WO1999035167A1 - Epitopes peptidiques reconnus par des auto-anticorps antifilaggrine presents dans le serum des patients atteints de polyarthrite rhumatoide - Google Patents

Epitopes peptidiques reconnus par des auto-anticorps antifilaggrine presents dans le serum des patients atteints de polyarthrite rhumatoide Download PDF

Info

Publication number
WO1999035167A1
WO1999035167A1 PCT/FR1998/002899 FR9802899W WO9935167A1 WO 1999035167 A1 WO1999035167 A1 WO 1999035167A1 FR 9802899 W FR9802899 W FR 9802899W WO 9935167 A1 WO9935167 A1 WO 9935167A1
Authority
WO
WIPO (PCT)
Prior art keywords
rheumatoid arthritis
antigen
filaggrin
serum
peptide
Prior art date
Application number
PCT/FR1998/002899
Other languages
English (en)
Inventor
Guy Serre
Elisabeth Girbal-Neuhauser
Christian Vincent
Michel Simon
Mireille Sebbag
Pascal Dalbon
Colette Jolivet-Reynaud
Michel Arnaud
Michel Jolivet
Original Assignee
Biomerieux
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biomerieux filed Critical Biomerieux
Priority to EP98964536A priority Critical patent/EP1042366A1/fr
Priority to CA002316269A priority patent/CA2316269A1/fr
Priority to AU19717/99A priority patent/AU1971799A/en
Publication of WO1999035167A1 publication Critical patent/WO1999035167A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4713—Autoimmune diseases, e.g. Insulin-dependent diabetes mellitus, multiple sclerosis, rheumathoid arthritis, systemic lupus erythematosus; Autoantigens
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/564—Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9

Definitions

  • PEPTIDE EPITOPES RECOGNIZED BY ANTIFILAGGRIN AUTOANTIBODIES PRESENT IN THE SERUM OF PATIENTS WITH RHUMATOID POLYARTHRITIS.
  • the present invention relates to new preparations of antigens specifically recognized by auto-antibodies specific for rheumatoid arthritis.
  • RA Rheumatoid arthritis
  • RA Rheumatoid arthritis
  • serum of affected patients contains autoantibodies, some of which are specific, and can constitute a marker of this disease, allowing its diagnosis even at early stages.
  • Research has therefore been carried out with a view to identifying antigens recognized by these antibodies, in order to obtain purified preparations which can be used in conventional techniques of immunological diagnosis.
  • the inventors obtained, from human and murine squamous epithelia, preparations of antigens related to filaggrin and to profilaggrin, recognized specifically by the antibodies present in the serum of patients suffering from rheumatoid arthritis, and showed that the "antibodies antikeratins "were in fact anti-filaggrin autoantibodies (hereinafter referred to as" AAF ").
  • Application EP 0 511 116 describes these antigenic preparations, and their use for the diagnosis of rheumatoid arthritis.
  • Filaggrins are a family of proteins which has been identified in various species, notably in humans, rats, mice, guinea pigs, in the case of squamous keratinizing epithelia [for a review on filaggrins, cf. DALE et al. [The Keratinocyte Handbook, Cambridge University Press, pp 323-350, (1994)]. They derive from the dephosphorylation and proteolysis of a precursor, profilaggrin, which consists essentially of repeating domains of filaggrin separated by peptide segments between domains.
  • the gene coding for profilaggrin consists of repeated subunits, each of which codes for a filaggrin molecule, separated by portions coding for the interdomain peptide segments. All the repeating units coding for each of the human filaggrins have the same length (972 base pairs in humans); however, in humans, there are significant variations (10-15%) in sequence from one subunit to another. While most are conservative, some of these variations induce changes in amino acids and in some cases changes in the electrical charge of the protein. Thus human filaggrins form, independently of post-transcriptional modifications, a heterogeneous population of molecules of similar size but of different sequences and charges (pHi equal to 8.3 ⁇ 1.1) [GAN et al., Bioche. 29, p. 9432-9440 (1990)].
  • Profilaggrin is a high molecular weight protein (approximately 400,000 in humans) soluble in the presence of high concentrations of salts or urea. It has a high content of basic amino acids (arginine and histidine), as well as glycine, serine and glutamic acid. It is poor in non-polar amino acids and contains neither methionine, cysteine, nor tryptophan. It is strongly phosphorylated on Serine residues, which gives it an isoelectric point close to neutrality.
  • Filaggrins resulting from dephosphorylation and from cleavage of profilaggrin are basic proteins whose amino acid content is similar to that of profilaggrins. They participate in the organization of the keratin filaments, and undergo a progressive maturation during which the arginine residues, basic, are converted into citrulline residues, neutral, under the action of peptidylarginine deiminase [HARDING CR and SCOTT IR, J Mol. Biol. 170, p. 651-673 (1983)]. This leads to a reduction in their affinity for the keratins from which they are detached; they are then completely degraded under the action of various proteases.
  • the properties of filaggrins and profilaggrins have been particularly well studied in rats, mice and humans.
  • the size of profilaggrin varies, depending on the species, from 300 to 400 kD and that of filaggrins from 27 to 64 kD.
  • Filaggrins also exhibit great inter- and intra-specific variability in their sequence. However, this variability does not affect their functional properties, their overall amino acid composition, and their biochemical properties. Likewise, the tissue localizations of profilaggrin and filaggrins are identical in the different mammals studied.
  • the inventors sought to reproduce in vi tro, from recombinant filaggrin, these post-translational modifications, in order to determine which were liable to influence the antigenicity of filaggrin.
  • This work resulted in the obtaining of artificial antigens recognized specifically by the FAAs present in the serum of RA patients, and constituted by recombinant or synthetic polypeptides, derived from the sequence of filaggrin, or portions of that -ci, by substitution of at least one arginine residue by a citrulline residue.
  • filamentaggrin unit means a polypeptide whose sequence is that of the translation product of any of the subunits coding for a filaggrin domain of the gene for human profilaggrin or of another species, or else is a consensus sequence, theoretical sequence obtained from the sequences of the filaggrin domains.
  • these epitopes comprise a tripeptide motif centered on a citrulline residue, specifically present on citrulline peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, and absent from the sequence SEQ ID NO: 4.
  • the present invention relates to a peptide constituting an epitope recognized by anti-filaggrin autoantibodies present in the serum of patients suffering from rheumatoid arthritis, characterized in that said epitope comprises a tripeptide motif centered on a citrulline residue, specifically present on at least one of the citrullinated peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6.
  • said peptide comprises at least one pentapeptide motif centered on a citrulline residue, present on at least one of the citrulline peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6.
  • said peptide comprises the tripeptide motif Ser-Cit-His, in which Cit represents a citrulline residue.
  • the peptides in accordance with the invention allow the preparation of artificial antigens recognized specifically by the anti-filaggrin autoantibodies present in the serum of patients suffering from rheumatoid arthritis. These artificial antigens are also part of the object of the present invention.
  • Artificial antigens according to the invention comprise at least one peptide epitope centered on a citrulline residue, as defined above. They are for example constituted by peptides of at least 5 amino acids, preferably at least 10 amino acids, and advantageously at least 14 amino acids.
  • They may be peptides consisting of at least one fragment of at least one of the citrullinated peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, or containing at least one such fragment.
  • These peptides can comprise several citrullinated epitopes specifically recognized by AAF, of identical or different sequences.
  • peptide as used in the present Application means in particular protein or protein fragment, oligopeptide, extract, separated or substantially isolated or synthesized, in particular those obtained by chemical synthesis or by expression in a recombinant organism; any peptide in the sequence of which one or more amino acids of the L series are replaced by an amino acid of the D series, and vice versa; any peptide of which at least one of the CO-NH bonds, and advantageously all of the CO-NH bonds of the peptide chain is (are) replaced by one (of) NH-CO bonds; any peptide of which at least one of the CO-NH bonds and advantageously all of the CO-NH bonds is or are replaced by one or more NH-CO bonds, the chirality of each aminoacyl residue, whether either involved or not in one or more CO-NH bonds mentioned above, being either conserved or reversed with respect to the aminoacyl residues constituting a reference peptide, these compounds being also designated immunoretroids, a mimotope, etc.
  • Antigens according to the invention can for example be obtained by the action of PAD (peptidyl arginine deiminase) on proteins or peptides natural, recombinant, or synthetic, comprising arginine residues, and in particular comprising at least one arginine residue constituting the center of a tripeptide motif identical to those present in the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6; they can also be obtained by peptide synthesis, by directly incorporating one or more citrulline residues, and preferably one or more epitopes comprising a citrulline residue, as defined above, in the synthesized peptide.
  • PAD peptidyl arginine deiminase
  • the present invention also relates to the use of the antigens in accordance with the invention, as defined above, for the in vi tro diagnosis of RA.
  • the present invention encompasses in particular antigenic compositions for diagnosing the presence of RA-specific autoantibodies in a biological sample, which compositions are characterized in that they contain at least one antigen according to the invention, optionally labeled and / or conjugated with a carrier molecule.
  • the present invention also relates to a method for detecting RA specific class G autoantibodies in a biological sample, which method is characterized in that it comprises:
  • This detection method can be implemented using a kit comprising at least one antigen according to the invention, as well as buffers and reagents suitable for constituting a medium. reaction allowing the formation of an antigen / antibody complex, and / or means of detection of said antigen / antibody complex.
  • Said kit may also include, where appropriate, reference samples, such as one or more negative serum (s) and one or more positive serum (s).
  • reference samples such as one or more negative serum (s) and one or more positive serum (s).
  • EXAMPLE 1 IN VITRO DEIMINATION OF RECOMBINANT FILAGGRIN BY PEPTIDYL ARGININE DEIMINASE (P.A.D.).
  • Recombinant filaggrin is produced according to the following protocol:
  • a DNA fragment coding for a filaggrin unit is amplified by PCR, from human genomic DNA (RAJI cells: ATCC CCL86) using the following 2 primers: 5 'primer:
  • the amplification product is cloned into the SmaI site of the vector pUC19.
  • the recombinant clones are selected, checking the presence of a 972 bp insert obtained after digestion with SacI and Xbal.
  • This insert is then subcloned into pUC19.
  • the insert resulting from this subcloning is then transferred into the vector pGEX (sold by the company PHARMACIA), between the EcoRI and HindIII sites.
  • the expression vector thus obtained expresses, in E. coli, filaggrin in fusion with glutathione-S-transferase (GST), under the control of the prokaryotic promoter Tac.
  • the mixture of the 9 fragments is subjected to in vitro elimination by peptidyl arginine deiminase.
  • a preparation of rabbit muscle peptidyl arginine deiminase (681 U / ml) sold by TAKARA BIOMED EUROPE is used, according to the protocol recommended by the manufacturer.
  • the operating conditions are as follows:
  • BSA bovine serum albumin
  • PHAST ® -SDS 12.5% gel, PHARMACIA electrophoresis gel
  • electrophoresis is carried out with the PHAST-SYSTEM ® device (PHARMACIA), under the conditions recommended by the manufacturer.
  • nitrocellulose either with a pool of 5 sera from RA patients, diluted to 1/2000, or with the anti-filaggrin monoclonal antibody AHF2 [SIMON et al. J. Invest. Dermatol. 105, 432, (1995)] at the concentration of 0.2 ⁇ g / ml.
  • the antigen / antibody complex is revealed using a secondary antibody coupled to peroxidase, by the ECL technique.
  • the peptide of 49 amino acids S-47-S of sequence (code 1 letter): NH 2 -STGHSGSQHSHTTTQGRSDASRGSSGSRSTSRETRDQEQSGDGSRHSGS-COOH corresponding to amino acids 71 to 119 of the sequence of a human filaggrin unit, and comprising 6 arginine residues, and the peptide of 37 amino acids S-35-R of sequence (code 1 letter):
  • the peptides S-47-S and S-35-R are represented in the sequence list in the appendix under the respective numbers SEQ ID NO: 3 and SEQ ID NO: 4.
  • Peptides E-12-H and E-12-0 were determined by reference to the nucleotide sequences of the human profilaggrin gene described by GAN S.Q et al. [Biochemistry, 29: 9432-9440, (1990)].
  • NH 2 -EQSADSSRHSGSGH-COOH comprises 1 arginine residue, and the peptide of 14 amino acids E-12-D of sequence (code 1 letter):
  • NH 2 -ESSRDGSRHPRSHD-COOH contains 3 arginine residues.
  • the peptides E-12-H and E-12-D are represented in the sequence list in the appendix under the respective numbers SEQ ID NO: 5 and SEQ ID NO: 6.
  • citrullinated peptides E-12-H and E-12-D were synthesized directly by incorporation of a citrulline in replacement of an arginine.
  • the wells of NUNC MAXISORP microtiter plates were coated respectively with the non-citrullinated and citrullinated peptides E-12-D and E-12-H, diluted to a concentration of 5 ⁇ g / ml in PBS buffer (pH : 7.4) and incubated overnight at 4 ° C (final volume: 100 ⁇ g / well).
  • the wells were saturated for 30 minutes at 37 ° C. in PBS-T een 20, 0.05% gelatin 2.5%, 200 ⁇ l / well.
  • the negative control serum normal serum was diluted 1/120.
  • anti-filaggrin antibodies were diluted in PBS-Tween 20, 0.05% - 0.5% gelatin (PBS TG) so that the final concentrations of anti-filaggrin autoantibody are those indicated in Table I attached.
  • Negative control serum, PR sera and anti-filaggrin antibodies were added (final volume: 100 ⁇ l / well) and incubated for 1 hour at 37 ° C and overnight at 4 ° C.
  • Goat anti-heavy chain gamma antibodies of human immunoglobulins labeled with peroxidase (marketed by the company SOUTHERN BIOTECHNOLOGIES) were added to each well (dilution in PBSTG: 1/2000, final volume: 100 ⁇ l / well) and subjected incubation for 1 hour at 37 ° C. The revelation was carried out by adding orthophenylenediamine (2 mg / ml, for 10 minutes).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Rehabilitation Therapy (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Rheumatology (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Diabetes (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention est relative à des peptides comprenant des épitopes reconnus par des auto-anticorps antifilaggrine présents dans le sérum des patients atteints de polyarthrite rhumatoïde. Lesdits épitopes comprennent un motif tripeptidique centré sur un résidu citrulline. L'invention est également relative à des antigènes artificiels comprenant ces épitopes, et à leur utilisation de cet antigène pour le diagnostic de la polyarthrite rhumatoïde.

Description

EPITOPES PEPTIDIQUΞS RECONNUS PAR DES AUTO-ANTICORPS ANTIFILAGGRINE PRÉSENTS DANS LE SÉRUM DES PATIENTS ATTEINTS DE POLYARTHRITE RHUMATOÏDE.
La présente Invention est relative à de nouvelles préparations d'antigènes spécifiquement reconnus par des auto-anticorps spécifiques de la polyarthrite rhumatoïde.
La polyarthrite rhumatoïde (ci après abrégée en " PR ") est le plus fréquent des rhumatismes inflammatoires chroniques. Il s'agit d'une maladie auto- immune, et le sérum des patients atteints contient des auto-anticorps dont certains sont spécifiques, et peuvent constituer un marqueur de cette maladie, permettant son diagnostic même à des stades précoces. Des recherches ont donc été effectuées en vue d' identifier des antigènes reconnus par ces anticorps, afin d'en obtenir des préparations purifiées utilisables dans des techniques classiques de diagnostic immunologique .
Des auto-anticorps spécifiquement présents chez les malades atteints de PR et réagissant avec un antigène épithélial oesophagien de rat ont été décrits pour la première fois par B. J. J. YOUNG et al. dans Br. Med. J. 2:97-99, (1979). Ces auto-anticorps ont été à l'époque dénommés "anticorps antikératines". Lors de précédents travaux, l'équipe des
Inventeurs a obtenu, à partir d' épithéliums malpighiens humain et murin, des préparations d'antigènes apparentés à la filaggrine et à la profilaggrine, reconnus spécifiquement par les anticorps présents dans le sérum de patients atteints de polyarthrite rhumatoïde, et montré que les " anticorps antikératines " étaient en fait des auto-anticorps anti-filaggrine (ci-après dénommés " AAF ") . La Demande EP 0 511 116 décrit ces préparations antigéniques, et leur utilisation pour le diagnostic de la polyarthrite rhumatoïde. Les filaggrines sont une famille de protéines qui a été identifiée chez diverses espèces, entre autres chez l'homme, le rat, la souris, le cobaye, au niveau des épithéliums malpighiens kératinisants [pour revue sur les filaggrines, cf. DALE et al. [The Keratinocyte Handbook, Cambridge University Press, pp 323-350, (1994)]. Elles dérivent de la déphosphorylation et de la protéolyse d'un précurseur, la profilaggrine, qui est constituée essentiellement de domaines répétés de filaggrine séparés par des segments peptidiques interdomaines.
Le gène codant pour la profilaggrine se compose de sous-unités répétées dont chacune code pour une molécule de filaggrine, séparées par des portions codant pour les segments peptidiques interdomaines. Toutes les unités de répétition codant pour chacune des filaggrines humaines ont la même longueur (972 paires de base chez l'homme) ; cependant, chez l'homme, on observe des variations importantes (10-15%) de séquence d'une sous-unité à l'autre. Si la plupart sont conservatives, certaines de ces variations induisent des changements d'acides aminés et dans certains cas des changements de la charge électrique de la protéine. Ainsi les filaggrines humaines forment, indépendamment des modifications post-transcriptionnelles, une population hétérogène de molécules de taille similaire mais de séquences et de charges (pHi égal à 8,3 ± 1,1) différentes [GAN et al., Bioche . 29, p. 9432-9440 (1990) ] .
La profilaggrine est une protéine de poids moléculaire élevé (environ 400 000 chez l'homme) soluble en présence de fortes concentrations de sels ou d'urée. Elle possède une forte teneur en acides aminés basiques (arginine et histidine) , ainsi qu'en glycine, serine et acide glutamique. Elle est pauvre en acides aminés non polaires et ne contient ni methionine, ni cysteine, ni tryptophane. Elle est fortement phosphorylée sur des résidus serine, ce qui lui confère un point isoélectrique proche de la neutralité.
La profilaggrine est clivée en unités filaggrine au cours d'un processus complexe de maturation, impliquant une dephosphorylation, suivie d'un clivage par des protéases au niveau des segments interdomaines. Ce clivage génère d'abord des fragments de taille intermédiaire, puis les molécules fonctionnelles de filaggrine. Les filaggrines issues de la dephosphorylation et du clivage de la profilaggrine sont des protéines basiques dont le contenu en acides aminés est similaire à celui des profilaggrines . Elles participent à l'organisation des filaments de kératine, et subissent une maturation progressive au cours de laquelle les résidus arginine, basiques, sont convertis en résidus citrulline, neutres, sous l'action de la peptidylarginine déiminase [HARDING C.R. et SCOTT I.R., J. Mol. Biol. 170, p. 651-673 (1983)]. Ceci entraîne une réduction de leur affinité pour les kératines dont elles se détachent ; elles sont alors totalement dégradées sous l'action de diverses protéases.
Les propriétés des filaggrines et des profilaggrines ont été particulièrement bien étudiées chez le rat, chez la souris et chez l'homme. La taille de la profilaggrine varie, selon les espèces, de 300 à 400 kD et celle des filaggrines de 27 à 64 kD.
Le polymorphisme observé chez l'homme entre les séquences des unités filaggrine à l'intérieur d'un même gène de profilaggrine n'apparaît pas chez le rat et la souris. Les filaggrines présentent en outre une grande variabilité inter et intra-spécifique au niveau de leur séquence. Cette variabilité n'affecte toutefois pas leurs propriétés fonctionnelles, ni leur composition globale en acides aminés, et leurs propriétés biochimiques. De même, les localisations tissulaires de la profilaggrine et des filaggrines sont identiques chez les différents mammifères étudiés.
En poursuivant leurs travaux, les Inventeurs ont constaté que la profilaggrine présente dans les granules de kératohyaline de l'épiderme humain n'était contrairement aux filaggrines, pas reconnue par les AAF[SIMON et al. Clin. Exp . Immunol . 100, 90-98 (1995)]. Ils ont alors testé la réactivité des AAF avec de la filaggrine recombinante, et ont constaté que celle-ci non plus n'était pas reconnue. D'autre part, il avait été précédemment observé que les formes des filaggrines épidermiques humaines principalement reconnues par les AAF étaient les formes acido-neutres décrites par SIMON et al. [J. Clin. Invest., 92, 1387, (1993)] et dans la demande EP 0 511 116. Le fait que ces formes acido- neutres correspondent à un stade tardif de maturation de la filaggrine, permettait de supposer que tout ou partie des modifications post-traductionnelles intervenant jusqu'à ce stade étaient impliquées dans la formation des épitopes reconnus par les AAF.
Pour vérifier cette hypothèse, les Inventeurs ont cherché à reproduire in vi tro, à partir de filaggrine recombinante, ces modifications post-traductionnelles, afin de déterminer lesquelles étaient susceptibles d'influer sur l' antigénicité de la filaggrine.
Ils ont ainsi constaté qu'en fait, la citrullination de la filaggrine suffisait à générer des épitopes reconnus par les AAF. En effet, ils ont observé, en procédant à la déimination in vi tro de filaggrine recombinante que le remplacement d'au moins une partie des arginines par des citrullines permet l'obtention d'un antigène reconnu spécifiquement par les AAF présents dans le sérum des patients atteints de PR. Ils ont en outre localisé des régions qui étaient après citrullination, fortement immunoreactives vis-à-vis des auto-anticorps anti-filaggrine. Il s'agit en particulier de la région correspondant à la portion C-terminale (acides aminés 144 à 324) et en particulier aux acides aminés 144 à 314, ainsi que de la région correspondant aux acides aminés 76 à 144, et de la région correspondant aux acides aminés 71 à 119 d'une unité de filaggrine humaine. Ces travaux ont abouti à l'obtention d'antigènes artificiels reconnus spécifiquement par les AAF présents dans le sérum des patients atteints de PR, et constitués par des polypeptides recombinants ou de synthèse, dérivés de la séquence de la filaggrine, ou de portions de celle-ci, par substitution d'au moins un résidu arginine par un résidu citrulline. Ces antigènes, ainsi que leur utilisation, font l'objet de la Demande FR FR 96 10651, déposée le 30 août 1996 au nom de BIOMÉRIEUX. En poursuivant leur travaux, les Inventeurs sont parvenus à sélectionner à partir de la séquence d'une unité filaggrine, des peptides dans lesquels la substitution d'au moins un résidu arginine par un résidu citrulline donnait naissance à des épitopes reconnus spécifiquement par les AAF présents dans le sérum des patients atteints de PR.
Les séquences de ces peptides sont identifiées dans la liste de séquences en annexe sous les numéros SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6. On entend par : " unité filaggrine " , un polypeptide dont la séquence est celle du produit de traduction de l'une quelconque des sous-unités codant pour un domaine filaggrine du gène de la profilaggrine humaine ou d'une autre espèce, ou bien est une séquence consensus, séquence théorique obtenue à partir des séquences des domaines filaggrine.
Les Inventeurs ont maintenant identifié des épitopes reconnus par les auto-anticorps anti- filaggrine : ces épitopes comprennent un motif tripeptidique centré sur un résidu citrulline, spécifiquement présent sur les peptides citrullinés dérivés des séquences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, et absent de la séquence SEQ ID NO: 4.
Il s'agit en particulier du motif tripeptidique Ser-Cit-His, dans lequel Cit représente un résidu citrulline.
La présente Invention a pour objet un peptide constituant un épitope reconnu par des autoanticorps anti-filaggrine présents dans le sérum des patients atteints de polyarthrite rhumatoïde, caractérisé en ce que ledit épitope comprend un motif tripeptidique centré sur un résidu citrulline, spécifiquement présent sur au moins un des peptides citrullinés dérivés des séquences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6.
Selon un mode de réalisation préféré de la présente invention, ledit peptide comprend au moins un motif pentapeptidique centré sur un résidu citrulline, présent sur au moins un des peptides citrullinés dérivés des séquences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6.
Avantageusement, ledit peptide comprend le motif tripeptidique Ser-Cit-His, dans lequel Cit représente un résidu citrulline.
A titre d'exemple, on citera des peptides dérivés, par citrullination, de peptides qui comprennent le motif pentapeptidique, Xl-Ser-Arg-His-X2 dans lequel Xl=Ser ou Gly, et X2=Ser ou Pro, et parmi ceux-ci, des peptides qui comprennent le motif hexapeptidique X0-X1- Ser-Arg-His-X2, ou le motif heptapeptidique XO-Xl-Ser- Arg-His-X2-X3, dans lesquels XI et X2 sont tels que définis ci-dessus, X0=Asp, et X3=Gly ou Arg . Les peptides conformes à l'invention permettent la préparation d'antigènes artificiels reconnus spécifiquement par les auto-anticorps anti- filaggrine présents dans le sérum de patients atteints de polyarthrite rhumatoïde. Ces antigènes artificiels font également partie de l'objet de la présente invention. Des antigènes artificiels conformes à l'invention comprennent au moins un épitope peptidique centré sur un résidu citrulline, tel que défini ci- dessus. Ils sont par exemple constitués par des peptides d'au moins 5 acides aminés, de préférence au moins 10 acides aminés, et avantageusement au moins 14 acides aminés. Il peut s'agir de peptides constitués par au moins un fragment d'au moins un des peptides citrullinés dérivés des séquences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, ou contenant au moins un tel fragment. Ces peptides peuvent comprendre plusieurs épitopes citrullinés spécifiquement reconnus par les AAF, de séquences identiques ou différentes.
Le terme "peptide" tel qu'utilisé dans la présente Demande signifie notamment protéine ou fragment de protéine, oligopeptide, extrait, séparé ou substantiellement isolé ou synthétisé, notamment ceux obtenus par synthèse chimique ou par expression dans un organisme recombinant ; tout peptide dans la séquence duquel un ou plusieurs acides aminés de la série L sont remplacés par un acide aminé de la série D, et vice- versa ; tout peptide dont l'une au moins des liaisons CO- NH, et avantageusement toutes les liaisons CO-NH de la chaîne peptidique est (sont) remplacée (s) par une (des) liaisons NH-CO ; tout peptide dont l'une au moins des liaisons CO-NH et avantageusement toutes les liaisons CO- NH est ou sont remplacée (s) par une ou des liaison (s) NH- CO, la chiralité de chaque résidu aminoacyle, qu'il soit impliqué ou non dans une ou plusieurs liaisons CO-NH sus- mentionnées, étant soit conservée, soit inversée par rapport aux résidus aminoacyles constituant un peptide de référence, ces composés étant encore désignés immunorétroïdes, un mimotope, etc.
Des antigènes conformes à 1 ' invention peuvent par exemple être obtenus par action de la PAD (peptidyl arginine déiminase) sur des protéines ou des peptides naturels, recombinants, ou de synthèse, comportant des résidus arginine, et en particulier comprenant au moins un résidu arginine constituant le centre d'un motif tripeptidique identique à ceux présents dans les séquences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6 ; ils peuvent également être obtenus par synthèse peptidique, en incorporant directement un ou plusieurs résidus citrulline, et de préférence, un ou plusieurs épitopes comprenant un résidu citrulline, tels que définis ci- dessus, dans le peptide synthétisé.
La présente Invention a également pour objet l'utilisation des antigènes conformes à l'invention, tels que définis ci-dessus, pour le diagnostic in vi tro de la PR. La présente invention englobe en particulier des compositions antigéniques pour le diagnostic de la présence d'auto-anticorps spécifiques de la PR dans un échantillon biologique, lesquelles compositions sont caractérisées en ce qu'elles contiennent au moins un antigène conforme à l'invention, éventuellement marqué et/ou conjugué avec une molécule porteuse.
La présente Invention a également pour objet un procédé de détection des auto-anticorps de classe G spécifiques de la PR dans un échantillon biologique, lequel procédé est caractérisé en ce qu'il comprend :
- la mise en contact dudit échantillon biologique avec au moins un antigène conforme à l' Invention, tel que défini ci-dessus, dans des conditions permettant la formation d'un complexe antigène/anticorps avec les auto-anticorps spécifiques de la PR éventuellement présents ;
- la détection, par tous moyens appropriés, du complexe antigène/anticorps éventuellement formé.
Ce procédé de détection peut être mis en oeuvre grâce à un nécessaire comprenant au moins un antigène selon l'Invention, ainsi que des tampons et réactifs appropriés pour la constitution d'un milieu réactionnel permettant la formation d'un complexe antigène/anticorps, et/ou des moyens de détection dudit complexe antigène/anticorps.
Ledit nécessaire peut également comprendre, le cas échéant, des échantillons de référence, tels qu'un ou plusieurs sérum(s) négatif (s) et un ou plusieurs sérum(s) positif (s) .
La présente invention sera mieux comprise à l'aide du complément de description qui va suivre, qui se réfère à des exemples de préparation et de mise en œuvre d'antigènes conformes à l'invention.
EXEMPLE 1 : DEIMINATION IN VITRO DE FILAGGRINE RECOMBINANTE PAR LA PEPTIDYL ARGININE DEIMINASE (P.A.D.) . De la filaggrine recombinante est produite selon le protocole suivant :
Un fragment d'ADN codant pour une unité filaggrine est amplifié par PCR, à partir d'ADN génomique humain (cellules RAJI : ATCC CCL86) à l'aide des 2 amorces suivantes : Amorce 5' :
5' TTCCTATACCAGGTGAGCACTCAT 3' Amorce 3' :
5' AGACCCTGAACGTCCAGACCGTCCC 3'
Le produit d'amplification est clone dans le site Smal du vecteur pUC19. On procède à la sélection des clones recombinants, en vérifiant la présence d'un insert de 972 pb obtenu après digestion avec Sacl et Xbal . Cet insert est ensuite sous-cloné dans pUC19. L' insert résultant de ce sous-clonage est ensuite transféré dans le vecteur pGEX (commercialisé par la société PHARMACIA) , entre les sites EcoRI et HindIII. Le vecteur d'expression ainsi obtenu exprime, dans E . coli , la filaggrine en fusion avec la glutathion-S-transférase (GST) , sous contrôle du promoteur procaryote Tac. La synthèse de la protéine recombinante est induite par addition d' isopropyl-β-D-galactoside (IPTG) à la culture. La filaggrine recombinante ainsi obtenue sera dénommée ci-après : " fil-gst ".
On constate après electrophorese, l'existence de 9 fragments qui résultent d'une protéolyse post- traductionnelle de la filaggrine entière.
Le mélange des 9 fragments est soumis à une déimination in vi tro par la peptidyl arginine déiminase.
On utilise une préparation de peptidyl arginine déiminase de muscle de lapin (681 U/ml) commercialisée par TAKARA BIOMED EUROPE, selon le protocole préconisé par le fabricant.
Les conditions opératoires sont les suivantes :
- Milieu réactionnel : Tris-HCl 0,1 M, CaCl2 10 mM, DTT 5 mM, pH 7,4 ;
- Rapport enzyme/substrat : 140 mU/μmole de filaggrine contenant 10% d' arginine soit 4 mU/μmole d' arginine ;
- Incubation : entre 0 et 60 mn à 50°C ; - Arrêt de la réaction : chauffage 3 mn en tampon de LAEMMLI
On effectue en parallèle les 8 réactions suivantes .
(1) BSA (sérum albumine bovine) incubée dans milieu réactionnel (lh, 50°C) sans P.A.D.
(2) BSA incubée dans milieu réactionnel (lh, 50°C) avec 60 mU de P.A.D.
(3) fil-gst incubée dans milieu réactionnel (lh, 50°C) sans P.A.D. (4) fil-gst incubée dans milieu réactionnel (5 minutes à 50°C) avec 60 mU de P.A.D.
(5) fil-gst incubée dans milieu réactionnel (15 minutes à 50°C) avec 60 mU de P.A.D.
(6) fil-gst incubée dans milieu réactionnel (30 minutes à 50°C) avec 60 U de P.A.D. (7) fil-gst incubée dans milieu réactionnel (lh à 50°C) avec 60 mU de P.A.D.
(8) fil-gst incubée dans milieu réactionnel (lh à 50°C) avec 60 mU de P.A.D. et en présence de 10 mM de N-éthylmaléimide (inhibiteur de la P.A.D.).
On dépose 1 μl de chaque échantillon sur un gel d' electrophorese (gel PHAST®-SDS 12,5%, PHARMACIA), et on réalise l' electrophorese avec l'appareil PHAST-SYSTEM® (PHARMACIA), dans les conditions préconisées par le fabricant. Après transfert sur nitrocellulose, on révèle soit avec un pool de 5 sérums de patients atteints de PR , dilué au 1/2000 soit avec l'anticorps monoclonal anti-filaggrine AHF2 [SIMON et al. J. Invest. Dermatol. 105, 432, (1995)] à la concentration de 0,2 μg/ml. Le complexe antigène/anticorps est révélé à l'aide d'un anticorps secondaire couplé à la peroxydase, par la technique ECL .
Les résultats montrent qu'en l'absence de réaction de citrullination, la fil-gst n'est pas reconnue par les sérums de patients atteints de PR, alors que dès 5 minutes de citrullination, elle est détectée par ces sérums. On constate une augmentation de la réactivité avec le pool de sérums quand on fait agir la P.A.D. pendant 60 minutes à 50°C. En outre, ces résultats permettent de supposer qu' il existe un ou plusieurs épitopes de forte affinité dans la moitié COOH-terminale de la filaggrine (positions 144 à 324), cet ou ces épitope(s) étant répété(s) entre les positions 76 et 144. EXEMPLE 2 : CITRULLINATION DES PEPTIDES S-47-S ET S-35-R PAR LA P.A.D, ET ESSAI DE LA RÉACTIVITÉ DES PEPTIDES CITRULLINÉS .
Le peptide de 49 acides aminés S-47-S de séquence (code 1 lettre) : NH2-STGHSGSQHSHTTTQGRSDASRGSSGSRSTSRETRDQEQSGDGSRHSGS-COOH correspondant aux acides aminés 71 à 119 de la séquence d'une unité de filaggrine humaine, et comportant 6 résidus arginine, et le peptide de 37 acides aminés S-35-R de séquence (code 1 lettre) :
NH2-SQDRDSQAQSEDSERRSASASRNHRGSAQEQSRDGSR-COOH correspondant aux acides aminés 155 à 191 de la séquence d'une unité de filaggrine humaine, et comportant 7 résidus arginine, ont été préparés par synthèse peptidique. Les peptides S-47-S et S-35-R sont représentés dans la liste de séquences en annexe sous les numéros respectifs SEQ ID NO: 3 et SEQ ID NO: 4.
Ces 2 peptides, ainsi que la fil-gst, ont été citrullinés par action de la P.A.D., pendant 30 minutes à 50°C, dans le même milieu réactionnel que celui indiqué à l'exemple 1. Les conditions spécifiques pour chaque peptide, et pour la fil-gst sont les suivantes :
- peptide S-47-S : 4 mU/μmole arginine
- peptide S-35-R : 2,7 mU/μmole arginine - fil-gst : comme indiqué à l'exemple 2.
On compare, par " dot-blot ", la réactivité de chaque peptide et celle de la fil-gst, avant et après action de l'enzyme, vis-à-vis de l'anticorps monoclonal AHF4, et du sérum d'un patient atteint de PR. Les conditions opératoires sont les suivantes :
0,5 μg par dépôt de chaque antigène (peptides, fil-gst, variants acido-neutres de la filaggrine (VAF) ) - Traitement de la nitrocellulose 45 minutes à
80°C, avant immunodétection .
- sérum PR utilisé à la dilution de 1/2000 ; anticorps monoclonal AHF4 utilisé à une concentration de 0,2 μg/ l Les résultats montrent que : - AHF4 reconnaît le peptide S-47-5 et la fil- gst citrullinés ou non, mais ne reconnaît pas S-35-R, citrulline ou non.
- S-47-S est reconnu, après citrullination, par le sérum du patient atteint de PR, alors que S-35-R, citrulline ou non, n'est pas reconnu. Le même sérum reconnaît par ailleurs les VAF et la fil-gst citrullinée, mais ne reconnaît pas la fil-gst non-citrullinée . EXEMPLE 3 : SYNTHESE DES PEPTIDES E-12-H ET E-12-D CITRULLINES ET NON CITRULLINES ET ESSAI DE LA REACTIVITE DES PEPTIDES.
Les peptides E-12-H et E-12-0 ont été déterminés par référence aux séquences nucléotidiques du gène de la profilaggrine humaine décrites par GAN S.Q et al. [Biochemistry, 29 : 9432-9440, (1990)].
Le peptide de 14 acides aminés E-12-H de séquence (code 1 lettre) :
NH2-EQSADSSRHSGSGH-COOH comprend 1 résidu arginine, et le peptide de 14 acides aminés E-12-D de séquence (code 1 lettre) :
NH2-ESSRDGSRHPRSHD-COOH comprend 3 résidus arginine.
Les peptides E-12-H et E-12-D sont représentés dans la liste de séquences en annexe sous les numéros respectifs SEQ ID NO: 5 et SEQ ID NO: 6.
Ces peptides ont été préparés par synthèse peptidique en phase solide.
Les peptides E-12-H et E-12-D citrullinés ont été synthétisés directement par incorporation d'une citrulline en remplacement d'une arginine.
Pour le peptide E-12-D, seul le résidu arginine correspondant au 8ème acide aminé de la séquence a été remplacé par une citrulline lors de la synthèse peptidique. La réactivité de chaque peptide citrulline et non citrulline a été testée respectivement vis-à-vis d'un sérum normal, de deux sérums de patients PR, d'anticorps anti-filaggrine (AFAs) purifiés à partir d'un pool de 45 sérums de patients PR et d'anticorps anti-filaggrine purifiés à partir de 12 sérums de patients PR. PROTOCOLE EXPERIMENTAL :
Les puits de plaques de microtitration NUNC MAXISORP ont été revêtus respectivement à l'aide des peptides E-12-D et E-12-H non-citrullinés et citrullinés, dilués à une concentration de 5 μg/ml dans un tampon PBS (pH: 7,4) et incubés pendant une nuit à 4°C (volume final : 100 μg/puits) . Les puits ont été saturés pendant 30 minutes à 37°C en PBS-T een 20, 0,05% gélatine 2,5%, 200 μl/puits. Le sérum de contrôle négatif (sérum normal) a été dilué au 1/120. Les anticorps anti-filaggrine ont été dilués en PBS-Tween 20, 0, 05%-gélatine 0,5% (PBS TG) de sorte que les concentrations finales en auto-anticorps anti-filaggrine soient celles indiquées dans le tableau I annexé. Le sérum de contrôle négatif, les sérums PR et les anticorps anti-filaggrine ont été ajoutés (volume final : 100 μl/puits) et soumis à incubation pendant 1 heure à 37 °C et une nuit à 4°C. Des anticorps de chèvre anti-chaînes lourdes gamma des immunoglobulines humaines, marqués à la peroxydase (commercialisés par la société SOUTHERN BIOTECHNOLOGIES) ont été ajoutés dans chaque puits (dilution en PBSTG : 1/2000, volume final : 100 μl/puits) et soumis à incubation pendant 1 heure à 37°C. La révélation a été effectuée par addition d' ortho- phénylènediamine (2mg/ml, pendant 10 minutes) .
Les résultats présentés dans le tableau I annexé sont donnés en rapport de DO à 492 nm : signal peptide citrulliné/signal peptide non-citrulliné.
Ces résultats montent que, dans la majorité des cas, le rapport en DO peptide citrulliné/peptide non- citrulliné est supérieur à 1, et illustrent donc la bonne sensibilité des peptides citrullinés par rapport aux peptides non-citrullinés pour leur réactivité vis-à-vis des autoanticorps anti-filaggrine .
TABLEAU I
Figure imgf000018_0001
Concentration en AFAs en μg/ml.

Claims

REVENDICATIONS 1) Peptide comprenant un épitope reconnu par des autoanticorps anti-filaggrine présents dans le sérum des patients atteints de polyarthrite rhumatoïde, caractérisé en ce que ledit épitope comprend un motif tripeptidique centré sur un résidu citrulline, spécifiquement présent sur au moins un des peptides citrullinés dérivés des séquences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6. 2) Peptide selon la revendication 1, caractérisé en ce qu'il comprend le motif tripeptidique Ser-Cit-His, dans lequel Cit représente un résidu citrulline .
3) Antigène artificiel reconnu spécifiquement par les auto-anticorps anti-filaggrine présents dans le sérum de patients atteints de polyarthrite rhumatoïde, caractérisé en ce qu'il comprend ou est constitué par au moins un peptide selon une quelconque des revendications 1 ou 2. 4) Utilisation d'un antigène selon une quelconque des revendications 1 à 3, pour le diagnostic in vi tro de la polyarthrite rhumatoïde.
5) Composition antigénique pour le diagnostic de la présence d'auto-anticorps spécifiques de la polyarthrite rhumatoïde dans un échantillon biologique, caractérisée en ce qu'elle contient au moins un antigène selon une quelconque des revendications 1 à 3, éventuellement marqué et/ou conjugué avec une molécule porteuse . 6) Procédé de détection des auto-anticorps spécifiques de la polyarthrite rhumatoïde dans un échantillon biologique, lequel procédé est caractérisé en ce qu'il comprend : - la mise en contact dudit échantillon biologique avec au moins un antigène selon une quelconque des revendications 1 à 3, dans des conditions permettant la formation d'un complexe antigène/anticorps avec les auto-anticorps spécifiques de la polyarthrite rhumatoïde éventuellement présents ;
- la détection, par tous moyens appropriés, du complexe antigène/anticorps éventuellement formé.
7) Nécessaire pour la détection des autoanticorps spécifiques de la polyarthrite rhumatoïde dans un échantillon biologique, caractérisé en ce qu'il comprend au moins un antigène selon quelconque des revendications 1 à 3, ainsi que des tampons et réactifs appropriés pour la constitution d'un milieu réactionnel permettant la formation d'un complexe antigène/anticorps, et/ou des moyens de détection dudit complexe antigène/anticorps .
PCT/FR1998/002899 1997-12-30 1998-12-29 Epitopes peptidiques reconnus par des auto-anticorps antifilaggrine presents dans le serum des patients atteints de polyarthrite rhumatoide WO1999035167A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP98964536A EP1042366A1 (fr) 1997-12-30 1998-12-29 Epitopes peptidiques reconnus par des auto-anticorps antifilaggrine presents dans le serum des patients atteints de polyarthrite rhumatoide
CA002316269A CA2316269A1 (fr) 1997-12-30 1998-12-29 Epitopes peptidiques reconnus par des auto-anticorps antifilaggrine presents dans le serum des patients atteints de polyarthrite rhumatoide
AU19717/99A AU1971799A (en) 1997-12-30 1998-12-29 Peptide epitopes recognised by antifilaggrin autoantibodies in serum from rheumatoid arthritis patients

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR97/16673 1997-12-30
FR9716673A FR2773157B1 (fr) 1997-12-30 1997-12-30 Epitopes peptidiques reconnus par des auto-anticorps antifilaggrine presents dans le serum des patients atteints de polyarthrite rhumatoide

Publications (1)

Publication Number Publication Date
WO1999035167A1 true WO1999035167A1 (fr) 1999-07-15

Family

ID=9515272

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR1998/002899 WO1999035167A1 (fr) 1997-12-30 1998-12-29 Epitopes peptidiques reconnus par des auto-anticorps antifilaggrine presents dans le serum des patients atteints de polyarthrite rhumatoide

Country Status (5)

Country Link
EP (1) EP1042366A1 (fr)
AU (1) AU1971799A (fr)
CA (1) CA2316269A1 (fr)
FR (1) FR2773157B1 (fr)
WO (1) WO1999035167A1 (fr)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2826124A1 (fr) * 2001-06-13 2002-12-20 Bio Merieux Procede de detection d'auto-anticorps specifiques de la polyarthrite rhumatoide
EP1041997B1 (fr) * 1997-12-30 2003-04-16 Universite Paul Sabatier (Toulouse Iii) Utilisation de peptides citrullines derives de la filaggrine dans le cadre du traitement de maladies autoimmunes
WO2003050542A2 (fr) * 2001-12-11 2003-06-19 Stichting Voor De Technische Wetenschappen Procede pour detecter des auto-anticorps chez des patients souffrant de polyarthrite rhumatoide, peptide et trousse de dosage
EP1980855A1 (fr) 2004-02-27 2008-10-15 Roche Diagnostics GmbH Méthode d'évaluation de la polyarthrite rhumatoide consistant à mesurer la concentration d'anti-CCP et de sérum amyloide A
US7846674B2 (en) 2003-12-23 2010-12-07 Roche Diagnostics Operations, Inc. Assessing rheumatoid arthritis by measuring anti-CCP and interleukin 6
EP2336769A1 (fr) 2009-12-18 2011-06-22 F. Hoffmann-La Roche AG Test pour différencier les troubles rhumatismaux des troubles non rhumatismaux
US8058013B2 (en) 2006-09-29 2011-11-15 Roche Diagnostics Operations, Inc. Assessing risk of disease progression in rheumatoid arthritis patients
EP3056903A1 (fr) 2015-02-13 2016-08-17 F. Hoffmann-La Roche AG Procédé d'évaluation de l'arthrite rhumatoïde par la mesure de l'anti-CCP et de l'anti-Casp8
EP3056904A1 (fr) 2015-02-13 2016-08-17 F. Hoffmann-La Roche AG Procédé pour l'évaluation de l'arthrite rhumatoïde par la mesure de l'anti-CCP et de l'anti-MCM3
WO2016128348A1 (fr) 2015-02-13 2016-08-18 F. Hoffmann-La Roche Ag Procédé d'évaluation de la polyarthrite rhumatoïde par mesure des anti-ccp et anti-pik3cd

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2391356A1 (fr) * 1999-12-21 2001-06-28 Innogenetics N.V. Peptides permettant de diagnostiquer et de traiter la polyarthrite rhumatoide

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998008946A1 (fr) * 1996-08-30 1998-03-05 Biomerieux Antigenes derives des filaggrines et leur utilisation pour le diagnostic de la polyarthrite rhumatoide

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998008946A1 (fr) * 1996-08-30 1998-03-05 Biomerieux Antigenes derives des filaggrines et leur utilisation pour le diagnostic de la polyarthrite rhumatoide

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHEMICAL ABSTRACTS, vol. 128, no. 12, 23 March 1998, Columbus, Ohio, US; abstract no. 139653, G A SCHELLEKENS ET AL.: "Citrulline is an essential constituent of antigenic determinants recognized by rheumatoid arthritis-specific antibodies" XP002101365 *
E GIRBAL-NEUHAUSER ET AL.: "The epitopes targeted by the rheumatoid arthritis-associated antifilaggrin autoantibodies are posttranslationally generated on various sites of (Pro)filaggrin b deimidation of arginine residues", JOURNAL OF IMMUNOLOGY, vol. 162, no. 1, 1 January 1999 (1999-01-01), BALTIMORE US, pages 585 - 594, XP002101364 *
J. CLIN. INVEST., vol. 101, no. 1, 1 January 1998 (1998-01-01), pages 273 - 281 *
SCHELLEKENS G A ET AL: "THE MODIFIED ARGININE RESIDUE CITRULLINES IS THE MAJOR CONSTITUENT OF EPITOPES RECOGNIZED BY AUTOANTIBODIES IN SERA FROM RHEUMATOID ARTHRITIS PATIENTS", ARTHRITIS AND RHEUMATISM, vol. 40, no. 9, SUPPL. 08, 8 November 1997 (1997-11-08), pages S276, XP002067877 *

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1041997B1 (fr) * 1997-12-30 2003-04-16 Universite Paul Sabatier (Toulouse Iii) Utilisation de peptides citrullines derives de la filaggrine dans le cadre du traitement de maladies autoimmunes
FR2826124A1 (fr) * 2001-06-13 2002-12-20 Bio Merieux Procede de detection d'auto-anticorps specifiques de la polyarthrite rhumatoide
WO2003050542A3 (fr) * 2001-12-11 2003-12-11 Stichting Tech Wetenschapp Procede pour detecter des auto-anticorps chez des patients souffrant de polyarthrite rhumatoide, peptide et trousse de dosage
US7888133B2 (en) 2001-12-11 2011-02-15 Stichting Voor De Technische Wetenschappen Method of detecting auto-antibodies from patients suffering from rheumatoid arthritis, a peptide and an assay kit
US9689871B2 (en) 2001-12-11 2017-06-27 Stichting Voor De Technische Wetenschappen Method of detecting auto-antibodies from patients suffering from rheumatoid arthritis, a peptide and an assay kit
EP1693673A2 (fr) * 2001-12-11 2006-08-23 Stichting Voor De Technische Wetenschappen Procédé pour détecter des auto-anticorps chez des patients souffrant de polyarthrite rhumatoïde
EP1693673A3 (fr) * 2001-12-11 2006-12-06 Stichting Voor De Technische Wetenschappen Procédé pour détecter des auto-anticorps chez des patients souffrant de polyarthrite rhumatoïde
CN105699648B (zh) * 2001-12-11 2017-10-20 技术科学基金会 从患有类风湿性关节炎的患者中检测自身抗体的方法、肽和检测试剂盒
CN105699648A (zh) * 2001-12-11 2016-06-22 技术科学基金会 从患有类风湿性关节炎的患者中检测自身抗体的方法、肽和检测试剂盒
NL1019540C2 (nl) * 2001-12-11 2003-07-01 Stichting Tech Wetenschapp Werkwijze voor het detecteren van auto-antilichamen van patienten die lijden aan reumatoïde artritis, peptide en assaykit.
US10119966B2 (en) 2001-12-11 2018-11-06 Stichting Voor De Technische Wetenschappen Method of detecting auto-antibodies from patients suffering from rheumatoid arthritis, a peptide and assay kit
US8759114B2 (en) 2001-12-11 2014-06-24 Stichting Voor De Technische Wetenschappen Method of detecting auto-antibodies from patients suffering from rheumatoid arthritis, a peptide and an assay kit
WO2003050542A2 (fr) * 2001-12-11 2003-06-19 Stichting Voor De Technische Wetenschappen Procede pour detecter des auto-anticorps chez des patients souffrant de polyarthrite rhumatoide, peptide et trousse de dosage
US8481332B2 (en) 2001-12-11 2013-07-09 Stichting Voor de Technische Wetenshappen Method of detecting auto-antibodies from patients suffering from rheumatoid arthritis, a peptide and an assay kit
US7846674B2 (en) 2003-12-23 2010-12-07 Roche Diagnostics Operations, Inc. Assessing rheumatoid arthritis by measuring anti-CCP and interleukin 6
US8062907B2 (en) 2004-02-27 2011-11-22 Roche Diagnostics Operations, Inc. Method to assess the severity of rheumatoid arthritis by measuring anti-CCP and serum amyloid A
US7981693B2 (en) 2004-02-27 2011-07-19 Roche Diagnostics Operations, Inc. Combined measurement of anti-CCP and serum amyloid A to assess rheumatoid arthritis
EP1980855A1 (fr) 2004-02-27 2008-10-15 Roche Diagnostics GmbH Méthode d'évaluation de la polyarthrite rhumatoide consistant à mesurer la concentration d'anti-CCP et de sérum amyloide A
US8058013B2 (en) 2006-09-29 2011-11-15 Roche Diagnostics Operations, Inc. Assessing risk of disease progression in rheumatoid arthritis patients
EP2336769A1 (fr) 2009-12-18 2011-06-22 F. Hoffmann-La Roche AG Test pour différencier les troubles rhumatismaux des troubles non rhumatismaux
WO2016128348A1 (fr) 2015-02-13 2016-08-18 F. Hoffmann-La Roche Ag Procédé d'évaluation de la polyarthrite rhumatoïde par mesure des anti-ccp et anti-pik3cd
EP3056904A1 (fr) 2015-02-13 2016-08-17 F. Hoffmann-La Roche AG Procédé pour l'évaluation de l'arthrite rhumatoïde par la mesure de l'anti-CCP et de l'anti-MCM3
EP3056903A1 (fr) 2015-02-13 2016-08-17 F. Hoffmann-La Roche AG Procédé d'évaluation de l'arthrite rhumatoïde par la mesure de l'anti-CCP et de l'anti-Casp8
US10094826B2 (en) 2015-02-13 2018-10-09 Roche Diagnostics Operations, Inc. Method of assessing rheumatoid arthritis by measuring anti-CCP and anti-PIK3CD

Also Published As

Publication number Publication date
CA2316269A1 (fr) 1999-07-15
EP1042366A1 (fr) 2000-10-11
AU1971799A (en) 1999-07-26
FR2773157B1 (fr) 2001-10-05
FR2773157A1 (fr) 1999-07-02

Similar Documents

Publication Publication Date Title
EP0929669B1 (fr) Antigenes derives des filaggrines et leur utilisation pour le diagnostic de la polyarthrite rhumatoide
EP1814901B1 (fr) Peptides citrullines derives de la fibrine reconnus par des auto-anticorps specifiques de la polyartrhite rhumatoide, et leurs utilisations
EP0423301B1 (fr) Peptides synthetiques du conjugue de l'ubiquitine et de l'histone h2a
EP1196450B1 (fr) Derives citrullines de la fibrine et leur utilisation pour le diagnostic ou le traitement de la polyarthrite rhumato de
WO1999035167A1 (fr) Epitopes peptidiques reconnus par des auto-anticorps antifilaggrine presents dans le serum des patients atteints de polyarthrite rhumatoide
EP0451070B1 (fr) Procédé d'identification ou de dosage de protéines et applications
EP1204865B1 (fr) Composes synthetiques portant deux epitopes pour immunodosages
FR2677653A1 (fr) Fragments peptidiques issus du cytochrome humain p450 iid6, anticorps anti-fragments peptidiques et leurs applications dans le diagnostic de l'hepatite auto-immune.
WO2021070696A1 (fr) Peptide cyclique possédant une activité inhibitrice de ｃｔｌａ－４, et application de celui-ci
CA2204438A1 (fr) Peptides capables de se lier au domaine sh3 de la proteine gap, sequences nucleotidiques codant pour ces peptides, leur preparation et utilisation
EP0491014B1 (fr) PEPTIDES DE L'ANTIGENE Sm-D ET LEUR UTILISATION NOTAMMENT POUR LE DIAGNOSTIC DU LUPUS ERYTHEMATEUX DISSEMINE
US10913780B2 (en) Conjugates, their compositions, their uses, and their methods of making
FR2682113A1 (fr) Peptides issus de la proteine a de la ribonucleoproteine snrnp-u1 et leur utilisation pour le diagnostic de la connectivite mixte.
FR2798672A1 (fr) Formes acides des peroxyredoxines et leur utilisation comme moyen de diagnostic
FR2826124A1 (fr) Procede de detection d'auto-anticorps specifiques de la polyarthrite rhumatoide
FR2848566A1 (fr) Peptides epitopiques de l'enzyme thyroperoxydase, les compositions les contenant et leurs applications
EP1423708A1 (fr) Compositions et methodes pour le dosage de l'aa4rp
EP0252787A1 (fr) Polypeptides de surfaces cellulaires, isolés et purifiés, reconnus par les anticorps responsables de la pathogénie du lupus érythémateux disséminé (LED), leur méthode d'obtention et leur application au diagnostic du LED

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AU BA BB BG BR CA CN CU CZ EE GD GE HR HU ID IL IN IS JP KG KP KR LC LK LR LT LV MG MK MN MX NO NZ PL RO SG SI SK SL TR TT UA US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2316269

Country of ref document: CA

Ref country code: CA

Ref document number: 2316269

Kind code of ref document: A

Format of ref document f/p: F

NENP Non-entry into the national phase

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: 09582711

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 1998964536

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1998964536

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1998964536

Country of ref document: EP