXTBOOK OF BIOCHEMISTRY WITH CLINICAL CORRELATIONS, 4th Edition (1997), pages 802-807.
  • the pHE4 series of vectors contain all of the components of the pHE4-5 vector except for the METH 1 or METH2 coding sequence.
  • Features of the pHE4 vectors include optimized synthetic T5 phage promoter, lac operator, and Shine-Delgarno sequences. Further, these sequences are also optimally spaced so that expression of an inserted gene may be tightly regulated and high level of expression occurs upon induction.
  • known bacterial promoters suitable for use in the production of proteins of the present invention include the E. coli lacl and lacZ promoters, the T3 and T7 promoters, the gpt promoter, the lambda PR and PL promoters and the trp promoter.
  • Suitable eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous Sarcoma -53-
  • RS V Virus
  • metallothionein promoters such as the mouse metallothionein-I promoter.
  • the pHE4-5 vector also contains a Shine-Delgarno sequence 5' to the
  • Shine-Delgarno sequences are short sequences generally located about 10 nucleotides up-stream (i.e., 5') from the AUG initiation codon.
  • the present invention is also directed to expression vector useful for the production of the proteins of the present invention.
  • This aspect of the invention is exemplified by the pHE4-5 vector (SEQ ID NO: 12).
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al, Basic Methods In Molecular Biology (1986).
  • the polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals, but also additional heterologous functional regions. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification, or during subsequent handling and storage. Also, peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art.
  • a preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to solubilize proteins.
  • EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is -54-
  • the METHl or METH2 protein can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography ("HPLC") is employed for purification.
  • Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells.
  • polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
  • the invention further provides an isolated METHl polypeptide having the amino acid sequence encoded by the deposited cDNA, or the amino acid sequence in SEQ ID NO:2, or a peptide or polypeptide comprising a portion of the above polypeptides.
  • the invention also provides an isolated METH2 polypeptide having the amino acid sequence encoded by the deposited cDNA, or the amino acid sequence in SEQ ID NO.4, or a peptide or polypeptide comprising a portion of the above polypeptides.
  • METHl or METH2 polypeptides can be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain amino acids other than the 20 gene-encoded amino acids.
  • the METHl or METH2 polypeptides may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature.
  • Modifications can occur anywhere in the METHl or METH2 polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given METHl or METH2 polypeptide. Also, a given METH 1 or METH2 polypeptide may contain many types of modifications. METHl or METH2 polypeptides may be branched , for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic METHl or METH2 polypeptides may result from posttranslation natural processes or may be made by synthetic methods.
  • Modifications include acetylation, acylation, ADP- ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, -56-
  • METHl and METH2 inhibit angiogenesis in vitro and in vivo METHl and METH2 each contain a metalloprotease domain, a disintegrin domain, and TSP-like domains
  • the metalloprotease domain may be catalytically active
  • the disintegrin domain may play a role in inhibiting angiogenesis by interacting with integrins, since integrins are essential for the mediation of both proliferative and migratory signals
  • the present inventors have shown that peptides derived from the TSP-like domains of METHl and METH2 inhibit angiogenesis in vitro and in vivo
  • the invention further includes variations of the METHl polypeptide which show substantial METHl polypeptide activity or which include regions of METHl protein such as the protein portions discussed below, and variations of the METH2 polypeptide which show substantial METH2 polypeptide activity or which include regions of METH2 protein such as the protein portions discussed below
  • Such mutants include deletions, insertions, inversions, repeats
  • amino acid residues may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as an IgG Fc fusion region peptide or leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.
  • a conserved or non-conserved amino acid residue preferably a conserved amino acid residue
  • substituted amino acid residue may or may not be one encoded by the genetic code
  • changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein (see Table 3).
  • Amino acids in the METHl and METH2 proteins of the present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244 1081-1085 (1989))
  • site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244 1081-1085 (1989))
  • the latter procedure introduces single alanine mutations at every residue in the molecule
  • the resulting mutant molecules are then tested for biological activity such as in vitro or in vivo inhibition of angiogenesis
  • Sites that are critical for inhibition of angiogenesis can also be determined by structural analysis such as crystallization, nuclear magnetic -59-
  • polypeptides of the present invention are preferably provided in an isolated form.
  • isolated polypeptide is intended a polypeptide removed from its native environment.
  • a polypeptide produced and/or contained within a recombinant host cell is considered isolated for purposes of the present invention.
  • polypeptides that have been purified, partially or substantially, from a recombinant host cell or from a native source are polypeptides that have been purified, partially or substantially, from a recombinant host cell or from a native source.
  • a recombinantly produced version of the METHl or METH2 polypeptide can be substantially purified by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988).
  • polypeptides of the present invention include the METHl polypeptide encoded by the deposited cDNA including the leader; the mature METHl polypeptide encoded by the deposited the cDNA minus the leader (i.e., the mature protein); a polypeptide comprising amino acids about 1 to about 950 in SEQ ID NO:
  • polypeptide comprising amino acids about 2 to about 890 in SEQ ID NO:4; a polypeptide comprising amino acids about 24 to about 890 in SEQ ID NO:4; a polypeptide comprising amino acids about 112 to about 890 in SEQ ID NO:4; a polypeptide comprising the metalloprotease domain of METH2, amino acids 214 to 439 in SEQ ID NO:4; a polypeptide comprising the disintegrin domain of
  • polypeptides amino acids 440 to 529 in SEQ ID NO:4; a polypeptide comprising the first TSP-like domain of METH2, amino acids 530 to 583 in SEQ ID NO:4; a polypeptide comprising the second TSP-like domain of METH2, amino acids 837 to 890 in SEQ ID NO:4; a polypeptide comprising amino acids 280 to 606 in SEQ ID NO:4; a polypeptide comprising amino acids 529 to 548 in SEQ ED NO:4; as well as polypeptides which are at least 95% identical, and more preferably at least 96%, 97%, 98% or 99% identical to the polypeptides described above and also include portions of such polypeptides with at least 30 amino acids and more preferably at least 50 amino acids.
  • a polypeptide having an amino acid sequence at least, for example, 95%
  • amino acid sequence of a METHl or METH2 polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the METHl or METH2 polypeptide.
  • up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • any particular polypeptide is at least 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO 4 or to the amino acid sequence encoded by deposited cDNA clones can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package,
  • a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence can be determined using the FASTDB computer program based on the algorithm of Brutlag et al, Comp. App. Biosci. 6 237-245 (1990)
  • the query and subject sequences are either both nucleotide sequences or both amino acid sequences
  • the result of said global sequence alignment is in percent identity Preferred parameters used in a
  • a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity
  • the deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a match/alignment of the first 10 residues at the N-terminus
  • the 10 unpaired residues represent 10% of the sequence (number of residues at theN- and C-termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program If the remaining 90 residues were perfectly matched, the final percent identity would be 90%
  • a 90 residue subject sequence is compared with a 100 residue query sequence This time, the deletions are internal, so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query In this case, the percent identity calculated by FASTDB is not manually corrected Once again, only residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not
  • polypeptides of the present invention are useful as a molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art.
  • the invention provides a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide of the invention.
  • the epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide described herein.
  • An "immunogenic epitope” is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen.
  • a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope.”
  • the number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes. See, for instance, Geysen et al, Proc. Natl Acad. Sci. USA 81:3998- 4002 (1983).
  • peptides or polypeptides bearing an antigenic epitope i.e., that contain a region of a protein molecule to which an antibody can bind
  • relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein. See, for instance, Sutcliffe, J. G. et al, "Antibodies that react with predetermined sites on proteins", Science 219:660-666 (1983).
  • Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl terminals.
  • Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention. See, for instance, Wilson et al. , Cell 37:767-778 (1984) at 777.
  • Antigenic epitope-bearing peptides and polypeptides of the invention preferably contain a sequence of at least seven, more preferably at least nine and -64-
  • the epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means. Houghten, R. A., "General method for the rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody interaction at the level of individual amino acids", Proc. Natl. Acad. Sci. USA 52:5131-5135 (1985). This "Simultaneous Multiple Peptide Synthesis (SMPS)" process is further described in U.S. Patent No. 4,631,211 to Houghten et al. (1986).
  • SMPS Simultaneous Multiple Peptide Synthesis
  • METH 1 or METH2 polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
  • IgG immunoglobulins
  • These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human
  • CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al, Nature 331: 84- 86 (1988)).
  • Fusion proteins that have a disulfide-linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric METHl or METH2 protein or protein fragment alone (Fountoulakis et al, J. Biochem. 270:3958-3964 (1995)).
  • a "polynucleotide fragment” refers to a short polynucleotide having a nucleic acid sequence contained in the deposited clones or shown in SEQ ID NO: 1 or SEQ ID NO: 3.
  • the short nucleotide fragments are preferably at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt in length.
  • a fragment "at least 20 nt in length,” for example, is intended to include -65-
  • nucleotide fragments 20 or more contiguous bases from the cDNA sequence contained in the deposited clones or the nucleotide sequence shown in SEQ ID NO: l or SEQ ID NO:3. These nucleotide fragments are useful as diagnostic probes and primers as discussed herein. Of course, larger fragments (e.g., 50, 150, 500, 600, 2000 nucleotides) are preferred.
  • METH 1 or METH2 polynucleotide fragments include, for example, fragments having a sequence from about nucleotide number 1-50, 51-100, 101-150, 151-200, 201-250, 251-300, 301-350, 351-400, 401-450, 451-500, 501-550, 551-600, 651-700, 701-750, 751-800, 800- 850, 851-900, 901-950, 951-1000, 1001-1050, 1051-1 100, 1101-1150, 1151-
  • nucleotides at either terminus or at both termini.
  • these fragments encode a polypeptide which has biological activity. More preferably, these polynucleotides can be used as probes or primers as discussed herein.
  • polypeptide fragment refers to a short amino acid sequence contained in SEQ ID NO:2 or SEQ ID NO:4 or encoded by the cDNA contained in the deposited clones. Protein fragments may be "freestanding,” or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region. Representative examples of polypeptide fragments of the invention, include, for example, fragments from about amino acid number 1 -20, 21 -40, 41 -60, 61-80, 81-100, 102-
  • polypeptide fragments can be about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 amino acids in length. In this context "about” includes -66-
  • Preferred polypeptide fragments include the secreted METHl or METH2 protein as well as the mature form Further preferred polypeptide fragments include the secreted METHl or METH2 protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both
  • any number of amino acids, ranging from 1-60 can be deleted from the amino terminus of either the secreted METHl or METH2 polypeptide or the mature form
  • any number of amino acids, ranging from 1 -30 can be deleted from the carboxy terminus of the secreted METHl or METH2 protein or mature form
  • any combination of the above amino and carboxy terminus deletions are preferred
  • polynucleotide fragments encoding these METHl or METH2 polypeptide fragments are also preferred
  • N-terminal deletions of the METHl polypeptide can be described by the general formula m-950, where m is an integer from 2 to 949, where m corresponds to the position of the amino acid residue identified in SEQ ID NO 2
  • N-terminal deletions of the METHl polypeptide of the invention shown as SEQ ID NO 2 include polypeptides comprising the amino acid sequence of residues G-2 to S-950, N-3 to S-950, A-4 to S-950, E-5 to S-950, R-6 to S-950, A-7 to S-950, P-8 to S-950, G-9 to S-950, S-10 to S-950, R-l 1 to
  • 950 A-756 to S-950, D-757 to S-950, G-758 to S-950, T-759 to S-950, Y-760 to S-950, 1-761 to S-950, L-762 to S-950, N-763 to S-950, G-764 to S-950, D- 765 to S-950, Y-766 to S-950, T-767 to S-950, L-768 to S-950, S-769 to S-950, T-770 to S-950, L-771 to S-950, E-772 to S-950, Q-773 to S-950, D-774 to S- 950, 1-775 to S-950, M-776 to S-950, Y-777 to S-950, K-778 to S-950, G-779 -72-
  • S-950 V-780 to S-950, V-781 to S-950, L-782 to S-950, R-783 to S-950, Y- 784 to S-950, S-785 to S-950, G-786 to S-950, S-787 to S-950, S-788 to S-950, A-789 to S-950, A-790 to S-950, L-791 to S-950, E-792 to S-950, R-793 to S- 950, 1-794 to S-950, R-795 to S-950, S-796 to S-950, F-797 to S-950, S-798 to S-950, P-799 to S-950, L-800 to S-950, K-801 to S-950, E-802 to S-950, P-803 to S-950, L-804 to S-950, T-805 to S-950, 1-806 to S-950, Q-807 to S-950, V- 808 to S-950, L-809 to S-950, T-810 to S-
  • S-950 G-923 to S-950, G-924 to S-950, V-925 to S-950, L-926 to S-950, S- 927 to S-950, H-928 to S-950, E-929 to S-950, S-930 to S-950, C-931 to S-950, D-932 to S-950, P-933 to S-950, L-934 to S-950, K-935 to S-950, K-936 to S- 950, P-937 to S-950, K-938 to S-950, H-939 to S-950, F-940 to S-950, 1-941 to S-950, D-942 to S-950, F-943 to S-950, C-944 to S-950, T-945 to S-950, of SEQ
  • C-terminal deletions of the METHl polypeptide can also be described by the general formula 1-n, where n is an integer from 2 to 950, where n corresponds to the position of amino acid residue identified in SEQ ID NO 2
  • C-terminal deletions of the METHl polypeptide of the invention shown as SEQ ID NO 2 include polypeptides comprising the amino acid sequence of residues M-l to C-949, M-l to E-948, M-l to A-947, M-l to M-946, M-l to T-945 , M- 1 to C-944, M- 1 to F-943 , M- 1 to D-942, M- 1 to 1-941 , M- 1 to F-940, M-l to H-939, M-l to K-938, M-l to P-937, M-l to K-936, M-l to K-935, M-l to L-934, M-l to P-933, M-l to D-932, M-l to C-931
  • M-l to P-210 M-l to G-209; M-l to E-208; M-l to D-207; M-l to E- 206; M-l to G-205; M-l to E-204; M-l to T-203; M-l to G-202; M-l to E-201; M-l to D-200; M-l to E-199; M-l to D-198; M-l to E-197; M-l to T-196; M-l to E-195; M-l to A-194; M-l to K-193; M-l to G-192; M-l to T-191; M-l to P- 190; M-l to R-l89; M-l to P-188; M-l to E-187; M-l to D-186; M-l to D-185; M-l to V-184; M-l to V-183; M-l to G-182; M-l to C-181; M-l to T-180;
  • N-terminal deletions of the METH2 polypeptide can be described by the general formula m-890, where m is an integer from 2 to 889, where m corresponds to the position of the amino acid residue identified in SEQ ID NO:4.
  • N-terminal deletions of the METH2 polypeptide of the invention shown as SEQ ID NO: 4 include polypeptides comprising the amino acid sequence of residues: F-2 to L-890; P-3 to L-890; A-4 to L-890; P-5 to L-890; A-6 to L-890; A-7 to L-890; P-8 to L-890; R-9 to L-890; W-10 to L-890; L-l 1 to L-890; P-12 to L-890; F-13 to L-890; L-14 to L-890; L-15 to L-890; L-16 to
  • L-890 130 to L-890, G-131 to L-890, E-132 to L-890, E-133 to L-890, F-134 to L-890, T-135 to L-890, 1-136 to L-890, Q-137 to L-890, P-138 to L-890, Q-139 to L- 890, G-140 to L-890, A-141 to L-890, G-142 to L-890, G-143 to L-890, S-144 to L-890, L-145 to L-890, A-146 to L-890, Q-147 to L-890, P-148 to L-890, H- 149 to L-890, R-150 to L-890, L-151 to L-890, Q-152 to L-890, R-153 to L-890,
  • L-890 225 to L-890, L-226 to L-890, V-227 to L-890, A-228 to L-890, D-229 to L-890, A-230 to L-890, S-231 to L-890, M-232 to L-890, A-233 to L-890, A-234 to L- 890, F-235 to L-890, Y-236 to L-890, G-237 to L-890, A-238 to L-890, D-239 to L-890, L-240 to L-890, Q-241 to L-890, N-242 to L-890, H-243 to L-890, 1- 244 to L-890, L-245 to L-890, T-246 to L-890, L-247 to L-890, M-248 to L-890,
  • C-terminal deletions of the METH2 polypeptide can also be described by the general formula 1-n, where n is an integer from 2 to 890 where n corresponds to the position of amino acid residue identified in SEQ ED NO:4.
  • C-terminal deletions of the METH2 polypeptide of the invention shown as SEQ ID NO: 4 include polypeptides comprising the amino acid sequence of residues: M-l to P-889; M-l to C-888; M-l to L-887; M-l to Q-886; M-l to S-885; M-l to E-884; M-l to C-883; M-l to P-882; M-l to K-881; M-l to A- 880; M-l to D-879; M-l to E-878; M-l to P-877; M-l to K-876; M-l to L-875; M- 1 to A-874; M- 1 to K-873 ; M- 1 to N-872; M- 1 to C
  • M-l to G-704 M-l to G-703, M-l to Y-702, M-l to N-701, M-l to T-700, M-l to P-699, M-l to T-698, M-l to L-697, M-l to S-696, M-l to G-695, M-l to S-694, M-l to V-693, M-l to K-692, M-l to R-691, M-l to C-690, M-l to S-689, M-l to N-688, M-l to G-687, M-l to K-686, M-l to G-685, M-l to G-684, M-l to C-683, M-l to V-682, M-l to G-681, M-l to C-680, M-l to K-679, M-l to D- 678, M-l to L-677, M-l to K-676, M-l to R-675, M-l to P-674, M-l to S
  • the invention also provides polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini, which may be described generally as having residues m-n of SEQ ID NO:2 or SEQ ID NO:4, where n and m are integers as described above.
  • METHl or METH2 polypeptide and polynucleotide fragments characterized by structural or functional domains.
  • Preferred embodiments of the invention include fragments that comprise alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet-forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions”), coil and coil-forming regions ("coil-regions”), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface- forming regions, substrate binding region, and high antigenic index regions.
  • such preferred regions include Garnier-Robson alpha- regions, beta-regions, turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and turn-regions, Kyte-Doolittle hydrophilic regions and hydrophobic regions, Eisenberg alpha and beta amphipathic regions, Karplus- Schulz flexible regions, Emini surface-forming regions, and Jameson-Wolf high -92-
  • polypeptide fragments of SEQ ID NO: 2 falling within conserved domains are specifically contemplated by the present invention. (See Figures 10 & 1 1 and Tables 1 & 2.) Moreover, polynucleotide fragments encoding these domains are also contemplated. Other preferred fragments are biologically active METHl or METH2 fragments. Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the METHl or METH2 polypeptide. The biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity. However, many polynucleotide sequences, such as EST sequences, are publicly available and accessible through sequence databases.
  • polynucleotides comprising a nucleotide sequence described by the general formula of a-b, where a is any integer between 1 to 936 of SEQ ID NO: 1 , b is an integer of 15 to 950, where both a and b correspond to the positions of nucleotide residues shown in SEQ ID NO: l, and where the b is greater than or equal to a + 14.
  • a-b is any integer between 1 to 876 of SEQ ID NO:3, b is an integer of 15 to 890, where both a and b correspond to the positions of nucleotide residues shown in SEQ ID NO:3, and where the b is greater than or equal to a + 14.
  • epitopes refer to METHl or METH2 polypeptide fragments having antigenic or immunogenic activity in an animal, especially in a human.
  • a preferred embodiment of the present invention relates -93-
  • an "antigenic epitope” is defined as a part of a protein that elicits an antibody response.
  • antigenic epitopes may be produced by any conventional means.
  • antigenic epitopes preferably contain a sequence of at least seven, more preferably at least nine, and most preferably between about 15 to about 30 amino acids.
  • Antigenic epitopes are useful to raise antibodies, including monoclonal antibodies, that specifically bind the epitope. (See, for instance, Wilson et al, Cell 37:161-118 (1984); Sutcliffe, J. G. et al, Science 279:660-666 (1983).)
  • immunogenic epitopes can be used to induce antibodies according to methods well known in the art. (See, for instance, Sutcliffe et al, supra; Wilson et al, supra; Chow, M. et al, Proc. Natl. Acad. Sci. USA 52:910- 914; and Bittle, F. J. et al, J. Gen. Virol. 66:2341-2354 (1985).)
  • a preferred immunogenic epitope includes the secreted protein.
  • the immunogenic epitopes may be presented together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse) or, if it is long enough (at least about 25 amino acids), without a carrier.
  • a carrier protein such as an albumin
  • immunogenic epitopes comprising as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide (e.g., in
  • SEQ ID NO:2 was found antigenic at amino acids: 2-14, 32-44, 47-60, 66-78, 87-103, 109-118, 146-162, 168-180, 183-219, 223-243, 275-284, 296-306, 314-334, 341-354, 357-376, 392-399, 401-410, 418- 429, 438-454, 456-471, 474-488, 510-522, 524-538, 550-561, 565-626, 630-643, -94-
  • SEQ ID NO 4 was found antigenic at amino acids 26-38, 45-52, 69-76, 80-99, 105-113, 129-136, 138-217, 254-263, 273-
  • antibody or “monoclonal antibody” (Mab) is meant to include intact molecules as well as antibody fragments (such as, for example, Fab and F(ab')2 fragments) which are capable of specifically binding to protein Fab and F(ab')2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding than an intact antibody (Wahl et al , J. Nucl Med. 24 316-325 (1983) ) Thus, these fragments are preferred, as well as the products of a FAB or other immunoglobulin expression library Moreover, antibodies of the present invention include chimeric, single chain, and humanized antibodies
  • any METHl or METH2 polypeptide can be used to generate fusion proteins
  • the METHl or METH2 polypeptide when fused to a second protein, can be used as an antigenic tag
  • Antibodies raised against the METHl or METH2 polypeptide can be used to indirectly detect the second protein by binding to the METHl or METH2
  • the METHl or METH2 polypeptides can be used as a targeting molecule once fused to other proteins -95-
  • domains that can be fused to METHl or METH2 polypeptides include not only heterologous signal sequences, but also other heterologous functional regions.
  • the fusion does not necessarily need to be direct, but may occur through linker sequences.
  • fusion proteins may also be engineered to improve characteristics of the METHl or METH2 polypeptide. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N- terminus of the METHl or METH2 polypeptide to improve stability and persistence during purification from the host cell or subsequent handling and storage.
  • peptide moieties may be added to the METHl or METH2 polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the METHl or METH2 polypeptide.
  • METHl or METH2 polypeptides can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
  • IgG immunoglobulins
  • fusion proteins facilitate purification and show an increased half-life in vivo.
  • chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins.
  • Fusion proteins having disulfide-linked dimeric structures can also be more efficient in binding and neutralizing other molecules, than the monomeric secreted protein or protein fragment alone.
  • EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is beneficial in therapy and diagnosis, and thus can result in, for example, improved pharmacokinetic properties.
  • the Fc portion may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations
  • human proteins such as hIL-5
  • Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5 (See, D Bennett et al , J Molecular Recognition 8 52-58 (1995), K Johanson et al , J Biol Chem 270 9459-9471 (1995) )
  • the METHl or METH2 polypeptides can be fused to marker sequences, such as a peptide which facilitates purification of METHl or METH2
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc , 9259 Eton Avenue, Chatsworth, C A, 91311 ), among others, many of which are commercially available As described in Gentz et al , Proc. Nail Acad. Sci.
  • hexa-histidine provides for convenient purification of the fusion protein
  • Another peptide tag useful for purification, the "HA” tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al , Cell 37 767 (1984) )
  • any of these above fusions can be engineered using the METHl or METH2 polynucleotides or the polypeptides
  • METHl or METH2 polynucleotides and polypeptides can be used in assays to test for one or more biological activities If METHl or METH2 polynucleotides and polypeptides do exhibit activity in a particular assay, it is likely that METHl or METH2 may be involved in the diseases associated with the biological activity Therefore, METHl or METH2 could be used to treat the associated disease -97-
  • METHl or METH2 polypeptides or polynucleotides may be useful in treating deficiencies or disorders of the immune system, by activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis) of immune cells.
  • Immune cells develop through a process called hematopoiesis, producing myeloid
  • METHl or METH2 polynucleotides or polypeptides can be used as a marker or detector of a particular immune system disease or disorder.
  • METHl or METH2 polynucleotides may be useful in treating or detecting deficiencies or disorders of hematopoietic cells.
  • METHl or METH2 polypeptides or polynucleotides could be used to increase differentiation and proliferation of hematopoietic cells, including the pluripotent stem cells, in an effort to treat those disorders associated with a decrease in certain (or many) types hematopoietic cells.
  • immunologic deficiency syndromes include, but are not limited to: blood protein disorders (e.g.
  • agammaglobulinemia agammaglobulinemia, dysgammaglobulinemia), ataxia telangiectasia, common variable immunodeficiency, Digeorge Syndrome, HIV infection, HTLV-BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocyte bactericidal dysfunction, severe combined immunodeficiency (SCIDs), Wiskott-Aldrich Disorder, anemia, thrombocytopenia, or hemoglobinuria.
  • SIDs severe combined immunodeficiency
  • METHl or METH2 polypeptides or polynucleotides can also be used to modulate hemostatic (the stopping of bleeding) or thrombolytic activity
  • METHl or METH2 polynucleotides or polypeptides could be used to treat blood coagulation disorders (e.g., afibrinogenemia, factor deficiencies), blood platelet disorders (e.g. thrombocytopenia), or wounds resulting from trauma, surgery, or other causes.
  • blood coagulation disorders e.g., afibrinogenemia, factor deficiencies
  • blood platelet disorders e.g. thrombocytopenia
  • wounds resulting from trauma, surgery, or other causes e.g., thrombocytopenia
  • hemostatic or thrombolytic activity could be used to inhibit or dissolve clotting, important in the treatment of heart attacks (infarction), strokes, or scarring
  • METHl or METH2 polynucleotides or polypeptides may also be useful in treating or detecting autoimmune disorders
  • Many autoimmune disorders result from inappropriate recognition of self as foreign material by immune cells This inappropriate recognition results in an immune response leading to the destruction of the host tissue Therefore, the administration of METHl or METH2 polypeptides or polynucleotides that can inhibit an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing autoimmune disorders
  • autoimmune disorders that can be treated or detected by METHl or METH2 include, but are not limited to Addison's Disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture's Syndrome, Graves' Disease,
  • METHl or METH2 polypeptides or polynucleotides may also be treated by METHl or METH2 polypeptides or polynucleotides Moreover, METH 1 or METH2 can be used to treat anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility
  • METHl or METH2 polynucleotides or polypeptides may also be used to treat and/or prevent organ rejection or graft-versus-host disease (GVHD)
  • GVHD organ rejection or graft-versus-host disease
  • Organ rejection occurs by host immune cell destruction of the transplanted tissue through an immune response Similarly, an immune response is also involved in GVHD, but, in this case, the foreign transplanted immune cells destroy the host tissues -99-
  • METHl or METH2 polypeptides or polynucleotides that inhibits an immune response may be an effective therapy in preventing organ rejection or GVHD.
  • METHl or METH2 polypeptides or polynucleotides may also be used to modulate inflammation.
  • METHl or METH2 polypeptides or polynucleotides may inhibit the proliferation and differentiation of cells involved in an inflammatory response.
  • These molecules can be used to treat inflammatory conditions, both chronic and acute conditions, including inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, or resulting from over production of cytokines (e.g., TNF or EL-1.)
  • infection e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)
  • ischemia-reperfusion injury e.g., endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, or resulting from over production of cytokines (e.g.
  • METHl or METH2 polypeptides or polynucleotides can be used to treat or detect hyperproliferative disorders, including neoplasms.
  • METHl or METH2 polypeptides or polynucleotides may inhibit the proliferation of the disorder through direct or indirect interactions.
  • METHl or METH2 polypeptides or polynucleotides may proliferate other cells which can inhibit the hyperproliferative disorder.
  • hyperproliferative disorders can be treated.
  • This immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response.
  • decreasing an immune response may also be a method of treating hyperproliferative disorders, such as a chemotherapeutic agent.
  • METHl or METH2 polynucleotides or polypeptides examples include, but are not limited to neoplasms located in the: abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus, thyroid), eye, head and neck, nervous (central and peripheral), lymphatic system, pelvic, skin, soft tissue, spleen, thoracic, and urogenital.
  • neoplasms located in the: abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus, thyroid), eye, head and neck, nervous (central and peripheral), lymphatic system, pelvic, skin, soft tissue, spleen, thoracic, and urogenital.
  • hyperproliferative disorders can also be treated or detected by METHl or METH2 polynucleotides or polypeptides.
  • hyperproliferative disorders include, but are not limited to : hypergammaglobulinemia, lymphoproliferative disorders, paraproteinemias, purpura, sarcoidosis, Sezary Syndrome, Waldenstron's Macroglobulinemia, Gaucher's Disease, histiocytosis, and any other hyperproliferative disease, besides neoplasia, located in an organ system listed above.
  • METHl or METH2 polypeptides or polynucleotides can be used to treat or detect infectious agents. For example, by increasing the immune response, particularly increasing the proliferation and differentiation of B and/or T cells, infectious diseases may be treated.
  • the immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response.
  • METH 1 or METH2 polypeptides or polynucleotides may also directly inhibit the infectious agent, without necessarily eliciting an immune response.
  • Viruses are one example of an infectious agent that can cause disease or symptoms that can be treated or detected by METHl or METH2 polynucleotides or polypeptides.
  • infectious agent that can cause disease or symptoms that can be treated or detected by METHl or METH2 polynucleotides or polypeptides.
  • viruses include, but are not limited to the following
  • DNA and RNA viral families Arbovirus, Adenoviridae, Arenaviridae, Arterivirus, Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Flaviviridae, Hepadnaviridae (Hepatitis), Herpesviridae (such as, Cytomegalovirus, Herpes Simplex, Herpes Zoster), Mononegavirus (e.g., -101-
  • Paramyxoviridae Morbillivirus, Rhabdoviridae
  • Orthomyxoviridae e.g., Influenza
  • Papovaviridae Parvoviridae
  • Picornaviridae Picornaviridae
  • Poxviridae such as Smallpox or Vaccinia
  • Reoviridae e.g., Rotavirus
  • Retroviridae HTLV-I, HTLV-II, Lentivirus
  • Togaviridae e.g., Rubivirus
  • Viruses falling within these families can cause a variety of diseases or symptoms, including, but not limited to: arthritis, bronchiollitis, encephalitis, eye infections (e.g., conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A, B, C, E, Chronic Active, Delta), meningitis, opportunistic infections (e.g., AIDS), pneumonia, Burkitt's Lymphoma, chickenpox , hemorrhagic fever, Measles, Mumps, Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella, sexually transmitted diseases, skin diseases (e.g., Kaposi's, warts), and viremia.
  • METHl or METH2 polypeptides or polynucleotides can be used to treat or detect any of these symptoms or diseases.
  • bacterial or fungal agents that can cause disease or symptoms and that can be treated or detected by METHl or METH2 polynucleotides or polypeptides include, but not limited to, the following Gram-Negative and Gram- positive bacterial families and fungi: Actinomycetales (e.g., Corynebacterium, Mycobacterium, Norcardia), Aspergillosis, Bacillaceae (e.g., Anthrax, Clostridium), Bacteroidaceae, Blastomycosis, Bordetella, Borrelia, Brucellosis, Candidiasis, Campylobacter, Coccidioidomycosis, Cryptococcosis,
  • Actinomycetales e.g., Corynebacterium, Mycobacterium, Norcardia
  • Aspergillosis e.g., Bacillaceae (e.g., Anthrax, Clostridium)
  • Bacteroidaceae Blasto
  • Dermatocycoses Enterobacteriaceae (Klebsiella, Salmonella, Serratia, Yersinia), Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis, Listeria, Mycoplasmatales, Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal), Pasteurellacea Infections (e.g., Actinobacillus, Heamophilus, Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, Syphilis, and Staphylococcal.
  • Neisseriaceae e.g., Acinetobacter, Gonorrhea, Menigococcal
  • Pasteurellacea Infections e.g., Actinobacillus, Heamophilus, Pasteurella
  • Pseudomonas Rickettsiaceae, Chla
  • bacterial or fungal families can cause the following diseases or symptoms, including, but not limited to: bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (e.g., AIDS related infections), paronychia, prosthesis-related infections, Reiter's Disease, respiratory tract infections, such as Whooping Cough or Empyema, -102-
  • parasitic agents causing disease or symptoms that can be treated or detected by METHl or METH2 polynucleotides or polypeptides include, but not limited to, the following families Amebiasis, Babesiosis,
  • Coccidiosis Coccidiosis, Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas
  • diseases or symptoms including, but not limited to Scabies, Trombiculiasis, eye infections, intestinal disease (e.g , dysentery, giardiasis), liver disease, lung disease, opportunistic infections (e.g , AIDS related), Malaria, pregnancy complications, and toxoplasmosis
  • METHl or METH2 polypeptides or polynucleotides can be used to treat or detect any of these symptoms or diseases
  • treatment using METHl or METH2 polypeptides or polynucleotides could either be by administering an effective amount of METHl or METH2 polypeptide to the patient, or by removing cells from the patient, supplying the cells with METHl or METH2 polynucleotide, and returning the engineered cells to the patient (ex vivo therapy)
  • the METHl or METH2 polypeptide or polynucleotide can be used as an antigen in a vaccine to raise an immune response against infectious disease
  • METHl or METH2 polynucleotides or polypeptides can be used to differentiate, proliferate, and attract cells, leading to the regeneration of tissues (See, Science 276.59-81 (1997) ) The regeneration of tissues could be used to -103-
  • Tissues that could be regenerated using the present invention include organs (e g , pancreas, liver, intestine, kidney, skin, endothe um), muscle (smooth, skeletal or cardiac), vascular (including vascular endothehum), nervous, hematopoietic, and skeletal (bone, cartilage, tendon, and ligament) tissue
  • regeneration occurs without or decreased scarring Regeneration also may include angiogenesis
  • METHl or METH2 polynucleotides or polypeptides may increase regeneration of tissues difficult to heal
  • increased tendon/ligament regeneration would quicken recovery time after damage
  • METH 1 or METH2 polynucleotides or polypeptides of the present invention could also be used prophylactically in an effort to avoid damage
  • Specific diseases that could be treated include of tendinitis, carpal tunnel syndrome, and other tendon or ligament defects
  • a further example of tissue regeneration of non-healing wounds includes pressure ulcers, ulcers associated with vascular insufficiency, surgical, and traumatic wounds
  • nerve and brain tissue could also be regenerated by using
  • METHl or METH2 polynucleotides or polypeptides to proliferate and differentiate nerve cells Diseases that could be treated using this method include central and peripheral nervous system diseases, neuropathies, or mechanical and traumatic disorders (e g , spinal cord disorders, head trauma, cerebrovascular disease, and stoke) Specifically, diseases associated with peripheral nerve injuries, peripheral neuropathy (e g , resulting from chemotherapy or other medical therapies), localized neuropathies, and central nervous system diseases (e g , Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome), could all be treated using the METHl or METH2 polynucleotides or polypeptides -104-
  • METH 1 or METH2 polynucleotides or polypeptides may have chemotaxis activity.
  • a chemotaxic molecule attracts or mobilizes cells (e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells) to a particular site in the body, such as inflammation, infection, or site of hyperproliferation.
  • the mobilized cells can then fight off and/or heal the particular trauma or abnormality.
  • METHl or METH2 polynucleotides or polypeptides may increase chemotaxic activity of particular cells. These chemotactic molecules can then be used to treat inflammation, infection, hyperproliferative disorders, or any immune system disorder by increasing the number of cells targeted to a particular location in the body. For example, chemotaxic molecules can be used to treat wounds and other trauma to tissues by attracting immune cells to the injured location. As a chemotactic molecule, METHl or METH2 could also attract fibroblasts, which can be used to treat wounds.
  • METHl or METH2 polynucleotides or polypeptides may inhibit chemotactic activity. These molecules could also be used to treat disorders. Thus, METHl or METH2 polynucleotides or polypeptides could be used as an inhibitor of chemotaxis.
  • METH 1 or METH2 polypeptides may be used to screen for molecules that bind to METHl or METH2 or for molecules to which METHl or METH2 binds.
  • the binding of METHl or METH2 and the molecule may activate (agonist), increase, inhibit (antagonist), or decrease activity of the METHl or METH2 or the molecule bound.
  • Examples of such molecules include antibodies, oligonucleotides, proteins (e.g., receptors),or small molecules.
  • the molecule is closely related to the natural ligand of METHl or METH2, e.g., a fragment of the ligand, or a natural substrate, a ligand, a structural or functional mimetic.
  • METHl or METH2 e.g., a fragment of the ligand, or a natural substrate, a ligand, a structural or functional mimetic.
  • the molecule can be closely related to the natural receptor to which METHl or METH2 binds, or at least, a fragment of the receptor capable of being bound by METHl or METH2 (e.g., active site). In either case, the molecule can be rationally designed using known techniques.
  • the screening for these molecules involves producing appropriate cells which express METHl or METH2, either as a secreted protein or on the cell membrane.
  • Preferred cells include cells from mammals, yeast, Drosophila, or E. coli.
  • Cells expressing METHl or METH2(or cell membrane containing the expressed polypeptide) are then preferably contacted with a test compound potentially containing the molecule to observe binding, stimulation, or inhibition of activity of either METHl or METH2 or the molecule.
  • the assay may simply test binding of a candidate compound toMETHl or METH2, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the candidate compound results in a signal generated by binding to METHl or METH2.
  • the assay can be carried out using cell-free preparations, polypeptide/molecule affixed to a solid support, chemical libraries, or natural product mixtures.
  • the assay may also simply comprise the steps of mixing a candidate compound with a solution containing METHl or METH2, measuring METHl or METH2/molecule activity or binding, and comparing the METHl or METH2/molecule activity or binding to a standard.
  • an ELISA assay can measure METHl or METH2 level or activity in a sample (e.g., biological sample) using a monoclonal or polyclonal antibody.
  • the antibody can measure METHl or METH2 level or activity by either binding, directly or indirectly, to METHl or METH2 or by competing with METHl or METH2 for a substrate.
  • the invention includes a method of identifying compounds which bind to METHl or METH2 comprising the steps of: (a) incubating a candidate binding compound with METHl or METH2; and (b) determining if binding has occurred.
  • the invention includes a method of identifying agonists/antagonists comprising the steps of: (a) incubating a candidate compound with METHl or METH2, (b) assaying a biological activity , and (b) determining if a biological activity of METHl or METH2 has been altered.
  • METHl or METH2 polypeptides or polynucleotides may also increase or decrease the differentiation or proliferation of embryonic stem cells, besides, as discussed above, hematopoietic lineage.
  • METHl or METH2 polypeptides or polynucleotides may also be used to modulate mammalian characteristics, such as body height, weight, hair color, eye color, skin, percentage of adipose tissue, pigmentation, size, and shape (e.g., cosmetic surgery).
  • METHl or METH2 polypeptides or polynucleotides may be used to modulate mammalian metabolism affecting catabolism, anabolism, processing, utilization, and storage of energy.
  • METHl or METH2 polypeptides or polynucleotides may be used to change a mammal's mental state or physical state by influencing biorhythms, circadian rhythms, depression (including depressive disorders), tendency for violence, tolerance for pain, reproductive capabilities (preferably by Activin or
  • Inhibin-like activity hormonal or endocrine levels, appetite, libido, memory, stress, or other cognitive qualities.
  • METHl or METH2 polypeptides or polynucleotides may also be used as a food additive or preservative, such as to increase or decrease storage -107-
  • the invention provides a diagnostic method useful during tumor diagnosis, which involves assaying the expression level of the gene encoding the METHl protein in mammalian cells or body fluid and comparing the gene expression level with a standard METHl gene expression level, whereby a decrease in the gene expression level under the standard is indicative of certain tumors.
  • the invention also provides a diagnostic method useful during tumor diagnosis, which involves assaying the expression level of the gene encoding the
  • METH2 protein in mammalian cells or body fluid and comparing the gene expression level with a standard METH2 gene expression level, whereby a decrease in the gene expression level under the standard is indicative of certain tumors.
  • the present invention is useful as a prognostic indicator, whereby patients exhibiting diminished METHl or METH2 gene expression will experience a worse clinical outcome relative to patients expressing the gene at a lower level.
  • saying the expression level of the gene encoding the METHl or METH2 protein is intended qualitatively or quantitatively measuring or estimating the level of the METHl or METH2 protein or the level of the mRNA encoding the METH 1 or METH2 protein in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the METHl or METH2 protein level or mRNA level in a second biological sample).
  • the METHl or METH2 protein level or mRNA level in the first biological sample is measured or estimated and compared to a standard METHl or METH2 protein level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the cancer.
  • a standard METHl or METH2 protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.
  • biological sample any biological sample obtained from an individual, cell line, tissue culture, or other source which contains METHl or
  • METH2 protein or mRNA include mammalian body fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) which contain secreted mature METHl or METH2 protein, and adrenal, thyroid, stomach, brain, heart, placenta, lung, liver, muscle, kidney, pancreas, testis and ovarian tissue (for METHl); and prostate, small intestine, colon, brain and lung tissue (for METH2).
  • mammalian body fluids such as sera, plasma, urine, synovial fluid and spinal fluid
  • METH2 protein secreted mature METHl or METH2 protein
  • adrenal thyroid, stomach, brain, heart, placenta, lung, liver, muscle, kidney, pancreas, testis and ovarian tissue
  • prostate small intestine, colon, brain and lung tissue
  • the present invention is useful for detecting cancer in mammals.
  • the invention is useful during diagnosis of the of following types of cancers in mammals: breast, ovarian, prostate, liver, lung, pancreatic, colon, and testicular.
  • Preferred mammals include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and humans. Particularly preferred are humans.
  • Total cellular RNA can be isolated from a biological sample using the single-step guanidinium-thiocyanate-phenol-chloroform method described in Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987). Levels of mRNA encoding the METHl or METH2 protein are then assayed using any appropriate method. These include Northern blot analysis (Harada et al, Cell 63:303-312 -109-
  • METHl or METH2 protein levels in a biological sample can occur using antibody-based techniques.
  • METH 1 or METH2 protein expression in tissues can be studied with classical immunohistological methods
  • antibody-based methods useful for detecting METHl or METH2 protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
  • immunoassays such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
  • Suitable labels are known in the art and include enzyme labels, such as, glucose oxidase, and radioisotopes, such as iodine ( 125 1, 121 I), carbon ( 14 C), sulfur
  • fluorescent labels such as fluorescein and rhodamine, and biotin.
  • METHl and METH2 are potent inhibitors of angiogenesis both in vitro and in vivo.
  • the advantage of METHl and METHl is that these inhibitors are normally associated with suppression of physiological angiogenesis; therefore, they offer lack of toxicity and endothelial specificity over other angiogenic inhibitors.
  • METH1 and METH2 present a restricted pattern of expression providing a possible advantage on organ specificity.
  • the polypeptides of the present invention may be employed to treat cancer.
  • the METHl and METH2 polypeptides of the present invention can also be used to treat individuals with other disorders that are related to angiogenesis, including abnormal wound healing, inflammation, rheumatoid arthritis, psoriasis, endometrial bleeding disorders, diabetic retinopathy, some forms of macula degeneration, hemangiomas, and arterial-venous malformations.
  • the invention provides a method of inhibiting angiogenesis in an individual comprising administering to such an individual a pharmaceutical composition comprising an effective amount of an isolated METHl polypeptide of the invention, effective to increase the METHl activity level in such an individual.
  • the invention also provides a method of inhibiting angiogenesis in an individual comprising administering to such an individual a pharmaceutical composition comprising an effective amount of an isolated METH2 polypeptide of the invention, effective to increase the METH2 activity level in such an individual.
  • METHl polypeptides which may be used to inhibit angiogenesis in this manner include: METHl polypeptide encoded by the deposited cDNA including the leader; the mature METHl polypeptide encoded by the deposited the cDNA minus the leader (i.e., the mature protein); a polypeptide comprising amino acids about 1 to about 950 in SEQ ID NO:2; a polypeptide comprising amino acids about 2 to about 950 in SEQ ED NO:2; a polypeptide comprising amino acids about 29 to about 950 in SEQ ID NO:2; a polypeptide comprising amino acids about 30 to about 950 in SEQ ID NO:2; a polypeptide comprising the metalloprotease domain of METHl, amino acids 235 to 459 in SEQ ID NO:2; a polypeptide comprising the disintegrin domain of METHl , amino acids 460 to 544 in SEQ ID NO:2; a polypeptide comprising the first TSP-like domain of METHl, amino acids 545
  • METH2 polypeptides which may be used to inhibit angiogenesis in this manner include the METH2 polypeptide encoded by the deposited cDNA including the leader, the mature METH2 polypeptide encoded by the deposited the cDNA minus the leader (i e , the mature protein), a polypeptide comprising amino acids about 1 to about 890 in SEQ ID NO 4, a polypeptide comprising amino acids about 2 to about 890 in SEQ ID NO 4, a polypeptide comprising amino acids about 24 to about 890 in SEQ ID NO 4, a polypeptide comprising amino acids about 112 to about 890 in SEQ ID NO 4, a polypeptide comprising the metalloprotease domain of METH2, amino acids 214 to 439 in
  • TSP-like domain of METH2 amino acids 837 to 890 in SEQ ID NO 4, a polypeptide comprising amino acids 280 to 606 in SEQ ID NO 4, and a polypeptide comprising amino acids 529 to 548 in SEQ ID NO 4
  • the total pharmaceutically effective amount of METHl or METH2 polypeptide administered parenterally per dose will be in the range of about 1 ⁇ g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion More preferably, this dose is at least 0 01 mg/kg/day, and most preferably for humans between about 0 01 and 1 mg/kg/day for the polypeptide
  • the METHl or METH2 polypeptide is typically administered at a dose rate of about 1 ⁇ g/kg/hour to about 50 ⁇ g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump
  • An intravenous bag solution may also be employed
  • compositions containing the METHl or METH2 of the invention may be administered orally, rectally, parenterally, intracistemally, -112-
  • pharmaceutically acceptable carrier is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • the nucleic acid molecules of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • the cDNA herein disclosed is used to clone genomic DNA of a METHl or METH2 protein gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially. The genomic DNA then is used for in situ chromosome mapping using well known techniques for this purpose.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3 ' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes.
  • Fluorescence in situ hybridization of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with probes from the cDNA as -113-
  • the amino-terminal end of METHl was obtained using 5 ' rapid amplification of cDNA ends (RACE) PCR technique (Marathon cDNA amplification kit, Clontech) according to manufacturer instructions.
  • RACE rapid amplification of cDNA ends
  • the amino- terminal end of METH2 was obtained partially through 5 'RACE PCR and later confirmed and completed by genomic screening.
  • BAC clones Gene Systems
  • Positive BAC clones containing 150-200bp of sequence were subsequently subcloned into pGEM vector as small fragments and sequenced.
  • pNPI procollagen I N- proteinase; (Colidge, A., etal, Proc. Natl. Acad. Sci. USA 94:2314-2319 (1997)) showed a striking sequence and structural similarity to METHl and METH2 ( Figure 3).
  • pNPI also contains metalloproteinase (reprolysin subfamily) and TSP domains at the carboxy-terminal end.
  • sequence for pNPI is of bovine origin, sequence alignment revealed identical structural features. The amino acid similarity between METHl and METH2 is 51.7%, and between METHl or METH2 and pNPI the homology is lesser 33.9% and 36.3%, respectively.
  • transmembrane domain around amino acid 300, deduced from the hydrophilicity plots. It is not clear whether these proteins are bound to the membrane. However, given preliminary data, it is more likely that this second transmembrane domain will consist of a hydrophobic pocket and that METHl , METH2 and pNPI are in fact secreted proteins.
  • the NH 2 -terminal end past the signal peptide has homology to the superfamily of zinc metalloproteases and can be subdivided in a prodomain, a metalloprotease domain, and a cysteine-rich region.
  • proteolytical processing occurs in SVMPs to yield soluble metalloproteases and disintegrins (Bjarnason, J.B. & Fox, J.W., Methods Enzymol 245:345-368 (1995)) and has also been detected in some ADAMs (reviewed by Wolsberg, T.G & White, J.M., Developmental Biology 180:389-401 (1996)). At this point, preliminary experiments suggest that proteolytical processing occurs, at least in
  • METHl METH2
  • METH2 present a Zn 2+ -binding site (dotted line in Figure 3) that is presumed to be catalytically active due to the conservation of certain functionally important amino acids (Rawlings, N.D. & Barrett, A.J., Methods Enzymol 245: 183-228 (1995)) suggesting that these proteins may be active proteases.
  • cysteine-rich region which contains two putative disintegrin loops (Wolsberg, T.G. & White, J.M., Developmental Biology 180:389-401 (1996)) (marked by arrows in Figure 3).
  • Disintegrin domains are found within the superfamily of metalloproteases in snake venom metalloproteases (SVMPs) and ADAMs (mammalian proteins containing a disintegrin and a metalloprotease domain) and have a possible function inhibiting binding of integrins to their ligands in SVMPs.
  • SVMPs snake venom metalloproteases
  • ADAMs mimmalian proteins containing a disintegrin and a metalloprotease domain
  • the AD AM-disintegrin-like domain may promote rather than disrupt, cell-cell interactions (Wolsberg, T.G. & White, J.M., Developmental Biology 750:389-401 (1996)).
  • the TSP-like domains are located in the COOH-half of METHl and METH2 proteins.
  • METH2 contains two conserved TSP domains separated by a spacer region with unknown function, and a subdomain with less homology, and only 5 cysteines, following the second anti-angiogenic region.
  • METH2 contains two TSP domains separated by the spacer region. The alignment of the TSP-like domains of METHl and METH2 with those of TSP 1 and TSP2 are shown in Figure 5. The homology varies between 19.2% to 52% amino acid similarity among all the TSP repeats. The cysteines, numbered 1 to 6, and the tryptophans, labeled by asterisks, are highly conserved.
  • the consensus sequence for the type I repeats includes 16 residues with 6 perfectly conserved cysteines. Typically it begins with the sequence motif WSXWS (SEQ ID NO: 82) that has also been shown to bind to heparin (Guo, N., et al, J. Biol. Chem. 267: 19349-19355 (1992)). The affinity of this region to heparin has been proposed to the part of the anti-angiogenic activity of TSP-1 (Guo, N., et al, J. Peptide Res. 49 (1997)). Among the five members of the TSP family of proteins, only TSP- 1 and TSP-2 inhibit angiogenesis and contain the type I repeats (Tolsma, S.S., et al, J.
  • TSP 1 and TSP2 were probably added to the precursor of TSP 1 and 2 by exon shuffling between 500 and 900 years ago (Adams, 1, et al, The Thrombospondin Gene Family, 1 Ed. Molecular Biology Intelligence Unit (Springer, Ed.), R.G Austin Company, Germany (1995)). It is likely that the acquisition of this domain provided the precursor of TSP 1 and TSP2 with functions, such as regulation of new vessel formation.
  • BAI-1 brain angiogenic inhibitor- 1
  • TSP-1 nerve angiogenic inhibitor-1
  • proteins containing the type I repeats appear not to have clear or more established anti-angiogenic properties such as: properdin, F-spondin, and other members of the complement family.
  • TSP-repeats in METHl and METH2, along with their anti-angiogenic properties, these proteins were originally considered members of the TSP superfamily. Nevertheless, they have no additional homology to other TSPs, and in fact, the similarity to TSP1 and TSP2 is restricted to the type I repeats. Furthermore, the proteins also have strong sequence and structural homology to members of the ADAM family. These features led Kuno and colleagues to name ADAMTS to the mouse homolog of METHl (Kuno, K., et al, J. Biol. Chem. 272:556-562 (1997)).
  • GPDH phosphate-dehydrogenase
  • METHl and METH2 transcripts revealed a single band of 4 6 and 3 7Kb, respectively Abundant METHl mRNA expression was observed in adrenal, heart, placenta, followed by skeletal muscle, thyroid and stomach From the embryonic tissues analyzed, kidney showed the highest expression of METHl mRNA Nevertheless, weaker expression of METHl mRNA was seen in all tissues analyzed Distribution of METH2 mRNA was more restricted and weaker than that of METHl The highest expression was seen in lung, both embryonic and adult Interestingly, METHl and METH2 expression do not appear to overlap In combination, the structural similarities and their pattern of expression suggest functional redundancy yet different transcriptional regulation The expression levels of TSP 1 transcripts in the same blots were also analyzed, for purpose of comparison TSP1 mRNA highest expression was seen in the adult place
  • the cell type distribution was also studied by Northern blot analysis of poly(A)+RNA METHl mRNA was detectable, at low levels, in dermal -119-
  • METH2 mRNA was detected only on SW480, a colon carcinoma cell line, but no expression was seen in any other of the cell lines or primary strains analyzed.
  • the possibility that groups of angiogenic and anti-angiogenic factors regulate vascular network formation in specific organs has been a frequently discussed hypothesis likely to be true, yet unproven.
  • TSP1 and TSP2 also share identical structure, high level of amino acid similarity, yet their pattern of expression differs significantly (Iruela-Arispe, M.L., Dev. Dyn. 197:40-56 (1993)). The differences are likely based on dissimilar cis-acting elements in their promoters and different regulatory mechanisms, as previously suggested. Although the promoters for METHl and 2 have not been characterized, it is likely that they provide unique features for the regulation of each gene. Nevertheless, the possibility that one motif, the anti-angiogenic / type I repeat, with demonstrated anti-angiogenic properties is present in several proteins with different tissue specificities is appealing. Alternatively, the small differences in sequence between closely related members of the same family could possess significance that goes beyond functional redundancy. In the case of TSP 1 and
  • TSP1 and TSP2 aside from the striking structural similarities and perhaps having functionally common anti-angiogenic properties, TSP1 and TSP2 also appear to display functions of their own and not likely shared by their similar relative. This became evident with the outcome of the two knock-outs for these genes. TSP1 null animals exhibited primarily lung disorders (Lawler, J., et aL, J. Clin. Invest.
  • mice exhibited unpredicted collagen assembly anomalies, with carry-on consequences to the skin, tendons, and bone (Kyriakides, T.R., etal, J. Cell Biol. 740:419-430 (1998)). In addition, these animals also appear to have overall -120-
  • pNIP has been shown to display active proteolytic activity by cleaving the N-terminus of type I procollagen (Colidge, A. , et al. , Proc. Natl. Acad. Sci. USA 94:2314-2319 (1997)).
  • a second region of functional interest corresponds to the disintegrin domain.
  • This domain has been more fully characterized in related members of the snake venom metalloproteases that have been shown to bind to ⁇ llb ⁇ 3 and inhibit platelet interaction blocking coagulation (Pfaff, M., et al, Cell Adhes Commun. 2:491-501 (1994); Usami, Y., etal, Biochem. Biophys. Res. Commun. 207:331-
  • the disintegrin motif consists of a thirteen to fifteen domain which frequently contain an RGD or a negatively charged residue at the position of the aspartic acid.
  • the RGD or equivalent, binds to integrins and serve as antagonist or signaling ligands (Wolsberg, T.G. & White, J.M., Developmental Biology 750:389-401 (1996)).
  • METH2 but not METHl, has an RGD sequence located amino-terminal to the disintegrin domain.
  • both molecules present relatively high, but not perfect, degree of conservation of cysteines within the disintegrin motif. This appears to display an important role in the tertiary structure of this region and its ability to interact with integrins.
  • pRSET-METHl-Type I METHl nt 1605-1839 (from the start codon) was amplified by polymerase chain reaction using the following primers: 5'-GCA TTT TGG ATC CGC CTT TTC ATG-3 ' (SEQ ID NO: 78) and 5 '-GTT -121-
  • the METH2 fragment was amplified by PCR using the following primers: 5 '-GAAAAATGGGGATCCGAGGTG-3 ' (SEQ ID NO:80) and 5 '-GCAGGAGAATTCCGTCCATG-3 ' (SEQ EDNO:81)to generate BamHI and EcoRI restriction sites; (4) pG ⁇ X-M ⁇ TH2-TSP: a 0.5Kb Xmal-
  • EcoRl fragment isolated from pGEX-1.0-METH2 was subcloned into theXmal and EcoRI sites of pGEX-2TK vector. All constructs were sequenced to verify sequence fidelity and correct open reading frame.
  • the recombinant proteins were named 6H-METH1, the recombinant protein expressed with the plasmid pRSET-METHl-TSP, GST-METH1, the protein expressed with the plasmid pGEX-METHl-TSP and GST-METH2, the protein expressed with the plasmid pGEX-METH2-TSP.
  • Expression plasmids were transformed into BL21 :DE3 E. coli strain (Stratagene Cloning Systems, La Jolla, CA) and fusion proteins were induced following manufacturer recommendations. Briefly, induced bacteria pellets were resuspended in PBS and sonicated on ice for 1 min. The suspension was, subsequently, incubated at RT for 20min in the presence of 1% triton X-100 and centrifuged at 4°C. Histidine tagged fusion proteins were then purified on Ni- NTA beads (Qiagen, Chatsworth, CA) by incubating 20ml of supernatant with 1ml of beads (50% slurry) for 2h at 4°C.
  • Ni- NTA beads Qiagen, Chatsworth, CA
  • the suspension was transferred into a column and washed with 10 columns volume of PB S containing 1 OmM imidazole, followed by 50mM imidazole and finally lOOmM imidazole.
  • the protein was eluted with 500mM imidazole in PBS. Fractions containing the recombinant protein were dialyzed against phenol-red free DMEM. Samples were centrifuged for 30min at 4°C, part of the protein was not soluble and was lost during -122-
  • the supernatant was stored at -70 °C and used for proliferation, cornea pocket and chorioallantoic membrane (CAM) assays.
  • CAM chorioallantoic membrane
  • the extract was cleared by centrifugation and applied to a GST-affinity column (Pharmacia).
  • the column was washed with PBS-1% triton X-100 in the presence of O. lmM reduced glutathione and, subsequently, with the same buffer in the presence of 0.5mM reduced glutathione.
  • Fusion proteins were eluted with 1 OmM reduced glutathione in 5 OmM Tris-HCl, pH 7.5. Fractions containing the protein were dialyzed against DMEM, stored at -70 °C and used for proliferation, cornea pocket and chorioallantoic membrane (CAM) assays.
  • CAM chorioallantoic membrane
  • Integrity and purity of recombinant proteins was analyzed in 12.5% or 15% acrylamide gels stained with Coomassie blue.
  • TSP domains could function as regulators of angiogenesis recombinant fusion proteins were generated in bacteria.
  • the constructs included the first TSP domain of METHl orMETH2. This domain is the most conserved, 52% amino acid similarity with the second type I repeat of TSP1, (this domain contains a putative binding site for CD36). All recombinant proteins were isolated under native conditions to preserve their secondary structure as much as possible. 6H-METH1 and GST-METHl contained the first TSP-like domain of METHl fused to a histidine tag or a GST, respectively. METHl recombinant protein was made with two different tags because of purification and structural advantages.
  • GST-METH2 contained the first TSP domain of METH2 also fused to a GST. A fragment corresponding to the last two type I repeats of TSP 1, also fused to a GST, and -123-
  • Example 4 TSP domains in METHl andMETH2 disrupt angiogenesis in vivo
  • the angiogenic response is analyzed by measuring the number of vessels that grow within a matrix polymer containing the angiogenic growth factor.
  • a matrigel polymer containing VEGF and the recombinant protein were implanted in the CAM. Quantitative analysis of the experiments, which included three different polymers per treatment are shown in Figure 6A. Matrigels polymers containing VEGF plus 5 ⁇ g of GST-METH1 or GST-METH2 caused greater than 80% inhibition in blood vessel growth.
  • Synthetic peptides from the second or the third type I repeats of human TSPl can mimic that anti-angiogenic effects of the intact TSPl (Tolsma, S S , et al, J. Cell. Biol 122 497-511 (1993))
  • a 19-residue polypeptide was shown to be sufficient to block in vivo neovascularization in the rat cornea and to inhibit the bFGF-induced migration of cultured endothelial cells ( Vogel, T , etal,
  • HDEC Human dermal endothelial cells
  • VSM vascular smooth muscle
  • fibroblast proliferation assays cells were incubated -127-
  • METHl and METH2 inhibited cell proliferation to the same degree as to endothelial cells.
  • TSPl also suppresses mammary epithelial cell proliferation both in vitro and in a transgenic model.
  • METHl and METH2 might act as disintegrins is consistent with their anti-angiogenic properties.
  • Clearly blockade of ⁇ v ⁇ 3 and ⁇ 1 integrins with antibodies has been shown to inhibit neovascularization both during development and in tumors (Brooks, P.C., etal, Cell 55:683-693 (1996); Brooks, P.C., et al, Cell 92:391-400 (1998); Senger, D.R., et al, Proc. Natl. Acad. Sci. USA 94: 13612-13617 (1997)).
  • Integrins are essential for the mediation of both proliferative and migratory signals (Schwartz, M.A. & Ingber, D.E., Mol. Biol.
  • METHl and METH2 have almost entire conservation in both these regions.
  • a complementary and also likely occurrence is binding of METHl and METH2 to bFGF. Binding to heparin and bFGF has been proposed as part of the anti-angiogenic activity of TSPl (Guo, N., et al, J. Peptide Res. 49 (1997)). This property appears to be mediated -129-
  • the deposited clone is transformed into a suitable host (such as XL-1 Blue (Stratagene)) using techniques known to those of skill in the art, such as those provided by the vector supplier or in related publications or patents.
  • the transformants are plated on 1.5% agar plates (containing the appropriate selection agent, e.g., ampicillin) to a density of about 150 transformants (colonies) per plate.
  • a single colony is then used to generate DNA using nucleic acid isolation techniques well known to those skilled in the art. (e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edit., (1989),
  • two primers of 17-20 nucleotides derived from both ends of the SEQ ID NO: l or SEQ ID NO: 3 are synthesized and used to amplify the METHl or METH2 cDNA using the deposited cDNA plasmids as templates.
  • the polymerase chain reaction is carried out under routine conditions, for instance, in 25 ⁇ l of reaction mixture with 0.5 ⁇ g of the above cDN A template .
  • a convenient reaction mixture is 1.5 - 5 mM MgCl 2 , 0.01% (w/v) gelatin, 20 uM each of dATP, dCTP, dGTP, dTTP, 25 pmol of each primer and 0.25 Unit of Taq polymerase.
  • Thirty five cycles of PCR (denaturation at 94 degree C for 1 min; annealing at 55 degree C for 1 min; elongation at 72 degree C for 1 min) are performed with a Perkin-Elmer Cetus automated thermal cycler.
  • the amplified product is analyzed by agarose gel electrophoresis and the DNA band with expected molecular weight is excised and purified.
  • RNA oligonucleotide is ligated to the 5' ends of a population of RNA presumably containing full-length gene RNA transcripts.
  • a primer set containing a primer specific to the ligated RNA oligonucleotide and a primer specific to a known sequence of the METHl or METH2 gene of interest is used to PCR amplify the 5' portion of the METHl or METH2 full-length gene.
  • This amplified product may then be sequenced and used to generate the full length gene.
  • RNA isolation can then be treated with phosphatase if necessary to eliminate 5' phosphate groups on degraded or damaged RNA which may interfere with the later RNA ligase step.
  • the phosphatase should then be inactivated and the RNA treated with tobacco acid pyrophosphatase in order to remove the cap structure present at the 5' ends of messenger RNAs. This reaction leaves a 5' phosphate group at the 5' end of the cap cleaved RNA which can then be ligated to an RNA oligonucleotide using T4
  • This modified RNA preparation is used as a template for first strand cDNA synthesis using a gene specific oligonucleotide.
  • the first strand synthesis reaction is used as a template for PCR amplification of the desired 5' end using a primer specific to the ligated RNA oligonucleotide and a primer specific to the known -131-
  • a METHl or METH2 polynucleotide encoding a METHl or METH2 polypeptide invention is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' ends of the DNA sequence, as outlined in Example 5 , to synthesize insertion fragments
  • the primers used to amplify the cDN A insert should preferably contain restriction sites, such as BamHI and Xbal, at the 5' end of the primers in order to clone the amplified product into the expression vector
  • BamHI and Xbal correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc , Chatsworth, CA)
  • This plasmid vector encodes antibiotic resistance (Amp 1 ), a bacterial origin of replication (ori), an IPTG-regulatable promoter/operator (P/O), a ribosome binding site (RBS), a 6-histidine tag (6-His), and restriction enzyme cloning sites
  • the pQE-9 vector is digested with BamHI and Xbal and the amplified fragment is ligated into the pQE-9 vector maintaining the reading frame initiated at the bacterial RBS
  • the ligation mixture is then used to transform the E coli strain M 15/rep4 (Qiagen, Inc ) which contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kan 1 )
  • Transformants are identified by their ability to grow on
  • Clones containing the desired constructs are grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml)
  • the O/N culture is used to inoculate a large culture at a ratio of 1 100 to 1 :250
  • the cells are grown to an optical density 600 (O.D 600 ) of between 0 4 and 0.6 IPTG (Isopropyl-B-D-thiogalacto pyranoside) is then added to a final -132-
  • IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression.
  • Ni-NTA nickel-nitrilo-tri-acetic acid
  • the supernatant is loaded onto the column in 6 M guanidine-HCl, pH 8, the column is first washed with 10 volumes of 6 M guanidine-HCl, pH 8, then washed with 10 volumes of 6 M guanidine-HCl pH 6, and finally the polypeptide is eluted with 6 M guanidine-HCl, pH 5.
  • the purified METHl or METH2 protein is then renatured by dialyzing it against phosphate-buffered saline (PBS) or 50 mM Na-acetate, pH 6 buffer plus 200 mM NaCI.
  • PBS phosphate-buffered saline
  • the METHl or METH2 protein can be successfully refolded while immobilized on the Ni-NTA column.
  • the recommended conditions are as follows: renature using a linear 6M-1M urea gradient in 500 mM NaCI, 20% glycerol, 20 mM Tris/HCl pH 7.4, containing protease inhibitors.
  • the renaturation should be performed over a period of 1.5 hours or more.
  • the proteins are eluted by the addition of 250 mM immidazole.
  • Immidazole is removed by a final dialyzing step against PBS or 50 mM sodium acetate pH 6 buffer plus 200 mM NaCI.
  • the purified METHl or METH2 protein is stored at 4°C or frozen at -80°C.
  • the present invention further includes an expression vector comprising phage operator and promoter elements operatively linked to a METH 1 or METH2 polynucleotide, called pHE4a. (ATCC Accession Number 209645, deposited February 25, 1998.)
  • This vector contains: 1) a neomycinphosphotransferase gene as a selection marker, 2) anE. coli origin -133-
  • lactose operon repressor gene laclq
  • the origin of replication is derived from pUC19 (LTI, Gaithersburg, MD)
  • the promoter sequence and operator sequences are made synthetically DNA can be inserted into the pHEa by restricting the vector with Ndel and
  • the DNA insert is generated according to the PCR protocol described in Example 5, using PCR primers having restriction sites for Ndel (5' primer) and Xbal, BamHI, Xhol, or Asp718 (3 ' primer)
  • the PCR insert is gel purified and restricted with compatible enzymes
  • the insert and vector are ligated according to standard protocols
  • the engineered vector could easily be substituted in the above protocol to express protein in a bacterial system
  • the cell culture Upon completion of the production phase of the E. coli fermentation, the cell culture is cooled to 4-10 degree C and the cells harvested by continuous centrifugation at 15,000 rpm (Heraeus Sepatech) On the basis of the expected yield of protein per unit weight of cell paste and the amount of purified protein required, an appropriate amount of cell paste, by weight, is suspended in a buffer solution containing 100 mM Tris, 50 mM EDTA, pH 7 4 The cells are dispersed to a homogeneous suspension using a high shear mixer
  • the cells are then lysed by passing the solution through a microfluidizer (Microfuidics, Corp or APV Gaulin, Inc ) twice at 4000-6000 psi
  • a microfluidizer Microfuidics, Corp or APV Gaulin, Inc
  • homogenate is then mixed with NaCI solution to a final concentration of 0.5 M NaCI, followed by centrifugation at 7000 xg for 15 min.
  • the resultant pellet is washed again using 0.5M NaCI, 100 mM Tris, 50 mM EDTA, pH 7.4.
  • the resulting washed inclusion bodies are solubilized with 1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After 7000 xg centrifugation for 15 min., the pellet is discarded and the polypeptide containing supernatant is incubated at 4 degree C overnight to allow further GuHCl extraction.
  • guanidine hydrochloride (GuHCl)
  • the GuHCl solubilized protein is refolded by quickly mixing the GuHCl extract with 20 volumes of buffer containing 50 mM sodium, pH 4.5, 150 mM
  • a previously prepared tangential filtration unit equipped with 0.16 um membrane filter with appropriate surface area e.g., Filtron
  • 40 mM sodium acetate, pH 6.0 is employed.
  • the filtered sample is loaded onto a cation exchange resin (e.g., Poros HS-50, Perseptive Biosystems).
  • the column is washed with 40 mM sodium acetate, pH 6.0 and eluted with 250 mM, 500 mM, 1000 mM, and 1500 mM NaCI in the same buffer, in a stepwise manner.
  • the absorbance at 280 nm of the effluent is continuously monitored. Fractions are collected and further analyzed by SDS-PAGE.
  • Fractions containing the METHl or METH2 polypeptide are then pooled and mixed with 4 volumes of water.
  • the diluted sample is then loaded onto a previously prepared set of tandem columns of strong anion (Poros HQ-50, Perseptive Biosystems) and weak anion (Poros CM-20, Perseptive Biosystems) exchange resins.
  • the columns are equilibrated with 40 mM sodium acetate, pH 6.0. Both columns are washed with 40 mM sodium acetate, pH 6.0, 200 mM NaCI.
  • CM-20 column is then eluted using a 10 column volume linear gradient ranging from 0.2 M NaCI, 50 mM sodium acetate, pH 6.0 to 1.0 M NaCI, 50 mM sodium acetate, pH 6.5. Fractions are collected under constant A 2g0 monitoring -135-
  • the resultant METHl or METH2 polypeptide should exhibit greater than 95% purity after the above refolding and purification steps. No major contaminant bands should be observed from Coomassie blue stained 16% SDS-PAGE gel when
  • the purified METHl or METH2 protein can also be tested for endotoxin/LPS contamination, and typically the LPS content is less than 0.1 ng/ml according to LAL assays.
  • Example 9 Cloning and Expression of METHl or METH2 in a Baculovirus Expression System
  • the plasmid shuttle vector pA2 is used to insert METHl or METH2 polynucleotide into a baculovirus to express METHl or METH2.
  • This expression vector contains the strong polyhedrin promoter oft eAutographa californica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites such as BamHI, Xba I and Asp718.
  • the polyadenylation site of the simian virus 40 (“SV40") is used for efficient polyadenylation.
  • the plasmid contains the beta-galactosidase gene from E.
  • coli under control of a weak Drosophila promoter in the same orientation, followed by the polyadenylation signal of the polyhedrin gene.
  • the inserted genes are flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate a viable virus that express the cloned METHl or METH2 polynucleotide.
  • baculovirus vectors can be used in place of the vector above, such as pAc373, pVL941, and pAcIMl, as one skilled in the art would readily appreciate, as long as the construct provides appropriately located signals for transcription, translation, secretion and the like, including a signal peptide and an in-frame AUG as required.
  • Such vectors are described, for instance, in Luckow et al., Virology 170:31-39 (1989). -136-
  • the METHl or METH2 cDNA sequence contained in the deposited clone, including the AUG initiation codon and any naturally associated leader sequence, is amplified using the PCR protocol described in Example 5. If the naturally occurring signal sequence is used to produce the secreted protein, the pA2 vector does not need a second signal peptide.
  • the vector can be modified ( ⁇ A2 GP) to include a baculovirus leader sequence, using the standard methods described in Summers et al, "A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures," Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
  • the amplified fragment is isolated from a 1% agarose gel using a commercially available kit ("Geneclean,” BIO 101 Inc., La Jolla, Ca.). The fragment then is digested with appropriate restriction enzymes and again purified on a 1% agarose gel.
  • the plasmid is digested with the corresponding restriction enzymes and optionally, can be dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art.
  • the DNA is then isolated from a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.).
  • E. coli HB 101 or other suitable E. coli hosts such as XL- 1 Blue
  • a plasmid containing the polynucleotide Five ug of a plasmid containing the polynucleotide is co-transfected with 1.0 ug of a commercially available linearized baculovirus DNA ("BaculoGold 3 baculovirus DNA", Pharmingen, San Diego, CA), using the lipofection method described by Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417 (1987).
  • BaculoGold 3 virus DNA and 5 ug of the plasmid are mixed in a sterile -137-
  • plaque assay After four days the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, supra. An agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) is used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques. (A detailed description of a "plaque assay” of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FB S .
  • the cells are infected with the recombinant baculovirus containing the polynucleotide at a multiplicity of infection ("MOI") of about 2. If radiolabeled proteins are desired, 6 hours later the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Rockville, MD). After 42 hours, 5 uCi of 35 S-methionine and 5 uCi 35 S-cysteine (available from Amersham) are added. The cells are further incubated for 16 hours and then are harvested by -138-
  • MOI multiplicity of infection
  • Microsequencing of the amino acid sequence of the amino terminus of purified protein may be used to determine the amino terminal sequence of the produced METHl or METH2 protein.
  • METHl or METH2 polypeptide can be expressed in a mammalian cell.
  • a typical mammalian expression vector contains a promoter element, which mediates the initiation of transcription of mRNA, a protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript.
  • Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription is achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from Retroviruses, e.g., RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV).
  • LTRs long terminal repeats
  • CMV cytomegalovirus
  • cellular elements can also be used (e.g., the human actin promoter).
  • Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2DHFR (ATCC 37146), pBC12MI (ATCC 67109), pCMVSport 2.0, and pCMVSport 3.0.
  • Mammalian host cells that could be used include, human Hela, 293, H9 and Jurkat cells, mouse NEH3T3 and C127 cells, Cos 1, Cos 7 and CV1, quail QC1-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells.
  • METHl or METH2 polypeptide can be expressed in stable cell lines containing the METHl or METH2 polynucleotide integrated into a chromosome.
  • the co-transfection with a selectable marker such as DHFR, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells.
  • the transfected METHl or METH2 gene can also be amplified to express large amounts of the encoded protein.
  • the DHFR (dihydrofolate reductase) marker is useful in developing cell lines that carry several hundred or even several thousand copies of the gene of interest. (See, e.g., Alt, F. W., et al, J. Biol. Chem. 253:1351- 310 (1978); Hamlin, J. L. and Ma, C, Biochem. et Biophys.
  • Another useful selection marker is the enzyme glutamine synthase (GS) (Murphy et al. , Biochem J. 227: 277-279 (1991); Bebbington et al. , Bio/Technology 70: 169-175 (1992).
  • GS glutamine synthase
  • the mammalian cells are grown in selective medium and the cells with the highest resistance are selected. These cell lines contain the amplified gene(s) integrated into a chromosome. Chinese hamster ovary (CHO) and NSO cells are often used for the production of proteins.
  • LTR Rous Sarcoma Virus
  • CMV-enhancer Boshart et al, Cell 47:521-530 (1985).
  • Multiple cloning sites e.g., with the restriction enzyme cleavage sites BamHI, Xbal and Asp718, facilitate the cloning of METHl or METH2.
  • the vectors also contain the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene, and the mouse DHFR gene under control of the SV40 early promoter.
  • the vector does not need a second signal peptide.
  • the vector can be modified to include a heterologous signal sequence in an effort to secrete the protein from the cell. (See, e.g., WO 96/34891.)
  • the amplified fragment is then digested with the appropriate restriction enzyme and purified on a 1% agarose gel using a commercially available kit -140-
  • E. coli HB 101 or XL-1 Blue cells are then transformed and bacteria are identified that contain the fragment inserted into plasmid pC6 or pC4 using, for instance, restriction enzyme analysis.
  • Chinese hamster ovary cells lacking an active DHFR gene is used for transfection.
  • Five ⁇ g of the expression plasmid pC6 or pC4 is cotransfected with 0.5 ug of the plasmid pSVneo using lipofectin (Feigner et al., supra).
  • the plasmid pS V2-neo contains a dominant selectable marker, the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418.
  • the cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418.
  • the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml of metothrexate plus 1 mg/ml G418. After about 10-14 days single clones are trypsinized and then seeded in 6-well petri dishes or 10 ml flasks using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM).
  • methotrexate 50 nM, 100 nM, 200 nM, 400 nM, 800 nM.
  • Clones growing at the highest concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate ( 1 uM, 2 uM, 5 uM, 10 mM, 20 mM). The same procedure is repeated until clones are obtained which grow at a concentration of 100 - 200 uM.
  • Expression of METHl or METH2 is analyzed, for instance, by SDS-PAGE and Western blot or by reversed phase HPLC analysis.
  • oligonucleotide primers of about 15-25 nucleotides are derived from the desired 5' and 3' positions of a polynucleotide of SEQ ID NO:l or SEQ ID NO:3. The 5' and 3' positions of the primers are determined based on the desired METHl or -141-
  • METH2 polynucleotide fragment An initiation and stop codon are added to the 5' and 3' primers respectively, if necessary, to express the METHl or METH2 polypeptide fragment encoded by the polynucleotide fragment.
  • Preferred METHl or METH2 polynucleotide fragments are those encoding the N-terminal and C- terminal deletion mutants disclosed above in the "Polynucleotide and Polypeptide
  • METHl or METH2 polynucleotide fragment is amplified from genomic DNA or from the deposited cDNA clone using the appropriate PCR oligonucleotide primers and conditions discussed herein or known in the art.
  • the METHl or METH2 polypeptide fragments encoded by the METHl or METH2 polynucleotide fragments of the present invention may be expressed and purified in the same general manner as the full length polypeptides, although routine modifications may be necessary due to the differences in chemical and physical properties between a particular fragment and full length polypeptide.
  • the polynucleotide encoding the METHl polypeptide fragment D-40 to S-950 or the METH2 polypeptide fragment L-20 to L-890 is amplified and cloned as follows:
  • a 5' primer is generated comprising a restriction enzyme site followed by an initiation codon in frame with the polynucleotide sequence encoding the N- terminal portion of the polypeptide fragment beginning with D-40 or L-20, respectively.
  • a complementary 3' primer is generated comprising a restriction enzyme site followed by a stop codon in frame with the polynucleotide sequence encoding C-terminal portion of the METHl or METH2 polypeptide fragment ending with S-950 or L-890, respectively.
  • the amplified polynucleotide fragment and the expression vector are digested with restriction enzymes which recognize the sites in the primers.
  • the digested polynucleotides are then ligated together.
  • polynucleotide fragment is inserted into the restricted expression vector, preferably in a manner which places the METH 1 or METH2 polypeptide fragment coding region downstream from the promoter
  • the ligation mixture is transformed into competent E. coli cells using standard procedures and as described in the Examples herein Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing
  • METHl or METH2 polypeptides are preferably fused to other proteins
  • These fusion proteins can be used for a variety of applications
  • fusion of METHl or METH2 polypeptides to His-tag, HA-tag, protein A, IgG domains, and maltose binding protein facilitates purification (See Example 7, see also EP A 394,827, Traunecker, et al , Nature 331 84-86 (1988) )
  • fusion to IgG-1, IgG-3, and albumin increases the halflife time in vivo
  • Nuclear localization signals fused to METHl or METH2 polypeptides can target the protein to a specific subcellular localization, while covalent heterodimer or homodimers can increase or decrease the activity of a fusion protein Fusion proteins can also create chimeric molecules having more than one function
  • fusion proteins can increase solubility and/or stability of the fused protein compared to the non-fused protein All of the types of fusion proteins described above can be
  • the human Fc portion of the IgG molecule can be PCR amplified, using primers that span the 5' and 3' ends of the sequence described below These primers also should have convenient restriction enzyme sites that will facilitate cloning into an expression vector, preferably a mammalian expression vector
  • the human Fc portion can be ligated into the BamHI cloning site Note that the 3' BamHI site -143-
  • the vector containing the human Fc portion is re- restricted with BamHI, linearizing the vector, and METHl or METH2 polynucleotide, isolated by the PCR protocol described in Example 5, is ligated into this BamHI site. Note that the polynucleotide is cloned without a stop codon, otherwise a fusion protein will not be produced.
  • pC4 does not need a second signal peptide.
  • the vector can be modified to include a heterologous signal sequence. (See, e.g., WO 96/34891.)
  • the antibodies of the present invention can be prepared by a variety of methods. (See, Current Protocols, Chapter 2.) For example, cells expressing METHl or METH2 is administered to an animal to induce the production of sera containing polyclonal antibodies. In a preferred method, a preparation of METHl or METH2 protein is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.
  • the antibodies of the present invention are monoclonal antibodies (or protein binding fragments thereof).
  • Such monoclonal antibodies can be prepared using hybridoma technology. (Kohler et al. , Nature 256:495 (1975); Kohler et al. , Eur. J. Immunol. 6:511 (1976); Kohler et al. , Eur. J. Immunol. 6:292 (1976); Hammerling et al, in: Monoclonal Antibodies and T- Cell Hybridomas, Elsevier, N.Y., pp. 563-681 (1981).) In general, such procedures involve immunizing an animal (preferably a mouse) with METHl or
  • METH2 polypeptide or, more preferably, with a secreted METHl or METH2 polypeptide-expressing cell.
  • Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with 10% fetal bovine serum (inactivated at about 56 degree C), and supplemented with about 10 g/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ug/ml of streptomycin.
  • the splenocytes of such mice are extracted and fused with a suitable myeloma cell line.
  • a suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP2O), available from the ATCC.
  • SP2O parent myeloma cell line
  • the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 50:225-232 (1981).)
  • the hybridoma cells obtained through such a selection are then assayed to identify -145-
  • additional antibodies capable of binding to METHl or METH2 polypeptide can be produced in a two-step procedure using anti-idiotypic antibodies.
  • Such a method makes use of the fact that antibodies are themselves antigens, and therefore, it is possible to obtain an antibody which binds to a second antibody.
  • protein specific antibodies are used to immunize an animal, preferably a mouse.
  • the splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the METHl or
  • METH2 protein-specific antibody can be blocked by METHl or METH2.
  • Such antibodies comprise anti-idiotypic antibodies to the METHl or METH2 protein-specific antibody and can be used to immunize an animal to induce formation of further METHl or METH2 protein-specific antibodies.
  • Fab and F(ab')2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein. Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
  • secreted METHl or METH2 protein-binding fragments can be produced through the application of recombinant DNA technology or through synthetic chemistry.
  • chimeric monoclonal antibodies For in vivo use of antibodies in humans, it may be preferable to use "humanized" chimeric monoclonal antibodies. Such antibodies can be produced using genetic constructs derived from hybridoma cells producing the monoclonal antibodies described above. Methods for producing chimeric antibodies are known in the art. (See, for review, Morrison, Science 229: 1202 (1985); Oi et al. , BioTechniques 4:214 (1986); Cabilly etal, U.S.
  • the following protocol produces a supernatant containing METHl or METH2 polypeptide to be tested. This supernatant can then be used in the Screening Assays described in Examples 16-23.
  • PBS w/o calcium or magnesium 17-516F Biowhittaker
  • the PBS should remain in the well until just prior to plating the cells and plates may be poly-lysine coated in advance for up to two weeks. Plate 293T cells (do not carry cells past P+20) at 2 x 10 5 cells/well in .5ml
  • DMEM Dulbecco's Modified Eagle Medium
  • glucose and L- glutamine (12-604F Biowhittaker) 10% heat inactivated FBSQ4-503F
  • the transfection should be performed by tag-teaming the following tasks.
  • tag-teaming hands on time is cut in half, and the cells do not -147-
  • Valine 0 0035 mg/L of Biotin, 3 24 mg/L of D-Ca Pantothenate, 11 78 mg/L of Choline Chloride, 4 65 mg/L of Folic Acid, 15 60 mg/L of i-Inositol, 3 02 mg/L of Niacinamide, 3 00 mg/L of Pyridoxal HCL, 0 031 mg/L of Pyridoxine HCL, 0 319 mg/L of Riboflavin, 3 17 mg/L of Thiamine HCL, 0 365 mg/L of Thymidine, 0 680 mg/L of Vitamin B 12 , 25 mM of HEPES Buffer, 2 39 mg/L of -148-
  • Adjust osmolarity to 327 mOsm) with 2mm glutamine and lx penstrep. (BSA (81-068-3 Bayer) lOOgm dissolved in IL DMEM for a 10% BSA stock solution). Filter the media and collect 50 ul for endotoxin assay in 15ml polystyrene conical. The transfection reaction is terminated, preferably by tag-teaming, at the end of the incubation period. Person A aspirates off the transfection media, while person B adds 1.5ml appropriate media to each well. Incubate at 37 degree C for 45 or 72 hours depending on the media used: 1%BSA for 45 hours or CHO-5 for 72 hours.
  • METHl or METH2 polypeptide directly (e.g., as a secreted protein) or by METHl or METH2 inducing expression of other proteins, which are then secreted into the supernatant.
  • the invention further provides a method of identifying the protein in the supernatant characterized by an activity in a particular assay.
  • Jaks-STATs pathway bind to gamma activation site "GAS” elements or interferon- sensitive responsive element ("ISRE"), located in the promoter of many genes. The binding of a protein to these elements alter the expression of the associated gene. GAS and ISRE elements are recognized by a class of transcription factors called Signal Transducers and Activators of Transcription, or " ST ATs. " There are six members of the STATs family. Statl and Stat3 are present in many cell types, as is Stat2 (as response to IFN-alpha is widespread). Stat4 is more restricted and is not in many cell types though it has been found in T helper class I, cells after treatment with IL- 12. Stat5 was originally called mammary growth factor, but has been found at higher concentrations in other cells including myeloid cells. It can be activated in tissue culture cells by many cytokines.
  • the STATs are activated to translocate from the cytoplasm to the nucleus upon tyrosine phosphorylation by a set of kinases known as the Janus Kinase ("Jaks") family.
  • Jaks represent a distinct family of soluble tyrosine kinases and include Tyk2, Jakl, Jak2, and Jak3. These kinases display significant sequence similarity and are generally catalytically inactive in resting cells.
  • a cytokine receptor family capable of activating Jaks, is divided into two groups: (a) Class 1 includes receptors for IL-2, IL-3, EL-4, IL-6, EL-7, EL-9, EL-11, IL-12, IL-15, Epo, PRL, GH, G-CSF, GM-CSF, LIF, CNTF, and thrombopoietin; and (b) Class 2 includes IFN-a, EFN-g, and EL-10.
  • the Class 1 receptors share a conserved cysteine motif (a set of four conserved cysteines and one tryptophan) and a WSXWS motif (a membrane proxial region encoding Trp-
  • Jaks are activated, which in turn activate STATs, which then translocate and bind to GAS elements. This entire process is encompassed in the Jaks-STATs signal transduction pathway. -150-
  • activation of the Jaks-STATs pathway reflected by the binding of the GAS or the ISRE element, can be used to indicate proteins involved in the proliferation and differentiation of cells
  • growth factors and cytokines are known to activate the Jaks-STATs pathway (See Table below )
  • activators of the Jaks- STATs pathway can be identified
  • a PCR based strategy is employed to generate a GAS-SV40 promoter sequence.
  • the 5' primer contains four tandem copies of the GAS binding site found in the IRF1 promoter and previously demonstrated to bind STATs upon induction with a range of cytokines
  • the 5' primer also contains 18bp of sequence complementary to the S V40 early promoter sequence and is flanked with an Xhol site.
  • the sequence of the 5' primer is: 5':GCGCCTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTT
  • the downstream primer is complementary to the SV40 promoter and is flanked with a Hind III site: 5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID NO: 87)
  • PCR amplification is performed using the S V40 promoter template present in the B-gal:promoter plasmid obtained from Clontech.
  • the resulting PCR fragment is digested with Xhol/Hind III and subcloned into BLSK2-. (Stratagene.) Sequencing with forward and reverse primers confirms that the insert contains the following sequence:
  • a GAS:SEAP2 reporter construct is next engineered.
  • the reporter molecule is a secreted alkaline phosphatase, or "SEAP.”
  • SEAP secreted alkaline phosphatase
  • reporter molecules can be instead of SEAP, in this or in any of the other Examples.
  • Well known reporter molecules that can be used instead of SEAP include chloramphenicol acetyltransferase (CAT), luciferase, alkaline phosphatase, B- galactosidase, green fluorescent protein (GFP), or any protein detectable by an antibody.
  • CAT chloramphenicol acetyltransferase
  • luciferase luciferase
  • alkaline phosphatase B- galactosidase
  • GFP green fluorescent protein
  • the above sequence confirmed synthetic GAS-SV40 promoter element is subcloned into the pSEAP-Promoter vector obtained from Clontech using Hindlll and Xhol, effectively replacing the S V40 promoter with the amplified GAS : S V40 promoter element, to create the GAS-SEAP vector.
  • this vector does not contain a neomycin resistance gene, and therefore, is not preferred for mammalian expression systems.
  • the GAS-SEAP cassette is removed from the GAS-SEAP vector using Sail and Notl, and inserted into a backbone vector containing the neomycin resistance gene, such as pGFP-1 (Clontech), using these restriction sites in the multiple cloning site, to create the GAS-SEAP/Neo vector.
  • pGFP-1 pGFP-1
  • HELA epidermal
  • HUVEC endothelial
  • Reh B-cell
  • Saos-2 osteoblast
  • HUVAC aortic
  • Cardiomyocyte aortic
  • T-cell activity is assessed using the GAS/SEAP/Neo construct produced in Example 15. Thus, factors that increase SEAP activity indicate the ability to activate the Jaks-STATS signal transduction pathway.
  • the T-cell used in this assay is Jurkat T-cells (ATCC Accession No. TIB-152), although Molt-3 cells (ATCC Accession No. CRL-1552) and Molt-4 cells (ATCC Accession No. CRL-1582) cells can also be used.
  • Jurkat T-cells are lymphoblastic CD4+ Thl helper cells.
  • Jurkat cells are transfected with the GAS-SEAP/neo vector using DMRIE-C (Life Technologies)(transfection procedure described below).
  • the transfected cells are seeded to a density of approximately 20,000 cells per well and transfectants resistant to 1 mg/ml genticin selected. Resistant colonies are expanded and then tested for their response to increasing concentrations of interferon gamma. The dose response of a selected clone is demonstrated.
  • the following protocol will yield sufficient cells for 75 wells containing 200 ul of cells. Thus, it is either scaled up, or performed in multiple to generate sufficient cells for multiple 96 well plates. Jurkat cells are maintained in
  • RPMI + 10% serum with l%Pen-Strep Combine 2.5 mis of OPTI-MEM (Life Technologies) with 10 ug of plasmid DNA in a T25 flask. Add 2.5 ml OPTIMEM containing 50 ul of DMRIE-C and incubate at room temperature for 15-45 mins. During the incubation period, count cell concentration, spin down the required number of cells (10 7 per transfection), and resuspend in OPTI-MEM to a final concentration of 10 7 cells/ml. Then add 1ml of 1 x 10 7 cells in OPTI-MEM to T25 flask and incubate at 37 degree C for 6 hrs. After the incubation, add 10 ml of RPMI + 15% serum. -154-
  • the Jurkat: GAS -SEAP stable reporter lines are maintained in RPMI + 10% serum, 1 mg/ml Genticin, and 1% Pen-Strep. These cells are treated with supernatants containing METHl or METH2 polypeptides or METHl orMETffi induced polypeptides as produced by the protocol described in Example 14. On the day of treatment with the supernatant, the cells should be washed and resuspended in fresh RPMI + 10% serum to a density of 500,000 cells per ml. The exact number of cells required will depend on the number of supernatants being screened. For one 96 well plate, approximately 10 million cells (for 10 plates, 100 million cells) are required.
  • the 96 well dishes containing Jurkat cells treated with supernatants are placed in an incubator for 48 hrs (note: this time is variable between 48-72 hrs).
  • 35 ul samples from each well are then transferred to an opaque 96 well plate using a 12 channel pipette.
  • the opaque plates should be covered (using sellophene covers) and stored at -20 degree C until SEAP assays are performed according to Example 20.
  • the plates containing the remaining treated cells are placed at 4 degree C and serve as a source of material for repeating the assay on a specific well if desired.
  • interferon gamma 100 Unit/ml interferon gamma can be used which is known to activate Jurkat T cells. Over 30 fold induction is typically observed in the positive control wells. -155-
  • Example 17 High-Throughput Screening Assay Identifying Myeloid Activity
  • the myeloid cell used in this assay is U937, a pre-monocyte cell line, although TF-1, HL60, or KG1 can be used
  • the GAS-SEAP/U937 stable cells are obtained by growing the cells in 400 ug/ml G418
  • the G418-free medium is used for routine growth but every one to two months, the cells should be re-grown in 400 ug/ml G418 for couple of passages
  • These cells are tested by harvesting lxl 0 8 cells (this is enough for ten 96- well plates assay) and wash with PBS Suspend the cells in 200 ml above described growth medium, with a final density of 5x10 5 cells/ml Plate 200 ul cells per well in the 96-well plate (or lxl 0 5 cells/well) -156-
  • Example 14 Incubate at 37 degee C for 48 to 72 hr. As a positive control, 100
  • Unit/ml interferon gamma can be used which is known to activate U937 cells.
  • Example 18 High-Throughput Screening Assay Identifying Neuronal Activity
  • EGR1 early growth response gene 1
  • the promoter of EGR1 is responsible for such induction.
  • EGR1 promoter linked to reporter molecules activation of cells can be assessed by METHl or METH2.
  • PC 12 cells rat phenochromocytoma cells
  • mitogens such as
  • TPA tetradecanoyl phorbol acetate
  • NGF nerve growth factor
  • EGF epidermal growth factor
  • the EGR/SEAP reporter construct can be assembled by the following protocol.
  • the EGR-1 promoter sequence (-633 to +l)(Sakamoto K et al, Oncogene 6:861-811 (1991)) can be PCR amplified from human genomic DNA using the following primers: 5' GCGCTCGAGGGATGACAGCGATAGAACCCCGG -3' (SEQ ID NO: 9)
  • GAS/SV40 stuffer Restrict the EGRl amplified product with these same enzymes Ligate the vector and the EGRl promoter
  • EGR-SEAP/PC12 stable cells are obtained by growing the cells in 300 ug/ml G418 The G418-free medium is used for routine growth but every one to two months, the cells should be re- grown in 300 ug/ml G418 for couple of passages
  • a 10 cm plate with cells around 70 to 80% confluent is screened by removing the old medium Wash the cells once with PBS (Phosphate buffered saline) Then starve the cells in low serum medium (RPMI- 1640 containing 1% horse serum and 0 5% FBS with antibiotics) overnight The next morning, remove the medium and wash the cells with PBS
  • PBS Phosphate buffered saline
  • a growth factor known to activate PC 12 cells through EGR can be used, such as 50 ng/ul of Neuronal Growth Factor (NGF). Over fifty-fold induction of SEAP is typically seen in the positive control wells. SEAP assay the supernatant according to Example 20.
  • NF-KB Nuclear Factor KB
  • NF-KB is a transcription factor activated by a wide variety of agents including the inflammatory cytokines IL-1 and TNF, CD30 and CD40, lymphotoxin-alpha and lymphotoxin-beta, by exposure to LPS or thrombin, and by expression of certain viral gene products.
  • NF-KB regulates the expression of genes involved in immune cell activation, control of apoptosis (NF- KB appears to shield cells from apoptosis), B and T-cell development, anti-viral and antimicrobial responses, and multiple stress responses.
  • KB (Inhibitor KB). However, upon stimulation, I- KB is phosphorylated and degraded, causing NF- KB to shuttle to the nucleus, thereby activating transcription of target genes.
  • Target genes activated by NF- KB include IL-2, IL-6, GM-CSF, ICAM-1 and class 1 MHC.
  • reporter constructs utilizing the NF-KB promoter element are used to screen the supernatants produced in Example 14.
  • Activators or inhibitors of NF-KB would be useful in treating diseases.
  • inhibitors of NF-KB could be used to treat those diseases related to the acute or chronic activation of NF-KB, such as rheumatoid arthritis.
  • the upstream primer contains four tandem copies of the NF-KB binding site (GGGGACTTTCCC) (SEQ ID NO:91), 18 bp of sequence complementary to the 5' end of the SV40 early promoter sequence, and is flanked with an Xhol site: ⁇ 159-
  • the downstream primer is complementary to the 3' end of the SV40 promoter and is flanked with a Hind III site: 5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID NO:93)
  • PCR amplification is performed using the S V40 promoter template present in the pB-gal: promoter plasmid obtained from Clontech.
  • the resulting PCR fragment is digested with Xhol and Hind III and subcloned into BLSK2-.
  • the NF-KB/S V40/SEAP cassette is removed from the above NF-KB/SEAP vector using restriction enzymes Sail and Notl, and inserted into a vector containing neomycin resistance.
  • the NF-KB/S V40/SEAP cassette was inserted into pGFP-1 (Clontech), replacing the GFP gene, after restricting pGFP-1 with Sail and Not!
  • NF-KB/S V40/SEAP/Neo vector Once NF-KB/S V40/SEAP/Neo vector is created, stable Jurkat T-cells are created and maintained according to the protocol described in Example 16.
  • Example 16 As a positive control, exogenous TNF alpha (0.1,1, -160-
  • SEAP activity is assayed using the Tropix Phospho-light Kit (Cat. BP-400) according to the following general procedure.
  • the Tropix Phospho-light Kit supplies the Dilution, Assay, and Reaction Buffers used below.
  • Example 21 High- Throughput Screening Assay Identifying Changes in Small Molecule Concentration and Membrane Permeability
  • Binding of a ligand to a receptor is known to alter intracellular levels of small molecules, such as calcium, potassium, sodium, and pH, as well as alter membrane potential. These alterations can be measured in an assay to identify supernatants which bind to receptors of a particular cell. Although the following protocol describes an assay for calcium, this protocol can easily be modified to ⁇ 162-
  • FLIPR Fluorometric Imaging Plate Reader
  • adherent cells For adherent cells, seed the cells at 10,000 -20,000 cells/well in a Co-star black 96-well plate with clear bottom The plate is incubated in a CO 2 incubator for 20 hours The adherent cells are washed two times in Biotek washer with 200 ul of HBSS (Hank's Balanced Salt Solution) leaving 100 ul of buffer after the final wash
  • a stock solution of 1 mg/ml fluo-3 is made in 10% pluronic acid DMSO To load the cells with fluo-3, 50 ul of 12 ug/ml fluo-3 is added to each well The plate is incubated at 37 degree C in a CO 2 incubator for 60 min The plate is washed four times in the Biotek washer with HBSS leaving 100 ul of buffer
  • the cells are spun down from culture media
  • Cells are re-suspended to 2-5x10 6 cells/ml with HBSS in a 50-ml conical tube 4 ul of 1 mg/ml fluo-3 solution in 10% pluronic acid DMSO is added to each ml of cell suspension
  • the tube is then placed in a 37 degree C water bath for 30-60 min
  • the cells are washed twice with HBSS, resuspended to lxl 0 6 cells/ml, and dispensed into a microplate, 100 ul/well
  • the plate is centrifuged at 1000 rpm for 5 min
  • the plate is then washed once in Denley CellWash with 200 ul, followed by an aspiration step to 100 ul final volume
  • each well contains a fluorescent molecule, such as fluo-3
  • a fluorescent molecule such as fluo-3
  • the FLIPR is set for the following parameters (1) System gain is 300-800 mW, (2) Exposure time is 0 4 second, (3) Camera F/stop is F/2, (4) Excitation is 488 nm, (5) Emission is 530 nm, and (6) Sample addition is 50 ul Increased emission at 530 nm indicates -163-
  • the Protein Tyrosine Kinases represent a diverse group of transmembrane and cytoplasmic kinases. Within the Receptor Protein Tyrosine Kinase RPTK) group are receptors for a range of mitogenic and metabolic growth factors including the PDGF, FGF, EGF, NGF, HGF and Insulin receptor subfamilies. In addition there are a large family of RPTKs for which the corresponding ligand is unknown. Ligands for RPTKs include mainly secreted small proteins, but also membrane-bound and extracellular matrix proteins.
  • cytoplasmic tyrosine kinases include receptor associated tyrosine kinases of the src-family (e.g., src, yes, lck, lyn, fyn) and non-receptor linked and cytosolic protein tyrosine kinases, such as the Jak family, members of which mediate signal transduction triggered by the cytokine superfamily of receptors (e.g., the Interleukins, Interferons, GM-CSF, and Leptin).
  • src-family e.g., src, yes, lck, lyn, fyn
  • non-receptor linked and cytosolic protein tyrosine kinases such as the Jak family, members of which mediate signal transduction triggered by the cytokine superfamily of receptors (e.g., the Interleukins, Interferons, GM-CSF, and Leptin).
  • Seed target cells e.g., primary keratinocytes
  • Loprodyne Silent Screen Plates purchased from Nalge Nunc (Naperville, IL). The plates are sterilized with two 30 minute rinses ⁇ 164-
  • A431 cells are seeded onto the nylon membranes of Loprodyne plates (20,000/200ml/well) and cultured overnight in complete medium Cells are quiesced by incubation in serum-free basal medium for 24 hr After 5-20 minutes treatment with EGF (60ng/ml) or 50 ul of the supernatant produced in Example 14, the medium was removed and 100 ml of extraction buffer ((20 mM HEPES pH 7 5, 0 15 M NaCI, 1% Triton X-100, 0 1% SDS, 2 mMNa3VO4, 2 mM Na4P2O7 and a cocktail of protease inhibitors (# 1836170) obtained from Boehringer Mannheim (Indianapolis, IN) is added to each well and the plate is shaken on a rotating shaker for 5 minutes at 4°C The plate is then placed in a vacuum transfer manifold and the extract filtered through the 0 45 mm membrane bottoms of each well using house vacuum Extracts are
  • the tyrosine kinase activity of a supernatant is evaluated by determining its ability to phosphorylate a tyrosine residue on a specific substrate (a biotinylated peptide).
  • Biotinylated peptides that can be used for this purpose include PSK1 (corresponding to amino acids 6-20 of the cell division kinase cdc2- p34) and PSK2 (corresponding to amino acids 1-17 of gastrin). Both peptides are substrates for a range of tyrosine kinases and are available from Boehringer Mannheim.
  • the tyrosine kinase reaction is set up by adding the following components in order. First, add 1 Oul of 5uM Biotinylated Peptide, then 1 Oul ATP/Mg 2+ (5mM ATP/50mM MgC12), then lOul of 5x Assay Buffer (40mM imidazole hydro chloride, pH7.3, 40 mM beta-glycerophosphate, lmM EGTA, lOOmM MgCl 2 , 5 mM MnCl 2 , 0.5 mg/ml BSA), then 5ul of Sodium Vanadate(lmM), and then 5ul of water. Mix the components gently and preincubate the reaction mix at 30 degree C for 2 min. Initial the reaction by adding lOul of the control enzyme or the filtered supernatant.
  • 5x Assay Buffer 40mM imidazole hydro chloride, pH7.3, 40 mM beta-glycerophosphate, lmM EGTA
  • the tyrosine kinase assay reaction is then terminated by adding 10 ul of 120mm EDTA and place the reactions on ice.
  • Tyrosine kinase activity is determined by transferring 50 ul aliquot of reaction mixture to a microtiter plate (MTP) module and incubating at 37 degree C for 20 min. This allows the streptavadin coated 96 well plate to associate with the biotinylated peptide. Wash the MTP module with 300ul/well of PBS four times. Next add 75 ul of anti-phospotyrosine antibody conjugated to horse radish peroxidase(anti-P-Tyr-POD(0.5u/ml)) to each well and incubate at 37 degree C for one hour. Wash the well as above.
  • MTP microtiter plate
  • an assay which detects activation (phosphorylation) of major intracellular signal transduction intermediates can also be used for example, as described below one particular assay can detect tyrosine phosphorylation of the Erk-1 and Erk-2 kinases
  • phosphorylation of other molecules such as Raf, JNK, p38 MAP, Map kinase kinase (MEK), MEK kinase, Src, Muscle specific kinase (MuSK), IRAK, Tec, and Janus, as well as any other phosphoserine, phosphotyrosine, or phosphothreonine molecule, can be detected by substituting these molecules for Erk- 1 or Erk-2 in the following assay
  • assay plates are made by coating the wells of a 96-well ELISA plate with 0 1ml of protein G (lug/ml) for 2 hr at room temp, (RT) The plates are then rinsed with PBS and blocked with 3% BS A/PBS for 1 hr at RT The protein G plates are then treated with 2 commercial monoclonal antibodies
  • MAP kinase 1 Ong/well
  • A431 extract Plates are then treated with a commercial polyclonal (rabbit) antibody ( 1 ug/ml) which specifically recognizes the phosphorylated epitope of the Erk-1 and Erk-2 kinases (1 hr at RT)
  • This antibody is biotinylated by standard ⁇ 167-
  • the bound polyclonal antibody is then quantitated by successive incubations with Europium-streptavidin and Europium fluorescence enhancing reagent in the Wallac DELFIA instrument (time-resolved fluorescence).
  • An increased fluorescent signal over background indicates a phosphorylation by METHl or METH2 or a molecule induced by METHl or METH2.
  • RNA isolated from entire families or individual patients presenting with a phenotype of interest is be isolated. cDNA is then generated from these RNA samples using protocols known in the art. (See, Sambrook.)
  • the cDNA is then used as a template for PCR, employing primers surrounding regions of interest in SEQ ID NO: l .
  • Suggested PCR conditions consist of 35 cycles at 95 degree C for 30 seconds; 60-120 seconds at 52-58 degree C; and 60- 120 seconds at 70 degree C, using buffer solutions described in Sidransky, D. et al, Science 252 : 706 ( 1991 ) .
  • PCR products are then sequenced using primers labeled at their 5' end with T4 polynucleotide kinase, employing SequiTherm Polymerase. (Epicentre Technologies). The intron-exon borders of selected exons of METHl or METH2 is also determined and genomic PCR products analyzed to confirm the results. PCR products harboring suspected mutations in METHl or METH2 is then cloned and sequenced to validate the results of the direct sequencing.
  • PCR products of METHl or METH2 are cloned into T-tailed vectors as described in Holton, T.A. and Graham, M.W., Nucleic Acids Research 79: 1156 (1991) and sequenced with T7 polymerase (United States Biochemical). Affected individuals are identified by mutations in METHl or METH2 not present in unaffected individuals.
  • Genomic rearrangements are also observed as a method of determining alterations in the METHl or METH2 gene. Isolated genomic clones are nick- translated with digoxigenindeoxy-uridine 5'-triphosphate (Boehringer Manheim), -168-
  • Hybridization with the labeled probe is carried out using a vast excess of human cot-1 DNA for specific hybridization to the METHl or METH2 genomic locus.
  • Chromosomes are counterstained with 4,6-diamino-2-phenylidole and propidium iodide, producing a combination of C- and R-bands.
  • Aligned images for precise mapping are obtained using a triple-band filter set (Chroma Technology, Brattleboro, VT) in combination with a cooled charge-coupled device camera (Photometries, Arlington, AZ) and variable excitation wavelength filters. (Johnson, Cv.
  • Example 25 Method of Detecting Abnormal Levels of METHl orMETH2 in a Biological Sample
  • METHl or METH2 polypeptides can be detected in a biological sample, and if an increased or decreased level of METHl or METH2 is detected, this polypeptide is a marker for a particular phenotype. Methods of detection are numerous, and thus, it is understood that one skilled in the art can modify the following assay to fit their particular needs.
  • antibody-sandwich ELISAs are used to detect METHl or METH2 in a sample, preferably a biological sample.
  • Wells of a microtiter plate are coated with specific antibodies to METHl or METH2, at a final concentration of 0.2 to 10 ug/ml.
  • the antibodies are either monoclonal or polyclonal and are produced by the method described in Example 13. The wells are blocked so that non-specific binding of METHl or METH2 to the well is reduced. -169-
  • the coated wells are then incubated for > 2 hours at RT with a sample containing METHl or METH2.
  • serial dilutions of the sample should be used to validate results.
  • the plates are then washed three times with deionized or distilled water to remove unbounded METHl or METH2.
  • 50 ul of specific antibody-alkaline phosphatase conjugate, at a concentration of 25-400 ng, is added and incubated for 2 hours at room temperature.
  • the plates are again washed three times with deionized or distilled water to remove unbounded conjugate.
  • MUP 4-methylumbelliferyl phosphate
  • NBP p-nitrophenyl phosphate
  • the METHl or METH2 composition will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with the METHl or METH2 polypeptide alone), the site of delivery, the method of administration, the scheduling of administration, and other factors known to practitioners.
  • the "effective amount" for purposes herein is thus determined by such considerations.
  • the total pharmaceutically effective amount of METHl or METH2 administered parenterally per dose will be in the range of about lug/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and -170-
  • METHl or METH2 is typically administered at a dose rate of about 1 ug/kg/hour to about 50 ug/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump.
  • An intravenous bag solution may also be employed. The length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect.
  • compositions containing METHl or METH2 are administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), bucally, or as an oral or nasal spray.
  • “Pharmaceutically acceptable carrier” refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • sustained-release compositions include semi- permeable polymer matrices in the form of shaped articles, e.g., films, or mirocapsules.
  • Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L- glutamate (Sidman, U. et al, Biopolymers 22:541-556 (1983)), poly (2- hydroxyethyl methacrylate) (R. Langer et al. , J. Biomed. Mater. Res.
  • Sustained- release compositions also include liposomally entrapped METHl or METH2 polypeptides. Liposomes containing the METHl or METH2 are prepared by methods known per se: DE 3,218,121; Epstein et al, Proc. Natl. Acad. Sci. USA 52:3688-3692 (1985); Hwang et al, Proc. Natl. Acad. Sci.
  • the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal secreted polypeptide therapy.
  • METHl or METH2 is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • a pharmaceutically acceptable carrier i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to polypeptides.
  • the formulations are prepared by contacting METHl or METH2 uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation.
  • the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non- aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.
  • the carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability.
  • Such materials are non- toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as -172-
  • EDTA EDTA
  • sugar alcohols such as mannitol or sorbitol
  • counterions such as sodium
  • nonionic surfactants such as polysorbates, poloxamers, or PEG.
  • METHl or METH2 is typically formulated in such vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It will be understood that the use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of polypeptide salts.
  • METHl or METH2 used for therapeutic administration can be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes).
  • Therapeutic polypeptide compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • METHl or METH2 polypeptides ordinarily will be stored in unit or multi- dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
  • a lyophilized formulation 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous METHl or METH2 polypeptide solution, and the resulting mixture is lyophilized.
  • the infusion solution is prepared by reconstituting the lyophilized METHl or METH2 polypeptide using bacteriostatic Water-for-Injection.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • METHl or METH2 may be employed in conjunction with other therapeutic compounds. -173-
  • Example 27 Method of Treating Decreased Levels of METHl or METH2
  • the present invention relates to a method for treating an individual in need of a decreased level of METHl or METH2 activity in the body comprising, administering to such an individual a composition comprising a therapeutically effective amount of METH 1 or METH2 antagonist.
  • Preferred antagonists for use in the present invention are METHl or METH2-specific antibodies.
  • the invention also provides a method of treatment of an individual in need of an increased level of METHl or METH2 polypeptide comprising administering to such an individual a pharmaceutical composition comprising an amount of METHl or METH2 to increase the activity level of METHl or METH2 in such an individual.
  • a patient with decreased levels of METHl or METH2 polypeptide receives a daily dose 0.1-100 ug/kg of the polypeptide for six consecutive days.
  • the polypeptide is in the secreted form.
  • Example 28 Method of Treating Increased Levels of METHl or METH2
  • the present invention also relates to a method for treating an individual in need of an increased level of METHl or METH2 activity in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of METHl or METH2 or an agonist thereof.
  • Antisense technology is used to inhibit production of METHl or METH2.
  • This technology is one example of a method of decreasing levels of METHl or METH2 polypeptide, preferably a secreted form, due to a variety of etiologies, such as cancer. -174-
  • METHl or METH2 is administered intravenously antisense polynucleotides at
  • Example 26 The formulation of the antisense polynucleotide is provided in Example 26
  • fibroblasts which are capable of expressing METHl or METH2 polypeptides
  • fibroblasts are obtained from a subject by skin biopsy
  • the resulting tissue is placed in tissue-culture medium and separated into small pieces Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask
  • the flask is turned upside down, closed tight and left at room temperature over night After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e g , Ham's F12 media, with 10% FBS, penicillin and streptomycin) is added
  • fresh media e g , Ham's F12 media, with 10% FBS, penicillin and streptomycin
  • the monolayer is trypsinized and scaled into larger flasks pMV-7 (Kirschmeier, P T et al, DNA 7 219-25 (1988)), flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and Hindlll and subsequently treated with calf intestinal phosphatase
  • the linear vector is fractionated on agarose gel and purified, using glass beads
  • the cDNA encoding METHl or METH2 can be amplified using PCR primers which correspond to the 5' and 3' end sequences respectively as set forth in Example 5
  • the 5' primer contains an EcoRI site and the 3' primer includes a Hindlll site
  • the amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin.
  • DMEM Dulbecco's Modified Eagles Medium
  • CS calf serum
  • penicillin and streptomycin The MSV vector containing the METHl or METH2 gene is then added to the media and the packaging cells transduced with the vector.
  • the packaging cells now produce infectious viral particles containing the METHl or METH2 gene(the packaging cells are now referred to as producer cells).
  • Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells.
  • the spent media containing the infectious viral particles, is filtered through a millip ore filter to remove detached producer cells and this media is then used to infect fibroblast cells.
  • Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
  • the fibroblasts are analyzed to determine whether METHl or METH2 protein is produced.
  • the engineered fibroblasts are then transplanted onto the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. ⁇ 176-
  • Another aspect of the present invention is using in vivo gene therapy methods to treat disorders, diseases and conditions
  • the gene therapy method relates to the introduction of naked nucleic acid (DNA, RNA, and antisense DNA or RNA) METH 1 or METH2 sequences into an animal to increase or decrease the expression of the METHl or METH2 polypeptide
  • the METHl or METH2 polynucleotide may be operatively linked to a promoter or any other genetic elements necessary for the expression of the METHl or METH2 polypeptide by the target tissue
  • Such gene therapy and delivery techniques and methods are known in the art, see, for example, WO90/11092, WO98/11779, U S PatentNO
  • the METHl or METH2 polynucleotide constructs may be delivered by any method that delivers injectable materials to the cells of an animal, such as, injection into the interstitial space of tissues (heart, muscle, skin, lung, liver, intestine and the like).
  • the METHl or METH2 polynucleotide constructs can be delivered in a pharmaceutically acceptable liquid or aqueous carrier
  • naked polynucleotide DNA or RNA
  • DNA or RNA refers to sequences that are free from any delivery vehicle that acts to assist, promote, or facilitate entry into the cell, including viral sequences, viral particles, liposome formulations, lipofectin or precipitating agents and the like
  • the METHl or METH2 polynucleotides may also be delivered in liposome formulations (such as those taught in Feigner P. L etal. (1995) Ann. NY Acad. Sci. 772 126-139 and Abdallah B et al. (1995) Biol Cell 85(1) 1-7) which can be prepared by methods well known to those skilled in the art -177-
  • the METHl or METH2 polynucleotide vector constructs used in the gene therapy method are preferably constructs that will not integrate into the host genome nor will they contain sequences that allow for replication. Any strong promoter known to those skilled in the art can be used for driving the expression of DNA. Unlike other gene therapies techniques, one major advantage of introducing naked nucleic acid sequences into target cells is the transitory nature of the polynucleotide synthesis in the cells. Studies have shown that non- replicating DNA sequences can be introduced into cells to provide production of the desired polypeptide for periods of up to six months.
  • the METHl or METH2 polynucleotide construct can be delivered to the interstitial space of tissues within the an animal, including of muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eye, gland, and connective tissue.
  • Interstitial space of the tissues comprises the intercellular fluid, mucopolysaccharide matrix among the reticular fibers of organ tissues, elastic fibers in the walls of vessels or chambers, collagen fibers of fibrous tissues, or that same matrix within connective tissue ensheathing muscle cells or in the lacunae of bone.
  • the space occupied by the plasma of the circulation and the lymph fluid of the lymphatic channels Delivery to the interstitial space of muscle tissue is preferred for the reasons discussed below. They may be conveniently delivered by injection into the tissues comprising these cells. They are preferably delivered to and expressed in persistent, non-dividing cells which are differentiated, although delivery and expression may be achieved in non-differentiated or less completely differentiated cells, such as, for example, stem cells of blood or skin fibroblasts. In vivo muscle cells are particularly competent in their ability to take up and express polynucleotides.
  • an effective dosage amount of DNA or RNA will be in the range of from about 0.05 g/kg body weight to about 50 mg/kg body weight. Preferably the dosage will be from about -178-
  • this dosage will vary according to the tissue site of injection
  • the appropriate and effective dosage of nucleic acid sequence can readily be determined by those of ordinary skill in the art and may depend on the condition being treated and the route of administration
  • the preferred route of administration is by the parenteral route of injection into the interstitial space of tissues
  • other parenteral routes may also be used, such as, inhalation of an aerosol formulation particularly for delivery to lungs or bronchial tissues, throat or mucous membranes of the nose
  • naked METHl or METH2 polynucleotide constructs can be delivered to arteries during angioplasty by the catheter used in the procedure
  • Suitable METHl or METH2 template DNA for production of mRNA coding for METHl or METH2 polypeptide is prepared in accordance with a standard recombinant DNA methodology
  • the template DNA which may be either circular or linear, is either used as naked DNA or complexed with liposomes
  • the quadriceps muscles of mice are then injected with various amounts of the template DNA
  • mice Five to six week old female and male Balb/C mice are anesthetized by intraperitoneal injection with 0 3 ml of 2 5% Avertin A 1 5 cm incision is made on the anterior thigh, and the quadriceps muscle is directly visualized
  • the METHl or METH2 template DNA is injected in 0 1 ml of carrier in a 1 cc syringe through a 27 gauge needle over one minute, approximately 0.5 cm from the distal insertion site of the muscle into the knee and about 0 2 cm deep A suture is placed over the injection site for future localization, and the skin is closed with stainless steel clips
  • muscle extracts are prepared by excising the entire quadriceps Every fifth 15 um cross-section of the individual quadriceps muscles is histochemically stained for METHl or METH2 protein expression.
  • a time course for METHl or METH2 protein expression may -179-
  • mice can be done in a similar fashion except that quadriceps from different mice are harvested at different times.
  • Persistence of METHl or METH2 DNA in muscle following injection may be determined by Southern blot analysis after preparing total cellular DNA and HIRT supernatants from injected and control mice. The results of the above experimentation in mice can be use to extrapolate proper dosages and other treatment parameters in humans and other animals using

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Vascular Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US1999/001313 1998-01-23 1999-01-22 Meth1 and meth2 polynucleotides and polypeptides Ceased WO1999037660A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP99904190A EP1049708A4 (en) 1998-01-23 1999-01-22 METH1 AND METH2 POLYNUCLEOTIDES AND POLYPEPTIDES
CA002319109A CA2319109A1 (en) 1998-01-23 1999-01-22 Meth1 and meth2 polynucleotides and polypeptides
NZ505855A NZ505855A (en) 1998-01-23 1999-01-22 METH1 and METH2 polynucleotides and polypeptides
MXPA00007165A MXPA00007165A (es) 1998-01-23 1999-01-22 Polinucleotidos y polipeptidos de meth1 y meth2.
AU24641/99A AU766787B2 (en) 1998-01-23 1999-01-22 Meth1 and meth2 polynucleotides and polypeptides
KR1020007008060A KR20010086224A (ko) 1998-01-23 1999-01-22 Meth1 및 meth2 폴리뉴클레오티드 및 폴리펩티드
JP2000528581A JP2002501077A (ja) 1998-01-23 1999-01-22 Meth1およびmeth2のポリヌクレオチドおよびポリペプチド
AU2004200046A AU2004200046A1 (en) 1998-01-23 2004-01-07 Meth1 and Meth2 Polynucleotides and Polypeptides

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US7229898P 1998-01-23 1998-01-23
US60/072,298 1998-01-23
US9853998P 1998-08-28 1998-08-28
US60/098,539 1998-08-28

Publications (2)

Publication Number Publication Date
WO1999037660A1 true WO1999037660A1 (en) 1999-07-29
WO1999037660A9 WO1999037660A9 (en) 1999-10-14

Family

ID=26753215

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/001313 Ceased WO1999037660A1 (en) 1998-01-23 1999-01-22 Meth1 and meth2 polynucleotides and polypeptides

Country Status (9)

Country Link
EP (1) EP1049708A4 (https=)
JP (1) JP2002501077A (https=)
KR (1) KR20010086224A (https=)
CN (1) CN1292796A (https=)
AU (1) AU766787B2 (https=)
CA (1) CA2319109A1 (https=)
MX (1) MXPA00007165A (https=)
NZ (1) NZ505855A (https=)
WO (1) WO1999037660A1 (https=)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000075317A3 (en) * 1999-06-09 2001-02-08 Genentech Inc Compositions and methods for the treatment of tumor
EP1149903A1 (en) * 2000-04-26 2001-10-31 Pfizer Products Inc. ADAMTS polypeptides, nucleic acids encoding them, and uses thereof
WO2001074852A3 (en) * 2000-03-31 2002-05-16 Bayer Ag Protein having activity as an angiogenesis modulator
US6395889B1 (en) * 1999-09-09 2002-05-28 Millennium Pharmaceuticals, Inc. Nucleic acid molecules encoding human protease homologs
US6416974B1 (en) 1997-08-06 2002-07-09 Millennium Pharmaceuticals, Inc. Tango 71 nucleic acids
WO2002002623A3 (en) * 2000-06-29 2003-10-02 Corixa Corp Compositions and methods for the therapy and diagnosis of lung cancer
EP1557466A4 (en) * 2002-09-27 2006-02-08 Dainippon Sumitomo Pharma Co TUMORANT PROPERTIES AND USE THEREOF
US7094591B2 (en) * 1999-05-10 2006-08-22 Syntex (U.S.A.) Llc Human aggrecanase and nucleic acid compositions encoding the same
EP1054963B1 (de) * 1998-02-17 2007-08-29 Forschungszentrum Jülich Gmbh Sequenzen eines ih-ionenkanals und deren verwendung
EP1892250A3 (en) * 2000-01-31 2008-09-17 Munin Corporation CYR61 compositions and methods
US7923543B1 (en) 2001-04-10 2011-04-12 Agensys, Inc. Nucleic acid and corresponding protein entitled 162P1E6 useful in treatment and detection of cancer
US8921534B2 (en) 2001-12-12 2014-12-30 Sanofi Pasteur Limited Enhancement of the immune response using CD36-binding domain
US9260499B2 (en) 2008-10-20 2016-02-16 Sapporo Medical University Tumor antigen peptide and use thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE69822307T2 (de) * 1997-06-03 2005-02-17 Kureha Chemical Industry Co., Ltd. Menschliches adamts-1 protein, gen , welches für dieses kodiert, pharmazeutische zusammensetzung und verfahrem zur immunologischen bestimmung von menschlichen adamts-1 proteinen
WO1999007850A1 (en) * 1997-08-06 1999-02-18 Millennium Biotherapeutics, Inc. Tango-71, tango-73, tango-74, tango-76, and tango-83 nucleic acid molecules and polypeptides

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
"MOLECULAR BIOLOGY/REAGENT SYSTEMS.", PROMEGA CATALOGUE, XX, XX, 1 January 1994 (1994-01-01), XX, pages 167., XP002920405 *
KUNO K ET AL: "Molecular cloning of a gene encoding a new type of metalloproteinase-disintegrin family protein with thrombospondin motifs as an inflammation associated gene", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, US, vol. 272., no. 01., 3 January 1997 (1997-01-03), US, pages 556 - 562., XP002093741, ISSN: 0021-9258, DOI: 10.1074/jbc.272.1.556 *
KUNO K., ET AL.: "THE EXON/INTRON ORGANIZATION AND CHROMOSOMAL MAPPING OF THE MOUSE ADAMTS-1 GENE ENCODING AN ADAM FAMILY PROTEIN WITH TSP MOTIFS.", GENOMICS, ACADEMIC PRESS, SAN DIEGO., US, vol. 46., 1 January 1997 (1997-01-01), US, pages 466 - 471., XP002920404, ISSN: 0888-7543, DOI: 10.1006/geno.1997.5064 *
See also references of EP1049708A4 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6416974B1 (en) 1997-08-06 2002-07-09 Millennium Pharmaceuticals, Inc. Tango 71 nucleic acids
EP1054963B1 (de) * 1998-02-17 2007-08-29 Forschungszentrum Jülich Gmbh Sequenzen eines ih-ionenkanals und deren verwendung
US7094591B2 (en) * 1999-05-10 2006-08-22 Syntex (U.S.A.) Llc Human aggrecanase and nucleic acid compositions encoding the same
WO2000075317A3 (en) * 1999-06-09 2001-02-08 Genentech Inc Compositions and methods for the treatment of tumor
US6395889B1 (en) * 1999-09-09 2002-05-28 Millennium Pharmaceuticals, Inc. Nucleic acid molecules encoding human protease homologs
EP1892250A3 (en) * 2000-01-31 2008-09-17 Munin Corporation CYR61 compositions and methods
WO2001074852A3 (en) * 2000-03-31 2002-05-16 Bayer Ag Protein having activity as an angiogenesis modulator
EP1149903A1 (en) * 2000-04-26 2001-10-31 Pfizer Products Inc. ADAMTS polypeptides, nucleic acids encoding them, and uses thereof
WO2002002623A3 (en) * 2000-06-29 2003-10-02 Corixa Corp Compositions and methods for the therapy and diagnosis of lung cancer
US7923543B1 (en) 2001-04-10 2011-04-12 Agensys, Inc. Nucleic acid and corresponding protein entitled 162P1E6 useful in treatment and detection of cancer
US8497351B2 (en) 2001-04-10 2013-07-30 Agensys, Inc. Nucleic acid and corresponding protein entitled 162P1E6 useful in treatment and detection of cancer
US8921534B2 (en) 2001-12-12 2014-12-30 Sanofi Pasteur Limited Enhancement of the immune response using CD36-binding domain
EP1557466A4 (en) * 2002-09-27 2006-02-08 Dainippon Sumitomo Pharma Co TUMORANT PROPERTIES AND USE THEREOF
US7700108B2 (en) 2002-09-27 2010-04-20 Dainippon Sumitomo Pharma Co., Ltd. Tumor antigen protein and use thereof
US9260499B2 (en) 2008-10-20 2016-02-16 Sapporo Medical University Tumor antigen peptide and use thereof

Also Published As

Publication number Publication date
NZ505855A (en) 2005-01-28
EP1049708A1 (en) 2000-11-08
CA2319109A1 (en) 1999-07-29
MXPA00007165A (es) 2002-06-21
JP2002501077A (ja) 2002-01-15
EP1049708A4 (en) 2002-09-04
WO1999037660A9 (en) 1999-10-14
CN1292796A (zh) 2001-04-25
AU766787B2 (en) 2003-10-23
AU2464199A (en) 1999-08-09
KR20010086224A (ko) 2001-09-10

Similar Documents

Publication Publication Date Title
EP1000084A1 (en) 123 human secreted proteins
WO1999031117A1 (en) 110 human secreted proteins
CA2286303A1 (en) 20 human secreted proteins
CA2291221A1 (en) 32 human secreted proteins
EP1019091A1 (en) 50 human secreted proteins
EP1044211A1 (en) 36 human secreted proteins
WO1999037660A1 (en) Meth1 and meth2 polynucleotides and polypeptides
WO1999024836A1 (en) 125 human secreted proteins
WO1999003990A1 (en) 64 human secreted proteins
WO2000006589A9 (en) Prostate derived ets factor
EP1042342A1 (en) 53 human secreted proteins
WO2000071577A1 (en) Meth1 and meth2 polynucleotides and polypeptides
WO1999022243A1 (en) 148 human secreted proteins
WO1999006423A1 (en) 83 human secreted proteins
EP1017707A1 (en) 29 human secreted proteins
WO1999018208A1 (en) 101 human secreted proteins
WO2000009148A9 (en) Vascular endothelial growth factor 3
AU2004200046A1 (en) Meth1 and Meth2 Polynucleotides and Polypeptides
EP1394252A2 (en) 70 human secreted proteins
EP1428833A2 (en) 207 human secreted proteins
EP1445316A1 (en) Novel secreted protein
EP1336656A2 (en) 20 human secreted proteins
EP1464653A1 (en) Human secreted proteinteins

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 99803495.9

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: C2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PAGES 1/12-12/12, DRAWINGS, REPLACED BY NEW PAGES 1/19-19/19; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 505855

Country of ref document: NZ

ENP Entry into the national phase

Ref document number: 2319109

Country of ref document: CA

Ref document number: 2319109

Country of ref document: CA

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2000 528581

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: PA/a/2000/007165

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 1020007008060

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 24641/99

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 1999904190

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999904190

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1020007008060

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: 24641/99

Country of ref document: AU

WWR Wipo information: refused in national office

Ref document number: 1020007008060

Country of ref document: KR

WWW Wipo information: withdrawn in national office

Ref document number: 1999904190

Country of ref document: EP