Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
  • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
  • C07K14/4702—Regulators; Modulating activity
  • C07K14/4703—Inhibitors; Suppressors
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P13/00—Drugs for disorders of the urinary system
  • A61P13/10—Drugs for disorders of the urinary system of the bladder
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P13/00—Drugs for disorders of the urinary system
  • A61P13/12—Drugs for disorders of the urinary system of the kidneys
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P17/00—Drugs for dermatological disorders
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2799/00—Uses of viruses
  • C12N2799/02—Uses of viruses as vector
  • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid

Definitions

• the present invention concerns materials and methods relating to the identification of a tumour suppressor locus at 9q32-33, and a gene within this region.
• the present invention further relates to applications of these findings, in particular in the diagnostic, prophylactic and therapeutic treatment of cancer, especially bladder cancer.
• TCCs transitional cell carcinomas
• LH heterozygosity
• chromosome 9q and/or 9p the most frequent genetic alteration (>50%) in both superficial papillary and invasive TCC
• LOH studies have demonstrated the frequent occurrence of LOH at all loci on both arms of chromosome 9 and cytogenetic studies have identified frequent monosomy 9 in TCC (Smeets et al . , 1987; Vanni et al . , 1988).
• Deletion mapping studies using microsatellite markers have defined localised deletions on the short arm and long arm of chromosome 9 (Ruppert et al . , 1993; Keen and Knowles, 1994) .
• candidate tumour suppressor genes, pl6/CDKN2/MTSl and pl5/MTS2 identified at 9p21 have been found to be homozygously deleted in many types of human malignant tumours including TCC (Cairns et al . , 1995; Williamson et al . , 1995) .
• TCC Tumor Cell et al .
• the present invention concerns the localisation of a common deleted region at 9q32-33 between D9S1848 and AFMA239XA9 by a detailed deletion mapping analysis using a large number of microsatellite markers and the identification of a tumour suppressor gene IB3089A located within a single 840kb YAC covering this region.
• the tumour suppressor locus at 9q32-33 and IB3089A gene are also referred to herein as "DBCCRl” for Deleted in Bladder Cancer Chromosome Region candidate 1.
• the gene was previously referred to as "DBCl” for "deleted in bladder cancer one" and the two terms are used herein interchangeably.
• LOH on 9q or partial LOH involving 9q32- 33 has been reported in other types of sporadic human malignant tumour such as squamous carcinoma, non-melanoma skin cancer, renal cell carcinoma, squamous cell carcinoma of the oesophagus and ovarian cancer (Ah-See et al . , 1994; Quinn et al . , 1994; Cairns et al . , 1995; Miura et al . , 1995; Devlin et al . , 1996), implicating the possible inactivation of a tumour suppressor at this locus in many human cancers.
• the present invention provides an isolated nucleic acid molecule comprising the nucleotide of the DBCCRl gene as set out in figure 6, or alleles thereof.
• the present invention also provides nucleic acid molecules including polymorphisms of the figure 6 nucleic acid sequence, for example, the silent polymorphisms selected from the group consisting of T1036C, C2044A and T2642C (see below) .
• the present invention also includes the first characterisation of the genomic structure of the DBCCRl gene see the intron/exon information in table 2, as well as the sequencing of the coding region shown in figure 6. The sequence of the DBCCRl promoter region is set out in figure 11.
• the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a DBCCRl polypeptide having the amino acid sequence set out in figure 6.
• the present invention further includes an isolated nucleic acid molecule which has a nucleotide sequence encoding a polypeptide which is a variant, derivative or allele of the DBCCRl polypeptide including the amino acid sequence set out in figure 6.
• the present invention also includes fragments of the DBCCRl gene excluding the ESTs used in the identification of the gene or found in search after its location.
• the fragments encode polypeptides retaining a biological property of full length DBCCRl polypeptide, and have lengths greater than about 350 nucleotide, more preferably greater than 450 nucleotides, and still more preferably greater than 600 nucleotides in length.
• the present invention provides an isolated nucleic acid molecule encoding a polypeptide having a 80% sequence identity to the DBCCRl polypeptide including the amino acid sequence set out in figure 6.
• the present invention provides an expression vector comprising any one of the above nucleic acid molecules operably linked to control sequences to direct its expression.
• the present invention provides host cells transformed with the above vectors.
• vectors e.g. viral vectors
• DBCCRl nucleic acid can be used in methods of gene therapy, e.g. to produce active DBCCRl polypeptide in a population of cells.
• the present invention provides a method of producing a DBCCRl polypeptide comprising culturing the above host cells and recovering the DBCCRl polypeptide thus produced.
• the method further comprises the step of recovering the DBCCRl polypeptide.
• the present invention provides any of the above mentioned nucleic acid molecules for use in a method of medical treatment.
• the present invention provides a substance which is a DBCCRl polypeptide encoded by the any one of the above nucleic acid molecules.
• the present invention provides a substance which is a DBCCRl polypeptide including the amino acid sequence set out in figure 6.
• the present invention also includes substances which are polypeptides and have sequence identity, for example greater than 80% amino acid identity, to the DBCCRl polypeptide including the amino acid sequence set out in figure 6.
• the present invention further includes polypeptides which are variants, derivatives or alleles of the DBCCRl polypeptide having the sequence set out in figure 6.
• the present invention includes a substance which is a fragment or active portion or functional mimetic of a DBCCRl polypeptide including the amino acid sequence of figure 6.
• the present invention provides the above substances for use in a method of medical treatment .
• the DBCCRl polypeptides and nucleic acid molecules are used in the treatment of cancer, bladder cancer, squamous carcinoma, skin cancer, renal cell carcinoma, oesophageal cancer and ovarian cancer.
• the present invention provides antibodies capable of specifically binding to any one of the above DBCCRl nucleic acid molecules or DBCCRl polypeptides.
• Antibodies capable of specifically binding DBCCRl polypeptides are especially useful as the DBCCRl polypeptides do not have significant homology with other known proteins, and the antibodies can be used in their detection and/or characterisation.
• compositions comprising one or more of the above nucleic acid molecules, substances or antibodies.
• Such compositions will typically also include a pharmaceutically acceptable carrier.
• the present invention provides the DBCCRl polypeptides set out above for use in a method of medical treatment.
• the present invention provides the use of the above substances in the preparation of a medicament for treating cancer, especially bladder cancer.
• the present invention provides the use of a DBCCRl polypeptide as defined above as a molecular weight marker, e.g. as a standard on a gel (SDS- PAGE etc) .
• the present invention provides the use of a polymorphism in the DBCCRl nucleic acid sequence as a genetic marker within the 9q32-33 locus, and more particularly within the interval between D9S1848 and AFMA239XA9.
• a polymorphism in the DBCCRl nucleic acid sequence as a genetic marker within the 9q32-33 locus, and more particularly within the interval between D9S1848 and AFMA239XA9.
• the use of genetic markers is well known in the art and they are valuable tools for the identification and mapping of genes. Examples of polymorphisms include the T1036C, C2044A and T2642C polymorphisms described below.
• nucleic acid including one of the genetic markers can be detected in a test sample using a nucleic acid probe capable of hybridising to the nucleic acid sequence including one or more of the polymorphisms, or a complementary sequence thereof, by exposing the test nucleic acid to the probe under hybridising conditions and observing whether hybridisation takes place.
• this approach is generally applicable and can also be used to detect the presence of DBCCRl nucleic acid, by employing a probe based on the DBCCRl nucleic acid sequence shown in figure 6 or a complementary sequence thereof.
• the present invention provides a method for determining inactivation of the DBCCRl gene in a biological sample from a patient, the method comprising:
• the present invention provides a method for determining the inactivation of the DBCCRl gene, the method comprising determining the methylation in the DBCCRl promoter region or gene .
• Methods for quantitating methylation differences between nucleic acid sequences are discussed below. These include: (a) the use of methylation sensitive single nucleotide primer extension (Ms-SNuPE) .
• the above methods can be carried out following the digestion of bisulphite-converted DNA.
• the above determinations may be useful in assisting a physician in the diagnosis or prognosis of cancer, e.g the forms of cancer mentioned above that are associated with deletions in the 9q32-33 region.
• the method is used in the diagnosis or prognosis of bladder cancer. Methods for carrying out the above determinations are well known in the art and are discussed below.
• the present invention provides a method for detecting mutations in the DBCCRl gene or the polypeptide encoded by the gene, the methods including:
• a specific binding member capable of binding to a DBCCRl nucleic acid sequence (either a normal sequence or a known mutated sequence) , the specific binding member comprising nucleic acid hybridisable with the DBCCRl sequence, or substances comprising an antibody domain with specificity for a native or mutated DBCCRl nucleic acid sequence or the polypeptide encoded by it, the specific binding member being labelled so that binding of the specific binding member to its binding partner is detectable; or,
• the present invention provides the use of a methylation inhibitor in the preparation of a medicament for treating cancer, especially bladder cancer, wherein the methylation inhibitor causes activation of the tumour suppressor activity of the DBCCRl gene, e.g. by allowing the production of active DBCCRl polypeptide.
• methylation inhibitor 5-aza-2 ' -deoxycytidine An example of a methylation inhibitor is methylation inhibitor 5-aza-2 ' -deoxycytidine .
• the role of methylation in carcinogenesis and further examples of methylation inhibitors is discussed in Zingg and Jones, 1997.
• the present invention provides the use of the above DBCCRl nucleic acid in designing primers for use in the polymerase chain reaction to amplify all or part of the DBCCRl nucleic acid sequence. Examples of primers used to amplify the coding region of the DBCCRl gene are set out in table 3.
• tumour #35 LOH is found at D9S195 with retention of heterozygosity at the other markers.
• B In tumour #68, LOH is observed at D9S195 and AFMA239ZE1 with retention of heterozygosity at the other markers.
• C In tumour #121, localised LOH is found at D9S195 with retention of heterozygosity at D9S1848, AFMA239ZE1 and AFMA239XA9.
• D Representative patterns for microsatellite markers D9S195, AFMA239ZE1 and D9S1848. In D9S195, stutter
• FIG. 3 A YAC contig map encompassing the deleted region at 9q32-33. 3EG8, 21GH3, 36GD9, 15HD3, 12IB1, 28BB3, 9EE5, 9DC8 and 21GH3 are from the ICI YAC library and other YACs are from the CEPH YAC library. Black squares and white squares indicate presence or absence of a particular STS in each YAC, respectively.
• Hatched squares indicate the YAC- end STSs. -R and -L indicate right and left YAC-ends, respectively.
• the size of each YAC was determined by CHEF- gel electrophoresis, followed by Southern hybridisation with total human DNA. The size of all CEPH YACs shown was consistent with CEPH data.
• Fi ure 4
• RT-PCR analysis of IB3089A mRNA expression in bladder cancer cell lines RT-PCR products were electrophoresed and blotted onto nylon membranes. Blots were hybridized with 32 P-labelled internal specific primers exposed for 0.5 to 2 hours. No bands were identified in cell lines 609CR, 5637, RT4 , T24 and SCaBer even after a longer exposure. GAPDH RT-PCR was used as a control for RNA integrity and reverse transcription reaction.
• Figure 9 :
• This figure depicts the nucleic acid sequence of the region containing the DBCCRl promoter, the sequence starting immediately upstream of the the nucleic acid sequence shown in figure 6.
• the DBCCRl coding sequence may be that shown in figure 6, or it may be a variant, derivative, or allele of this sequence, or the complement of any of these sequences.
• the sequence may differ from that shown by a change which is one or more of addition, insertion, deletion and substitution of one or more nucleotides of the sequence shown. Changes to a nucleotide sequence may result in an amino acid change at the protein level, or not, as determined by the genetic code.
• nucleic acid according to the present invention may include a sequence different from the sequence shown in figure 6 yet encode a polypeptide with the same amino acid sequence.
• the amino acid sequence of the complete DBCCRl polypeptide shown in figure 6 consists of 761 residues.
• the DBCCRl promoter region is set out in figure 11.
• the encoded polypeptide may comprise an amino acid sequence which differs by one or more amino acid residues from the amino acid sequence shown in figure 6.
• Nucleic acid encoding a polypeptide which is an amino acid sequence variant, derivative, or allele of the sequence shown in figure 6 is further provided by the present invention. Such polypeptides are discussed below. Nucleic acid encoding such a polypeptide may show greater than about 60% homology with the coding sequence shown in figure 6 greater than about 70% homology, greater than about 80% homology, greater than about 90% homology, or greater than about 95% homology.
• nucleic acid according to the present invention is provided as an isolate, in isolated and/or purified form, or free or substantially free of material with which it is naturally associated, such as free or substantially free of nucleic acid flanking the gene in the human genome, except possibly one or more regulatory sequence (s) for expression.
• Nucleic acid may be wholly or partially synthetic and may include genomic DNA, cDNA or RNA. Where nucleic acid according to the invention includes RNA, reference to the sequence shown should be construed as reference to the RNA equivalent, with U substituted for T.
• Nucleic acid sequences encoding all or part of the DBCCRl gene and/or its regulatory elements can be readily prepared by the skilled person using the information and references contained herein and techniques known in the art
• DBCCRl sequences can be incorporated in a vector having control sequences operably linked to the DBCCRl nucleic acid to control its expression.
• the vectors may include other sequences such as promoters or enhancers to drive the expression of the inserted nucleic acid, nucleic acid sequences so that the DBCCRl polypeptide is produced as a fusion and/or nucleic acid encoding secretion signals so that the polypeptide produced in the host cell is secreted from the cell.
• DBCCRl polypeptide can then be obtained by transforming the vectors into host cells in which the vector is functional, culturing the host cells so that the DBCCRl polypeptide is produced and recovering the DBCCRl polypeptide from the host cells or the surrounding medium.
• Prokaryotic and eukaryotic cells are used for this purpose in the art, including strains of E. coli, yeast, and eukaryotic cells such as COS or CHO cells.
• the choice of host cell can be used to control the properties of the DBCCRl polypeptide expressed in those cells, e.g. controlling where the polypeptide is deposited in the host cells or affecting properties such as its glycosylation.
• PCR techniques for the amplification of nucleic acid are described in US Patent No.
• PCR comprises steps of denaturation of template nucleic acid (if double-stranded) , annealing of primer to target, and polymerisation.
• the nucleic acid probed or used as template in the amplification reaction may be genomic DNA, cDNA or RNA.
• PCR can be used to amplify specific sequences from genomic DNA, specific RNA sequences and cDNA transcribed from mRNA, bacteriophage or plasmid sequences.
• the DBCCRl nucleic acid sequences provided herein readily allow the skilled person to design PCR primers, see for example table 2.
• the present invention provides a method of obtaining nucleic acid of interest, the method including hybridisation of a probe having the sequence shown in figures 6 or 11, or a complementary sequence, to target nucleic acid.
• This approach can be extended to polymorphisms in the figure 6 sequence which can, for example, be used as markers in the 9q32-33 region of the genome .
• Hybridisation is generally followed by identification of successful hybridisation and isolation of nucleic acid which has hybridised to the probe, which may involve one or more steps of PCR.
• Nucleic acid according to the present invention is obtainable using one or more oligonucleotide probes or primers designed to hybridise with one or more fragments of the nucleic acid sequence shown in figure 6 or 11, particularly fragments of relatively rare sequence, based on codon usage or statistical analysis.
• a primer designed to hybridise with a fragment of the nucleic acid sequence shown in the above figures may be used in conjunction with one or more oligonucleotides designed to hybridise to a sequence in a cloning vector within which target nucleic acid has been cloned, or in so-called "RACE" (rapid amplification of cDNA ends) in which cDNA' s in a library are ligated to an oligonucleotide linker and PCR is performed using a primer which hybridises with the sequence shown in figures 6 or 11 and a primer which hybridises to the oligonucleotide linker.
• RACE rapid amplification of cDNA ends
• Such oligonucleotide probes or primers, as well as the full-length sequence (and alleles, mutants, variants and derivatives) are also useful in screening a test sample containing nucleic acid for the presence of polymorphisms, the probes hybridising with a target sequence from a sample obtained from the individual being tested.
• the conditions of the hybridisation can be controlled to minimise nonspecific binding, and preferably stringent to moderately stringent hybridisation conditions are preferred.
• the skilled person is readily able to design such probes, label them and devise suitable conditions for the hybridisation reactions, assisted by textbooks such as Sambrook et al (1989) and Ausubel et al (1992) .
• the probes may also be used to determine whether mRNA encoding DBCCRl is present in a cell or tissue.
• CpG islands at the 5' end of the DBCCRl gene and in the promoter region are hypermethylated in some types of cancer means that samples of DBCCRl nucleic acid including this part of the DBCCRl gene or promoter region can be screened to determine the extent of hypermethylation, and thereby to assist in the prognosis or diagnosis of cancers, such as bladder cancer, in a patient. Protocols for determining the extent of hypermethylation are described below.
• Nucleic acid isolated and/or purified from one or more cells may be probed under conditions for selective hybridisation and/or subjected to a specific nucleic acid amplification reaction such as the polymerase chain reaction (PCR) .
• PCR polymerase chain reaction
• cloning it may be necessary for one or more gene fragments to be ligated to generate a full- length coding sequence. Also, where a full-length encoding nucleic acid molecule has not been obtained, a smaller molecule representing part of the full molecule, may be used to obtain full-length clones. Inserts may be prepared from partial cDNA clones and used to screen cDNA libraries. The full-length clones isolated may be subcloned into expression vectors and activity assayed by transfection into suitable host cells, e.g. with a reporter plasmid. A method may include hybridisation of one or more (e.g. two) probes or primers to target nucleic acid.
• hybridisation will generally be preceded by denaturation to produce single- stranded DNA.
• the hybridisation may be as part of a PCR procedure, or as part of a probing procedure not involving PCR.
• An example procedure would be a combination of PCR and low stringency hybridisation.
• a screening procedure chosen from the many available to those skilled in the art, is used to identify successful hybridisation events and isolated hybridised nucleic acid.
• Binding of a probe to target nucleic acid may be measured using any of a variety of techniques at the disposal of those skilled in the art.
• probes may be radioactively, fluorescently or enzymatically labelled.
• Other methods not employing labelling of probe include examination of restriction fragment length polymorphisms, amplification using PCR, RNAase cleavage and allele specific oligonucleotide probing.
• Probing may employ the standard Southern blotting technique. For instance DNA may be extracted from cells and digested with different restriction enzymes. Restriction fragments may then be separated by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter. Labelled probe may be hybridised to the DNA fragments on the filter and binding determined.
• DNA for probing may be prepared from RNA preparations from cells.
• Preliminary experiments may be performed by hybridising under low stringency conditions various probes to Southern blots of DNA digested with restriction enzymes. Suitable conditions would be achieved when a large number of hybridising fragments were obtained while the background hybridisation was low. Using these conditions nucleic acid libraries, e.g. cDNA libraries representative of expressed sequences, may be searched.
• oligonucleotide probes or primers may be designed, taking into account the degeneracy of the genetic code, and, where appropriate, codon usage of the organism from the candidate nucleic acid is derived.
• An oligonucleotide for use in nucleic acid amplification may have about 10 or fewer codons (e.g. 6, 7 or 8), i.e. be about 30 or fewer nucleotides in length (e.g. 18, 21 or 24).
• specific primers are upwards of 14 nucleotides in length, but not more than 18-20.
• a further aspect of the present invention provides an oligonucleotide or polynucleotide fragment of the nucleotide sequence shown in figures 6 or 11, or a complementary sequence, in particular for use in a method of obtaining and/or screening nucleic acid.
• the sequences referred to above may be modified by addition, substitution, insertion or deletion of one or more nucleotides, but preferably without abolition of ability to hybridise selectively with nucleic acid with the sequence shown in figure 6, that is wherein the degree of homology of the oligonucleotide or polynucleotide with one of the sequences given is sufficiently high.
• Nucleic acid according to the present invention may be used in methods of gene therapy, for instance in treatment of individuals with the aim of preventing or curing (wholly or partially) cancer. This too is discussed below.
• Nucleic acid according to the present invention such as a full-length coding sequence or oligonucleotide probe or primer, may be provided as part of a kit, e.g. in a suitable container such as a vial in which the contents are protected from the external environment .
• the kit may include instructions for use of the nucleic acid, e.g. in PCR and/or a method for determining the presence of nucleic acid of interest in a test sample.
• a kit wherein the nucleic acid is intended for use in PCR may include one or more other reagents required for the reaction, such as polymerase, nucleosides, buffer solution etc.
• the nucleic acid may be labelled.
• a kit for use in determining the presence or absence of nucleic acid of interest may include one or more articles and/or reagents for performance of the method, such as means for providing the test sample itself, e.g. a swab for removing cells from the buccal cavity or a syringe for removing a blood sample or a container for collecting urine samples (such components generally being sterile) .
• a convenient way of producing a polypeptide according to the present invention is to express nucleic acid encoding it, by use of the nucleic acid in an expression system. The use of expression system has reached an advanced degree of sophistication today.
• the present invention also encompasses a method of making a polypeptide (as disclosed) , the method including expression from nucleic acid encoding the polypeptide (generally nucleic acid according to the invention) .
• This may conveniently be achieved by growing a host cell in culture, containing such a vector, under appropriate conditions which cause or allow expression of the polypeptide.
• Polypeptides may also be expressed in in vitro systems, such as reticulocyte lysate.
• Suitable host cells include bacteria, eukaryotic cells such as mammalian and yeast, and baculovirus systems. Mammalian cell lines available in the art for expression . of a heterologous polypeptide include Chinese hamster ovary cells, HeLa cells, baby hamster kidney cells, COS cells and many others. A common, preferred bacterial host is E. coli .
• Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. Vectors may be plasmids, viral e.g.
• a further aspect of the present invention provides a host cell containing nucleic acid as disclosed herein.
• the nucleic acid of the invention may be integrated into the genome (e.g. chromosome) of the host cell. Integration may be promoted by inclusion of sequences which promote recombination with the genome, in accordance with standard techniques.
• the nucleic acid may be on an extra-chromosomal vector within the cell.
• a still further aspect provides a method which includes introducing the nucleic acid into a host cell.
• the introduction which may (particularly for in vi tro introduction) be generally referred to without limitation as "transformation", may employ any available technique.
• suitable techniques may include calcium phosphate transfection, DEAE-Dextran, electroporation, liposome-mediated transfection and transduction using retrovirus or other virus, e.g. vaccinia or, for insect cells, baculovirus.
• suitable techniques may include calcium chloride transformation, electroporation and transfection using bacteriophage .
• direct injection of the nucleic acid could be employed.
• Marker genes such as antibiotic resistance or sensitivity genes may be used in identifying clones containing nucleic acid of interest, as is well known in the art .
• the introduction may be followed by causing or allowing expression from the nucleic acid, e.g. by culturing host cells (which may include cells actually transformed although more likely the cells will be descendants of the transformed cells) under conditions for expression of the gene, so that the encoded polypeptide is produced. If the polypeptide is expressed coupled to an appropriate signal leader peptide it may be secreted from the cell into the culture medium.
• a polypeptide may be isolated and/or purified from the host cell and/or culture medium, as the case may be, and subsequently used as desired, e.g. in the formulation of a composition which may include one or more additional components, such as a pharmaceutical composition which includes one or more pharmaceutically acceptable excipients, vehicles or carriers (e.g. see below).
• nucleic acid may take place in vivo by way of gene therapy, as discussed below.
• a host cell containing nucleic acid according to the present invention may be comprised (e.g. in the soma) within an organism which is an animal, particularly a mammal, which may be human or non-human, such as rabbit, guinea pig, rat, mouse or other rodent, cat, dog, pig, sheep, goat, cattle or horse, or which is a bird, such as a chicken.
• an animal particularly a mammal, which may be human or non-human, such as rabbit, guinea pig, rat, mouse or other rodent, cat, dog, pig, sheep, goat, cattle or horse, or which is a bird, such as a chicken.
• Genetically modified or transgenic animals or birds comprising such a cell are also provided as further aspects of the present invention, including knockout animals in which all or part of the DBCCRl gene is deleted or non-functional . This may have a therapeutic aim. (Gene therapy is discussed below.)
• the presence of a allele or variant sequence within cells of an organism, particularly when in place of a homologous endogenous sequence, may allow the organism to be used as a model in testing and/or studying the role of the DBCCRl gene or substances which modulate activity of the encoded polypeptide in vitro or the promoter sequence shown in figure 11 are otherwise indicated to be of therapeutic potential .
• host cells may be used as a nucleic acid factory to replicate the nucleic acid of interest in order to generate large amounts of it. Multiple copies of nucleic acid of interest may be made within a cell when coupled to an amplifiable gene such as DHFR.
• Host cells transformed with nucleic acid of interest, or which are descended from host cells into which nucleic acid was introduced, may be cultured under suitable conditions, e.g. in a fermenter, taken from the culture and subjected to processing to purify the nucleic acid.
• nucleic acid or one or more fragments thereof may be used as desired, for instance in a diagnostic or prognostic assay as discussed elsewhere herein.
• a further aspect of the present invention provides a polypeptide which has the amino acid sequence shown in figure 6, which may be in isolated and/or purified form, free or substantially free of material with which it is naturally associated, such as other polypeptides or such as human polypeptides other than DBCCRl polypeptide or (for example if produced by expression in a prokaryotic cell) lacking in native glycosylation, e.g. unglycosylated.
• Polypeptides which are amino acid sequence variants, alleles or derivatives are also provided by the present invention.
• a polypeptide which is a variant, allele, or derivative may have an amino acid sequence which differs from that given in figure 6 by one or more of addition, substitution, deletion and insertion of one or more amino acids.
• Preferred such polypeptides have DBCCRl function, that is to say have one or more of the following properties: immunological cross-reactivity with an antibody reactive the polypeptide for which the sequence is given in figure 6; sharing an epitope with the polypeptide for which the amino acid sequence is shown in figure 6 (as determined for example by immunological cross-reactivity between the two polypeptides) ; having the tumour suppressing or growth inhibiting activity of full length DBCCRl.
• This latter activity can be assayed by transforming cells with a nucleic acid encoding the DBCCRl polypeptide and observing any change in tumour suppression or growth inhibition takes place.
• the cells do not express endogenous DBCCRl polypeptide, e.g. the "5637" cell line used in the examples below) , although with suitable controls cell types could be used.
• a polypeptide which is an amino acid sequence variant, allele or derivative of the amino acid sequence shown in figure 6 may comprise an amino acid sequence which shares greater than about 35% sequence identity with the sequence shown, greater than about 40%, greater than about 50%, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90% or greater than about 95%.
• the sequence may share greater than about 60% similarity, greater than about 70% similarity, greater than about 80% similarity or greater than about 90% similarity with the amino acid sequence shown in any one of figure 6.
• Particular amino acid sequence variants may differ from those shown in figure 6 by insertion, addition, substitution or deletion of 1 amino acid, 2, 3, 4, 5-10, 10-20 20-30, 30-50, 50-100, 100-150, or more than 150 amino acids. Sequence comparison can be made using the GCG program which is available from Genetics Computer Group, Oxford Molecular Group, Madison, Wisconsin, USA, Version 9.1.
• the present invention also includes active portions, fragments, derivatives and functional mimetics of the DBCCRl polypeptides of the invention.
• An "active portion" of DBCCRl polypeptide means a peptide which is less than said full length DBCCRl polypeptide, but which retains its essential biological activity, i.e. inhibiting cell growth or acting as a tumour suppressor.
• a "fragment" of the DBCCRl polypeptide means a stretch of amino acid residues of at least about five to seven contiguous amino acids, often at least about seven to nine contiguous amino acids, typically at least about nine to 13 contiguous amino acids and, most preferably, at least about
• a "derivative" of the DBCCRl polypeptide or a fragment thereof means a polypeptide modified by varying the amino acid sequence of the protein, e.g. by manipulation of the nucleic acid encoding the protein or by altering the protein itself. Such derivatives of the natural amino acid sequence may involve insertion, addition, deletion or substitution of 1 amino acid, 2, 3, 4, 5-10, 10-20 20-30, 30-50, 50-100, 100-150, or more than 150 amino acids, without fundamentally altering a given biological activity of the wild type DBCCRl polypeptide.
• “Functional mimetic” means a substance which may not contain an active portion of the DBCCRl amino acid sequence, and probably is not a peptide at all, but which retains the essential biological activity of natural DBCCRl polypeptide. The design and screening of candidate mimetics is described in detail below.
• a polypeptide according to the present invention may be isolated and/or purified (e.g. using an antibody) for instance after production by expression from encoding nucleic acid (for which see below) .
• Polypeptides according to the present invention may also be generated wholly or partly by chemical synthesis.
• the isolated and/or purified polypeptide may be used in formulation of a composition, which may include at least one additional component, for example a pharmaceutical composition including a pharmaceutically acceptable excipient, vehicle or carrier.
• a composition including a polypeptide according to the invention may be used in prophylactic and/or therapeutic treatment as discussed below.
• the DBCCRl polypeptides can also be linked to a coupling partner, e.g. an effector molecule, a label, a drug, a toxin and/or a carrier or transport molecule.
• a coupling partner e.g. an effector molecule, a label, a drug, a toxin and/or a carrier or transport molecule.
• Techniques for coupling the peptides of the invention to both peptidyl and non-peptidyl coupling partners are well known in the art.
• the carrier molecule is a 16 aa peptide sequence derived from the homeodomain of Antennapedia (e.g. as sold under the name "Penetratin” ) , which can be coupled to a peptide via a terminal Cys residue.
• the "Penetratin” molecule and its properties are described in WO 91/18981.
• a polypeptide, peptide fragment, allele or variant according to the present invention may be used as an immunogen or otherwise in obtaining specific antibodies. Antibodies are useful in purification and other manipulation of polypeptides and peptides, diagnostic screening and therapeutic contexts. This is discussed further below.
• a polypeptide according to the present invention may be used in screening for molecules which affect or modulate its activity or function. Such molecules may be useful in a therapeutic (possibly including prophylactic) context.
• DBCCRl polypeptides A further important use of the DBCCRl polypeptides is in raising antibodies that have the property of specifically binding to the DBCCRl polypeptides, or fragments or active portions thereof. As the DBCCRl polypeptide of figure 6 does not have significant homology with known polypeptides, so antibodies raised against this polypeptide will be new.
• Monoclonal antibodies can be subjected to the techniques of recombinant DNA technology to produce other antibodies or chimeric molecules which retain the specificity of the original antibody. Such techniques may involve introducing DNA encoding the immunoglobulin variable region, or the complementarity determining regions (CDRs) , of an antibody to the constant regions, or constant regions plus framework regions, of a different immunoglobulin. See, for instance, EP-A-184187, GB-A-2188638 or EP-A-239400.
• a hybridoma producing a monoclonal antibody may be subject to genetic mutation or other changes, which may or may not alter the binding specificity of antibodies produced.
• a further aspect of the present invention provides an antibody able to bind specifically to the polypeptide whose sequence is given in figure 6.
• Such an antibody may be specific in the sense of being able to distinguish between the polypeptide it is able to bind and other human polypeptides for which it has no or substantially no binding affinity (e.g. a binding affinity of about lOOOx worse) .
• Specific antibodies bind an epitope on the molecule which is either not present or is not accessible on other molecules.
• Antibodies according to the present invention may be specific for the wild-type polypeptide.
• Antibodies according to the invention may be specific for a particular variant, allele, mutant or derivative polypeptide as between that molecule and the wild- ype DBCCRl polypeptide, so as to be useful in diagnostic and prognostic methods as discussed below. Antibodies are also useful in purifying the polypeptide or polypeptides to which they bind, e.g. following production by recombinant expression from encoding nucleic acid.
• Preferred antibodies according to the invention are isolated, in the sense of being free from contaminants such as antibodies able to bind other polypeptides and/or free of serum components. Monoclonal antibodies are preferred for some purposes, though polyclonal antibodies are within the scope of the present invention.
• Antibodies may be obtained using techniques which are standard in the art. Methods of producing antibodies include immunising a mammal (e.g. mouse, rat, rabbit, horse, goat, sheep or monkey) with the protein or a fragment thereof. Antibodies may be obtained from immunised animals using any of a variety of techniques known in the art, and screened, preferably using binding of antibody to antigen of interest.
• an antibody specific for a protein may be obtained from a recombinantly produced library of expressed immunoglobulin variable domains, e.g. using lambda bacteriophage or filamentous bacteriophage which display functional immunoglobulin binding domains on their surfaces; for instance see WO92/01047.
• the library may be naive, that is constructed from sequences obtained from an organism which has not been immunised with any of the proteins (or fragments) , or may be one constructed using sequences obtained from an organism which has been exposed to the antigen of interest.
• Antibodies according to the present invention may be modified in a number of ways. Indeed the term “antibody” should be construed as covering any binding substance having a binding domain with the required specificity. Thus the invention covers antibody fragments, derivatives, functional equivalents and homologues of antibodies, including synthetic molecules and molecules whose shape mimics that of an antibody enabling it to bind an antigen or epitope.
• Example antibody fragments capable of binding an antigen or other binding partner are the Fab fragment consisting of the VL, VH, Cl and CHI domains; the Fd fragment consisting of the VH and CHI domains; the Fv fragment consisting of the VL and VH domains of a single arm of an antibody; the dAb fragment which consists of a VH domain; isolated CDR regions and F(ab')2 fragments, a bivalent fragment including two Fab fragments linked by a disulphide bridge at the hinge region. Single chain Fv fragments are also included.
• a hybridoma producing a monoclonal antibody according to the present invention may be subject to genetic mutation or other changes. It will further be understood by those skilled in the art that a monoclonal antibody can be subjected to the techniques of recombinant DNA technology to produce other antibodies or chimeric molecules which retain the specificity of the original antibody. Such techniques may involve introducing DNA encoding the immunoglobulin variable region, or the complementarity determining regions (CDRs) , of an antibody to the constant regions, or constant regions plus framework regions, of a different immunoglobulin. See, for instance, EP-A-184187, GB-A-2188638 or EP-A-0239400.
• CDRs complementarity determining regions
• Hybridomas capable of producing antibody with desired binding characteristics are within the scope of the present invention, as are host cells, eukaryotic or prokaryotic, containing nucleic acid encoding antibodies (including antibody fragments) and capable of their expression.
• the invention also provides methods of production of the antibodies including growing a cell capable of producing the antibody under conditions in which the antibody is produced, and preferably secreted.
• the reactivities of antibodies on a sample may be determined by any appropriate means. Tagging with individual reporter molecules is one possibility.
• the reporter molecules may directly or indirectly generate detectable, and preferably measurable, signals.
• the linkage of reporter molecules may be directly or indirectly, covalently, e.g. via a peptide bond or non- covalently. Linkage via a peptide bond may be as a result of recombinant expression of a gene fusion encoding antibody and reporter molecule.
• Suitable fluorochromes include fluorescein, rhodamine, phycoerythrin and Texas Red.
• Suitable chromogenic dyes include diaminobenzidine .
• Other reporters include macromolecular colloidal particles or particulate material such as latex beads that are coloured, magnetic or paramagnetic, and biologically or chemically active agents that can directly or indirectly cause detectable signals to be visually observed, electronically detected or otherwise recorded. These molecules may be enzymes which catalyse reactions that develop or change colours or cause changes in electrical properties, for example.
• Biotin/avidin or biotin/streptavidin and alkaline phosphatase detection systems may be employed.
• the mode of determining binding is not a feature of the present invention and those skilled in the art are able to choose a suitable mode according to their preference and general knowledge.
• Antibodies according to the present invention may be used in screening for the presence of a polypeptide, for example in a test sample containing cells or cell lysate as discussed, and may be used in purifying and/or isolating a polypeptide according to the present invention, for instance following production of the polypeptide by expression from encoding nucleic acid therefor. Antibodies may modulate the activity of the polypeptide to which they bind and so, if that polypeptide has a deleterious effect in an individual, may be useful in a therapeutic context (which may include prophylaxis) .
• An antibody may be provided in a kit, which may include instructions for use of the antibody, e.g. in determining the presence of a particular substance in a test sample.
• One or more other reagents may be included, such as labelling molecules, buffer solutions, elutants and so on. Reagents may be provided within containers which protect them from the external environment, such as a sealed vial .
• a number of methods are known in the art for analysing biological samples from individuals to determine the extent of inactivation of the DBCCRl gene in a biological sample from a patient.
• the purpose of such analysis may be used for diagnosis or prognosis, and serve to detect the presence of an existing cancer, to help identify the type of cancer, to assist a physician in determining the severity or likely course of the cancer and/or to optimise treatment of it .
• One aspect of the invention involves methods for:
• DBCCRl gene is hypermethylated in a sample from patient; and/or,
• nucleic acid samples including the 5 ' end of the DBCCRl gene can be exposed to such enzymes and the resulting fragments analysed to determine the presence and/or amount of methylation at this site, visualising the fragments produced using well known methods such as Southern blotting or PCR and sizing the fragments on a gel .
• the above methods can carried out following the digestion of bisulphite-converted DNA to convert unmethylated cytosine to be converted to uracil.
• the use of bisulphite to treat the DNA means that the uracil from the unmethylated cytosine is replicated as thymine during subsequent PCR.
• methylcytosine is resistant to deamination and is therefore replicated as cytosine during amplification.
• quantitation of the ratio of methylated: unmethylated cytosine (C:T) allows the extent of methylation in a nucleic acid sequence to be determined and correlated to standards, e.g. to diagnose the presence of a tumour or a urothelial condition predisposed to develop cancer.
• the C:T ratio can be determined by incubating the isolated PCR product, primers and Taq polymerase with either [ 32 P] dCTP or P 2 P] dTTP followed by denaturing gel electrophoresis and phosphoimage analysis.
• the PCR product may be subjected to restriction analysis to assess methylation at specific sites or in Ms-SNuPE by annealing specific primers which terminate immediately 5' of the nucleotide to be assessed, followed by primer extension in the presence of [ 32 P] dCTP or
• the present invention also includes method for detecting DBCCRl nucleic acid or polypeptides, in particular mutations in the DBCCRl nucleic acid or polypeptides associated with cancer, the methods including: (a) comparing the sequence of nucleic acid in the sample with the DBCCRl nucleic acid sequence to determine whether the sample from the patient contains mutations; or, (b) determining the presence in a sample from a patient of the polypeptide encoded by the DBCCRl gene and, if present, determining whether the polypeptide is full length, and/or is mutated, and/or is expressed at the normal level; or,
• a specific binding member capable of binding to a DBCCRl nucleic acid sequence (either a normal sequence or a known mutated sequence) , the specific binding member comprising nucleic acid hybridisable with the DBCCRl sequence, or substances comprising an antibody domain with specificity for a native or mutated DBCCRl nucleic acid sequence or the polypeptide encoded by it, the specific binding member being labelled so that binding of the specific binding member to its binding partner is detectable; or,
• DBCCRl gene and to detecting silent mutations as well as mutations changing the amino acid sequence of the DBCCRl polypeptide .
• a “specific binding pair” comprises a specific binding member (sbm) and a binding partner (bp) which have a particular specificity for each other and which in normal conditions bind to each other in preference to other molecules.
• specific binding pairs are antigens and antibodies, molecules and receptors and complementary nucleotide sequences. The skilled person will be able to think of many other examples and they do not need to be listed here. Further, the term “specific binding pair” is also applicable where either or both of the specific binding member and the binding partner comprise a part of a larger molecule.
• the specific binding pair are nucleic acid sequences, they will be of a length to hybridise to each other under the conditions of the assay, preferably greater than 10 nucleotides long, more preferably greater than 15 or 20 nucleotides long.
• the methods can be carried out using biological samples which include blood, plasma, serum, tissue samples, tumour samples, saliva and urine.
• biological samples which include blood, plasma, serum, tissue samples, tumour samples, saliva and urine.
• urine sample in methods for the diagnosis or prognosis of bladder cancer is especially convenient.
• exemplary tests include nucleotide sequencing, hybridization using nucleic acid immobilized on chips, molecular phenotype tests, protein truncation tests (PTT) , single-strand conformation polymorphism (SSCP) tests, mismatch cleavage detection and denaturing gradient gel electrophoresis (DGGE) .
• PTT protein truncation tests
• SSCP single-strand conformation polymorphism
• DGGE denaturing gradient gel electrophoresis
• Tests may be carried out on preparations containing genomic DNA, cDNA and/or mRNA. Testing cDNA or mRNA has the advantage of the complexity of the nucleic acid being reduced by the absence of intron sequences, but the possible disadvantage of extra time and effort being required in making the preparations. RNA is more difficult to manipulate than DNA because of the wide-spread occurrence of RN'ases. Nucleic acid in a test sample may be sequenced and the sequence compared with the sequence shown in figures 6 or 11, to determine whether or not a difference is present. The nucleic acid may also be analysed to determine other differences between the normal gene and that found in cancer patients, e.g. by looking at the extent of methylation of CpG islands at the 5' end of the gene or in the promoter region shown in figure 11.
• a specific amplification reaction such as PCR using one or more pairs of primers may be employed to amplify the region of interest in the nucleic acid, for instance the DBCCRl gene or a particular region in which mutations associated with cancer.
• Exemplary primers for this purpose are shown in table 2.
• the amplified nucleic acid may then be sequenced as above, and/or tested in any other way to determine the presence or absence of a particular feature.
• Nucleic acid for testing may be prepared from nucleic acid removed from cells or in a library using a variety of other techniques such as restriction enzyme digest and electrophoresis.
• Nucleic acid may be screened using a variant- or allele-specific probe.
• a probe corresponds in sequence to a region of the DBCCRl gene, or its complement, containing a sequence alteration known to be associated with cancer.
• specific hybridisation of such a probe to test nucleic acid is indicative of the presence of the sequence alteration in the test nucleic acid.
• more than one probe may be used on the same test sample.
• Allele- or variant-specific oligonucleotides may similarly be used in PCR to specifically amplify particular sequences if present in a test sample.
• Assessment of whether a PCR band contains a gene variant may be carried out in a number of ways familiar to those skilled in the art .
• the PCR product may for instance be treated in a way that enables one to display the mutation or polymorphism on a denaturing polyacrylamide DNA sequencing gel, with specific bands that are linked to the gene variants being selected .
• An alternative or supplement to looking for the presence of variant sequences in a test sample is to look for the presence of the normal sequence, e.g. using a suitably specific oligonucleotide probe or primer.
• an oligonucleotide probe will hybridise with a sequence which is not entirely complementary.
• the degree of base-pairing between the two molecules will be sufficient for them to anneal despite a mis -match.
• Various approaches are well known in the art for detecting the presence of a mis-match between two annealing nucleic acid molecules.
• RN'ase A cleaves at the site of a mismatch. Cleavage can be detected by electrophoresing test nucleic acid to which the relevant probe or probe has annealed and looking for smaller molecules (i.e. molecules with higher electrophoretic mobility) than the full length probe/test hybrid.
• Other approaches rely on the use of enzymes such as resolvases or endonucleases .
• the presence of differences in sequence of nucleic acid molecules may be detected by means of restriction enzyme digestion, such as in a method of DNA fingerprinting where the restriction pattern produced when one or more restriction enzymes are used to cut a sample of nucleic acid is compared with the pattern obtained when a sample containing the normal gene or a variant or allele is digested with the same enzyme or enzymes.
• the presence of absence of a lesion in a promoter or other regulatory sequence may also be assessed by determining the level of mRNA production by transcription or the level of polypeptide production by translation from the mRNA.
• a test sample of nucleic acid may be provided for example by extracting nucleic acid from cells, e.g. in saliva or preferably blood, or for pre-natal testing from the amnion, placenta or foetus itself.
• a sample may be tested for the presence of a binding partner for a specific binding member such as an antibody (or mixture of antibodies) , specific for one or more particular variants of the polypeptide shown in figure 6.
• a binding partner for a specific binding member such as an antibody (or mixture of antibodies) , specific for one or more particular variants of the polypeptide shown in figure 6.
• a sample may be tested for the presence of a binding partner for a specific binding member such as an antibody
• the sample may be tested by being contacted with a specific binding member such as an antibody under appropriate conditions for specific binding, before binding is determined, for instance using a reporter system as discussed.
• a specific binding member such as an antibody under appropriate conditions for specific binding
• different reporting labels may be employed for each antibody so that binding of each can be determined.
• a specific binding member such as an antibody may be used to isolate and/or purify its binding partner polypeptide from a test sample, to allow for sequence and/or biochemical analysis of the polypeptide to determine whether it has the sequence and/or properties of the polypeptide whose sequence is shown in figure 6, or if it is a mutant or variant form.
• Amino acid sequence is routine in the art using automated sequencing machines.
• the DBCCRl polypeptides, antibodies, peptides and nucleic acid of the invention can be formulated in pharmaceutical compositions.
• These compositions may comprise, in addition to one of the above substances, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
• a pharmaceutically acceptable excipient e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
• compositions for oral administration may be in tablet, capsule, powder or liquid form.
• a tablet may include a solid carrier such as gelatin or an adjuvant.
• Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.
• the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability.
• a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability.
• isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, Lactated Ringer's Injection.
• Preservatives, stabilisers, buffers, antioxidants and/or other additives may be included, as required.
• administration is preferably in a "prophylactically effective amount” or a "therapeutically effective amount” (as the case may be, although prophylaxis may be considered therapy) , this being sufficient to show benefit to the individual.
• a prophylaxis may be considered therapy
• the actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g. decisions on dosage etc, is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners.
• targeting therapies may be used to deliver the active agent more specifically to certain types of cell, by the use of targeting systems such as antibody or cell specific ligands. Targeting may be desirable for a variety of reasons; for example if the agent is unacceptably toxic, or if it would otherwise require too high a dosage, or if it would not otherwise be able to enter the target cells.
• these agents could be produced in the target cells by expression from an encoding gene introduced into the cells, eg in a viral vector (a variant of the VDEPT technique - see below) .
• the vector could be targeted to the specific cells to be treated, or it could contain regulatory elements which are switched on more or less selectively by the target cells.
• the agent could be administered in a precursor form, for conversion to the active form by an activating agent produced in, or targeted to, the cells to be treated.
• an activating agent produced in, or targeted to, the cells to be treated.
• This type of approach is sometimes known as ADEPT or VDEPT; the former involving targeting the activating agent to the cells by conjugation to a cell- specific antibody, while the latter involves producing the activating agent, eg an enzyme, in a vector by expression from encoding DNA in a viral vector (see for example, EP-A- 415731 and WO 90/07936) .
• a composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
• Methods of Gene Therapy are described below.
• the nucleic acid encoded the authentic biologically active DBCCRl polypeptide could be used in a method of gene therapy, to treat a patient who is unable to synthesize the active polypeptide or unable to synthesize it at the normal level, thereby providing the tumour suppressing or growth inhibiting effect provided by wild-type DBCCRl, and thereby suppressing the occurrence of cancer and/or reduce the size or extent of existing cancer in the target cells.
• Vectors such as viral vectors have been used in the prior art to introduce genes into a wide variety of different target cells. Typically the vectors are exposed to the target cells so that transfection can take place in a sufficient proportion of the cells to provide a useful therapeutic or prophylactic effect from the expression of the desired polypeptide.
• the transfected nucleic acid may be permanently incorporated into the genome of each of the targeted tumour cells, providing long lasting effect, or alternatively the treatment may have to be repeated periodically.
• viral vectors both viral vectors and plasmid vectors
• a number of viruses have been used as gene transfer vectors, including papovaviruses, such as SV40, vaccinia virus, herpesviruses, including HSV and EBV, and retroviruses .
• papovaviruses such as SV40
• vaccinia virus such as SV40
• herpesviruses including HSV and EBV
• retroviruses include vaccinia virus
• Many gene therapy protocols in the prior art have used disabled murine retroviruses .
• viral vectors other known methods of introducing nucleic acid into cells includes electroporation, calcium phosphate co- precipitation, mechanical techniques such . as microinjection, transfer mediated by liposomes and direct DNA uptake and receptor-mediated DNA transfer.
• the aim of gene therapy using nucleic acid encoding the DBCCRl polypeptide, or an active portion thereof is to increase the amount of the expression product of the nucleic acid in cells in which the level of the wild-type DBCCRl polypeptide is absent or present only at reduced levels.
• Such treatment may be therapeutic in the treatment of cells which are already cancerous .
• Gene transfer techniques which selectively target the DBCCRl nucleic acid to bladder cells are preferred. Examples of this included receptor-mediated gene transfer, in which the nucleic acid is linked to a protein ligand via polylysine, with the ligand being specific for a receptor present on the surface of the target cells.
• a polypeptide according to the present invention may be used in screening for molecules which affect or modulate its activity or function. Such molecules may be useful in a therapeutic (possibly including prophylactic) context.
• a method of screening for a substance which modulates activity of a polypeptide may include contacting one or more test substances with the polypeptide in a suitable reaction medium, testing the activity of the treated polypeptide and comparing that activity with the activity of the polypeptide in comparable reaction medium untreated with the test substance or substances. A difference in activity between the treated and untreated polypeptides is indicative of a modulating effect of the relevant test substance or substances.
• Combinatorial library technology provides an efficient way of testing a potentially vast number of different substances for ability to modulate activity of a polypeptide.
• Such libraries and their use are known in the art.
• the use of peptide libraries is preferred.
• test substances Prior to or as well as being screened for modulation of activity, test substances may be screened for ability to interact with the polypeptide, e.g. in a yeast two-hybrid system (which requires that both the polypeptide and the test substance can be expressed in yeast from encoding nucleic acid) .
• This may be used as a coarse screen prior to testing a substance for actual ability to modulate activity of the polypeptide.
• the screen could be used to screen test substances for binding to a DBCCRl specific binding partner, to find mimetics of the
• DBCCRl polypeptide e.g. for testing as cancer therapeutics .
• the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals.
• the present invention extends in various aspects not only to a substance identified using a nucleic acid molecule as a modulator of polypeptide activity, in accordance with what is disclosed herein, but also a pharmaceutical composition, medicament, drug or other composition comprising such a substance, a method comprising administration of such a composition to a patient, e.g. for treatment (which may include preventative treatment) of cancer, use of such a substance in manufacture of a composition for administration, e.g. for treatment of cancer, and a method of making a pharmaceutical composition comprising admixing such a substance with a pharmaceutically acceptable excipient, vehicle or carrier, and optionally other ingredients.
• a substance identified using as a modulator of polypeptide function may be peptide or non-peptide in nature.
• Non-peptide "small molecules" are often preferred for many in vivo pharmaceutical uses. Accordingly, a mimetic or mimic of the substance (particularly if a peptide) may be designed for pharmaceutical use.
• the designing of mimetics to a known pharmaceutically active compound is a known approach to the development of pharmaceuticals based on a "lead" compound. This might be desirable where the active compound is difficult or expensive to synthesise or where it is unsuitable for a particular method of administration, e.g. peptides are unsuitable active agents for oral compositions as they tend to be quickly degraded by proteases in the alimentary canal.
• Mimetic design, synthesis and testing is generally used to avoid randomly screening large number of molecules for a target property.
• a mimetic from a compound having a given target property There are several steps commonly taken in the design of a mimetic from a compound having a given target property. Firstly, the particular parts of the compound that are critical and/or important in determining the target property are determined. In the case of a peptide, this can be done by systematically varying the amino acid residues in the peptide, e.g. by substituting each residue in turn. Alanine scans of peptide are commonly used to refine such peptide motifs. These parts or residues constituting the active region of the compound are known as its "pharmacophore" .
• the pharmacophore Once the pharmacophore has been found, its structure is modelled to according its physical properties, eg stereochemistry, bonding, size and/or charge, using data from a range of sources, eg spectroscopic techniques, X-ray diffraction data and NMR. Computational analysis, similarity mapping (which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms) and other techniques can be used in this modelling process. In a variant of this approach, the three-dimensional structure of the ligand and its binding partner are modelled. This can be especially useful where the ligand and/or binding partner change conformation on binding, allowing the model to take account of this in the design of the mimetic.
• a template molecule is then selected onto which chemical groups which mimic the pharmacophore can be grafted.
• the template molecule and the chemical groups grafted on to it can conveniently be selected so that the mimetic is easy to synthesise, is likely to be pharmacologically acceptable, and does not degrade in vivo, while retaining the biological activity of the lead compound.
• the mimetic is peptide based
• further stability can be achieved by cyclising the peptide, increasing its rigidity.
• the mimetic or mimetics found by this approach can then be screened to see whether they have the target property, or to what extent they exhibit it . Further optimisation or modification can then be carried out to arrive at one or more final mimetics for in vivo or clinical testing.
• the present invention also provides the use of all or part of the nucleic acid sequence of the DBCRR1 promoter region set out in figure 11 in methods of screening for substances which modulate the activity of the promoter and increase or decrease the level of DBCCRl expression.
• Promoter activity is used to refer to ability to initiate transcription.
• the level of promoter activity is quantifiable for instance by assessment of the amount of mRNA produced by transcription from the promoter or by assessment of the amount of protein product produced by translation of mRNA produced by transcription from the promoter.
• the amount of a specific mRNA present in an expression system may be determined for example using specific oligonucleotides which are able to hybridise with the mRNA and which are labelled or may be used in a specific amplification reaction such as the polymerase chain reaction.
• Use of a reporter gene facilitates determination of promoter activity by reference to protein production.
• nucleic acid construct comprising a DBCCRl promoter region set out in figure 11 or a fragment thereof able to promote transcription, operably linked to a heterologous gene, e.g. a coding sequence.
• a heterologous gene e.g. a coding sequence.
• a "heterologous” or “exogenous” gene is generally not a modified form of DBCCRl Generally, the gene may be transcribed into mRNA which may be translated into a peptide or polypeptide product which may be detected and preferably quan itated following expression.
• a gene whose encoded product may be assayed following expression is termed a "reporter gene", i.e. a gene which "reports" on promoter activity.
• the reporter gene preferably encodes an enzyme which catalyses a reaction which produces a detectable signal, preferably a visually detectable signal, such as a coloured product.
• a detectable signal preferably a visually detectable signal
• Many examples are known, including ⁇ - galactosidase and luciferase.
• 3-galactosidase activity may be assayed by production of blue colour on substrate, the assay being by eye or by use of a spectrophotometer to measure absorbance. Fluorescence, for example that produced as a result of luciferase activity, may be quantitated using a spectrophotometer.
• Radioactive assays may be used, for instance using chloramphenicol acetyltransferase, which may also be used in non- radioactive assays.
• the presence and/or amount of gene product resulting from expression from the reporter gene may be determined using a molecule able to bind the product, such as an antibody or fragment thereof.
• nucleic acid constructs comprising a promoter (as disclosed herein) and a heterologous gene (reporter) may be employed in screening for a substance able to modulate activity of the promoter.
• a substance able to up-regulate expression of the promoter directing the expression of DBCCRl may be sought.
• a method of screening for ability of a substance to modulate activity of a promoter may comprise contacting an expression system, such as a host cell, containing a nucleic acid construct as herein disclosed with a test or candidate substance and determining expression of the heterologous gene.
• the level of expression in the presence of the test substance may be compared with the level of expression in the absence of the test substance.
• a difference in expression in the presence of the test substance indicates ability of the substance to modulate gene expression.
• An increase in expression of the heterologous gene compared with expression of another gene not linked to a promoter as disclosed herein indicates specificity of the substance for modulation of the promoter.
• a promoter construct may be introduced into a cell line using any technique previously described to produce a stable cell line containing the reporter construct integrated into the genome.
• the cells may be grown and incubated with test compounds for varying times.
• the cells may be grown in 96 well plates to facilitate the analysis of large numbers of compounds.
• the cells may then be washed and the reporter gene expression analysed. For some reporters, such as luciferase the cells will be lysed then analysed.
• the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals.
• Specimens of 145 TCCs of the bladder and 9 TCCs of the ureter or renal pelvis were obtained with paired blood or normal kidney samples as a source of constitutional normal DNA.
• DNA from tumour specimens and corresponding normal tissues were obtained by proteinase K digestion followed by phenol/chloroform extraction. Adjacent portions of each tumour specimen were subjected to histopathological examination. Tumour stage and grade were classified according to the TNM system and the WHO criteria, respectively.
• PCR reactions consisted of 26-27 cycles of 1 min at 95°C, 1 min at 55°C, and 1.5 min at 72 °C followed by a final elongation.
• Reaction products were diluted with formamide dye, heat- denatured, and run in 6 % denaturing polyacrylamide gels. Gels were dried and exposed to Fuji XR film and subsequently to a Phosphorlmager screen (Molecular Dynamics) .
• Phosphorlmager screen Molecular Dynamics
• LOH was screened visually for loss of one allele, and cases with 'partial loss' or 'allelic imbalance' were further analysed by the Phosphorlmager using the ImageQuant software (Molecular Dynamics) .
• a relative decrease in the intensity of the signal from one tumour allele of more than 40% was scored as LOH. Loci at which new alleles were detected (microsatellite alterations) were considered to be 'not informative'.
• Typical running conditions were as follows: 60 second pulse time for 15 hours followed by a 90 second pulse time for 9 hours at 200 volts in 0.5 TBE buffer at 14°C. After ethidium bromide staining, gels were blotted onto nylon membranes (Hybond N+, Amersham) using 0.4N NaOH as transfer buffer and each blot was hybridised with total human DNA 32 P-labelled by random priming.
• the size of each YAC was evaluated by using Saccharomyces cerevisae (strain YNN295, BioRad) chromosome and mutimers of lambda-phage (BioRad) as size markers. The size of all CEPH YACs shown in figure 2 was consistent with CEPH data (http://www.ceph.fr/).
• STSs sequence-tagged sites
• STSs from YAC insert ends were generated using the modified vectorette-PCR procedure as described by Riley et al and direct DNA sequencing of PCR fragments.
• YAC DNA was digested with Rsal , Alul , or PvuII, and then ligated with the blunt-end vectorette cassette as described in Riley et al (1990) .
• PCR was performed with 224 primer and a primer 5 ' -CTACTTGGAGCCACTATCGACTACGCGATC to isolate the left arm of each YAC and with 224 primer and a primer 5 ' -CTTGCAAGTCTGGGAAGTGAATGGAGACAT to isolate the right arm.
• the resulting PCR products were electrophoresed in agarose gels and amplified fragments of appropriate size were recovered and used as sequencing templates.
• Direct sequencing was performed using internal primers 1207 and 368 (Riley et al , 1990) for the left YAC-end fragments and 1208 and 368 for the right YAC-end fragment using a cycle sequencing kit (fmol sequencing system, Promega) .
• Oligonucleotides which can amplify a 81 to 190 bp PCR fragment from each YAC-end sequence were generated (Table 1) .
• the presence or absence of these STSs in each YAC clone was tested at least twice by PCR amplification and agarose gel electrophoresis.
• DNA from a hybrid cell line GM10611 containing an intact human chromosome 9 in a Chinese hamster background and original YAC clone DNAs were used as positive control templates and normal hamster fibroblast DNA as a negative control template.
• a YAC contig map was constructed by PCR based analyses. PCR reactions were performed with 20 ng of YAC DNA or yeast cell pellets washed with 1 x TE in 25 ⁇ l reaction volumes using 1 unit of Taq polymerase with 200 ⁇ M concentrations of each dNTP and 1.0 to 1.5 mM of MgCl 2 . PCR reactions were routinely carried using a 'hot-start', in which Taq polymerase was added to the reaction after a 5 minutes denaturing step at 95°C. Thirty to 35 amplification cycles with 95°C for 60s, 50 to 55°C for 60s, and 72°C for 90s were performed.
• URLs Uniform resource locators
• RACE 5' RACE was performed to characterize the 5' sequence of the IB3089A gene using a human fetal brain Clontech Marathon cDNA amplification kit according to the manufacture's protocol (Clontech).
• RACE-PCR was carried out with a primer 5' -CTTCTCTTGCAGATACTGAGGA (nt 1141-1119) and a primer API, which was provided in the kit.
• the product was electrophoresed on agarose gel, alkali-blotted onto the nylon membrane, and probed with a oligonucleotide probe 5'- GGTAGGTCTCCTGCCAAGCA end-labelled with 32 P.
• a corresponding positive PCR band was excised from agarose gel and cloned into a pGEM-T vector using a pGEM-T kit (Promega) .
• the 5' ends of 8 clones were sequenced using the API primer or pGEM-T vector specific primers.
• Data base searches were carried out using the GCG software package and the BLAST search service from the UK Human Genome Mapping Project Resource Centre.
• Exon-intron boundaries and their sequence were determined by the vectorette-PCR method as described (Riley et al . , 1990). Briefly, high-molecular-weight DNA of YAC clone 9DC8 was digested with Alul, Hpall, Rsal, PvuII, or EcoRV and ligated with a blunt end vectorette cassette as described (Riley, et al . , 1990). Using these 5 vectorette libraries as templates, PCRs were performed with a vectorette-cassette specific primer '224' (Riley, et al . ,
• Obtained sequences were compared with the cDNA sequence and primers were made to amplify each exon-containing genomic fragment. For some exon-intron boundaries, another round of vectorette-PCR was performed using these new primers.
• tumours Forty primary TCCs of the bladder, which showed loss of heterozygosity on 9q, including 9q32-33 were screened for mutation. These tumours included the 5 tumours with localised LOH at 9q32-33 described previously. All these tumour DNA specimens were proved not to have substantial normal cell contamination because clear loss of one allele was detected in the previous LOH analysis (Habuchi et al . ,
• Tumour DNA and corresponding normal peripheral blood or kidney DNA were extracted with a standard method
• tumour DNA was amplified using unlabelled primers (10 ⁇ M) in 12.5 ⁇ l containing 200 ⁇ M of dATP, dGTP and dTTP, 4 ⁇ M of dCTP, 1 unit of Taq polymerase (Life Technologies), 0.1 ⁇ l of [alpha-32P] dCTP and 1.2-1.5 mM MgCl 2 .
• PCR conditions were 95°C for 4 min, 5 cycles of 95°C for 60 s, 60°C for 60s, and 72°C for 90 s, followed by 25 cycles of 95°C for 60 s, 55°C for 60 s, and 72°C for 90.
• exon 2 exon 8c and exon 8d
• PCR products were treated with restriction enzymes to give appropriate size for the SSCP analysis (Table 3).
• PCR products were diluted 1:1 with denaturing dye containing formamide, denatured at 90 °C for 3 min, and 2 ⁇ l of each sample was loaded on gels. Three gels with different conditions were run at room temperature for 16 hours with 3-10 W constant power.
• the three gel formulations were the following: 6 % acrylamide (29:1 cross linking of acrylamide to bis-cryamide) with or without 5% glycerol in 0.5X TBE buffer and 0.5x MDETM (FMC) in 0.6X TBE buffer.
• the gels were dried and exposed to X- ray film for 1-16 hours.
• PCR products were gel purified using low-melting agarose gel and sequenced on both strand with PCR primers using the fmol Sequencing System (Promega) .
• paired normal DNA and tumour DNA were analysed. Of these 46 samples, 22 samples were also tested by SSCP analysis for subtle mutation as described above. 10 ⁇ g of paired normal DNA and tumour DNA were digested overnight with TaqI or BamHI (New England Biolab) and transferred to nylon membranes (Hybond-N+, Amersham) using 0.4N NaOH as transfer buffer. About 3.1 kb insert of clone ICRFp507K12270 was excised by EcoRI and NotI double digestion, and the resulting 2 fragments were used as a probe.
• the filters were hybridized overnight with the probe labelled with 32P by the random primer method at 65°C in buffer containing 5X SSPE (Sambrook et al . , 1989). The final washing condition was 0.2X SSC, 0.2% SDS at 65°C. Each blot was re-probed with jS-actin probe or D9S7 probe for loading control of each sample.
• human multiple tissue northern blots were purchased (Clontech) and hybridized with the 32 P labelled probe as mentioned above using the manufacturer's recommended protocol.
• RNA from 5 bladder cancer cell lines was extracted using ⁇ Total RNA Isolation Reagent' (Advanced Biotechnologies) and poly (A) + RNA was then purified using oligo-dT Dynabeads (DYNAL) .
• Poly (A) + RNA was fractionated and blotted onto a nylon membrane (Hybond-N, Amersham) with a standard method
• transitional cell carcinoma cell lines T24, SW1710, 5637, RT4 , RT112, 253J, J82, UM-UC-3, 609CR
• SCaBER bladder squamous cell carcinoma cell line
• Histologically normal urothelial tissues from bladder and ureter were obtained from 2 non-bladder cancer patients and dissected under the microscope.
• Total RNA from the 10 cell lines and normal urothelium of the bladder or ureter was prepared using 'Total RNA Isolation Reagent' (Advanced Biotechnologies) .
• the GAPDH (glyceraldehyde 3 -phosphate dehydrogenase) RT-PCR is used as a control for RNA quality and reverse transriptase reaction.
• RNA quality and reverse transriptase reaction Approximately 2 ⁇ g of total RNA was reverse transcribed with a oligo-dT primer using a kit (Superscript Preamplification System, Life Technologies) according to the manufacturer's protocol.
• Generated cDNA was diluted with TE (pH 8.0) and cDNA equivalent to 100 ng or 25 ng of total RNA was used as a template for IB3089A or GAPDH in 25 ⁇ l reaction volume.
• the primers for IB3089A were designed in exon 7 and exon 8, giving a 232 bp fragment from cDNA template.
• Conditions for IB3089A RT-PCR were 95°C for 4 min, 10 cycles of 95°C for 60 sec, 60°C for 60 sec and 72°C for 90 sec, and then 25 cycles of 95°C for 60 sec, 55°C for 60 sec and 72 °C for 90 sec, followed by incubation at 72°C for 5 min in lx Taq polymerase buffer (Life Technologies) with 1.2 mM MgCl 2 , 200 ⁇ M dNTPs and 2 unit Taq polymerase (Life Technologies) .
• Primers for the GAPDH gene were also designed to flank multiple introns giving a 455 bp fragment.
• CTCTAGGCAGCTGGTGGTTG (IB3089A, nt 1559-1539) and 5'-
• genomic DNA was isolated from TCC cells (609CR, 5637, 353J, SW1710 and T24) and 10 primary TCC specimens by a standard procedure (Sambrook et al . , 1989). Ten ⁇ g total genomic DNA was subjected to restriction enzyme digestion with BssHII (100 unit) followed by BamHI (100 unit) or PvuII (100 unit) for 16 hrs under conditions specified by the manufacturer (New England Biolabs) . Digests were size fractionated on a 1.2 % agarose gel, transferred onto a nylon membrane (Hybond- N+, Amersham) using 0.4N NaOH.
• Membranes were hybridized at 65°C in buffer containing 5x SSPE with a IB3089A 5' region probe labelled with 32P-dCTP by the random primer method.
• the 5' probe was prepared by PCR amplification of a 312 bp cDNA fragment (nt 57-368) using clone ICRFp507K12270 as a template.
• the probe was labelled by incorporation of 32 P-dCTP during a second PCR without cold' dCTP using the purified 312 bp PCR fragment as a template.
• the final washing condition of the filters was 0.2x SCC, 0.2% SDS at 65°C.
• the DBCCRl gene was inserted into an expression vector under the control of a stong heterologous promoter, with the gene linked to a small epitope tag HA to facilitate antibody detection. This construct was used to transfect mouse 3T3 cells and 2 human bladder tumour cells lines that do not express endogenous DBCCRl (cell lines 5637 and EJ) . The expression of the DBCCRl gene and immunohistochemistry of the DBCCRl polypeptide was then determined.
• the results above show that one of candidate tumour suppressor loci on 9q is localized at 9q32-33 and that the critical candidate region is between D9S1848 and AFMA239XA9 (Fig. 5) .
• the candidate region is encompassed by a single CEPH YAC 852ell, whose size is estimated to be 840 kb.
• ESTs expressed sequence tags
• the Whitehead Institute/MIT center for Genome Research data base suggests that one EST, named IB3089 (GeneBank: T16063) , is positive in YAC 852ell.
• IB3089 represents a good candidate gene.
• the DNA sequence of IB3089 (317 nucleotides) was used to search the GeneBank and dbEST databases using the BLAST search program (Altschul et al . , 1990) .
• the cDNA sequence of the IB3089A gene consists of 3,158 base pairs and defines a single long 2,283 nucleotide open reading frame of 761- amino acids with a calculated molecular weight of 88,689.
• the putative translation initiation site is at nucleotide 419 and the sequence surrounding the site conforms to Kozak rules (Kozak, 1987; Kozak, 1991) .
• the sequence 5' to the proposed initiation methionine has stop codons in all three open reading frames.
• the result indicates that the IB3089A gene is conserved between human and rodents.
• a search of the predicted IB3089A protein with the SwissProt, the ProDom (release ProDom33) (Sonnhammer and Kahn, 1994) and the SBASE (Pongor et al . , 1994) databases using the BLAST algorithm revealed no significant homology with known amino acid sequences or domains. Searching the PROSITE database
• Genomic structure of IB3089A and mutation analysis in primary TCCs The nearly full-length insert of the clone ICRFp507K12270 was hybridized with blotted YAC (852ell, 9DC8 and 15HD1) DNAs digested with BamHI. This sequence hybridized with 852ell, 9DC8 and 15HD1. Since the EST IB3089, which represents the 3' end of the IB3089A is located between 9DC8-R and 814c5-L, the 5' end of the gene is considered to be located telomeric to the 3' end (Fig. 5) . This result was confirmed by hybridization with a specific 5' probe (nt 56-368) which was later used for methylation analysis.
• tumours included the 5 tumours with localised deletion at 9q32-33 described previously above. Although several variant bands were detected, all these variant bands were considered to be normal sequence polymorphisms by subsequent sequence analysis of both normal (peripheral blood) DNA and tumour DNA.
• the polymorphisms identified were T1036C (Ser to Ser) in 9/40 (22.5%) cases, C2044A (lie to lie) in 1/40 (2.5%) cases and T2642C (Leu to Leu) in 1/40 (2.5%) cases.
• Homozygous deletion of the DBCCRl gene in a bladder tumour More recently, we have identified a bladder tumour which shows deletion of both alleles in the region of DBCCRl. To detect homozygous deletion, we carried out duplex PCR using primers for loci in the critical region of deletion and primers for a locus on 8p which showed no LOH in the tumour concerned. Using restricted numbers of PCR cycles, homozygous deletion was identified as a faint signal showing apparent retention of heterozygosity compared with a strong signal from the control primers and from markers in the region which retained one allele. Using this approach (Williamson et al , 1995), we mapped the region of homozygous deletion to the interval between D9S275 and D9S258. Homozygous deletions are strongly indicative that a tumour suppressor gene is nearby and since our work has identified no gene other than DBCCRl within this region of homozygous deletion, this provides additional evidence that DBCCRl is the critical gene.
• IB3089A in Normal Tissues and Bladder Cancer Cells.
• Northern blot analysis using mRNAs from a variety of different normal human tissues detected a single major band corresponding to 3.0-3.5 kb in size in multiple tissues (heart, brain, lung, skeletal muscle, kidney, thymus, prostate, testis, small intestine) (Fig. 7) .
• Significantly high expression was detected in brain tissue and a minor 8.5 kb mRNA was observed along with the dominant 3.0-3.5 kb band (Fig. 7) . Since the size of the major band corresponds to the 3.2 kb IB3089A cDNA sequence presented herein (Fig.
• the cDNA sequence is considered to be full length.
• the minor 8.5 kb signal in brain might come from a different gene with similar sequence or alternatively spliced mRNA or the use of an alternative promoter or an alternative polyadenylation site.
• Exon 1 contains a single BssHII site (nt 37-42, Fig. 6), which is also a characteristic of the CpG island (Lindsay and Bird, 1987) .
• the methylation status of the 2 BssHII sites did not correlate absolutely with the expression level of IB3089A, since the sites are almost unmethylated non-expressing cell line 5637 and both sites were methylated in the expressing cell line 253J.
• Three of 10 (30%) primary TCCs showed obvious hypermethylation of these sites with the retention of the 1.7 kb band and the presence of 1.0 kb and 1.3 kb bands, and another tumour showed weak bands with 1.0 kb and 1.3 kb in size (Fig. 9B) .
• the 1.0 kb aand 1.3 kb bands were faintly visualized in all normal cells (Fig.
• IB3089A de novo expression could be obtained by culturing the non-expressing cell lines, T24, 609CR and 5637, in the presence of methylation inhibitor 5-aza-2 ' -deoxycytidine . Induction of IB3089A expression was observed in all three cell lines after a 4 day exposure to the drug (Fig. 10) . Thus, demethylation was considered to be sufficient to relax the silencing of the IB3089A expression. This result further supports the involvement of hypermethylation-associated silencing of the gene.
• a cosmid clone 50A8 containing DBCCRl was identified by screening the chromosome 9 cosmid library LL09NC01P with a probe derived from the left arm of YAC 9DC8.
• the promoter sequence of DBCCRl was determined by sequencing the cosmid directly upstream of the transcription start site, initially using an antisense primer derived from the cDNA sequence and subsequently using primers derived from the new sequence. This promoter sequence of 1632bp is shown in figure 11.
• tumour suppressor located on 9q32-33 sometimes occurs in these low grade superficial tumours without inactivation of other tumour suppressors on chromosome 9.
• this is likely to be a rare event since LOH at all loci on chromosome 9 or monosomy 9 is frequently found even in low grade low stage TCCs.
• the identification of all relevant tumour suppressor (s) on chromosome 9, including the gene identified in this application, will be required to define the roles of partial or total hemizygous loss of chromosome 9 in the genesis and progression of TCC.
• LOH involving 9q has been reported in other types of human cancer, including squamous cell carcinoma of the head and neck (Ah-See et al , 1994) , squamous cell carcinoma of the skin (Quinn et al , 1994) , ovarian cancer (Schultz et al, 1995, Devlin et al, 1996) , renal cell carcinoma (Cairns et al, 1995) and oesophageal cancer (Miura et al , 1995).
• the localised deleted regions reported in these other cancers encompass the region at 9q32-33 described here.
• telomeric to HXB and telomeric to D9S127 at 9q22.1-32 were reported in renal cell carcinoma and head and neck squamous cell carcinoma, respectively (Ah-See et al, Cairns et al) .
• the present inventors have also identified a novel gene, IB3089A, located within the candidate tumour suppressor region at 9q32-33 defined above. Since LOH encompassing at 9q32-33 is detected in approximately 60% of TCC, somatic alteration or mutation leading to the inactivation of the gene product might be expected in a considerable proportion of TCCs if the gene is a target for LOH at this locus. To date, several tumour suppressor genes have been identified by means of positional cloning and have been shown to be mutated or homozygously deleted in certain percentage of various tumours. However, we could not detect any somatic mutation by SSCP analysis in 40 primary TCCs with LOH at 9q32-33.
• the discrepancy between the IB3089A expression status and the 2 BssHII methylation status in bladder cancer cell lines indicates that hypermethylation of CpG site(s) other than these 2 BssHII sites might be crucial for repression of expression.
• the promoter sequence now determined contains many CpG dinucleotides which may be methylated and show a more clear cut association with expression.
• IB3089A is predominantly expressed in the adult brain and all the ESTs or cDNA clones corresponding the IB3089A originated from fetal or infant brain or adult retina cDNA libraries, one of the its main function may be important in neuronal activities.
• DCC colorectal tumour suppressor DCC
• the IB3089A protein might have an important function in both neuronal cells and non-neuronal cells.
• IB3089A a novel gene, in a bladder cancer-tumour suppressor region at 9q32-33.
• Expression of IB3089A was frequently down regulated in bladder cancer cells in vitro and thus can be reversed by treatment with a demethylating agent.
• Our results indicate that downregulation of IB3089A expression in bladder caner cells lines and bladder tumours is due to hypermethylation of the 5' region of the gene.
• Keino-Masu, K. Masu, M. , Hinck, L., Leonardo, E. D., Chan, S. S.-Y., Culotti, J. G., Tessier-Lavigne, M. (1997) .
• Deleted in colorectal cancer (DCC) encodes a netrin receptor. Cell 87: 175-185.
• pl6(CDKN2) is a major deletion target at 9p21 in bladder cancer.
• IB 1 -L 1 CCATGGTTTGAACTGCAGTGTA
• IB1-R 1 TTGACTGGAGAGCTAGTTTGCC
• Intron sequences and exon sequences are shown in lower case letters and upper case letters, respectively.
• exon 2 and exon 8D-SSCP analyses PCR fragments were digested with Mspl (exon 2 and exon 8D) or Hincfl " (exon 8C) before gel-electrophoresis. The smallest fragment in exon 2 and exon 8D (indicated by *) is located in non-coding regions.

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• General Chemical & Material Sciences (AREA)
• Pharmacology & Pharmacy (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Animal Behavior & Ethology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Engineering & Computer Science (AREA)
• Urology & Nephrology (AREA)
• Gastroenterology & Hepatology (AREA)
• Reproductive Health (AREA)
• Toxicology (AREA)
• Zoology (AREA)
• Endocrinology (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Genetics & Genomics (AREA)
• Molecular Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Dermatology (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Priority Applications (4)

Applications Claiming Priority (2)

Publications (2)

Family

ID=10813172

Family Applications (1)

Country Status (6)

Cited By (7)

Families Citing this family (8)

Citations (1)

• 1997
  • 1997-05-28 GB GBGB9710995.3A patent/GB9710995D0/en active Pending
• 1998
  • 1998-05-26 EP EP98922966A patent/EP0983355A1/en not_active Withdrawn
  • 1998-05-26 WO PCT/GB1998/001515 patent/WO1998054318A1/en active IP Right Grant
  • 1998-05-26 JP JP50036199A patent/JP2002511749A/ja active Pending
  • 1998-05-26 CA CA002288235A patent/CA2288235A1/en not_active Abandoned
  • 1998-05-26 AU AU75425/98A patent/AU752701B2/en not_active Ceased

Patent Citations (1)

Non-Patent Citations (12)

Also Published As

Similar Documents

Legal Events