WO1998035048A2 - Engineered protein kinases which can utilize modified nucleotide triphosphate substrates - Google Patents
Engineered protein kinases which can utilize modified nucleotide triphosphate substrates Download PDFInfo
- Publication number
- WO1998035048A2 WO1998035048A2 PCT/US1998/002522 US9802522W WO9835048A2 WO 1998035048 A2 WO1998035048 A2 WO 1998035048A2 US 9802522 W US9802522 W US 9802522W WO 9835048 A2 WO9835048 A2 WO 9835048A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- substrate
- mutant
- orthogonal
- kinase
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
- G01N33/5026—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on cell morphology
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
- G01N33/5041—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving analysis of members of signalling pathways
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5091—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing the pathological state of an organism
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/23—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a GST-tag
Definitions
- the present invention is in the field of biotechnology. More specifically, the invention is in a field often referred to as enzyme engineering, in which through genetic alterations or other means, the amino acid sequences of enzymes of interest are changed in order to alter or improve their catalytic properties.
- enzyme engineering in which through genetic alterations or other means, the amino acid sequences of enzymes of interest are changed in order to alter or improve their catalytic properties.
- the embodiments of the invention which are described below involve methods in the fields of genetic engineering and enzymology, and more particularly, to the design of protein kinases and other multi-substrate enzymes, including inhibitable such enzymes, and to related materials, techniques and uses.
- the intracellular signals used are molecules called "ligands," and a given ligand can bind to a particular type of receptor on the surface of those cells that are to receive that signal. But this simple ligand binding alone is not enough to provide for the complex responses that the receiving cells may need to make. Cells therefore amplify and add complexity to this signal through complex, often cascading mechanisms leading to the rapid modulation of catalytic activities inside the cell, which in turn can produce complex, and sometimes dramatic, intracellular responses.
- Signal transduction This process as a whole, from initial ligand binding to completion of the intracellular response, is called “signal transduction.”
- Signal transduction is often accomplished by the activation of intracellular enzymes that can act upon other enzymes and change their catalytic activity. This may lead to increases or decreases in the activity certain metabolic pathways, or may lead to even large intracellular changes, for example, the initiation of specific patterns of gene expression. The ability of one enzyme to alter the activity of other enzymes generally indicates that the enzyme is involved in cellular signal transduction.
- kinases The most common covalent modification used in signal transduction process is phosphorylation, which results in the alteration of the activity of those enzymes which become phosphorylated. This phosphorylation is catalyzed by enzymes known as protein kinases, which are often simply referred to as "kinases.”
- kinases make them ideally suited as signaling proteins.
- a given kinase may in one instance transmit a growth inhibitory signal and in another instance transmit a growth promoting signal, depending on the structure of the extracellular ligand that has bound to the cell surface (2).
- a second key feature is that the kinases are organized into several modular functional regions, or "domains” (3).
- domains One domain known as “SH3” is a proline-rich region of 55-70 amino acids in length, and another, known as “SH2,” is a phosphotyrosine- binding region of about 100 amino acids in length. These two domains are believed to be involved in recognizing and binding to the protein substrates.
- the third domain, “SHI,” is comprised of about 270 amino acids, and is the domain which is responsible for catalysis. It also contains the binding site for the nucleoside triphosphate which is used as energy source and phosphate donor (3).
- domains including myristylation and palmitylation sites, along with SH2 and SH3, are responsible for assembling multiprotein complexes which guide the catalytic domain to the correct targets (3,22,23).
- Molecular recognition by the various domains has been studied using by x-ray diffraction and by using NMR methods (24-28).
- a third key feature of the kinases is their speed.
- the kinetics of phosphorylation and dephosphorylation is extremely rapid in many cells (on a millisecond time scale), providing for rapid responses and short recovery times, which in turn makes repeated signal transmission possible (5).
- tyrosine kinases in their signaling cascades (12,13).
- Tyrosine kinases catalytically attach a phosphate to one or more tyrosine residues on their protein substrates.
- the tyrosine kinases include proteins with many diverse functions including the cell cycle control element c-abl (14-16), epidermal growth factor receptor which contains a cytoplasmic tyrosine kinase domain (12),c-_src.
- tyrosine kinases a non- receptor tyrosine kinase involved in many immune cell functions (13), and Tyk2, a cytoplasmic tyrosine kinase which is involved in phosphorylation of the p91 protein which is translocated to the nucleus upon receptor stimulation and functions as a transcription factor (17).
- the serine/threonine kinases make up much if not all of the remainder of the kinase family; these catalytically phosphorylate serine and threonine residues in their protein substrates, and they have similarly diverse roles. They share homology in the 270 amino acid catalytic domain with tyrosine kinases. As such, although the discussion which follows focuses more particularly on the tyrosine kinases, that discussion is generally applicable to the serine/threonine kinases as well.
- inhibitors are among the most important pharmaceutical compounds known.
- asprin acetylsalicylic acid
- Asprin acetylsalicylic acid
- Traditional drug discovery can be characterized as the design and modification of compounds designed specifically to bind to and inactivate a disease-causing protein; the relative success of such an effort depends upon the selectivity of the drug for the target protein and its lack of inhibition of non-disease associated enzymes with similar enzyme activities.
- this compound has an inhibition constant (IC 50 ) for that kinase which is almost seven times lower than for the kinase src (the IC 50 is the concentration of inhibitor which must be added to reduce catalytic activity by 50%).
- inhibitor CGP 57148 is reportedly now undergoing clinical trials for use in treating myelogenous leukemia, even though the substrates it may block phosphorylation of in vivo are not known.
- Rous sarcoma virus which has become an important model system for studying the role of kinases in oncogenesis.
- RSV transformation of fibroblasts is controlled by a single viral gene product, the protein tyrosine kinase v-src (32). It is the rapid time course and the dramatic morphological changes during RSV fibroblast transformation that have made RSV a paradigm for studies of oncogene activity in all cells.
- the origin (33), regulation (3,8,34,35), and structure (25,27,36) of v-Src have been extensively studied and are well understood (8,37,38).
- v-Src results in the tyrosine phosphorylation of over 50 cellular proteins (37). These same substrates are also phosphorylated by other kinases in untransformed fibroblasts (40).
- biochemical and genetic techniques including anti-phosphotyrosine protein blots of transformed fibroblasts, transfection of fibroblasts with transformation-defective v-Src mutants, temperature-sensitive v-Src mutants, gene knock-out studies of cellular Src, host- range dependent Src mutants, anti-v-Src immunoprecipitation, and use of kinase- specific inhibitors, have not led to the unambiguous identification of v-Src " s direct substrates (see reference (38) for a comprehensive review).
- kinases can be highly promiscuous, there is a significant chance that inhibiting one kinase will simply force another kinase to "take its place.” Therefore, there is a need for a simple and direct way to determine the biochemical and cellular effects of inhibiting a given kinase, before herculean efforts are undertaken to design or discover specific inhibitors.
- the present invention for the first time provides a method for the highly specific inhibition of individual kinases, which have been engineered to bind the inhibitor more readily than the wild-type form of that kinase or other, non-engineered kinases.
- the invention also provides for the engineered kinases and the inhibitors to which they are adapted.
- this method is even more broadly applicable, as it would provide similar advantages for the study of other enzymes which, like the kinases, covalently attach part of at least one substrate to at least one other substrate.
- the present invention involves the engineering of kinases and other multi-substrate enzymes such that they can become bound by inhibitors which are not as readily bound by their wild-type forms. Modified substrates and mutant enzymes that can bind them have been used to study an elongation factor (41) and a receptor for cyclophilin A (42). However, prior to the present invention, it was not known how, or even if, multi-substrates enzymes which covalently attach part or all of a donor substrate onto a recipient substrate could be engineered to bind to an inhibitor, yet still retain at least some catalytic activity and at least some specificity for the recipient substrate in the absence of the inhibitor.
- the present invention is that this can be done, as explained below; and this invention for the first time opens the door to the selective inhibition of individual kinases, which are not only important tools for understanding of the kinase cascades and other complex catalytic cellular mechanisms, but also may provide avenues for therapeutic intervention in diseases where those mechanisms come into play.
- the present invention provides a solution to the above-described problems by providing materials and methods by which a single protein kinase can be specifically inhibited, without the simultaneous inhibition of other protein kinases.
- the present invention involves the engineering of kinases and other multi-substrate enzymes such that they can utilize modified substrates which are not as readily used by their wild-type forms.
- the invention further provides such chemically modified nucleotide triphosphate substrates, methods of making them, and methods of using them.
- the methods of the present invention include methods for using the modified substrates along with the engineered kinases to identify which protein substrates the kinases act upon, to measure the extent of such action, and to determine if test compounds can modulate such action.
- the invention provides engineered protein kinases which can bind inhibitors that are not as readily bound by the wild-type forms of those enzymes. Methods of making and using all such engineered kinases are also provided. The invention further provides such inhibitors, methods of making them, and methods of using them. The methods of the present invention include methods for using the inhibitors along with the engineered kinases to identify which protein substrates the kinases act upon, to measure the kinetics of such action, and to determine the biochemical and cellular effects of such inhibition.
- inhibitors and engineered kinases relate to the use of such inhibitors and engineered kinases to elucidate which kinases may be involved in disease; these kinases can then become the subject of efforts to design or discover more traditional specific inhibitors of their wild-type forms, which may prove to be valuable in treating the kinase-related disease or disorder.
- methods are provided for inserting the engineered kinase into cells or whole animals, preferably in place of the corresponding wild-type kinase, and then using the inhibitor to which it has been adapted as a tool for study of the disease- kinase relationship, and ultimately, as a drug for the treatment of the disease.
- the present invention also more generally relates to engineered forms of multi- substrate enzymes which covalently attach part or all of at least one (donor) substrate to at least one other (recipient) substrate.
- engineered forms will accept modified substrates and inhibitors that are not as readily bound by the wild-type forms of those enzymes.
- the invention also relates to methods for making and using such engineered enzymes, as well as the modified donor substrates.
- the methods of the present invention include methods for using the modified substrates and inhibitors along with the engineered enzymes to identify which substrates the enzymes act upon, to measure the kinetics of such action, and in the instance of the modified substrates, to determine the recipient substrates to which part or all of the donor substrate becomes attached, to measure the extent of such action, and to identify and measure the extent of modulation thereof by test compounds.
- the methods seek to determine the biochemical and cellular effects of such inhibition.
- the methods also extend to the use of such inhibitors and engineered enzymes to elucidate which enzymes may be involved in disease; these enzymes can then become the subject of efforts to design or discover specific inhibitors of their wild-type forms, which may prove to be valuable in treating the enzyme-related disease or disorder.
- methods are provided for inserting the engineered enzyme into cells or whole animals, preferably in place of the corresponding wild-type enzyme, and then using the inhibitor to which it has been adapted as a tool for study of the disease-enzyme relationship, and ultimately, as a drug for the treatment of the disease.
- the engineered kinase to use a nucleotide triphosphate or an inhibitor that is not as readily bound by the wild-type form of that kinase, or by other kinases.
- the inhibitor used is one that is "orthogonal" to the "natural" nucleotide triphosphate substrate for that kinase, or is orthogonal to a less specific inhibitor (e.g., one which is readily bound by the wild-type form of that kinase).
- the term “orthogonal,” as further discussed below, means that the substrate or inhibitor is similar in structure (including those that are geometrically similar but not chemically similar, as described below), but differs in a way that limits its ability to bind to the wild-type form.
- An engineered kinase made according to the present invention will be able to use an orthogonal nucleotide triphosphate substrate that is not as readily used by other, non- engineered kinases present in cells. Preferably, it will be able to use an orthogonal nucleotide triphosphate that is not substantially used by other kinases; and most preferably, it will be able to use an orthogonal nucleotide triphosphate substrate that can not be used at all by other kinases.
- the protein substrates of the engineered kinase will become labeled, whereas the protein substrates of other kinases will be at least labeled to a lesser degree; preferably, the protein substrates of the other kinases will not be substantially labeled, and most preferably, they will not be labeled at all.
- radioactive phosphorous P 32
- v-Src mutant with specificity for an orthogonal ATP substrate allows for the direct substrates of v-Src to be uniquely radiolabeled using [ ⁇ - 32 P] N 6 -(cyclopentyl)ATP, because it is able to serve as substrate to the engineered v-Src kinase, but is not substantially able to serve as substrate for other cellular kinases.
- v-Src mutant with specificity for such an inhibitor allows for the mutant to be inhibited, whereas other kinases in the same test system are not substantially inhibited, not even the wild-type form of that same kinase.
- Another object of the present invention to provide a nucleotide sequence which encodes such a mutant protein kinase; and it is a further object to provide a method for producing such a nucleic acid sequence.
- it is a primary object provide a mutant protein kinase which binds to and is inhibited by an inhibitor, which inhibitor less readily binds to or inhibits the corresponding wild-type kinase.
- a further object of the present invention is to provide a nucleotide sequence which encodes such a mutant protein kinase; and it is a further object to provide a method for producing such a nucleic acid sequence.
- Another object is to provide a method for determining what are the substrates for a given protein kinase.
- a further object is to provide a methods of preventing and treating kinase-mediated diseases by introducing an inhibitor-adapted mutant kinase of the present invention into a diseased organism, and preferably diminishing or, most preferably, depleting the organism of the wild-type enzyme; and then administering the inhibitor to regulate the activity of the now disease-mediating mutant kinase so as to diminish or eliminate the cause or symptoms of the disease.
- Another object is to provide a method for determining what are the substrates for a given multi-substrate enzyme.
- a further object is to provide a methods of preventing and treating multi-substrate enzyme-mediated diseases by introducing an inhibitor-adapted multi-substrate enzyme of the present invention into a diseased organism, and preferably diminishing or, most preferably, depleting the organism of the wild-type enzyme; and then administering the inhibitor to regulate the now disease-mediating mutant enzyme so as to diminish or eliminate the cause or symptoms of the disease.
- FIG. 1 is a schematic representation of the protein domain structures of v-Src, of XD4
- FIG. 2 is a schematic representation of adenosine triphosphate (ATP), with an "X" bound to the N 6 position; and in the box below, schematic representations are provided for the twelve side chains that take the place of "X" in each of the orthogonal
- FIG. 3 is an anti-phosphotyrosine immunoblot showing the level of protein tyrosine phosphorylation following treatment of a murine lymphocyte cell lysate with ATP or one of the ATP analogs (A*TPs);
- FIG. 4 provides a close-up view of the X-ray model showing the ATP binding domain in cAMP dependent protein kinase (1 ATP);
- FIG. 5 shows (a) an anti-phosphotyrosine blot of cell lysates expressing XD4 and GST-XD4(V323A, I338A), (b) an autoradiogram showing levels of phosphorylation when cell lysates are provided only radiolabeled ATP or only radiolabeled
- N 6 (cyclopentyl)ATP N 6 (cyclopentyl)ATP, and ⁇ an autoradiogram showing autophosphorylation of GST- XD4 and GST-XD4(V323A, 1338A) by radiolabeled ATP and radiolabeled N 6 (cyclopentyl)ATP(A*TP(8));
- FIG. 6 is a bar chart showing the relative degree to which ATP and each of the twelve ATP analogs inhibits GST-XD4 and GST-XD4(V323A, I338A) catalyzed phosphorylation by radiolabeled ATP;
- FIG. 7 shows autoradiograms indicating the levels of autophosphorylation by several v-Src position 338 single mutants when provided with either radiolabeled ATP and radiolabeled N 6 (cyclopentyl)ATP as phosphate donor substrate;
- FIG. 8 is a schematic diagram of a method of the present invention for determining which phosphorylated substrates in cells were phosphorylated by a particular kinase, here v-src.
- FIG. 9 is a schematic diagram of how an engineered kinase of the present invention can be inhibited by an inhibitor of the present invention, even in the presence of other kinases, and can be used to reveal the kinase's protein substrates;
- FIG. 10 shows the chemical structures for three known kinase inhibitors, Damnacanthal, PPI and CGP 57148, along with summaries of their inhibition constants (IC 50 ) for several kinases;
- FIG. 11 A shows the core structure of adenosine and PP3,
- FIG. 1 IB shows the structures of several bulky substitutents which can be added to N4 nitrogen of PP3 to produce the inhibitor candidate compounds whose IC 50 values are listed in Table 1 ;
- FIG. 12 shows the chemical structure of N-4 cyclopentoyl PP3, and autogradiograms of electrophoresed proteins which have become radiolabeled in the presence of N-4 cyclopentoyl PP3 in the presence of either wild-type v-Src or the mutant (I338G);
- FIG. 13A-C is a chart presenting additional inhibitor analogs prepared and tested in accordance with the present invention.
- FIG. 14A Schematic representation of the specificity problems associated with using small molecule protein kinase inhibitors to deconvolute cell signaling.
- Kinase catalytic domains red ovals
- b Schematic representation of the approach toward selective protein kinase inhibition described here.
- a space creating mutation is introduced into the ATP binding site of the kinase of choice (Src). This mutation creates an active site pocket (notch) in Src which can be uniquely recognized by a rationally designed small molecule inhibitor.
- This inhibitor contains a bulky chemical group (bump) which makes it orthogonal to wild type protein kinases.
- Design of the complementary kinase/inhibitor pair allows for highly selective inhibition of the target kinase in the context of a whole cell.
- FIG. 15A Structure of N-6 cyclopentyloxyadenosine (1).
- b. Synthesis of pyrazolo[3,4- ⁇ jpyrimidine inhibitor analogues. 2 was synthesized according to
- FIG. 16a Chemical structures of quercetin (5) and AMP PNP (6).
- b. Predicted binding orientation of 2 in src family kinase active sites. The crystal structures of Hck bound to AMP PNP (red) and Hck bound to quercetin (blue) were superimposed according to the Hck protein backbone (white) . The structure of 2 (yellow) was subsequently docked into the kinase active site by superimposing the pyrazolo[3,4-J]pyrimidine ring system of 2 onto the adenine ring of AMP PNP. c.)
- FIG. 17 Inhibitor analogue 3g does not inhibit B cell receptor mediated tyrosine phosphorylation.
- Murine spleen cells were incubated with 1.1% DMSO (lanes 1-2), 100 mM 3g in 1.1% DMSO (lane 3), or 100 mM 2 in 1.1% DMSO (lane 4).
- B cell stimulation (lanes 2-4) was initiated by the addition of 1 Omg/mL goat anti -mouse IgM. Cellular proteins were resolved by 10% PAGE, transferred to nitrocellulose, and immunoblotted with a monoclonal antibody for phosphotyrosine (4G10).
- FIG. 18 Inhibitor 3g blocks p36 phosphorylation in I338G v-Src, but not WT v-Src transformed NIH3T3 fibroblasts.
- Non-transformed NIH3T3 cells (lane 1), WT v-Src transformed NIH3T3 cells (lanes 2-3), and I338G v-Src transformed NIH3T3 cells (lanes 4-5) were incubated with 1.1% DMSO (lanes 1 , 2 and 4) or 100 mM 3g in 1.1 %
- FIG. 19 I338G v-Src transformed fibroblasts selectively acquire a flattened morphology and selectively regain actin stress fibers upon incubation with 3g.
- Non-transformed (a.-b.) WT v-Src transformed (c, d., g., h.)
- After 48 hours cells were photographed (a., c.-fi), stained with phalloidin-FITC, and visualized (b., g.-j.) by fluorescence microscopy..
- This figure shows a schematic representation of an experiment to Identify Kinase Substrates below which uses the invention for discovery of the substrates of a Src protein kinase.
- the ovals at the top of the figure represent protein kinase substrates which become phosphorylated by the protein kinases adjacent to the arrow.
- the protein kinases containing several ovals connected by lines are members of the "Src- Family" of protein kinases (Src, Fyn, Lck).
- One kinase (Src) contains a notch cut out which represents the I338G mutation which creates an extra space in the adenine binding pocket of this kinase.
- the symbol above this kinase represents the orthogonal inhibitor which contains a protrusion which complements the mutation in the Src
- the kinase with a large round oval and two protruding stings is the F-Actin Dependent protein kinase (FAK).
- F-Actin Dependent protein kinase F-Actin Dependent protein kinase
- the protein kinases with only an oval are members of the serine or threonine specific protein kinase family.
- the ovals below the arrow containing small P's represent the phosphorylated (P) substrates after action by the protein kinases.
- the simulated gels at the bottom of the figure represent the expected results if cells expressing either all wild-type kinases (on left) or one mutant kinase (Src-I338G) in place of wild-type Src are treated with the orthogonal inhibitor.
- the inhibitor should have no effect on the phosphoproteins present in the cells which do not express the mutant Src kinase (identical pattern in the gel on the left) and several phosphoproteins should be absent following treatment of the mutant expressing cells with the inhibitor (gel on the right).
- Figs. 11 A and 1 IB show the structures of a variety of bulky substituents which, when added to either N-4 of PP3 or to N 6 of adenosine diphosphate, or to N 6 of adenosine monophosphate, or to N 6 of adenosine (specifically N 6 cyclopentyloxy adenosine) to produce inhibitors of the mutant kinase v-Src(T120G), which is an engineered kinase of the present invention; the synthesis and inhibition constants for these inhibitors are discussed in Example 12 below.
- Such inhibitors may be useful in studies directed towards developing other useful mutants of this and other kinases, and for the several methods described elsewhere herein.
- the scope of the present invention is not limited to the use of these particular inhibitors, and those of ordinary skill in the art will recognize that many other possible structures could be substituted for or supplement those described herein.
- inhibitors of the present invention are not limited to modifications of nucleotides at the N 6 position or modifications of PP3 at the N 4 position. Chemical means to modify various positions on such compounds are known, and any of the resulting derivatives would be within the scope of the present invention; it is even possible to make changes or substitutions in their ring structures. Exemplary variants are presented herein, and particular reference is made to Fig. 13 where both analogs and data relating to their activity is set forth. Of course, the use of such inhibitors may require that different positions in the protein sequence of the kinase be modified in order to make an engineered kinase that will bind to them, but such different modifications are well within the scope of the present invention.
- inhibitors of the present invention are not limited to ADP and PP3 derivatives.
- derivatives of other natural nucleotide phosphate donor substrate may in fact be preferred.
- GTP phosphate donor substrate and energy source; to make inhibitors for engineered forms of such kinases, analogs of guanosine diphosphate would be suitable.
- inhibitors of the present invention are not limited to those made by chemical synthetic means, but also include compounds which may be found in nature, and which can serve that role, some of which are discussed above.
- compounds which may be found in nature and which can serve that role, some of which are discussed above.
- those of ordinary skill in the art will appreciate that there are other variations besides those set forth here, and that these are all within the scope of the present invention.
- the inhibitors that are candidates for use in accordance with the present invention can conveniently be screened to determine the extent to which they are accepted by wildtype kinases, using a screening procedure such as that set forth in Example 13 below, or by a screening procudure involving the use of a cell or cells which are rich in protein kinase activity as set forth in Example 9 herein.
- a screening procedure such as that set forth in Example 13 below
- a screening procudure involving the use of a cell or cells which are rich in protein kinase activity as set forth in Example 9 herein.
- the engineered kinase should: (1) accept an ATP analog (A*TP) that is utilized less readily by wild-type protein kinases; preferably, accept an A*TP that is not substantially utilized by wild-type kinases; and most preferably, accept an A*TP that is not utilized by wild-type kinases at all; (2) preferably, use the ATP analog with high catalytic efficiency; and (3) preferably, have reduced catalytic efficiency for the natural nucleotide substrate (ATP) so that in the presence of cellular levels of ATP (1-2 mM) the mutated kinase would preferentially utilize A*TP as the phosphodonor. If such engineered kinases are to be used to study the protein substrate specificity of the wild-type kinase, then these criteria must be met without
- the engineered kinase should: (1) bind to an inhibitor which is bound less readily by wild-type protein kinases; preferably, the inhibitor will not substantially bind to wild-type kinases; and most preferably, will not bind at all to wild type kinases; (2) preferably, the engineered kinase will bind the inhibitor with high affinity (i.e., low IC 50 ).
- the inhibitor binds to the wild-type form of the kinase that corresponds to the engineered kinase, as such binding and the resulting inhibition would augment that of the engineered kinase. However, it is most likely that the wild-type form of that kinase will not bind the inhibitor any better than other wild-type kinases.
- an inhibitable engineered kinase is to be used to study the protein substrate specificity of the wild-type kinase, or to replace the wild-type form of that kinase through gene therapy or other means, as further discussed below, then a further concern is that the above-described criteria must preferably be met without substantially altering the protein target specificity of the engineered kinase when compared with the corresponding wild-type form.
- Example 1 describes the twelve ATP analogs which were used in the studies on mutant v-Src, which are described in the further examples which follow. These orthogonal ATP analogs may be useful in studies directed towards developing other useful mutants of this and other kinases, and for the several methods described elsewhere herein. However, the scope of the present invention is not limited to the use of these particular ATP analogs, and those of ordinary skill in the art will recognize that many other possible orthogonal substrates could be substituted for or supplement those described herein. For example, different and even more complex aliphatic or aromatic groups could be added to the N 6 position of ATP. In addition, the orthogonal substrates of the present invention are not limited to modifications of nucleotides at the N 6 position.
- orthogonal substrates of the present invention are not limited to ATP derivatives. For studying different kinases. different analog bases may in fact be preferred.
- kinases utilize GTP as phosphate donor substrate and energy source; for studies of such kinases, analogs of guanosine triphosphate would be preferred.
- compounds chemically unrelated to the natural substrate can sometimes nevertheless bind to an active site, and can even be acted upon or act upon other substrates through chemical catalysis by the enzyme. Sometimes they participate in the catalyzed reaction in the same way as the natural substrate, sometimes in different ways. Such compounds and their derivatives would also be within the scope of the terms "natural substrate” and "orthogonal substrate” as used herein.
- orthogonal substrates of the present invention are not limited to those made by chemical synthetic means, but also include compounds which may be found in nature, and which can serve that role. Those of ordinary skill in the art will appreciate that there are other variations besides those set forth here, and that these are all within the scope of the present invention.
- the orthogonal nucleotides that are candidates for use in accordance with the present invention can conveniently be screened to determine the extent to which they are accepted by wild-type kinases, using a screening procedure such as that set forth in Example 2 below.
- a screening procedure such as that set forth in Example 2 below.
- Example 3 The design of an engineered v-Src is described in Example 3 below. As is described, the engineered form was designed by reference to the crystal structures of other kinases which have domains that are homologous to those found in most if not all kinases. As will be seen, the example mutant kinases described herein have been constructed as fragments of protein kinases, rather than as containing the entire sequences; but it was found there is no substantial difference in performance when the entire sequence is used. Of course, the concepts and the practicalities are the same whether fragments or whole kinases are used, and both are within the scope of the present invention. As such, the term "kinase" should be viewed as including the whole enzyme or a fragment of one, including when interpreting the claims.
- the method for doing this comprises the steps of: (a) identifying, from the crystal structure of an identical or homologous enzyme bound to its phosphate donor substrate or to a known kinase inhibitor (which may be non-specific for kinases, specific for kinases generally but not for that kinase, or specific for that kinase), one or more amino acids other than glycine which are close enough to a substituent on the bound phosphate donor substrate or inhibitor that they would sterically restrict entry of a bulky substituent attached to that substituent in a putative orthagonal inhibitor; and (b) mutating a nucleotide sequence which encodes the wild-type protein kinase such that the nucleotide triplets encoding one or more of the identified amino acids, are converted to nucleotide triplets that encode amino acids having side chains that are sterically less bulky than the identified amino acids.
- the above-described method uses steric restriction of entry or exclusion as the criteria for deciding which amino acid(s) to change, and how to change them.
- the present invention is not so limited. It is also possible to engineer a kinase to change its ability to bind to an orthogonal substrate by considering other factors, such as hydrophobicity, hydrophilicity, ionic binding or repulsion, hydrogen bonding, forming covalent bonds between the enzyme and electrophilic groups on orthogonal substrates, etc.
- the study of protein kinases using the present invention will be greatly facilitated by the vast knowledge regarding the domain structure of many different kinases, and their generally homologous sequences.
- the Protein Kinase Fact Book (71) provides protein sequence data for the three functional domains in literally hundreds of protein kinases, and this along with sequence information available in the primary literature, should greatly facilitate the further application of the present invention to the kinases.
- the preferred method of the present invention involves the rational design of substrate analogs and mutant protein kinases, both could alternatively be made by use of methods known as combinatorial methods.
- combinatorial methods There are many combinatorial methods of synthesizing organic compounds. Using one such method, one could synthesize nucleoside analogs on resin beads using sequential chemical steps, and then release them from the resin prior to phosphorylation to make the nucleotide triphosphates.
- the collection or library could be screened for particularly favorable binding or catalytic properties. This may allow for the more thorough search of structural, conformational, and electronic features of such putative orthogonal substrates. Moreover, it is often found that when larger numbers of analogs of a given substrate are investigated, and unexpectedly efficient substrate or inhibitor can be found.
- Example 4 The synthesis of one engineered kinase is described in Example 4. The focus of this effort was on amino acid side chains that were within about 4 A of the N 6 of ATP; but there is nothing magical about that distance. Residues with side chains that are within about lA, 2A, 3 A, 4A, 5 A, 6A, 7 A, 8 A, 9A, lOA, or lesser, greater or intermediate distances should also be considered as targets for modification. Amino acids with side chains that are within about 3 A to about 6 A would be preferred targets.
- those amino acids with the closer side chains will be preferred over those with more distant side chains, as they would be expected to cause the greatest steric or other interference with the orthogonal substituent on the inhibitor; and those with the very closest side chains would be the most preferred.
- Example 7 describes testing which could be done to determine whether the engineered kinase had retained its protein substrate specificity. It is preferred that the wild-type protein substrate specificity be substantially retained if, as in the examples, the goal is to use the engineered kinase to study what substrates the kinase acts upon and to what degree it does so, or it is to be used to replace or supplement the corresponding wildtype kinase in vivo, e.g., through genetic engineering.
- the engineered kinase may still have substantial value for such purposes. If the engineered kinase does not recognize the same protein substrates as the wild-type enzyme, it may have less value in studying the wild-type enzyme, but may still have substantial value in studying protein phosphorylation and kinases in general, and would still be within the scope of the invention.
- Example 7 Although useful, need not be used. Those of skill in the art will readily be able to develop or adopt other assays that can provide comparable information.
- a mutant kinase which accepts a given orthogonal substrate analog, or which is inhibited by a given inhibitor, it can be characterized using classical enzyme kinetic analysis, as illustrated in Examples 5 and 6. Also, as shown in Example 8, one can study the degree to which the mutant can utilize or be inhibited by the analog, and whether the analog is a "dead" (i.e., wholly ineffective) inhibitor for the wild-type enzyme.
- the methods used in the examples are not the only ways these studies can be done, and those of skill in the art can easily design alternate approaches.
- Example 10 it is not necessary to make multiple amino acid substitutions to provide a mutant that will be inhibited by an inhibitor of the present invention. It may only be necessary to make a single amino acid change, as is the case with the mutants GST-XD4(I338A) and GST-XD4 (1338G).
- the orthogonal inhibitor is added to two samples of the cell of interest which either express an added gene for the engineered kinase or express the normal copy of the kinase of interest.
- the inhibitor can be added before after or during the activation of a signaling cascade (such as permiabilized cells, cell extracts, or cells that are naturally permeable to them).
- a method which allows detection of all phosphorylated proteins in a cell or cell fraction e.g., by using radioactive phosphorous [ ⁇ - 32 P]ATP or by using monoclonal antibodies specific for phosphorylated amino acids is used to reveal the result of specifically inhibition of the kinase of interest.
- the protein substrates of the native kinase will become labeled, even in the presence of the inhibitor, whereas the protein substrates of the engineered kinase will at least be labeled to a lesser degree; preferably, the protein substrates of the engineered kinases will not be substantially labeled, and most preferably, they will not be labeled at all.
- the wild-type kinase corresponding to the mutant has been removed from the cells, e.g., by "knock-out" of the cellular gene(s) for it. If the labeled proteins of such an assay are examined in tandem with control samples containing the wild-type kinase but not the mutant kinase, certain bands will be diminished in intensity in the mutant-treated sample relative to the control. Preferably, the difference in intensity will be high; most preferably, there will be bands which are missing in the mutant-containing samples treated with the inhibitor. This would indicate that the wild-type form of that kinase phosphorylates those differentially labeled proteins; when the kinase is inhibited, those bands do not get labeled.
- Example 10 provides one example of a method of using a mutant kinase of the present invention, along with its orthogonal substrate analog or its inhibitor, as the case may be, to detect which are the intracellular protein substrates for that protein kinase. Developing such a test was a primary goal of the research that led to the present invention.
- Example 10 the method described in Example 10 and in FIG. 8 would appear to be generally applicable; however, there are many other possible approaches that could be used, once a mutant that accepts an orthogonal substrate analog or inhibitor has been prepared.
- the natural phosphate donor substrate is first prepared to contain a labeled moiety on the terminal phosphate, for example, by replacing the phosphate with [ ⁇ - 32 P] phosphate.
- This substrate along with the analog or inhibitor, is then added to a sample of lysed cells, cell extracts, permiabilized cells, or cells which are naturally permeable to the orthogonal nucleotide triphosphate substrate analog or to the inhibitor, and which express the mutant kinase, or to which the mutant kinase has been exogenously added (e.g., by microinjection).
- the labeled products are then extracted and analyzed in comparison with those produced by a control sample, which was treated substantially the same way, but without the addition of the analog or inhibitor, respectively.
- similar assays can be used to identify drugs or other compounds that can modulate the activity of a given protein kinase on one or more substrates. For example, one could add small amounts of solutions of a variety of such compounds to test samples containing cell-free extract, mutant kinase, along with a labeled orthogonal substrate analog and/or inhibitor. The labeled proteins can then be identified, e.g., by gel electrophoresis followed by autoradiography, and compared with a duplicate test sample treated the same way, but to which no drug or other compound was added.
- a protein is not labeled in a sample having an added compound plus substrate analog and/or inhibitor that does get labeled in a sample treated with the analog and/or the inhibitor, this indicates that the added compound has caused the kinase to phosphorylate a protein that it does not act on in the absence of the compound, i.e. , the compound upwardly modulates the activity of the kinase for that protein.
- a labeled protein appears in a test sample to which the compound or drug was added, but does not appear in a test sample not having the compound or drug added, this indicates that the added compound has prevented the kinase from phosphorylating a protein that it does act on in the absence of the compound, i.e., the compound downwardly modulates the activity of the kinase for that protein substrate.
- quantitative measurements are made for each labeled protein, e.g., by scanning autoradiograms and integrating the data, more subtle effect on kinase activity can be detected.
- a protein is more fully or less fully phosphorylated in the presence or absence of a given compound (i.e., has been less dramatically modulated). It can also be expected that some compounds will upwardly modulate kinase activity for some proteins and downwardly modulate activity for others at the same time.
- kinases play key roles in various diseases, it is of great interest to develop inhibitors which can specifically inhibit a single wild-type kinase or group of wild-type kinases. By down-modulating the activity of these disease- involved kinases, it should be possible to reduce the disease symptoms, or even cure the disease.
- the primary difficulty is finding inhibitors which are specific, and do not inhibit other kinases than the intended target.
- the reasons for such non-specificity are (i) the nucleotide triphosphate binding sites of kinases are highly conserved in evolution, and (ii) many kinases are "degenerate,” that is, they have sufficiently similar activities and specificities that they can substitute for other kinases that because of gene deletion or other reason are absent or diminished in concentration in the cells.
- the problem of binding site similaries can in many instances be overcome, e.g., by careful rational inhibitor design, or by selection of inhibitors from combinatorial libraries on the basis of specificity.
- the present invention provides a means to generate a specific, unique kinase inhibitor for any kinase of interest, by making a mutant of the kinase that is specifically designed to be inhibited by candidate inhibitors selected, and then studying the effects of that inhibition.
- One way to accomplish this is to test cells or cell extracts in vitro. For example, one could add ATP to such a sample which has one kind of label (the "first label") on the terminal phosphate, and add the specific inhibitor which is differently labeled (the first label) on the terminal phosphate, and add the specific inhibitor which is differently labeled (the first label).
- second label at the terminal phosphate.
- the decrease in appearance of the second label on a given protein substrate indicates specific inhibition of the mutant kinase; and appearance of the first label on that same substrate indicates that the other kinases have taken over that phosphorylation role, the degree of which is shown by the relative degree of such labeling.
- the engineered kinase is specifically inhibited, and other kinases do not take over phosphorylation of the substrates of the engineered kinase when it is inhibited, or at least do not completely take over, then that kinase is not degenerate, or at least not completely so; it is thus probably not a good candidate for development of a specific inhibitor of the wild-type for use as a drug to treat the disease it relates to.
- inhibition of the mutant kinase with an inhibitor of the present invention is not compensated for by the other kinases, then it is a preferred candidate for the development of an inhibitor of the wild-type kinase.
- Another, preferred method of such screening would be to produce animal models for the disease of interest, and then "knock out” the wild-type gene, and then, by genetic engineering, insert into the genome a gene encoding a mutant kinase of the present invention "knock-in”. Then, an inhibitor of the present invention, preferably one which has been shown in vitro to inhibit the mutant, can be used to down-regulate the mutant kinase. If down regulation leads to a decrease in the symptoms or morbidity of the disease in the model animal, or eliminates the disease, then that kinase is a preferred candidate for the development of a specific inhibitor of the wild-type form.
- mutant kinases and inhibitors of the present invention can also be used directly to treat diseases in humans and animals. Just as described above for the animal model systems, gene substitution could be used on patients with diseases which are mediated by those kinases.
- the wild-type gene for one or more such wild-type kinase would be deleted, e.g., by "knock-out” methods known in the art, and then specifically inhibitable mutants of those one or more kinases would be added to the animal's genome, e.g., by "knock-in” or gene therapy methods which are known in the art.
- the inhibitor could be used as a drug to down-modulate those one or more mutant kinases, such that the disease is ameliorated to at least some degree, but the degree of activity of those kinases which may be found to be necessary for normal cellular function could be maintained.
- the kinases could also be essentially
- the mutant kinases should behave just like the wild-type (except to the extent that the engineering may have changed their activity or kinetics). And if the disease should recur or flare up again in the future, the patient could again be treated with the inhibitor, without the need to repeat the gene exchange.
- the present invention is not limited to mutant kinases, orthogonal inhibitors, and their synthesis and use.
- the present invention will work just as well for other multi-substrate enzymes which covalently transfer part or all of one substrate, here called the donor, to another substrate, here called the recipient; and there are surely more such enzymes yet to be discovered.
- the donor here called the donor
- the recipient another substrate
- the applicability of the present invention to such enzymes The tasks at hand in such an instance are quite similar to those described in detail here for the kinases. First, it is necessary to identify what the donor substrate is, and/or to identify compounds which can inhibit that kinase, even if it is not specific for that kinase.
- the third step is to engineer the kinase such that one or more amino acid in the three- dimensional location where the bulky group would be expected to be if the analog did bind are replaced with amino acids having less bulky side chains, thus "making room” for the bulky moiety of the inhibitor. Steps two and three can, of course, be carried out in the reverse order.
- transferase enzymes would be most interesting candidates for study using the present invention.
- the family of methyl-transf erases would be of clear interest, and could quite easily be studied using the methods provided herein.
- These enzymes all use the same nucleotide based cofactor, S-adenosylmethionine (AdoMet), as a methyl (CH3) group donor.
- the different members of the family can transfer the methyl group of AdoMet to a wide variety of cellular components such as proteins (in which case the methyl group is added to arginine, aspartate, and glutamate side chains), DNA (in which case the methyl group is added to the C-5 position of cytosine, or the N-7 of guanine), to components of cell membrane components such as phospholipids, and also to a number of small amine containing hormones.
- proteins in which case the methyl group is added to arginine, aspartate, and glutamate side chains
- DNA in which case the methyl group is added to the C-5 position of cytosine, or the N-7 of guanine
- components of cell membrane components such as phospholipids
- small amine containing hormones include a number of small amine containing hormones.
- AdoMet analogs that contain additional bulky hydrophobic groups at the N-6 position, or at other ring positions, which would make the analogs orthogonal, and thus not be accepted as readily by wild-type methyltransferases as is the natural substrate; and the structure in the region of the transferred methyl group might be altered such that the methyl group is more chemically resistant to transfer; or, for example, S-adenosylcysteine might be used as the starting compound instead.
- radiolabeled AdoMet can then be synthesized which contains a C-14 labeled methyl group attached to the sulfur atom of AdoMet.
- the direct substrates e.g., protein or DNA, or polyamines
- the specific substrates for the methyltransferase of interest will be less labeled in comparison to the sample not containing the inhibitor; preferably, they will not be substantially labeled, and most preferably, will not be labeled at all.
- direct substrates of methyltransferases can be identified which are important in cancer, embryonic development, chemotaxis of poly morphonuclear leukocytes, or in neurological disorders.
- the methods of the present invention can then be used to determining whether compounds can be identified that modulate the activity of the enzyme.
- the several other aspects of the present invention could also be applied to the methyl transferases, and also to other multi-substrate enzymes.
- orthogonal is used here to mean a compound that is similar, structurally and/or geometrically, to the natural substrate for a given enzyme, or to an inhibitor of the wild-type form of the enzyme, but has differences in chemical structure which make that compound less able to bind to the wild-type form of the enzyme than is the natural substrate.
- natural substrate we mean that substrate which is utilized by the wild-type form of that enzyme.
- the orthogonal inhibitors of the present invention may be referred to in different ways herein; for example, sometimes they are referred to as "modified substrates,” “modified inhibitors,” “analogs,” “derivatives,” just as “substrates,” or “inhibitors,” and perhaps by other terms as well. However, in each instance, the same meaning is intended. Of course, the meaning of "orthogonal” and its synonyms are further explained in the descriptions of the invention provided above.
- the putative orthogonal substrates and inhibitors of the embodiments of the invention described herein were made by adding bulky substituents to an atom on the natural substrate or known kinase inhibitor, respectively.
- the present invention is not so limited.
- the enzyme could mutate the enzyme to contain one or more amino acids having more bulky side chains than those found in the wild-type amino acid sequence, so that when the orthogonal substrate or inhibitor binds, those more bulky amino acid side chains fill or partially fill the extra space created by the missing atoms or substituents.
- the mutant would bind to and/or be inhibited by the orthogonal substrate or inhibitor, but would not substantially utilize the normal substrate, because the added bulky amino acids present a steric hinderance to its binding.
- Such an approach would allow for highly selective control of the resulting mutant.
- an analog which can bind, but not react would provide a competitive inhibition
- an analog which becomes covalently attached to the enzyme upon binding would be a non-competitive inhibitor, i.e., a poison. All such types of inhibitors are within the scope of the present invention.
- homologous to has been used to describe how information about how to modify one enzyme can be deduced from information regarding the three-dimensional structure of other, related enzymes.
- a part of one enzyme which is "homologous" to part of a second enzyme has a protein sequence which is related to that of the second enzyme. This relationship is that they have a number of amino acids in the same relative location to one another.
- the imaginary sequence Asp-Met-Phe-Arg-Asp-Lys-Glu and the imaginary sequence Asp- Met-Ile-Arg-Glu-Lys-Asp have four amino acids in the same relative location, and three which are different, and they would be said to have homologous sequences.
- the three amino acids that are different between the chains are "conservative" differences, in that the substitutions in the second sequence relative to the first are with amino acids that have similar functionalities on their side chains.
- Glu and Arg both have aliphatic side chains terminated in carboxylic acid groups, and both Phe and He are hydrophobic.
- domain is also one well known in the art, and it refers to a region in a protein which has been identified as having a particular functionality.
- the three domains in protein kinases have been discussed elsewhere herein, and their functional roles have been discussed.
- different enzymes of the same family will have the same number of domains with each serving the same function, and they are often (but probably not always) arranged in the same order along the protein sequence.
- one enzyme may have a different length of protein sequence between its domains than does another.
- the domains of two related enzymes are generally (but probably not always) homologous to one another, this does not generally hamper the identification of corresponding domains.
- multi-substrate is used. This is intended to mean enzymes which bind two or more substrates. Those multi-substrate enzymes of most interest here are those which catalytically attach at least part of one substrate to at least one other substrate.
- the kinases and the transferases are but two families of such multi-substrate enzymes, and those of skill in the art will readily recognize that there are other such enzymes and enzyme families.
- the term "recognize” is sometimes used here to describe the ability of a substrate to specifically bind to the active site on an enzyme. This simply refers to the fact that an enzyme's substrate (or sometimes substrate derivatives or even completely different compounds that mimic the substrate) can contact and bind to the enzyme's active site, but other compounds will not. This concept is well known in the art. Enzymologists often say that the enzyme has an affinity for its substrate, or that the substrate has an affinity for the enzyme. They also say that an enzyme has "substrate specificity.” These all really describe the same phenomenon.
- a related term is the term "bind.”
- An inhibitor generally binds, or sticks to, to an active site through one or more hydrophobic, hydrophilic, hydrogen, and/or ionic bonds, or, in the case of non-competitive inhibitors, through covalent bonds.
- mutant and engineered form when used to describe the enzymes of the present invention, simply mean that they have sequences that have a different amino acid at one or more position when compared to the sequence of the wild-type enzyme.
- two letters separated by a number indicate the amino acid mutations made. The letters are single-letter amino acid codes, and the numbers are the amino acid residue positions in the intact, wild-type enzyme. For example. GST-
- XD4 is a fusion protein containing a fragment, XD4, that has the same sequence as a specific part of the wild-type v-Src.
- the valine in the sequence of v-Src fragment XD4 that represents position 323 in the complete wild type v-Src sequence has been replaced by alanine
- the isoleucine in the XD4 fragment that represents position 338 in the complete wild type v-Src sequence has also been replaced with alanine.
- FIG. 2 is a schematic representation of their structure. The figure shows adenosine triphosphate (ATP), with an "X" bound to the 6 position; and in the box below, schematic representations are provided for the twelve side chains that take the place of "X" in each of the orthogonal ATP analogs described in the examples (which are always referred to by the numbers 1-12 set forth in bold typeface). Those analogs are:
- Analogs 1, 2, 4, 6, 9, and 12 were synthesized via Dimroth rearrangement of the corresponding N 1 alkoxy adenine derivatives in four steps starting from adenosine, according to the procedure of Fujii et al .(43).
- Analog 5 was synthesized similarly via Dimroth rearrangement of N 1 benzyladenosine (44).
- Analog 3 was prepared via in situ protection of the adenosine hydroxyl groups as trimethylsilyl ethers and subsequent treatment with acetyl chloride, according to McLaughlin et. al . (45).
- Analogs 7, 8, 10 & 11 were synthesized via treatment of 6-chloropurine riboside (Aldrich) with pyrrolidine, cyclopentylamine, piperidine & cyclohexylamine, respectively (46).
- Triphosphate synthesis was carried out according to the method of Ludwig (47) with the exception of the preparation of pyrophosphate. Accordingly, bis-tri-N-butyl ammonium pyrophosphate was prepared by mixing 1 equivalent of pyrophosphoric acid with 2 equivalents of tributyl amine in a (1 : 1) water: ethanol mixture until a homogenous solution was obtained. Solvent was removed under vacuum to dryness and the pyrophosphate was stored over P 2 O 5 overnight.
- the radiolabeled analog was purified by DEAE (A-25) Sephadex (Pharmacia) column chromatography and the triphosphate was identified by co- injection of the radiolabeled material with an authentic sample of N 6 -(cyclopentyl) ATP on an SAX-anion exchange HPLC column (Rainin) (linear gradient of 5-750 mM ammonium phosphate pH 3.9 in 10 min. at 0.5 mL/min). The chemical yield of the reaction varied from 70% to 80%.
- the assays were performed using spleenocytes (8-30 week old male and female C57/B6 mice from the Princeton University Animal Facility) which were isolated and washed in RPMI-1640 medium containing 5% Bovine Calf Serum (BCS), 1% Hepes and DNAsel (1 ⁇ g/ml). Red cells were lysed at 4°C by treatment with 17 mM tris ammonium chloride pH 7.2. The cells were hypotonically lysed on ice for 10 min. in ImM Hepes pH 7.4, 5 mM MgCl 2 , leupeptin (10 ⁇ g/ml), aprotinin (10 ⁇ g/ml) and lOO ⁇ M PMSF according to the method of Fukazawa et al.
- Each nucleotide triphosphate was added to a final concentration of 100 ⁇ M to 5 x 10 6 cell equivalents and incubated at 37 °C for 5 min. after which 4X Laemmli gel loading buffer was added to the cell lysate to quench the reaction. Proteins were separated by 12.5% SDS-PAGE and transferred to Protran BA85 (Schleicher-Schuell). The blot was probed with the anti-phosphotyrosine monoclonal antibody 4G10 (Upstate Biotechnology) and the bound antibody was detected via enhanced chemiluminescence (cat. 34080, Pierce) following treatment with HRP- coupled goat- anti-mouse antibody (VWR cat. 7101332) according to the manufacturer's instructions.
- FIG. 3 is an anti-phosphotyrosine protein immunoblot showing the level of protein tyrosine phosphorylation following treatment of a murine lymphocyte cell lysate (CF) with 100 ⁇ M of ATP or ATPs (1-12).
- the cell lysate used includes the tyrosine kinases Src, Fyn, Lck, Lyn, Yes, Fgr, Hck, Zap, Syk. Btk, Blk. and other tyrosine kinases present in B and T lymphocytes, macrophages, and follicular dendritic cells (13). Molecular size standards (in kilodaltons) are indicated.
- the ATPs containing the smallest N 6 substituents, 1 (methoxy), 2 (ethoxy), and 3 (acetyl) showed some ability to serve as cellular tyrosine kinase substrates (Fig. 3, lanes 3-5).
- the ATPs with sterically demanding N 6 substituents, 4 (j-propoxy), 5 (benzyl), and 6 (benzyloxy), and all analogs containing cyclic aliphatic substituents (7-12) showed little or no protein phosphorylation (Fig. 3, lanes 6-8, 11-16).
- analogs (7-12) are "dead substrates" for wild type tyrosine kinases, i.e., the wild-type substrates do not substantially, or at all, accept these as phosphate donor substrate. These analogs thus were chosen as the most preferred targets for reengineering the nucleotide binding site of v-Src.
- V104/M120 PKA
- V64/F80 CDK2
- FIG. 4 shows a close-up view of the ATP binding site in cAMP dependent protein kinase (PKA), which is bound to ATP.
- PKA cAMP dependent protein kinase
- Three residues within a 4 A sphere of the N 6 amine of ATP (Vall04, Metl20, and Glul21) and the catalytically essential lysine residue (Lys72) are shown in ball-and-stick representation. The remainder of the protein is shown in ribbon format. This figure was created by feeding the output of Molscript into the Raster3D rendering program (68,69). Note that in the model, the side chain of Glul21 is pointed away from the adenine ring binding region, and therefore Glul21 was not a candidate for alteration.
- the mutant (V323A 338A) was made as described below. Both the wild-type and the double alanine mutant of the v-Src catalytic domain, (the XD4 fragment) were made as glutathione S-transferase (GST) fusion proteins (GST-XD4) (61,62). These were made in E. coli, which is a good expression host because it lacks any endogenous tyrosine kinases, as described in the following Example. We used the XD4 fragment of v-Src because it contains an intact SHI catalytic domain but lacks the non-catalytic regulatory SH3 and SH2 domains, and exhibits higher specific activity than full-length v-Src.
- SEQ. ID NO. 4 (5'-TTTGG ⁇ rCCATGGGGAGTAGCAAGAGCAAG), SEQ. ID NO. 5 (5'-TTTG 7TCCTACTCAGCGACCTCCAACAC),
- SEQ. ID NO. 6 (5'-TGAGAAGCTGGCTCAACTGTACGCAG), SEQ. ID NO. 7 (5'-CTGCGTACAGTTGAGCCAGCTTCTCA), SEQ. ID NO. 8 (5'-CTACATCGTCGCTGAGTACATGAG), SEQ. ID NO. 9 (5'-CTCATGTACTCAGCGACGATGTAG).
- Primer SEQ. ID NO. 4 contains a BamHl site and primer SEQ. ID NO. 5 contains an
- Primers S ⁇ Q. ID NO. 6 and S ⁇ Q. ID NO. 7 contain the nucleotide sequence changes to introduce the V323A mutation (nucleotides encoding mutations are shown in bold).
- Primers S ⁇ Q ID NO. 8 and S ⁇ Q. ID NO. 9 contain the 1338 A mismatch.
- the XD4 gene from Y ⁇ p51 -XD4 plasmid (a gift of B. Cochran at Tufts Medical
- the PCR product was digested with BamHl and EcoRI and ligated into BamHl and EcoRI - digested pG ⁇ X-KT and then transformed into the E. coli strain DH5 ⁇ .
- the GST-XD4 (V323A) was constructed using primer S ⁇ Q. ID NO. 4, S ⁇ Q. ID NO. 5, S ⁇ Q. ID NO. 6 and S ⁇ Q. ID NO. 7 with the GST-XD4 plasmid as the template.
- the PCR product from the two step procedure was digested with BamHl and EcoRI , ligated into BamHl and EcoRI -digested pG ⁇ X-KT, and transformed into DH5 E. coli cells.
- GST-XD4 (V323A, I338A) was made in the same manner using primers S ⁇ Q. ID NO. 8 & S ⁇ Q. ID NO. 9 with GST-XD4 (V323A) as the template.
- 6-His-XD4 and 6-His-XD4 (V323A, I338A) in Sf9 insect cells was accomplished using the Life Technologies BAC-to-BAC system. Briefly, the 6-His-XD4 and 6-His-XD4 (V323A, I338A) in Sf9 insect cells was accomplished using the Life Technologies BAC-to-BAC system. Briefly, the 6-His-XD4 and 6-His-XD4 (V323A, I338A) in Sf9 insect cells was accomplished using the Life Technologies BAC-to-BAC system. Briefly, the 6-His-
- XD4 and 6-His-XD4 (V323A, 1338 A) genes were generated by PCR using the corresponding pGEX vectors as templates with primers SEQ. ID NO. 4 and SEQ. ID NO. 5, followed by digestion with BamHl and EcoRI .
- the resulting PCR fragment was cloned into pFASTBAC which had been digested with BamHl and EcoRI . Transformation of HB 1 OB AC cells and subsequent transfection of Sf9 cells with the
- transfection of v-src or v-src(I338G) mutant kinase was performed by cloning the v-src gene from the pG ⁇ X-v-Src vector(4) into the pBabe vector(5) which contains the ltr promotor for high level of expression in NIH 3T3 cells.
- the pBabe v-Src (I338G) plasmid was transfected into viral packaging cell line BOSC 23(6) and viral particles harvested after 2 days as described(6).
- NIH 3T3 cells were infected as described(7) with these viral particles and stable transfectants were selected in puromycin containing media as described(5). Stable transfectants were maintained in media containing puromycin to ensure no loss of expression of v-Src.
- FIG. 1 is a diagram showing the domain structure of v-Src including the Src-homology 3, 2, and 1 (SH3, SH2 & SHI) domains, with the domain boundaries indicated by the amino acid residue numbers listed above each boxed domain.
- the domain structure of XD4 is also represented, which contains a deletion of residues 77-225 ( ⁇ 77-225).
- Domain organizations of the glutathione S-transferase (GST) fusion with XD4 (numbering from v-Src), and the doubly mutated GST-XD4(representing both V323A,I338A and I338G) are also shown schematically.
- the wild-type kinase GST-XD4 displays poor binding affinity for most ATP analogs
- FIG. 6 solid bars
- the doubly mutated GST-XD4(V323A, I338A) shows excellent inhibition by more sterically demanding N 6 substituted ATP analogs (Fig. 6, shaded bars).
- the GST-XD4(V323A, I338A) mutant is inhibited by ATP analogs 5, 8, 9, and 11 almost as well as the wild-type kinase, GST-XD4, is inhibited by its natural substrate ATP.
- GST-XD4(V323A, I338A) and the full length GST-v-Src(V323A, I338A) display the same inhibition pattern with ATPs (1-
- the wild-type kinase GST-XD4 did not substantially phosphorylate the RR-Src peptide with [ ⁇ - 32 P] N 6 -(cyclopentyl) ATP, confirming our previous observations that this analog is not a significant substrate for the wild-type kinase.
- GST-XD4(V323A, 1338A) displayed Michaelis-Menten kinetics with the orthogonal ATP, [ ⁇ - 32 P] N 6 -(cyclopentyl) ATP.
- the K M of the mutant for the orthogonal substrate is quite close to the K M of GST-XD4 for ATP.
- the mutant has a K M for ATP which is more than 10-fold higher than the K M of GST-XD4 for ATP.
- the parameter used to rank catalysts for competing substrates is the ratio of the turnover number to the Michaelis-Menten constant, k cat /K M (the "specificity constant") (64).
- the k cat /K M of the engineered mutant GST-XD4(V323A, I338A) with the orthogonal substrate [ ⁇ - 32 P] N 6 -(cyclopentyl)ATP is only 50-fold lower than the k cat /K M value of the wild-type kinase with its natural substrate, ATP.
- This catalytic efficiency with the orthogonal ATP substrate, coupled with the mutant kinase's lower catalytic efficiency with ATP when compared to the wild-type satisfy two of the design criteria discussed above.
- 5 ⁇ is an autoradiogram showing [ ⁇ - 32 P] ATP dependent autophosphorylation of GST-XD4, lane 1, or GST-XD4(V323A, I338A), lane 2; and [ ⁇ - 32 P] N 6 (cyclopentyl) ATP dependent phosphorylation of GST-XD4, lane 3, or GST-XD4(V323A, I338A) phosphorylation, lane 4.
- the engineered kinase is efficiently autophosphorylated with [ ⁇ - 32 P] N 6 -(cyclopentyl)ATP (Fig. 5(c), lane 4).
- the engineered kinase phosphorylates the same broad set of proteins that are phosphorylated by wild-type XD4 when each is expressed in Sf9 insect cells.
- FIG. 5(a) shows an anti-phosphotyrosine protein blot of cell lysates (10 8 cell equivalents/lane) from Sf9 insect cells expressing 6-His-XD4, lane 2, or 6-His-XD4 (V323A, I338A), lane 3.
- These blots were carried out following lysis of 10 6 cells in a buffer containing 0.1% Triton-X-100, 50 mM Tris, pH 8.0, using a procedure similar to that of the blots of Example 2.
- the Sf9 insect cell system is a good host for expressing small amounts of tyrosine kinases because these cells contain most of the same machinery necessary to carry out post-translational modifications to proteins resulting in kinases which are more similar in activity to those found in mammalian cells. Furthermore, uninfected Sf9 cells lack endogenous tyrosine kinase activity, as shown in FIG. 5(a), lane 1 , and thus the phosphotyrosine containing proteins in lanes 2 and 3 of FIG. 5(a) are substrates of the expressed 6-His-XD4 or mutant 6-His-XD4 kinases. We attribute the small differences in phosphorylation level of particular proteins to the lower catalytic activity of the mutant XD4 (V323A, I338A) compared to the wild-type kinase.
- EXAMPLE 8 Confirmation that the Engineered Kinase Accepts the Preferred Orthogonal Substrate, but the Wild-Type Kinase Does Not Substantially Accept It
- the ultimate goal of this work is to use mutant kinases specific for synthetic substrate analogs to tag the direct protein substrates in whole cells or cell lysates. For this it is preferable that no wild-type kinase, including ser/thr specific kinases (which carry out the bulk of cellular phosphorylation, as only 0.03%) of all phosphoamino acids are tyrosine) (65), substantially accept the synthetic substrate.
- FIG. 5(b) is an autoradiogram showing the level of phosphorylation in hypotonically lysed murine lymphocytes with [ ⁇ - 32 P] ATP, lane 1 or [ ⁇ - 32 P] N 6 -(cyclopentyl) ATP, lane 2.
- [ ⁇ - 32 P] ATP lane 1
- [ ⁇ - 32 P] N 6 -(cyclopentyl) ATP lane 2.
- the results are shown in FIG. 7.
- the gel lanes shown on the top left of FIG. 7 show that the mutant with alanine at the 338 position was able to utilize the natural substrate, ATP, more readily than the mutant with serine at that same position.
- the gel lanes shown on the bottom left of FIG. 7 show that the mutant with alanine in position 338 is also better able to use ATP as a substrate than is the mutant with glycine at that position.
- the panels on the right side of FIG. 7 tell an even more interesting story. From the top right panel, it is clear that the mutant with serine at position 338 is not able to utilize N 6 (cyclotpentyl)ATP nearly as well as is the mutant with alanine at that position. However, the bottom panel shows that the mutant with glycine at position 338 is better able to use N 6 (cyclotpentyl)ATP as substrate than is the mutant with alanine at that position.
- glycine substitution would work here.
- glycine substitution is usually not expected to work in such situations, because it introduces too much flexibility into the enzyme structure, and thus detrimentally affects the desired outcome.
- EXAMPLE 11 Identifying the Substrates of v-Src A schematic representation of an experimental approach to identifying v-Src substrates is shown in FIG. 8.
- the engineered v-Src such as GST-XD4(V323A, 1338 A) is added to cell extracts or permiablized cells, along with a radiolabeled orthogonal substrate, such as [ ⁇ - 32 P] N 6 (cyclotpentyl)ATP. Typically, this would be done in triplicate. After incubation, the cells would be lysed (if not already lysed), and the resulting samples would be separated by polyacrylamide gel electrophoresis.
- a western blot taken from the gel and labeled with anti-phosphotyrosine would show all phosphorylated proteins in the sample; and an autoradiogram of the gel would reveal which of those were phosphorylated by v-Src.
- EXAMPLE 12 Synthesis of inhibitors The pyrazolopyrimadine backbone for the first six inhibitors is shown in FIG. 11 A.
- This inhibitor reverses the transforming effects of cellular expression of the engineered v-Src, but does not disrupt wild type v-Src mediated cellular transformation.
- These cell lines differ only by a single amino acid in a single protein kinase, establishing that dramatic changes in cellular signaling can be directly attributed to specific inhibition of the engineered kinase.
- mutant kinase serves the same function as the wild-type kinase
- an inhibitor of the mutant will affect cell signaling in the same manner as a selective inhibitor of the wild-type kinase in non-transfected cells.
- the ability to observe the phenotype of cells after selective inhibition of any protein kinase provides a rapid method for determining the unique roles of individual kinases in signal transduction cascades.
- Fyn is a src family tyrosine kinase which is important in T cell receptor mediated lymphocyte activation .
- Src and Fyn share a similar domain structure and have approximately 85% amino acid identity in their catalytic domains .
- the close structural relationship of the src family members provides the ideal test of our ability to engineer enzyme/inhibitor specificity between highly homologous kinases. If one can discriminate between these closely related src members using a cell permeable inhibitor, it is likely that specificity for members of other protein kinase families can also be achieved using a similar approach.
- GST glutathione-S-transferase
- N-6 cyclopentyloxyadenosine (1, Fig 15a.) with a 50% inhibitory concentration (IC 50 ) of 1 mM for I338G v-Src.
- IC 50 50% inhibitory concentration
- This first screen encouraged us to pursue the strategy of developing novel inhibitors of I338G v-Src since our design had allowed us to readily over come selectivity barriers which are major problems in conventional inhibitor discovery.
- adenosine analogues are not ideal because of the many cellular functions performed by adenosine as well as the large number of cellular proteins which bind adenosine.
- N-6 adenosine analogues have been shown to act as adenosine receptor agonists and antagonists , and one can imagine N-6 adenosine analogues acting as substrates for nucleoside kinases. For these reasons we turned to a class of known tyrosine kinase inhibitors that are not direct analogues of biologically known molecules. Our design strategy called for a core structure which exhibits potent inhibition of multiple wild type kinases and is easily synthesized.
- the binding orientation of the molecule in the enzyme active site must be known or readily predictable.
- the molecule must bind in a manner in which the site pointing toward Ile338 can be easily modified.
- our core inhibitor structure we chose 4-amino-l-tert-butyl-3-phenylpyrazolo [3,4-tt]pyrimidine (2, Fig 15b.). This molecule is a derivative of
- the panel of pyrazolo [3, 4-d]pyrimidines was screened against WT and I338G v-Src kinases (see FIG 13). All of the analogues are better inhibitors of the engineered v-Src as compared to wild type, confirming our prediction of the binding orientation of 2 in the kinase active site. Any derivatization of 2 at the N-4 position destroys the inhibitory activity against WT v-Src (no detectable inhibition at the limit of solubility, 300 mM). All 10 analogues demonstrated measurable inhibition of I338G v-Src and several of the compounds have IC 50 's in the low mM range.
- the analogues demonstrated measurable inhibition of I338G v-Src and several of the compounds have IC 50 's in the low mM range.
- the large size of the derivatization needed to achieve sub-micromolar potency for the I338G v-Src active site was rather unexpected. We removed only four carbon atoms from the ATP binding site and derivatized the parent molecule with eleven carbon atoms. This discrepancy may be due to an imperfection in our binding prediction .
- the He to Glv mutation may confer greater flexibility to the enzyme active site allowing the mutant kinase to accept a larger inhibitor analogue than predicted.
- 3g does inhibit I338G v-src at the ATP binding site. Lineweaver-Burk analysis confirmed that 3g does inhibit I338G v-Src competitively with respect to ATP with an inhibitory constant (K t ) of approximately 400 nM (data not shown .
- the panel of inhibitor analogues was next screened against WT Fyn to investigate their potential to cross react with this kinase.
- WT Fyn was chosen as the "worst case" control of wild type kinases because the published parent molecule, PP1, and 2 are highly potent (low nM) Fyn inhibitors .
- Many of the 10 synthetic analogues did not display high selectivity for the target kinase (see FIG 13).
- the N-acyl analogues with saturated ring systems (3a-3c) effectively inhibit wild type Fyn.
- the N-methylene compounds (4b, 4d, 4e) are sufficiently orthogonal to WT Fyn but show only poor to moderate inhibition of the engineered v-Src.
- 3g inhibits the engineered v-Src over 700 times more effectively than WT Fyn, which is likely to be the wild type cellular kinase which is most capable of binding the molecule.
- FIG. 17 demonstrates that 100 mM 3g treatment of antigen receptor cross linked murine B cells has no effect on the phosphotyrosine pattern of B cell stimulation (compare to lane 2). The signal intensities of all the major bands are unchanged and only slight depletion of some minor bands is detectable, confirming that 3g does not appreciably inhibit the panel of tyrosine kinases that are activated by BCR cross linking.
- V-Src activity is required for Rous sarcoma virus transformation of mammalian cells .
- Treatment of the I338G v-Src expressing NIH 3T3 cells with 100 mM 3g caused dramatic changes in cell morphology which are consistent with the reversal of transformation (Fig 19).
- the mutant cells that were treated with inhibitor 3g appeared flat and did not exhibit growth characteristics of transformed cells (i.e. the ability to grow on top of one another).
- WT v-Src infected cells demonstrated the prototypical rounded morphology and overlapping growth patterns of transformed cells.
- 3g treated I338G v-Src expressing cells have defined polymerized actin strings, strongly resembling the actin formations of non-transformed NIH3T3 fibroblasts. These inhibitor treated cells have an exaggerated flattened mo ⁇ hology and show peripheral actin staining that is not present in the non-transformed NIH3T3 cells.
- This data shows that 3g can uniquely induce mo ⁇ hological changes in cells which are engineered to contain a single amino acid change in the kinase of interest. This is the first demonstration that a small molecule inhibitor selective for a tyrosine kinase oncogene product can revert the mo ⁇ hological changes associated with cellular transformation.
- the reaction was quenched by the sequential, dropwise additions of 1 mL EtOAc, 1 mL water, and 1 mL 6N NaOH. After stirring for five minutes, the reaction mixture was filtered through a celite pad, diluted with water and extracted with El ⁇ O. The Et 2 O extracts were combined, dried over MgSO 4 , and evaporated. The residue was purified by flash chromatography on 10 g silica gel by elution with 4:1 hexanes/EtOAc.
- IC 50 's for putative kinase inhibitors were determined by measuring the counts per minute (cpm) of 32 P transferred to an optimized peptide substrate for src family kinases (IYGEFKKK).
- IC 50 was defined to be the concentration of inhibitor at which the cpm was 50%) of the control disk. When the IC 50 fell between two measured concentrations it was calculated based on the assumption of an inversely proportional relationship between inhibitor concentration and cpm between the two data points. Because the solubility limit of the inhibitor analogues in aqueous solutions is (300 ⁇ M, IC 50 values of (250 ⁇ M are approximate as full titrations to the upper limit of inhibition could not be tested. IC 50 's for non-src family kinases were measured equivalently with the following exceptions. Kemtide (Pierce, 133 mg/mL) was used as the substrate for PKA.
- EAIYAAPFAKKK An optimized Abl substrate (EAIYAAPFAKKK, 133 mg/mL) was used for Abl assays.
- PKCd assays were performed in the presence of 17 ng/mL diacyl glycerol (Sigma) and 17 ng/mL phosphatidyl serine (Sigma) with 170 ng/mL histone (Sigma) as the kinase substrate.
- Splenic lymphocytes were isolated from 6-20 week old Balb/c or C57/B6 mice. The cells were washed out of the spleen into RPMI media containing 1 mg/mL DNase I and the red blood cells were lysed in 17 mM tris-ammonium chloride, pH 7.2.
- EDTA 150 mM NaCl, 100 mM PMSF, 2 mM sodium orthovanadate, 10 mg/mL leupeptin, 10 mg/mL apoprotin).
- the cellular debris was then pelleted at 13,000 ⁇ m for 15 min.
- Cellular proteins were separated by 10% polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane by Western blotting. Phosphotyrosine containing proteins were visualized by immunoblotting with anti-phosphotyrosine antibody (Upstate Biotechnology, Inc.).
- Non-transformed NIH3T3 cells, WT v-Src transformed NIH3T3 cells, and I338G v-Src transformed NIH3T3 cells were incubated at 37°C with 1.1% DMSO or 100 mM 3g in 1.1% DMSO. After 12 hours, the cells were washed with PBS and lysed (lysis buffer: 1 % Triton X- 100, 50 mM tris pH 7.4, 2 mM EDTA, 150 mM NaCl, 100 mM phenylmethylsulphonyl fluoride, 2 mM sodium orthovanadate, 10 mg/mL leupeptin, 10 mg/mL apoprotin). The lysate was clarified by centrifugation at 13,000 ⁇ m for 15 min. Lysate protein concentrations were normalized and equal volumes of the lysate were resolved electrophoretically and analyzed for phosphotyrosine content as described above.
- Non-transformed, WT v-Src transformed, and I338G v-Src transformed NIH3T3 fibroblasts were grown in DMEM/10%> BCS on tissue culture treated slides.
- V-Src expressing cells were treated with either 1.1% DMSO or 100 mM 3g in 1.1% DMSO. After 48 hours cells were photographed at 400( magnification on an Nikon TMS light microscope. Immediately following light microscopy, the cells were fixed for 20 min in 3.7% formaldehyde/PBS and permeabilized for 60 sec in 0.2% Triton X-100(/PBS. Permeabilized cells were incubated with 200 ng/mL phalloidin-FITC/PBS for 20 min. Slides were rinsed with PBS and polymerized actin was visualized by fluorescence microscopy at 600( magnification on a Zeiss fluorescence microscope.
- the stereo typed role of v-Src in the oncogenic transformation of NIH 3T3 cells can be determined by observing the mo ⁇ hological change in cells expressing v-Src.
- the NIH 3T3 cells expressing mutant I338G v-Src display the identical mo ⁇ hological features of cells expressing wild-type v-Src which are dramatically distinct from NIH 3T3 cells which do not express either v-Src kinase, confirming that the 1338G mutation does not lead to any loss or gain of biological function of normal v-Src.
- an assay for the ability of NIH 3T3 cells to grow without "contact inhibition” can be measured in a cell culture based assay containing agarose, a viscous growth medium.
- the wild-type v-Src and mutant v-Src expressing NIH 3T3 cells display the exact same ability to form large growth colonies in this stereotyped assay as well, further confirming their identical functions (including substrate specificity, kinetics, cell distribution, etc.) In fibroblasts.
- FIG. 1 A schematic representation of an experimental approach to identifying v-Src substrates is outlined in FIG. 1 and the data showing experimental validation is in FIG. 4.
- the assays were performed by making anti-phosphotyrosine blots of pyrazolo pyrimidine (2-6) (25 ⁇ M) treated NIH 3T3 cells expressing either v-Src or v-Src (I338G) kinases were performed by lysing cells in modified RIPA buffer according to the method of Coussens et. al. (84). Cells were also treated for various times (in a cell culture Co 2 incubator) before lysis and anti-phosphotyrosine detection. Proteins were separated by 12.5% SDS-PAGE and transferred to Protran BA85 (Schleicher-Schuell).
- the blot was probed with the anti-phosphotyrosine monoclonal antibody 4G10 (gift of Dr. Brian Druker, Oregon Health Sciences Center Portland, Oregon) and the bound antibody was detected via enhanced chemiluminescence (cat. 34080), Pierce) following treatment with HRP-coupled goat-anti-mouse antibody (VWR cat. 7101332) according to the manufacturer's instructions.
- the two left lanes in FIG. 4 show the same phosphoprotein band pattern indicating that the orthogonal inhibitor 3 does not inhibit wild type v-Src kinase.
- the series of lanes in the right gel show a prominent band in the bottom of the gel (corresponding to protein molecular weight 3 kilodaltons) which is lost after treatment with 100 ⁇ M of compound 3.
- This specific inhibition of one phosphoprotein is a hallmark of a specific kinase inhibitor.
- the specificity of the inhibition is confirmed in the last lanes of the gel where the inhibitor is diluted and the phosphorylation of the 36 kilodalton band reappears when the inhibitor concentration is lower that 5 ⁇ M (the measured IC 50 in vitro is 5 ⁇ M, see text).
- This protein has been tentatively identified based on its unique molecular weight, as a protein called annexin II, an actin binding protein, of unknown function.
- T Cell antigen receptor signaling Three families of tyrosine kinases and a phosphatase. Immunity. 1: p. 351-356.
- MOLECULE TYPE peptide
- HYPOTHETICAL NO
- ANTI-SENSE NO
- ORGANISM Rous sarcoma virus
- ORGANISM Rous sarcoma virus
- MOLECULE TYPE other nucleic acid
- HYPOTHETICAL NO
- ORGANISM Rous sarcoma virus
- ORGANISM Rous sarcoma virus
- ORGANISM Rous sarcoma virus
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Toxicology (AREA)
- Organic Chemistry (AREA)
- Public Health (AREA)
- Physiology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Neurosurgery (AREA)
- Virology (AREA)
- General Engineering & Computer Science (AREA)
- Neurology (AREA)
- Communicable Diseases (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AT98906268T ATE271130T1 (de) | 1997-02-07 | 1998-02-09 | Veränderte proteinkinasen, die modifizierte nukleotidtriphosphat substrate verwenden können |
| EP98906268A EP1017823B1 (en) | 1997-02-07 | 1998-02-09 | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
| AU61535/98A AU755062B2 (en) | 1997-02-07 | 1998-02-09 | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
| DE69825066T DE69825066T2 (de) | 1997-02-07 | 1998-02-09 | Gentechnisch hergestellte Proteinkinasen, welche modifizierte Nukleotidtriphosphatsubstrate verwenden können |
| JP53499998A JP3784076B2 (ja) | 1997-02-07 | 1998-02-09 | 変性ヌクレオチド三燐酸基質を利用できる組み換えタンパクキナーゼ |
| US09/367,065 US6390821B1 (en) | 1997-02-07 | 1998-02-09 | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
| CA002279846A CA2279846C (en) | 1997-02-07 | 1998-02-09 | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
| MXPA/A/1999/007317A MXPA99007317A (en) | 1997-02-07 | 1999-08-06 | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
| US09/985,157 US7049116B2 (en) | 1997-02-07 | 2001-11-01 | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
| US09/985,061 US7026461B1 (en) | 1997-02-07 | 2001-11-01 | Engineered protein kinases which can utilize nucleotide triphosphate substrates |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US79752297A | 1997-02-07 | 1997-02-07 | |
| US08/797,522 | 1997-02-07 | ||
| US4672797P | 1997-05-16 | 1997-05-16 | |
| US60/046,727 | 1997-05-16 |
Related Parent Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US79752297A Continuation-In-Part | 1997-02-07 | 1997-02-07 | |
| US79752297A Continuation | 1997-02-07 | 1997-02-07 |
Related Child Applications (6)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09367065 A-371-Of-International | 1998-02-09 | ||
| US09/367,065 A-371-Of-International US6390821B1 (en) | 1997-02-07 | 1998-02-09 | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
| US09/568,466 Division US6521417B1 (en) | 1997-02-07 | 2000-05-10 | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
| US09/752,723 Division US20020016976A1 (en) | 1997-02-07 | 2001-01-03 | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
| US09/985,061 Division US7026461B1 (en) | 1997-02-07 | 2001-11-01 | Engineered protein kinases which can utilize nucleotide triphosphate substrates |
| US09/985,157 Division US7049116B2 (en) | 1997-02-07 | 2001-11-01 | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO1998035048A2 true WO1998035048A2 (en) | 1998-08-13 |
| WO1998035048A3 WO1998035048A3 (en) | 1999-01-07 |
Family
ID=26724237
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1998/002522 Ceased WO1998035048A2 (en) | 1997-02-07 | 1998-02-09 | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
Country Status (8)
| Country | Link |
|---|---|
| US (5) | US6390821B1 (https=) |
| EP (1) | EP1017823B1 (https=) |
| JP (2) | JP3784076B2 (https=) |
| AT (1) | ATE271130T1 (https=) |
| AU (1) | AU755062B2 (https=) |
| CA (1) | CA2279846C (https=) |
| DE (1) | DE69825066T2 (https=) |
| WO (1) | WO1998035048A2 (https=) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6162613A (en) * | 1998-02-18 | 2000-12-19 | Vertex Pharmaceuticals, Inc. | Methods for designing inhibitors of serine/threonine-kinases and tyrosine kinases |
| WO2001007659A3 (en) * | 1999-07-23 | 2001-03-22 | Univ Princeton | Methods for identifying inhibitors of signaling molecules |
| DE10024174A1 (de) * | 2000-05-17 | 2001-11-29 | Gsf Forschungszentrum Umwelt | Verfahren zum Selektieren von Inhibitoren für Enzyme |
| WO2005019221A1 (en) * | 2003-08-15 | 2005-03-03 | Merck & Co., Inc. | 4-cycloalkylaminopyrazolo pyrimidine nmda/nr2b antagonists |
| WO2003105723A3 (en) * | 2002-06-14 | 2005-09-09 | Salk Inst For Biological Studi | CAFEIC ACID / 5-HYDROXYFERULIC ACID 3/5-O-METHYLTRANSFERASES (COMT) OF MUTANT PLANTS, METHODS OF PREPARATION AND USE |
| US7383135B1 (en) | 1998-05-04 | 2008-06-03 | Vertex Pharmaceuticals Incorporated | Methods of designing inhibitors for JNK kinases |
| US7390808B2 (en) | 2001-04-30 | 2008-06-24 | Vertex Pharmaceuticals Incorporated | Inhibitors of GSK-3 and crystal structures of GSK-3β protein and protein complexes |
| EP1572097A4 (en) * | 2002-09-30 | 2010-02-17 | Smithkline Beecham Corp | NUCLEOSIDE DERIVATIVES FOR THE TREATMENT OF INFECTIONS WITH THE HEPATITIS C-VIRUS |
| US12215108B2 (en) | 2022-01-10 | 2025-02-04 | Southern Research Institute | Development of potential antidotes for arsenicals |
Families Citing this family (52)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU755062B2 (en) | 1997-02-07 | 2002-12-05 | Princeton University | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
| AU2001286931A1 (en) * | 2000-08-30 | 2002-03-13 | The Salk Institute For Biological Studies | Methods and compositions for determining isomerase enzymatic activity |
| AU2002245133A1 (en) * | 2000-12-15 | 2002-07-30 | The Salk Institute For Biological Studies | Methods of producing polyketide synthase mutants and compositions and uses thereof |
| US20060263800A1 (en) * | 2001-11-01 | 2006-11-23 | Princeton University | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
| WO2004024082A2 (en) * | 2002-09-13 | 2004-03-25 | Irm, Llc | Highly specific modulators of gtpases for target validation |
| US7429596B2 (en) * | 2003-06-20 | 2008-09-30 | The Regents Of The University Of California | 1H-pyrrolo [2,3-D] pyrimidine derivatives and methods of use thereof |
| ATE415148T1 (de) * | 2004-10-19 | 2008-12-15 | Krka Tovarna Zdravil D D Novo | Feste pharmazeutische zusammensetzung mit donepezilhydrochlorid |
| US9512125B2 (en) * | 2004-11-19 | 2016-12-06 | The Regents Of The University Of California | Substituted pyrazolo[3.4-D] pyrimidines as anti-inflammatory agents |
| EP1946106A4 (en) * | 2005-10-13 | 2009-04-08 | Activesite Pharmaceuticals | METHOD FOR IDENTIFYING INHIBITORS OF ENZYME ACTIVITY |
| WO2007114926A2 (en) * | 2006-04-04 | 2007-10-11 | The Regents Of The University Of California | Kinase antagonists |
| WO2008095140A1 (en) * | 2007-01-31 | 2008-08-07 | Bids Trading, L.P. | Electronic block trading system and method of operation |
| GB2467670B (en) | 2007-10-04 | 2012-08-01 | Intellikine Inc | Chemical entities and therapeutic uses thereof |
| EP3613743B1 (en) | 2008-01-04 | 2022-03-16 | Intellikine, LLC | Processes for the preparation of 1h-pyrazolo[3,4-d]pyrimidin-4-amine derivatives |
| US8193182B2 (en) | 2008-01-04 | 2012-06-05 | Intellikine, Inc. | Substituted isoquinolin-1(2H)-ones, and methods of use thereof |
| WO2009102867A1 (en) * | 2008-02-12 | 2009-08-20 | Bids Trading, L.P. | Real-time portfolio balancing and/or optimization system and method |
| US8993580B2 (en) * | 2008-03-14 | 2015-03-31 | Intellikine Llc | Benzothiazole kinase inhibitors and methods of use |
| US8637542B2 (en) | 2008-03-14 | 2014-01-28 | Intellikine, Inc. | Kinase inhibitors and methods of use |
| JP5788316B2 (ja) | 2008-07-08 | 2015-09-30 | インテリカイン, エルエルシー | キナーゼインヒビターおよび使用方法 |
| US20110224223A1 (en) * | 2008-07-08 | 2011-09-15 | The Regents Of The University Of California, A California Corporation | MTOR Modulators and Uses Thereof |
| US8703778B2 (en) | 2008-09-26 | 2014-04-22 | Intellikine Llc | Heterocyclic kinase inhibitors |
| WO2010045542A2 (en) | 2008-10-16 | 2010-04-22 | The Regents Of The University Of California | Fused ring heteroaryl kinase inhibitors |
| US8476431B2 (en) * | 2008-11-03 | 2013-07-02 | Itellikine LLC | Benzoxazole kinase inhibitors and methods of use |
| EP2427195B1 (en) | 2009-05-07 | 2019-05-01 | Intellikine, LLC | Heterocyclic compounds and uses thereof |
| PE20121148A1 (es) | 2009-08-17 | 2012-09-07 | Intellikine Llc | Compuestos heterociclicos y usos de los mismos |
| US8980899B2 (en) | 2009-10-16 | 2015-03-17 | The Regents Of The University Of California | Methods of inhibiting Ire1 |
| CA2799579A1 (en) | 2010-05-21 | 2011-11-24 | Intellikine, Inc. | Chemical compounds, compositions and methods for kinase modulation |
| JP2013545749A (ja) | 2010-11-10 | 2013-12-26 | インフィニティー ファーマシューティカルズ, インコーポレイテッド | 複素環化合物及びその使用 |
| TWI674262B (zh) | 2011-01-10 | 2019-10-11 | 美商英菲尼提製藥股份有限公司 | 製備異喹啉酮之方法及異喹啉酮之固體形式 |
| US9295673B2 (en) | 2011-02-23 | 2016-03-29 | Intellikine Llc | Combination of mTOR inhibitors and P13-kinase inhibitors, and uses thereof |
| MX2014000648A (es) | 2011-07-19 | 2014-09-25 | Infinity Pharmaceuticals Inc | Compuestos heterociclicos y sus usos. |
| WO2013012915A1 (en) | 2011-07-19 | 2013-01-24 | Infinity Pharmaceuticals Inc. | Heterocyclic compounds and uses thereof |
| KR20140075693A (ko) | 2011-08-29 | 2014-06-19 | 인피니티 파마슈티칼스, 인코포레이티드 | 헤테로사이클릭 화합물 및 그의 용도 |
| MX370814B (es) | 2011-09-02 | 2020-01-08 | Univ California | Pirazolo[3,4-d]pirimidinas sustituidas y usos de las mismas. |
| US8940742B2 (en) | 2012-04-10 | 2015-01-27 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
| US8828998B2 (en) | 2012-06-25 | 2014-09-09 | Infinity Pharmaceuticals, Inc. | Treatment of lupus, fibrotic conditions, and inflammatory myopathies and other disorders using PI3 kinase inhibitors |
| MX2015003874A (es) | 2012-09-26 | 2015-12-16 | Univ California | Modulacion de ire1. |
| EP2914296B2 (en) | 2012-11-01 | 2021-09-29 | Infinity Pharmaceuticals, Inc. | Treatment of cancers using pi3 kinase isoform modulators |
| US9481667B2 (en) | 2013-03-15 | 2016-11-01 | Infinity Pharmaceuticals, Inc. | Salts and solid forms of isoquinolinones and composition comprising and methods of using the same |
| WO2014153509A1 (en) | 2013-03-22 | 2014-09-25 | Millennium Pharmaceuticals, Inc. | Combination of catalytic mtorc 1/2 inhibitors and selective inhibitors of aurora a kinase |
| US10769725B1 (en) | 2013-06-05 | 2020-09-08 | Bids Trading, L.P. | System and methods for optimizing the effectiveness of interaction between participants in an electronic trading environment |
| WO2015051241A1 (en) | 2013-10-04 | 2015-04-09 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
| MX2021012208A (es) | 2013-10-04 | 2023-01-19 | Infinity Pharmaceuticals Inc | Compuestos heterocíclicos y usos de los mismos. |
| NZ724368A (en) | 2014-03-19 | 2023-07-28 | Infinity Pharmaceuticals Inc | Heterocyclic compounds for use in the treatment of pi3k-gamma mediated disorders |
| WO2015160975A2 (en) | 2014-04-16 | 2015-10-22 | Infinity Pharmaceuticals, Inc. | Combination therapies |
| WO2016054491A1 (en) | 2014-10-03 | 2016-04-07 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
| EP4585268A3 (en) | 2015-09-14 | 2025-10-15 | Twelve Therapeutics, Inc. | Solid forms of isoquinolinone derivatives, process of making, compositions comprising, and methods of using the same |
| US10759806B2 (en) | 2016-03-17 | 2020-09-01 | Infinity Pharmaceuticals, Inc. | Isotopologues of isoquinolinone and quinazolinone compounds and uses thereof as PI3K kinase inhibitors |
| WO2017214269A1 (en) | 2016-06-08 | 2017-12-14 | Infinity Pharmaceuticals, Inc. | Heterocyclic compounds and uses thereof |
| RU2754507C2 (ru) | 2016-06-24 | 2021-09-02 | Инфинити Фармасьютикалз, Инк. | Комбинированная терапия |
| CN113194752A (zh) | 2018-06-01 | 2021-07-30 | 康奈尔大学 | Pi3k相关疾病或病症的组合疗法 |
| EP4081528A4 (en) * | 2019-12-23 | 2024-03-13 | Sanford Burnham Prebys Medical Discovery Institute | ECTONUCLEOTIDE PYROPHOSPHATASE/PHOSPHODIESTERASE 1 (ENPP1) MODULATORS AND USES THEREOF |
| US20230417751A1 (en) * | 2021-05-13 | 2023-12-28 | Texas Tech University System | Analysis of protein kinases in live cells |
Family Cites Families (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5800992A (en) | 1989-06-07 | 1998-09-01 | Fodor; Stephen P.A. | Method of detecting nucleic acids |
| US5352660A (en) | 1991-10-31 | 1994-10-04 | Mount Sinai Hospital Corporation | Method for assaying for a substance that affects a SH2-phosphorylated ligand regulatory system |
| US5443962A (en) | 1993-06-04 | 1995-08-22 | Mitotix, Inc. | Methods of identifying inhibitors of cdc25 phosphatase |
| US5620676A (en) * | 1994-03-08 | 1997-04-15 | The United States Of America As Represented By The Department Of Health And Human Services | Biologically active ATP analogs |
| US5731343A (en) | 1995-02-24 | 1998-03-24 | The Scripps Research Institute | Method of use of radicicol for treatment of immunopathological disorders |
| US5593997A (en) | 1995-05-23 | 1997-01-14 | Pfizer Inc. | 4-aminopyrazolo(3-,4-D)pyrimidine and 4-aminopyrazolo-(3,4-D)pyridine tyrosine kinase inhibitors |
| US5914393A (en) * | 1995-12-05 | 1999-06-22 | Incyte Pharmaceuticals, Inc. | Human Jak2 kinase |
| US6251911B1 (en) | 1996-10-02 | 2001-06-26 | Novartis Ag | Pyrimidine derivatives and processes for the preparation thereof |
| AU755062B2 (en) * | 1997-02-07 | 2002-12-05 | Princeton University | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates |
| US6100254A (en) | 1997-10-10 | 2000-08-08 | Board Of Regents, The University Of Texas System | Inhibitors of protein tyrosine kinases |
| US6162613A (en) | 1998-02-18 | 2000-12-19 | Vertex Pharmaceuticals, Inc. | Methods for designing inhibitors of serine/threonine-kinases and tyrosine kinases |
| US5965352A (en) | 1998-05-08 | 1999-10-12 | Rosetta Inpharmatics, Inc. | Methods for identifying pathways of drug action |
| DK1140938T3 (da) | 1999-01-11 | 2003-12-22 | Univ Princeton | Højaffinitetsinhibitorer for målvalidering og anvendelser heraf |
| US6610483B1 (en) | 1999-07-23 | 2003-08-26 | Princeton University | Methods for identifying cellular responses attributable to signaling molecule inhibition and inhibitors thereof |
-
1998
- 1998-02-09 AU AU61535/98A patent/AU755062B2/en not_active Ceased
- 1998-02-09 CA CA002279846A patent/CA2279846C/en not_active Expired - Fee Related
- 1998-02-09 WO PCT/US1998/002522 patent/WO1998035048A2/en not_active Ceased
- 1998-02-09 JP JP53499998A patent/JP3784076B2/ja not_active Expired - Fee Related
- 1998-02-09 US US09/367,065 patent/US6390821B1/en not_active Expired - Lifetime
- 1998-02-09 DE DE69825066T patent/DE69825066T2/de not_active Expired - Lifetime
- 1998-02-09 AT AT98906268T patent/ATE271130T1/de not_active IP Right Cessation
- 1998-02-09 EP EP98906268A patent/EP1017823B1/en not_active Expired - Lifetime
-
2000
- 2000-05-10 US US09/568,466 patent/US6521417B1/en not_active Expired - Fee Related
-
2001
- 2001-01-03 US US09/752,723 patent/US20020016976A1/en not_active Abandoned
- 2001-11-01 US US09/985,061 patent/US7026461B1/en not_active Expired - Fee Related
- 2001-11-01 US US09/985,157 patent/US7049116B2/en not_active Expired - Fee Related
-
2004
- 2004-03-24 JP JP2004087151A patent/JP2004248675A/ja not_active Withdrawn
Non-Patent Citations (1)
| Title |
|---|
| SHAH, K. ET AL.: "Engineering unnatural nucleotide specificity for Rous sarcoma virus tyrosine kinase to uniquely label its direct substrates" PROC. NATL. ACAD. SCI. USA, vol. 94, 1997, pages 3565-3570, XP002078191 * |
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6849716B1 (en) | 1998-02-18 | 2005-02-01 | Vertex Pharmaceuticals Incorporated | Methods for designing inhibitors of serine/threonine kinases and tyrosine kinases |
| US6162613A (en) * | 1998-02-18 | 2000-12-19 | Vertex Pharmaceuticals, Inc. | Methods for designing inhibitors of serine/threonine-kinases and tyrosine kinases |
| US8002891B2 (en) | 1998-05-04 | 2011-08-23 | Vertex Pharmaceuticals Incorporated | Crystallization of C-Jun N-Terminal Kinase 3 (JNK3) |
| US7383135B1 (en) | 1998-05-04 | 2008-06-03 | Vertex Pharmaceuticals Incorporated | Methods of designing inhibitors for JNK kinases |
| AU782769B2 (en) * | 1999-07-23 | 2005-08-25 | Princeton University | Methods for identifying cellular responses attributable to signaling molecule inhibition and inhibitors thereof |
| JP2003521890A (ja) * | 1999-07-23 | 2003-07-22 | プリンストン ユニヴァーシティー | シグナル発生分子の阻害に起因し得る細胞応答を同定する方法およびそのインヒビター |
| WO2001007659A3 (en) * | 1999-07-23 | 2001-03-22 | Univ Princeton | Methods for identifying inhibitors of signaling molecules |
| US6610483B1 (en) | 1999-07-23 | 2003-08-26 | Princeton University | Methods for identifying cellular responses attributable to signaling molecule inhibition and inhibitors thereof |
| DE10024174A1 (de) * | 2000-05-17 | 2001-11-29 | Gsf Forschungszentrum Umwelt | Verfahren zum Selektieren von Inhibitoren für Enzyme |
| WO2001088530A3 (de) * | 2000-05-17 | 2002-11-14 | Gsf Forschungszentrum Umwelt | Verfahren zum selektieren von inhibitoren für enzyme |
| US7390808B2 (en) | 2001-04-30 | 2008-06-24 | Vertex Pharmaceuticals Incorporated | Inhibitors of GSK-3 and crystal structures of GSK-3β protein and protein complexes |
| US7666647B2 (en) | 2001-04-30 | 2010-02-23 | Vertex Pharmaceuticals Incorporated | Inhibitors of GSK-3 and crystal structures of GSK-3β protein and protein complexes |
| US7883881B2 (en) | 2001-04-30 | 2011-02-08 | Vertex Pharmaceuticals Incorporated | Inhibitors of GSK-3 and crystal structures of GSK-3β protein and protein complexes |
| US8318467B2 (en) | 2001-04-30 | 2012-11-27 | Vertex Pharmaceuticals Incorporated | Inhibitors of GSK-3 and crystal structures of GSK-3β protein and protein complexes |
| WO2003105723A3 (en) * | 2002-06-14 | 2005-09-09 | Salk Inst For Biological Studi | CAFEIC ACID / 5-HYDROXYFERULIC ACID 3/5-O-METHYLTRANSFERASES (COMT) OF MUTANT PLANTS, METHODS OF PREPARATION AND USE |
| EP1572097A4 (en) * | 2002-09-30 | 2010-02-17 | Smithkline Beecham Corp | NUCLEOSIDE DERIVATIVES FOR THE TREATMENT OF INFECTIONS WITH THE HEPATITIS C-VIRUS |
| US7452893B2 (en) | 2003-08-15 | 2008-11-18 | Merck & Co., Inc. | 4-cycloakylaminopyrazolo pyrimidine NMDA/NR2B antagonists |
| WO2005019221A1 (en) * | 2003-08-15 | 2005-03-03 | Merck & Co., Inc. | 4-cycloalkylaminopyrazolo pyrimidine nmda/nr2b antagonists |
| US12215108B2 (en) | 2022-01-10 | 2025-02-04 | Southern Research Institute | Development of potential antidotes for arsenicals |
Also Published As
| Publication number | Publication date |
|---|---|
| WO1998035048A3 (en) | 1999-01-07 |
| MX9907317A (es) | 2002-09-02 |
| JP3784076B2 (ja) | 2006-06-07 |
| JP2004248675A (ja) | 2004-09-09 |
| US7026461B1 (en) | 2006-04-11 |
| AU755062B2 (en) | 2002-12-05 |
| EP1017823A2 (en) | 2000-07-12 |
| AU6153598A (en) | 1998-08-26 |
| US6390821B1 (en) | 2002-05-21 |
| US20020016976A1 (en) | 2002-02-07 |
| CA2279846A1 (en) | 1998-08-13 |
| EP1017823B1 (en) | 2004-07-14 |
| US7049116B2 (en) | 2006-05-23 |
| DE69825066D1 (de) | 2004-08-19 |
| DE69825066T2 (de) | 2005-08-25 |
| ATE271130T1 (de) | 2004-07-15 |
| US20020146797A1 (en) | 2002-10-10 |
| JP2002503953A (ja) | 2002-02-05 |
| CA2279846C (en) | 2008-06-03 |
| US6521417B1 (en) | 2003-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1017823B1 (en) | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates | |
| AU779008C (en) | High affinity inhibitors for target validation and uses thereof | |
| Hunter | 1001 protein kinases redux—towards 2000 | |
| Yang et al. | An SH3-binding Site Conserved in Bruton's Tyrosine Kinase and Related Tyrosine Kinases Mediates Specific Protein Interactions in Vitro and in Vivo (∗) | |
| US20080213900A1 (en) | Engineered Protein Kinases Which Can Utilize Modified Nucleotide Triphosphate Substrates | |
| Yadav et al. | The evolutionarily conserved arrangement of domains in SRC family kinases is important for substrate recognition | |
| US6495353B1 (en) | Human orthologues of wart | |
| EP1607481A1 (en) | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates | |
| MXPA99007317A (en) | Engineered protein kinases which can utilize modified nucleotide triphosphate substrates | |
| EP1321467A2 (en) | High affinity inhibitors for target validation and uses thereof | |
| Sun et al. | The structural basis of localizing polo-like kinase to the flagellum attachment zone in Trypanosoma brucei | |
| McAllister-Lucas | The multidomain structure of acGMP-binding, cGMP-specific phosphodiesterase | |
| Merrill et al. | Protein kinases and phosphatases | |
| Wan | Role of tyrosine kinases in G protein signaling | |
| McNeill III | Characterization of binding proteins for Ca (2+)/calmodulin-dependent protein kinase II in postsynaptic density | |
| Lowry | Novel G protein signaling through non-receptor tyrosine kinases | |
| Kesavan | Identification and characterization of the sites of mitotic serine phosphorylation in Lck | |
| Lemrow | Investigating the mechanism involved in the nuclear entry of CaMKIV | |
| Corcoran | Identification and characterization of a calcium/calmodulin-dependent protein kinase cascade in the nematode, Caenorhabditis elegans | |
| Heist | Activation, translocation and function of nuclear CaM kinase II | |
| Lu | Control of cell proliferation by calcium and calmodulin in eukaryotes: a molecular genetic approach | |
| Korniotis | Expression studies of recombinant cAMP-specific phosphodiesterase type 4 | |
| Jiang | Characterization of R-PTP kappa, a receptor protein tyrosine phosphatase which mediates homophilic cell binding |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AL AU BA BB BG BR CA CN CU CZ EE GE GW HU ID IL IS JP KP KR LC LK LR LT LV MG MK MN MX NO NZ PL RO SG SI SK SL TR TT UA US US UZ VN YU |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| ENP | Entry into the national phase |
Ref document number: 2279846 Country of ref document: CA Ref country code: CA Ref document number: 2279846 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/1999/007317 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 61535/98 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1998906268 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 09367065 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 1998906268 Country of ref document: EP |
|
| WWG | Wipo information: grant in national office |
Ref document number: 61535/98 Country of ref document: AU |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1998906268 Country of ref document: EP |