MXPA99007317A - Engineered protein kinases which can utilize modified nucleotide triphosphate substrates - Google Patents

Abstract

Engineered protein kinases which can utilize modified nucleotide triphosphate substrates that are not as readily utilized by the wild-type forms of those enzymes, and methods of making and using them. Modified nucleotide triphosphate substrates and methods of making and using them. Methods for using such engineered kinases and such modified substrates to identify which protein substrates the kinases act upon, to measure the extent of such action, and to determine if test compounds can modulate such action. Also engineered forms of multi-substrate enzymes which covalently attach part or all of at least one (donor) substrate to at least one other (recipient) substrate, which engineered forms will accept modified substrates that are not as readily utilized by the wild-type forms of those enzymes. Methods for making and using such engineered enzymes. Modified substrates and methods of making and using them. Methods for using such engineered enzymes and such modified substrates to identify the recipient substrates the enzymes act upon, to measure the extent of such action, and to measure whether test compounds modulate such action.

Description

PROTEINS CINASSAS DESIGNED BY ENGINEERING THAT CAN USE MODIFIED TRIFOSPHATE SUBSTRATES NUCLEOTIDE The US Government has a paid license in this invention and the right in limited circumstances to require the patent owner to license others, under the terms of the NSF Concession No. MCB9506929 and DHHS Concession NCI No. RO1 CA70331-01.

I. FIELD OF THE INVENTION The present invention belongs to the field of Biotechnology. More specifically, the invention is in a field often referred to as Enzyme Engineering, in which the amino acid sequences of the enzymes of interest are changed by means of genetic alterations or other means to alter or improve their catalytic properties. The embodiments of the invention described below include methods in the fields of genetic engineering and enzymology, and more particularly, the design of protein kinases and other enzymes of multiple substrates, including inhibition of said enzymes, and to materials, techniques and uses. related II. BACKGROUND OF THE INVENTION It is obvious that communications between cell and cell in a multicellular organism must be rapid, and that they must be able to allow one cell to respond to another in diverse and complex ways. Typically, the intracellular signals used are molecules termed "ligands," and a given ligand can bind to a particular type of receptor on the surface of those cells that are to receive that signal. But this simple binding of ligand alone is not enough to provide the complex responses that recipient cells require to make. Therefore, cells amplify and add complexity to this signal by complex mechanisms often cascading, leading to rapid modulation of catalytic activities within the cell, which in turn can produce complex intracellular responses, sometimes dramatic This process as a whole, from the initial binding of ligand to the termination of the intracellular response, is called "signal translation". Signal translation is often accompanied by the activation of intracellular enzymes that can act on other enzymes and change their catalytic activity. This can lead to increases or decreases in the activity of certain metabolic pathways, or can even lead to large intracellular changes, for example, the initiation of specific patterns of gene expression. The ability of an enzyme to alter the activity of other enzymes generally indicates that the enzyme is involved in the translation of cellular signal. The most common covalent modification used in the signal translation process is phosphorylation, which results in the alteration of the activity of those enzymes that are transformed into phosphorylated enzymes. This phosphorylation is catalyzed by enzymes known as protein kinases, which are often referred to simply as "kinases". Several key features of the kinases make them ideally suited as signaling proteins. One of them is that they frequently have translatable specificities of the target substrate, which allows "interference" between different signaling routes, thus allowing the integration of different signals (1). It is thought that this is the result of the need for each kinase to phosphorylate various substrates before provoking a response, which in turn provides many types of diverse signaling results. For example, a given kinase can in one case transmit a growth inhibition signal and otherwise transmit a growth promotion signal, depending on the structure of the extracellular ligand that has bound to the cell surface (2). A second key feature is that the kinases are organized into several modular functional regions or "domains" (3). A domain known as "SH3" is a region rich in proline, 55-70 amino acids long, and another, known as "SH2" is a phosphotyrosine binding region of approximately 100 amino acids in length. It is believed that these two domains are involved in the recognition and binding to protein substrates. The third domain, "SH1", is comprised of approximately 270 amino acids, and is the domain responsible for catalysis. It also contains the binding site for the nucleoside triphosphate which is used as an energy source and phosphate donor (3). Other domains, including myristylation and palmitylation sites, together with SH2 and SH3, are responsible for the assembly of multiprotein complexes that guide the catalytic domain towards the correct targets (3, 22, 23). The molecular recognition performed by the different domains has been studied using X-ray diffraction and using NMR methods (24-28). It seems that these domains have been mixed and matched through evolution to produce the large "family" of protein kinases. It is thought that up to 1000 kinases are encoded in the mammalian genome (4), and more than 250 kinases have already been identified. The large number of kinases and the large number of enzymes modulated by phosphorylation, which are known to exist within cells, allow rapid signal amplification and multiple regulatory points. A third key feature of kinases is their speed. The kinetics of phosphorylation and dephosphorylation is extremely rapid in many cells (on a millisecond time scale), giving rapid responses and short recovery times, which in turn makes possible the repeated transmission of signals (5).

These characteristics of the kinases have apparently led to their use in a large array of different intracellular signal translation mechanisms. For example, growth factors, transcription factors, hormones, regulatory proteins of the cell cycle, and many other classes of cellular regulators use tyrosine kinases in their signaling cascades (12, 13). Tyrosine kinases catalytically bind a phosphate to one or more tyrosine residues on their protein substrates. Tyrosine kinases include proteins with many diverse functions including the cell cycle control element c-abl (14-16), epidermal growth factor receptor containing a cytoplasmic tyrosine kinase domain (12), c-src, a tyrosine kinase without receptor involved in many immune cell functions (13), and Ty 2, a cytoplasmic tyrosine kinase that is involved in the phosphorylation of the p91 protein that is transposed to the nucleus by receptor stimulation and functions as a transcription factor (17) . Serine / threonine kinases are a large part, if not all, of the rest of the kinase family; they catalytically phosphorylate serine and threonine residues in their protein substrates, and have similarly diverse functions. They share homology in the catalytic domain of 270 amino acids with tyrosine kinases. As such, although the following discussion focuses more particularly on tyrosine kinases, the discussion is also generally applicable to serine / threonine kinases. Unfortunately, the many features that make kinases useful in signal translation, and that have evolved them to become fundamental for almost any cellular function, also make it very difficult, if not impossible, to study and understand them. Their overlapping protein specificities, their structural and catalytic similarities, their great number and their great rapidity, make it very difficult, almost impossible, the specific identification of their protein substrates in vivo using the current techniques of Genetics and Biochemistry. Today this is the main obstacle to deciphering the signaling cascades involved in the translation of tyrosine kinase mediated signals (4, 6-8). Efforts to analyze the participation of specific tyrosine kinases in the signal translation cascades have been thwarted, due to their apparent lack of specificity for the substrate protein in vitro and in vivo (4, 8). The catalytic domains of tyrosine kinases possess little or no inherent specificity for the substrate protein, as demonstrated by domain permutation experiments (18-23). The catalytic domain of a tyrosine kinase can be substituted into a different tyrosine kinase with little change in specificity for the substrate protein of the latter (22). The low in vitro specificity of kinases also makes it difficult, if not impossible, to extrapolate what might be the in vivo function of certain kinases. An isolated tyrosine kinase of interest will frequently phosphorylate many test protein substrates with equal efficacy (29). This substrate specificity, apparently low, is also found in vivo; for example, many genetic approaches such as gene-nullification experiments, do not give interpretable phenotype due to compensation by means of other cellular tyrosine kinases (30, 31). Another complication is that it has been proposed that many tyrosine kinases phosphorylate at one end and on the other at proteins that are by themselves tyrosine kinases; Although this seems to make possible the existence of complex positive feedback circuits, it also makes it even more difficult to analyze the cascade (1). A very important way to decipher function and to understand the function of enzymes, both in vitro and in vivo, is the use of specific enzyme inhibitors. If one or more compounds that inhibit the enzyme could be found, the inhibitor can be used to modulate the activity of the enzyme, and the effects of that decrease can be observed. These approaches have been of great help in deciphering many of the routes of intermediate metabolism, and have also been important in learning the kinetics of enzymes and determining catalytic mechanisms. In addition, said inhibitors are among the most important known pharmaceutical compounds. For example, aspirin (acetylsalicylic acid) is one such inhibitor. It inhibits an enzyme that catalyzes the first step in the synthesis of prostaglandin, thus inhibiting the formation of prostaglandins, which are involved in the production of pain (72). The traditional discovery of drugs can be characterized as the design and modification of compounds specifically designed to bind to a disease-causing protein and inactivate it; the relative success of this effort depends on the selectivity of the drug for the target protein and its lack of inhibition of enzymes not associated with the disease and with similar enzymatic activities. Such approaches would seem promising ways to develop cancer treatments, since many human cancers are caused by deregulation of a normal protein (for example when a proto-oncogene is converted to oncogene by gene transposition). In addition, given that kinases are key regulators, they have been found to be very common proto-oncogenes, and therefore ideal targets for drug design. The method of designing selective inhibitors is relatively simple in cases in which few similar enzymes are present in the target organism, for example, in cases in which inhibitors of a single protein for bacteria can be directed. However, unfortunately the similarities between the kinases and their large number have almost completely frustrated the discovery and design of specific inhibitors, and have hampered most of the development expectations of specific pharmaceutical treatments directed at the proto-oncogene level. It is expected that the vast majority of candidate inhibitors will inhibit multiple kinases, even if they were initially identified as inhibitors of a particular purified kinase. However, this does not mean that inhibitors can not be found with at least some degree of kinase specificity. Several natural products have been identified that are relatively specific for particular families of kinases, but attempts to derive general rules about inhibiting kinases based on them have failed. In addition, as the following examples show, the specificity in most cases is very limited. For example, it was reported that the Damnacantal compound was a "very potent selective inhibitor" of the p561ck kinase (73); as shown in Figure 2A, this compound has an inhibition constant (IC50) for that kinase, which is almost seven times lower than for the src kinase (the IC50 is the concentration of inhibitor that must be added to reduce the activity catalytic in 50%). The PPI compound (Figure 2B) has a binding affinity for the Ick kinase that is very strong (IC50 = 0.005 μM); but unfortunately, the inhibition of other kinases of the src family is very similar. It inhibits the fyn kinase with an almost identical IC50, 0.006 μM, and has an IC50 only about 4 times higher for the hck kinase (IC50 = 0.020 μM). It has been reported that the compound CGP 57148 (Figure 2C) is "semi-selective" for the abl kinases (IC50 = 0.025 μM) and PDGFR (IC50 = 0.030 μM) (74). However, when considering the large number of kinases and their relative cellular importance, and also considering that the inhibitors described above have been reported only in the last two years, it seems that the success in the discovery or design of selective kinase inhibitors has been remarkably limited. These difficulties have implications beyond the mere frustration of scientists; They have thwarted efforts to decipher cascades of kinases and the function of individual kinases in cascades and other cellular mechanisms. Such understanding of the activity and function of kinases may be essential before certain human diseases can be effectively treated, prevented or cured. For example, it has been known for more than 30 years that the bcr-abl oncogene is a protein kinase that is responsible for chronic myelogenous leukemia; but the physiological substrates on which they act to cause oncogenesis, which may be important objectives of drug design, have not yet been definitively identified (11). On the bright side, despite this drawback, it is now reported that the inhibitor described above CGP 57148, is being subjected to clinical trials for use in the treatment of myelogenous leukemia, even though the substrates for which it can block phosphorylation in vivo are not known. The medical significance of these difficulties is further illustrated by the Rous sarcoma virus (RSV), which has become an important model system for studying the role of kinases in oncogenesis. The RSV transformation of fibroblasts is controlled by a single viral gene product, the protein tyrosine kinase v-src (32). It is the rapid course of time and the dramatic morphological changes during the transformation of fibroblasts by RSV, which has made the RSV a paradigm for studies of the activity of oncogenes in all cells. The origin (33), regulation (3, 8, 34, 35), and structure (25, 27, 36) of v-Src have been studied extensively and are well understood (8, 37, 38). But the central questions about this intensely studied kinase remain unanswered: what are its direct cellular substrates ?, the inhibition of its catalytic activity effectively inhibits, or even reverses, the transformation? This inhibition should be an effective therapy or prophylaxis against transformation by RSV ?. Unfortunately, as described above, the answers to these questions are not close, mainly because the number of cell kinases is enormous (it is estimated that 2% of the mammalian genome encodes protein kinases (4)), and because tyrosine kinases exhibit specificities of substrate that are translatable (, 39) and share catalytic domains, making the design of specific inhibitors very difficult. The expression of v-Src in fibroblasts originates the phosphorylation of torosine of more than 50 cellular proteins (37). These same substrates are also phosphorylated by other kinases in untransformed fibroblasts (40). Even the most sophisticated biochemical and genetic techniques, including anti-phosphotyrosine protein blots of transformed fibroblasts, transfection of fibroblasts with defective v-Src mutants of transformation, temperature-sensitive v-Src mutants, studies of cancellation of genes of cellular Src , Src mutants dependent on host range, anti-v-Src immunoprecipitation, and the use of specific kinase inhibitors, have not produced clear identification of the direct substrates of v-Src (see reference (38) for a comprehensive review). ). But this situation is not unique; in fact, direct substrates for most cell kinases remain unidentified (8). In addition, as mentioned above, there are also remarkably few known compounds that selectively inhibit individual kinases, or even groups of related kinases. Although the mentioned difficulties are discouraging, the new methods of rational design of drugs and combinatorial organic synthesis make feasible the design or discovery of specific kinase inhibitors given the sufficient resources. However, because kinase networks are highly degenerate and interconnected in unknown ways, there is considerable uncertainty regarding many diseases to which inhibition must be directed. Furthermore, it is by no means clear whether a specific inhibitor of a given kinase will have any effect on the disease, either in vitro or in vivo. As the kinases can be highly promiscuous, there is a significant likelihood that the inhibition of one kinase will simply force another kinase to "take its place". Therefore, there is a need in a simple and direct way to determine the biochemical and cellular effects of the inhibition of a given kinase, before making great efforts to design or discover specific inhibitors. From the above, it is clear that there has been a very felt but unsatisfied need for means to identify which cellular proteins act on the individual protein kinases. Such a method would ideally also allow the quantitative measurement of the relative activity of a given kinase on its protein substrates, which can be used, for example, to detect whether actual or potential active compounds can modulate kinase activity, and how they do so . In addition, there has also been a need for specific inhibitors of individual kinases or kinase families, which can be used to identify protein substrates (observing which proteins are not phosphorylated or are weakly phosphorylated in the presence of the inhibitor), to study the biochemical and phenotypic effects of the rapid negative regulation of the activity of a given kinase, to be used as drugs for the treatment of kinase-mediated diseases, and to confirm the utility of the tedious efforts to design or develop more traditional inhibitory drugs. As described in considerable detail below, the present invention provides for the first time a method for the highly specific inhibition of individual kinases, which have been designed to bind to the inhibitor more easily than the wild-type form of that kinase or other non-kinases. designed The invention also provides the designed kinases and the inhibitors for which they are adapted. Furthermore, as will be apparent, this method is applicable even more broadly, since it would give similar advantages for the study of other enzymes which, like the kinases, covalently bind to part of at least one substrate with at least one other substrate. The present invention includes the engineering of kinases and other multi-substrate enzymes so that they can bind inhibitors that do not bind so easily to their wild-type forms. Modified substrates and mutant enzymes that can bind to them have been used to study an elongation factor (41) and a receptor for cyclophilin A (42). However, prior to the present invention, it was not known how, or even if multiple substrates enzymes that covalently bind all or part of a donor substrate with a receiving substrate, could be engineered to bind to an inhibitor, still retaining at least some catalytic activity and at least some specificity for the receiving substrate in the absence of the inhibitor. The present invention is that this can be done, as explained below; and this invention for the first time opens the door to the selective inhibition of individual kinases, which is not only an important tool to understand the cascades of kinases and other complex cellular catalytic mechanisms, but can also provide possible ways to achieve therapeutic intervention in diseases where those mechanisms come into play. lll BRIEF DESCRIPTION OF THE INVENTION The present invention provides a solution to the aforementioned problems by providing materials and methods by means of which a single protein kinase can be specifically inhibited, without the simulataneous inhibition of other protein kinases. In a first aspect, the present invention includes the design of kinases and other enzymes of multiple substrates in such a way that they can use modified substrates that are not so easily used by their wild-type forms. The invention also provides such chemically modified nucleotide triphosphate substrates, methods for preparing them and methods for using them. The methods of the present invention include methods for using the modified substrates together with the kinases designed to identify on which protein substrates the kinases act, for measuring the magnitude of said action and for determining whether said action can be modulated by test compounds. In a further aspect, the invention provides designed r protein kinases that can bind to inhibitors that do not bind so easily to the wild-type forms of said enzymes. Methods for preparing and using all these engineered kinases are also provided. The invention also provides such inhibitors, methods for preparing them and methods for using them. The methods of the present invention include methods for using the inhibitors together with the kinases designed to identify on which protein substrates the kinases act, for measuring the kinetics of said action, and for determining the biochemical and cellular effects of said inhibition. It also relates to the use of said inhibitors and engineered kinases to elucidate which kinases may be involved in disease; these kinases may then become the subject of efforts to design or discover more traditional specific inhibitors of their wild type forms, which may be valuable in the treatment of diseases or disorders related to the kinase. In addition, methods are provided for inserting the designed kinase into whole cells or animals, preferably in place of the corresponding wild-type kinase, and then using the inhibitor for which it has been adapted as a tool to study the disease-kinase relationship, and finally, as a drug for the treatment of the disease. The present invention also more generally relates to designed forms of multiple substrate enzymes that covalently bind all or part of at least one substrate (donor) to at least one other substrate (receptor). The designed forms will accept modified substrates and inhibitors that do not bind so readily to the wild-type forms of such enzymes. The invention also relates to methods for preparing and using said engineered enzymes, as well as modified donor substrates. The methods of the present invention include methods for using modified substrates and inhibitors together with enzymes designed to identify on which substrates the enzymes act, to measure the kinetics of said action, and in the case of modified substrates, to determine the receptor substrates to which it is possible to unite all or part of the donor substrate, to measure the magnitude of said action, and to identify and measure the magnitude of the modulation thereof with test compounds. In the case of inhibitors, the methods seek to determine the biochemical and cellular effects of said inhibition. The methods also extend to the use of said inhibitors and enzymes designed to elucidate which enzymes may be involved in the disease; these enzymes may become the subject of efforts to design or discover specific inhibitors of their wild-type forms, which may be valuable in the treatment of diseases or disorders related to the enzyme. further, methods are provided for inserting the designed enzyme into whole cells or animals, preferably in place of the corresponding wild-type enzyme, and then using the inhibitor for which it has been adapted as a tool to study the disease-enzyme relationship, and finally , as a drug for the treatment of the disease. According to the invention, a structural distinction can be made by enzymatic engineering between the nucleotide binding site of a protein kinase of interest, and the nucleotide binding sites of other kinases. This distinction allows the designed kinase to use a nucleotide triphosphate or an inhibitor that does not bind so easily to the wild-type form of that kinase, or to other kinases. In a preferred embodiment with respect to the inhibitor, the inhibitor used is one that is "orthogonal" to the natural nucleotide triphosphate substrate for that kinase, or is orthogonal to a less specific inhibitor (e.g., one that binds easily to the form wild type of that kinase). The term "orthogonal", as mentioned below, means that the substrate or inhibitor is of similar structure (including those that are geometrically similar but not chemically similar, as described below), but differs in a way that limits its capacity to join the wild type form. A designed kinase prepared in accordance with the present invention will be capable of using an orthogonal nucleotide triphosphate substrate that is not so easily used by other, undesigned kinases present in the cells. Preferably, it will be able to use an orthogonal nucleotide triphosphate that is not used substantially by other kinases; and more preferably, it will be able to use an orthogonal nucleotide triphosphate substrate that can not be used by other kinases. By labeling the phosphate on the orthogonal substrate, for example, using radioactive phosphorus (32P), and then adding that labeled substrate to cells or permeabilized cell extracts, the protein substrates of the designed kinase will become labeled, while the protein substrates of the other kinases will be at least marked to a lesser degree; preferably, the protein substrates of the other kinases will not be marked substantially, and most preferably, will not be marked at all. The detailed description and the examples provided below describe the use of this strategy to uniquely label the direct substrates of the tyrosine kinase prototype, v-Src. A difference in amino acid sequence has been made by protein engineering that imparts a new structural distinction between the modified nucleotide binding site of the modified v-Src and that of other kinases. The v-Src kinase that the authors of the present invention have designed recognizes an ATP analogue (ATP), N ^ - (cyclopentyl) ATP, which is orthogonal to the nucleotide substrate of the wild-type kinases. The generation of a v-Src mutant with specificity for an orthogonal A * TP substrate allows the direct substrates of v-Src to be radiolabelled using [gamma-32P] N6- (cyclopentyl) ATP, because it is capable of serve as a substrate for the designed v-Src kinase, but substantially it is not able to serve as a substrate for other kinases. The detailed description and the examples provided below describe the use of this strategy to uniquely identify the direct substrates of the tyrosine kinase prototype, v-Src. A chemical difference has been made by protein engineering in the amino acid sequence that imparts a new structural distinction between the nucleotide binding site of the modified v-Src and that of all other kinases. The designed v-Src kinases that have been prepared and presented here bind to an orthogonal analog of the more general PP3 kinase inhibitor: the compound N04 cyclopentoii PP3. The generation of a v-Src mutant with specificity for said inhibitor allows the inhibition of the mutant, while other kinases in the same test system are not substantially inhibited, not even the wild-type form of that same kinase. As is evident from the foregoing, an object of the present invention is to provide a mutant protein kinase accepting an orthogonal nucleotide triphosphate analog as a phosphate donor substrate. Another object of the present invention is to provide a nucleotide sequence encoding said mutant protein kinase; and also provide a method for producing said nucleic acid sequence. Also, an object of the invention is to provide methods for producing said mutant protein kinase, for example, by expressing said nucleic acid sequence. Also, an object of the present invention is to provide said orthogonal nucieotide triphosphates and methods for their synthesis, including N6- (cyclopentyl) ATP, N6- (cyclopentyloxy) ATP, N6- (cyclohexyl) ATP; N6- (cyclohexyloxy) ATP, N6- (benzyl) ATP, N6- (benzyloxy) ATP, N6- (pyrrolidino) ATP, and N6- (piperidino) ATP (27). Another object of the invention is to provide a method for determining whether a test compound positively or negatively modulates the activity of a protein kinase with respect to one or more protein substrates. More particularly, and in accordance with a further aspect of the invention, a primary object is to provide a mutant protein kinase that binds to and inhibits an inhibitor; said inhibitor binds or inhibits less readily than the corresponding wild-type kinase. A further object of the present invention is to provide a nucleotide sequence encoding said mutant protein kinase; and a further object is to provide a method for producing said nucleic acid sequence. Also, an object of the invention is to provide methods for producing said mutant protein kinase, for example, by expressing said nucleic acid sequence. Another object of the present invention is to provide said inhibitors, such as the compound N-4 cyclopentoyl PP, and methods for their synthesis. Another object is to provide a method to determine which substrates are for a given protein kinase. Another object of the invention is to provide a method for determining whether the specific inhibition of a particular kinase produces a biochemical or phenotypic effect in a test system such as an extract free of cells, cell cultures, or living multicellular organisms. A further object of the invention is to provide a method for determining whether the inhibition of a particular kinase can have therapeutic value in the treatment of disease. Another object is to provide methods for studying the activity, kinetics and catalytic mechanisms of a kinase by studying the inhibition of the corresponding mutant of the present invention. A further object is to provide methods of prevention and treatment of kinase-mediated diseases by introducing a mutant kinase adapted to the inhibitor of the present invention in a diseased organism, and preferably by reducing, or more preferably, depleting the wild-type enzyme of the organism; and then administering the inhibitor to regulate the activity of the now mutant kinase mediator of the disease, in such a manner as to diminish or eliminate the cause or symptoms of the disease. Based on the foregoing and the detailed description of the present invention provided below, a person of ordinary skill in the art will readily recognize that the present invention can be more generally used to study multiple substrate enzymes that covalently transfer a donor substrate or portion. from it to a receiving substrate, as do the kinases. Said applications of the present invention will also be described in the following detailed description. Accordingly, an object of the present invention is also to provide a multi-substrate mutant enzyme that binds to an inhibitor that binds less readily to the wild-type enzyme or to other enzymes with similar activity. Another object of the invention is to provide a nucleotide sequence encoding said mutant enzyme of multiple substrates; and an "additional object" is to provide a method for producing said nucleic acid sequence. Also, an object of the present invention is to provide methods for producing said mutant enzyme from multiple substrates, for example, by expressing said nucleic acid sequence. Also, an object of the present invention is to provide said inhibitors, and methods for their synthesis. Another object is to provide a method for determining which substrates are for a given multiple substrate enzyme. Another object of the invention is to provide a method for determining whether the specific inhibition of a particular multi-substrate enzyme produces a biochemical or phenotypic effect in a test system such as cell-free extracts., cell cultures or living multicellular organisms. A further object of the invention is to provide a method for determining whether the inhibition of a particular multiple substrate enzyme could have a therapeutic value in the treatment of disease. Another object is to provide methods for the study of the activity, kinetics and catalytic mechanisms of a multiple substrate enzyme by studying the inhibition of the corresponding mutant of the present invention. Another object is to provide methods for the prevention and treatment of diseases mediated by multiple substrate enzymes, by introducing a multiple substrate enzyme adapted to the inhibitor of the present invention in a diseased organism, and preferably by reducing, or more preferably, depleting the enzyme from the organism. wild type; and then administering the inhibitor to regulate the now mutant enzyme mediating the disease, in such a manner as to diminish or eliminate the cause or symptoms of the disease. These and other objects of the present invention will become apparent to those of ordinary skill in the art, starting from the detailed description, the examples and the claims indicated below.

IV. BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a schematic representation of the protein domain structures of v-Src, of XD4 (which has a deletion of residues 77-225), of the fusion protein glutathione S-transferase (GST) -XD4, and of the double mutant of the GST-XD4 fusion protein (V323A, I338A). Figure 2 is a schematic representation of adenosine triphosphate (ATP), with an "X" attached to the N6 position; and in the lower table, schematic representations of the twelve lateral chains that take the place of "X" in each of the orthogonal analogues of ATP described in the examples (which are always referred to by numbers 1-12 indicated in letters) are provided. bold font). Figure 3 is an anti-phosphotyrosine immunoblot showing the level of protein tyrosine phosphorylation after treatment of a lysate of murine lymphocyte cells with ATP or one of the ATP analogs (A * TPs). Figure 4 provides an approach view of the X-ray model showing the binding domain of ATP in cAMP-dependent protein kinase (1ATP). Figure 5 shows (a) an anti-phosphotyrosine blot of cell lysates expressing XD4 and GST-XD4 (V323A, I338A), (b) an autoradiogram showing phosphorylation levels when cell lysates are provided only with radiolabeled ATP or only radiolabeled N6 (cyclopentyl) ATP, and (c) an autoradiogram showing autophosphorylation of GST-XD4 and GST-XD4 (V323A, I338A) by radiolabeled ATP and radiolabeled N6 (cyclopentyl) ATP (A * TP (8)). Figure 6 is a bar graph showing the relative degree to which ATP and each of the twelve ATP analogs inhibit phosphorylation catalyzed by GST-XD4 and GST-XD4 (V323A, I338A) by means of radiolabeled ATP. Figure 7 shows autoradiograms indicating autophosphorylation levels by several single mutants of position 338 of v-Src provided with radiolabelled ATP and radiolabelled N6 (cyclopentyl) ATP as a phosphate donor substrate. Figure 8 is a schematic diagram of a method of the present invention for determining which phosphorylated substrates in the cells were phosphorylated by a particular kinase, here v-src. Figure 9 is a schematic diagram of how a designed kinase of the present invention can be inhibited by an inhibitor of the present invention, even in the presence of other kinases, and can be used to reveal the protein substrates of the kinases. Figure 10 shows the chemical structures of three known kinase inhibitors, Damnacantal, PPI and CGP 57148, together with summaries of their inhibition constants (IC50) for various kinases.

Figure 11A shows the structure of adenosine core and PP3. Figure 11B shows the structures of several bulky substituents that can be added to the nitrogen N4 of PP3 to produce candidate inhibitor compounds whose IC50 values are listed in Table 1. Figure 12 shows the chemical structure of N-4 cyclopentoyl PP3 , and autoradiograms of proteins subjected to electrophoresis that have been radiolabelled in the presence of N-4 cyclopentoyl PP- in the presence of wild-type v-Src or the mutant (I338G); Figures 13A-C are graphs showing additional inhibitor analogues prepared and tested in accordance with the present invention. Figure 14A is a schematic representation of the specificity problems associated with the use of small molecule protein kinase inhibitors to decipher cell signaling. The kinase catalytic domains (red ovals) are highly conserved. In this way, most potent inhibitors block the activity of closely related kinases and widely downregulate the routes mediated by kinase activity. b) Schematic representation of the approach towards the selective inhibition of protein kinase. A mutation is introduced that causes a space at the ATP binding site of the kinase of choice (Src). This mutation creates an active site cavity (notch) in Src that can be recognized only by a rationally designed small molecule inhibitor. This inhibitor contains a bulky chemical group (bulge) that makes it orthogonal to wild-type protein kinases. The design of the complementary kinase / inhibitor allows the highly selective inhibition of the target kinase in the context of a whole cell. Figure 15A is the structure of N-6-cyclopentyloxyadenosine (1). b) represents the synthesis of pyrazolo inhibitor analogs [3, 4-d] pyrimidine. It was synthesized 2 according to Hanefeld et al., (I) RCOCI (10 equivalents), pyridine, 5 ° C, 1 hr.; then heat to 22 ° C, 1 hr; (ii) LIAIH4 (3.0 equivalents), dry THF under argon, 0 ° C, 30 min; then heat to reflux for 30 minutes. All compounds were characterized by 1 H NMR (300 MHz) and high resolution mass spectroscopy (MS). Figure 16 a) represents the chemical structures of quercetin (5) and AMP PNP (6). b) Predicted binding orientation of 2 in active sites of the src family of kinases. The crystal structures of Hck bound to AMP PNP (red) and Hck bound to quercetin (blue) were superimposed according to the protein skeleton of Hck (white). The structure of 2 (yellow) was subsequently lowered to the active site of kinase by overlaying the pyrazolo [3,4-d] pyrimidine ring system of 2 on the adenine ring of AMP PNP. c) Near predicted contact between N-4 of 2 and the side chain of residue 338 in the family of src kinases. Molecule 2 has been debased at the ATP binding site of the src kinase family, Hck, as in Figure 3b. The atoms of the threonine side chain 338 and 2 are colored according to their elemental formation (green = carbon, blue = nitrogen, red = oxygen, white = hydrogen) and the skeleton of Hck is shown in purple.

The methyl hydrogens of the threonine side chain are not shown. The images were generated using the Insight II program. Figure 17 shows that the inhibitor 3g analog does not inhibit receptor-mediated tyrosine phosphorylation of B cells. Murine spleen cells were incubated with 1.1% DMSO (lanes 1-2), 100 mM 3g in 1.1% DMSO (lane) 3), or 2 100 mM in DMSO 1.1% (lane 4). Stimulation by B cells (lanes 2-4) was initiated by the addition of 10 mg / ml goat anti-mouse IgM. The cellular proteins were resolved by 10% PAGE, transferred to nitrocellulose and immunoblotted with a monoclonal antibody to phosphotyrosine (4G10). Figure 18 shows that 3g blocks p36 phosphorylation in v-Src I338G, but not in NIH3T3 fibroblasts transformed with WT v-Src. Unreacted NIH3T3 cells (lane 1), NIH3T3 cells transformed with WT v-Src (lanes 2-3), and NIH3T3 cells transformed with v-Src I338G (lanes 4-5) with DMSO 1.1% (lanes 1, 2) were incubated. and 4) or 100mM 3g in 1.1% DMSO (lanes 3 and 5). After 12 hours, it is smooth to the cells. Phosphorylation levels were determined as in Figure 4. Figure 19 shows that fibroblasts transformed with v-Src I338G selectively acquire a flattened morphology and selectively recover actin-tension fibers by incubation with 3g. We treated untransformed NIH3T3 fibroblasts (ab), transformed with WT v-Src (c, d, g, h) and transformed with v-Src I338G (e, f, i, j), either with DMSO 1.1% (ac , e, g, i) or 100mM 3g in 1.1% DMSO (d, f, h, j). After 48 hours, photographs were taken of cells (a, c-f) stained with phalloidin-FITC, and visualized (b, g-j) by fluorescence microscopy).

V. DETAILED DESCRIPTION OF THE INVENTION Figure 9 This figure shows a schematic representation of an experiment to identify kinase substrates, which is used in the invention for the discovery of the substrates of a Src protein kinase. The ovals in the upper part of the figure represent protein kinase substrates that become phosphorylated by the protein kinases adjacent to the arrow. Protein kinases that contain several ovals linked by lines are members of the "Src family" of protein kinases (Ser, Fyn, Lck). A kinase (Src) contains a notch cut representing the I338G mutation that creates extra space in the adenine binding cavity of this kinase. The symbol above this kinase represents the orthogonal inhibitor that contains a protuberance that complements the mutation in Src I338G kinase, resulting in its unique inhibition. The kinase with a long round oval and two protruding stingers is the F-actin-dependent protein kinase (FAK). Protein kinases with only one oval are members of the family of protein kinases specific for serine or threonine. The ovals below the arrow containing small P's represent the phosphorylated substrates (P) after action by the protein kinases. The simulated gels in the lower part of the figure represent the expected results if cells expressing all the wild-type kinases (on the left) or a mutant kinase (Src-I338G) were treated in place of wild-type Src, with the inhibitor orthogonal. The inhibitor should have no effect on the phosphoproteins present in the cells that do not express the mutant Src kinase (identical pattern in the left gel) and several phosphoproteins should be absent after treatment of the cells expressing the mutant with the inhibitor ( in the gel on the right).

Inhibitors Figures 11A and 11B show the structures of a variety of bulky substituents that when added to either N-4 of PP3 or to N6 of adenosine triphosphate, or to N6 of adenosine monophosphate, or to N6 of adenosine (specifically: cyclopentyloxy-adenosine), produce inhibitors of the v-Src mutant kinase (T120G), which is a designed kinase of the present invention; the synthesis and inhibition constants for these inhibitors are described below in Example 12. Such inhibitors may be useful in studies directed towards the development of other useful mutants of these and other kinases, and for the various methods described elsewhere. part of the present description.

However, the scope of the present invention is not limited to the use of these particular inhibitors, and those of average skill in the art will recognize that they can be substituted or supplemented with many other possible structures to which they are described herein. For example, different simpler and even more complex aliphatic or aromatic groups could be added to the N 3 position of ADP or to the N 4 position of PP 3. In addition, the inhibitors of the present invention are not limited to modifications of nucleotides in the position f or modifications of PP3 in the N4 position. Chemical means are known to modify various positions on said compounds, and any of the resulting derivatives would be within the scope of the present invention; It is even possible to make changes or substitutions in their ring structures. Exemplary variants are presented here, and particular reference is made to Figure 13, where both analogs and data relating to their activity are indicated. Of course, the use of such inhibitors may require modification of different positions in the protein sequence of the kinase to make a designed kinase that can bind to them, but these different modifications are well within the scope of the present invention. Furthermore, it is important to note that the inhibitors of the present invention are not limited to the ADP and PP3 derivatives. For example, it should be possible to use derivatives of another natural substrate donor of nucleotide phosphate as such inhibitors. In fact, different analog bases can be preferred to study some kinases. For example, it is known that certain kinases use GTP as a phosphate donor substrate and energy source; to make inhibitors for designed forms of such kinases, guanosine diphosphate analogs would be suitable. Furthermore, it is well known that sometimes related compounds (eg, other bases) and compounds chemically unrelated to the natural substrate can be bound to an active site, and that they can be made to act (although for the purposes of this invention it is not necessary), or act on their own, on other substrates by chemical catalysis with the enzyme. Sometimes they participate in the catalyzed reaction in the same way as the natural substrate, sometimes in different ways. Said compounds and their derivatives would be suitable starting points for the design of inhibitors that are orthogonal to them, and which would be within the scope of the present invention. Similarly, other known kinase inhibitors can be used as a starting point for the synthesis of inhibitors of the present invention, such as those of the structures shown in Figure 10. Of course, even derivatives of inhibitors that are currently unknown, once identified, would be suitable core structures for the design of inhibitors of the present invention, as illustrated herein and are part of it. In addition, the inhibitors of the present invention are not limited to those prepared by chemical synthesis, but also include compounds that can be found in nature, and which can serve that function, part of which was mentioned above. In addition, those of average skill in the art will appreciate that there are other variations in addition to those noted herein, and that all of them are within the scope of the present invention. Inhibitors that are candidates for use in accordance with the present invention can be conveniently selected to determine the extent to which they can be accepted by wild-type kinases, using a selection procedure as outlined in example 13 below, or by means of a selection procedure that includes the use of a cell or cells that are rich in protein kinase activity as indicated here in example 9. By means of such a test, it can be determined whether each inhibitor binds to the wild type kinases to a lesser extent than the engineered kinases, or preferably, if the wild type kinases do not bind substantially to that inhibitor, or more preferably, do not bind not at all inhibitor. For those substrates that bind less easily, it may be useful to try to design the kinase of interest so that it binds more easily to them. Of course, one could first make the designed kinase and then test it together with the wild-type enzyme to determine whether it uses a given orthogonal substrate better than the wild type kinase.; this was the approach used in example 13. However, under most circumstances, pre-selection will be preferable as described above. Of course, other testing approaches will be apparent to those skilled in the art, and the use of such tests would be within the scope of the present invention.

Engineering designed kinases There are several criteria that must be satisfied in the reengineering of a kinase to mark only its authentic substrates in the presence of tyrosine and wild type serine / threonine kinases. The designed kinase must: (1) accept an ATP analogue (ATP) that is less easily used by wild-type protein kinases; preferably, accepting an ATP that is not substantially used by the wild-type kinases; and more preferably, accepting an ATP that is not used at all by wild-type kinases; (2) preferably, using the ATP analog with high catalytic efficiency; and (3) preferably, having reduced catalytic efficiency by the natural nucleotide substrate (ATP) so that, in the presence of cellular levels of ATP (1-2 mM), the mutated kinase preferably uses ATP as the phosphate donor. If such engineered kinases are used to study the specificity of the protein substrate of the wild-type kinase, then these criteria must be met without substantially altering the specificity of the kinase against the target protein. Likewise, several criteria must be met in the reengineering of a kinase to be inhibited by the inhibitors of the present invention. The designed kinase must: (1) bind to an inhibitor that binds less readily to wild-type protein kinases; preferably, the inhibitor will not bind substantially to wild-type kinases; and more preferably, it will not bind at all to wild-type kinases; (2) preferably, the designed kinase will bind to the inhibitor with high affinity (ie, low IC 50). Generally, it is not of particular importance that the inhibitor binds to the wild-type form of the kinase corresponding to the designed kinase, since such binding and the resulting inhibition would increase that of the designed kinase. However, it is very likely that the wild-type form of that kinase will not bind to the inhibitor in a better way than other wild-type kinases. Whether to use a designed kinase that can be inhibited, to study the specificity of the protein substrate of the wild type kinase, or to replace the wild type form of that kinase by gene therapy or other means, as described further further, then an additional interest is that preferably the above-described criteria should be satisfied without substantially altering the specificity of the target protein of the designed kinase when compared to the corresponding wild-type form. When viewed from the perspective of the state of the art when the present invention was made, it was not predictable to know if it was possible to satisfy all these criteria simultaneously; in fact, it was doubtful, since the ATP binding site that is designed is very close to the binding site of the second substrate, i.e., the peptide-binding site. However, as shown by the following examples, all of these criteria, including the preferred criteria, were actually satisfied simultaneously when the present authors made the described v-Src mutants, predicting them with N6 (cyclopentyl) ATP and inhibiting them using N4. -cyclopentyl PP3. Example 1 describes the twelve analogs of ATP that were used in the studies on mutant v-Src, which are described in the following examples. These orthogonal analogues of ATP may be useful in studies directed toward the development of other useful mutants of these and other kinases, and for the various methods described herein elsewhere. However, the scope of the present invention is not limited to the use of these particular ATP analogs, and those of average knowledge in the art will recognize that they can be replaced or supplemented with many other possible orthogonal substrates. For example, different and even more complex aliphatic or aromatic groups can be added to the N ^ position of ATP. In addition, the orthogonal substrates of the present invention are not limited to the nucleotide modifications at the N ^ position. Chemical means are known to modify various positions on adenosine, and any of these would be within the scope of the present invention; it is even possible to make changes or substitutions in the ring structures of nucleotides. Of course, the use of such orthogonal substrates may require modification of different positions in the protein sequence of the kinase to make a designed kinase that can bind to them, but these different modifications are well within the scope of the present invention. . Furthermore, it is important to note that the orthogonal substrates of the present invention are not limited to the ATP derivatives. In fact, different analogous bases can be preferred to study different kinases.

For example, it is known that some kinases use GTP as phosphate donor substrate and energy source; to study such kinases, guanosine triphosphate analogs would be preferred. It is well known that sometimes compounds chemically unrelated to the natural substrate, can be attached to an active site, and that they can even be made to act or act on their own, on other substrates by chemical catalysis with the enzyme. Sometimes they participate in the catalyzed reaction in the same way as the natural substrate, sometimes in different ways. Such compounds and their derivatives would also be within the scope of the terms "natural substrate" and "orthogonal substrate" as used herein. In addition, the orthogonal substrates of the present invention are not limited to those prepared by chemical synthesis, but also include compounds that can be found in nature, and which can serve that function. Those of average skill in the art will appreciate that there are other variations in addition to those set forth herein, and that they are within the scope of the present invention. The orthogonal nucleotides that are candidates for use in accordance with the present invention can be conveniently selected to determine the extent to which they are accepted by wild-type kinases, using a selection procedure as outlined in Example 2 below. By means of such a test, it can be determined whether each orthogonal substrate is accepted by the wild-type kinases to a lesser extent than the normal substrate for such kinases, or preferably, if that substrate is not substantially accepted, or more preferably, if not It is not accepted at all. For those substrates that are accepted with the least facility, it may be useful to try to design the kinase of interest so that they are more easily accepted. Of course, the designed kinase could be made first and then tested together with the wild-type enzyme to determine whether it uses a given orthogonal substrate better than the wild-type kinase. However, under most circumstances, preselection will be preferable as described in Example 2. Naturally, other testing approaches will be apparent to those skilled in the art, and the use of such tests would be within the scope of the specification. present invention. The design of a v-Src is described later in example 3.

As described, the designed form was designated by reference to the crystal structures of other kinases that have domains that are homologous to those found in most, if not all, kinases. As will be seen, exemplary mutant kinases described herein have been constructed as protein kinase fragments, rather than containing all sequences; but it was found that there is no substantial difference in performance when the entire sequence is used. Of course, the concepts and qualities of the practice are the same using either fragments or complete kinases, and both are within the scope of the present invention. As such, it should be considered that the term "kinase" includes the entire enzyme or a fragment thereof, even when interpreting the claims. By using this approach, it is possible to design mutants similar to virtually any other kinase. The method for doing this comprises the steps of: (a) identifying, from the crystal structure of an identical or homologous enzyme bound to its phosphate donor substrate or to a known kinase inhibitor (which may be non-specific for kinases, specific for kinases in general but not for that kinase, or specific for that kinase), one or more amino acids other than glycine that are sufficiently close to a substituent on the phosphate donor substrate or inhibitor attached so that they can sterically restrict the entry of a bulky substituent bound to that substituent in a putative orthogonal inhibitor; and (b) mutating a nucleotide sequence encoding the wild-type protein kinase so that the nucleotide triplets encoding one or more of the identified amino acids are converted into nucleotide triplets encoding amino acids having side chains that are sterically less bulky than the amino acids identified. The methods described above use steric restriction of entry or exclusion as the criteria to decide which amino acid (s) to change, and how to change them. However, the present invention is not so limited. It is also possible to design a kinase to change its ability to bind to an orthogonal substrate considering other factors such as hydrophobicity, hydrophilicity, ionic binding or repulsion, hydrogen bonds, formation of covalent bonds between the enzyme and electrophilic groups on orthogonal substrates, etc. The study of protein kinases using the present invention will be greatly facilitated by the vast knowledge regarding the domain structure of many different kinases, and their generally homologous sequences. The Protein Kinase Fact Book (71) provides protein sequence data for the three functional domains literally in hundreds of protein kinases, and this, together with the sequence information available in the primary literature, will greatly facilitate the subsequent application of the present invention to the kinases. Similar information is available regarding other enzymes of multiple substrates, which should facilitate their study and use in accordance with the present invention. Although the preferred method of the present invention includes the rational design of substrate analogs and mutant protein kinases, both can alternatively be prepared using methods known as combinatorial methods. There are many combinatorial methods of synthesis of organic compounds. Using one such method, nucleoside analogs can be synthesized on resin globules using sequential chemical steps, and then released from the resin prior to phosphorylation to make the nucleotide triphosphates. After using said method to make a collection of putative orthogonal substrates for v-Src kinase mutants, another protein kinase, or other multiple substrate enzymes, the collection can be screened to select particularly favorable binding or catalytic properties. This may allow a more complete search for structural, conformational and electronic characteristics of such putative orthogonal substrates. In addition, it is often found that when larger amounts of analogues are investigated, an unexpectedly efficient substrate or inhibitor can be found. In addition, sometimes the compounds that are most convenient would not have to be chosen if only well-understood parameters were used to specifically design the best compound. There are also many combinatorial methods known in the art for making mutant proteins. These include "prone to error" polymerase chain reaction (PCR), "sexual" PCR or PCR using primers with random nucleotides at fixed positions in the protein sequence. Other methods of randomization of sequences may include the use of chemical mutagens of cDNA or plasmid DNA, or MutD strains of bacteria, which are known to randomly introduce mutations into the proteins they express. It would be possible to carry out the present invention using such methods to make protein kinases or other enzymes of randomly mutated multiple substrates, and then select one with particularly high activity with a particular orthogonal substrate, or with some or all putative orthogonal substrates made using synthesis combinatorial, as described in the previous paragraph. The test methods described in the following examples would be suitable for this purpose, and experts in the field would be able to easily design alternative approaches. These methods and other methods that are developed or can be developed to screen the protein sequence and the structural space of small organic molecules could be particularly useful for the technological application described herein, in which the authors of the present document change or They alter both the protein and the putative inhibitor to find the best possible non-natural setting (ie, orthogonal). The use of any of these methods or any of the other methods described herein would be within the scope of the present invention. In example 4 the synthesis of a designed kinase is described. The focus of this effort was on the side chains of amino acids that were within approximately 4A of the N ^ of ATP; but there is nothing magical about that distance. Residues with side chains that are in a space of approximately 1A, 2A, 3A, 4A, 5A, 6A, 7A, 8A, 9A, 10A, or at shorter, greater or intermediate distances, should also be considered as modification targets. Amino acids with side chains that are within about 3A to about 6A would be the preferred targets. In general, preference will be given to amino acids with the closest side chains over those with more distant side chains, as it would be expected that these will cause the greatest steric interference and other interference with the orthogonal substituent on the inhibitor; and those with very close side chains would be most preferred. Of course, today there are many other ways to modify and express genetic sequences apart from those used in the examples, such as site-directed mutagenesis, and we can expect the development of other methods in the future. The use of each and every one of these would be within the scope of the present invention. In addition, although the use of genetic engineering is currently the preferred method for preparing such mutants, it is not the only way. For example, a kinase can be designed and then synthesized that protein by known methods of chemical synthesis of peptides. Or it may be possible to chemically modify a given enzyme at a specific location so that one or more side chains change in size, hydrophobicity, or other characteristics, so that it can more easily utilize an orthogonal substrate. The use of such methods is within the scope of the invention. Example 7 describes the tests that can be done to determine if the designed kinase has retained its protein substrate specificity. It is preferred that the substrate specificity of wild-type protein be retained substantially if, as in the examples, the goal is to use the kinase designed to study on which substrates the kinase acts and to what extent it does so, or is it to be used for replacing or supplementing the corresponding wild-type kinase in vivo, for example, by genetic engineering. However, although for such purposes it is important that the kinase still recognizes the same substrates as the wild type, it is not critical that it does so with the same kinetics; that is, if it is done more slowly or faster, or to a greater or lesser degree, the designed kinase may still have substantial value for such purposes. If the designed kinase does not recognize the same protein substrates as the wild-type enzyme, it may have less value in the study of the wild-type enzyme, but may still have substantial value in the study of protein phosphorylation and kinases in general, and it would still be within the scope of the invention. Of course, although they are useful, it is not necessary to use the particular tests used in Example 7. Those skilled in the art will be able to easily develop or adopt other tests that can provide comparable information. Once a mutant kinase that accepts a given orthogonal substrate analog, or that is inhibited by a given inhibitor, can be characterized using classical analysis of enzymatic kinetics as illustrated in examples 5 and 6. Also, as shown in FIG. Example 8, one can study the degree to which the mutant can use or be inhibited by the analog, and if the analog is a "dead" (ie, completely ineffective) inhibitor for the wild-type enzyme. Naturally, the methods used in the examples are not the only ways in which these studies can be done, and those skilled in the art can easily design alternative approaches. As illustrated in Example 10, it is not necessary to make multiple amino acid substitutions to provide a mutant that is inhibited by an inhibitor of the present invention. It may only be necessary to make a single amino acid change, as is the case with the mutants GST-XD4 (I338A) and GST-XD4 (I338G).

Test to identify kinase substrates A very simple embodiment of the present invention would be the following. First, the orthogonal inhibitor is added to two samples of the cell of interest that expresses a gene added to the designed kinase, or expresses the normal copy of the kinase of interest. The inhibitor can be added before, after, or during the activation of a significant cascade (such as permeabilized cells, cell extracts or cells that are naturally permeable to them). A method allowing the detection of all phosphorylated proteins in a cell or cell fraction is then used, for example, using radioactive phosphorus [P-32p] ATP or using monoclonal anti-convolutions specific for phosphorylated amino acids, to reveal the result of the specific inhibition of the interest kinase. In cells expressing the normal copy of the kinase of interest, the protein substrates of the natural kinase will be labeled, even in the presence of the inhibitor, while the protein substrates of the designed kinase will be labeled at least to a lesser degree.; preferably, the protein substrates of the substantially designed kinases will not be labeled, and more preferably, will not be marked at all.

It is also preferable that the wild-type kinase corresponding to the mutant has been removed from the cells, for example by "knock-out" of the gene or the cellular genes for the same. If labeled proteins from such a test are examined in tandem with control samples containing the wild-type kinase but not the mutant kinase, certain bands in the mutant-treated sample will decrease in intensity from the control. Preferably, the intensity difference will be high; most preferably, there will be missing bands in the mutant-containing samples treated with the inhibitor. This could indicate that the wild-type form of that kinase phosphorylates the differentially labeled proteins; When the kinase is inhibited, those bands do not get marked. Example 10 provides an example of a method of using a mutant kinase of the present invention, together with its orthogonal substrate analog or its inhibitor, as the case may be, to detect which intracellular protein substrates are for that protein kinase. The development of such a test was a primary goal of the investigation that gave rise to the present invention. In general, the method described in Example 10 and Figure 8 would appear to be generally applicable; however, there are many other possible approaches that can be used, once a mutant that accepts an orthogonal substrate analog or inhibitor is prepared. First, the natural phosphate donor substrate is prepared to contain a labeled portion on the terminal phosphate, for example, by replacing the phosphate with [P- 32 P] phosphate. This substrate, together with the analog or inhibitor, is then added to a sample of used cells, cell extracts, permeabilized cells, or cells that are naturally permeable to the orthogonal nucleotide triphosphate substrate analog or to the inhibitor, and which express the kinase mutant, or to which the mutant kinase has been added exogenously (for example, by microinjection). After incubation under conditions that allow the inhibition of the mutant kinase, and / or phosphorylate their protein substrates to the non-inhibited extent, the labeled products are then extracted and analyzed in comparison to those produced by a control sample that was treated substantially in the same manner, but without the addition of the analog or inhibitor, respectively. The methods for the detection of labeled proteins are well known and include both quantitative and qualitative methods. In addition, all methods can be used to characterize and identify protein to determine with specificity what protein substrates are and what their functions are. Finally, it should be possible to develop an understanding of which protein substrates act on each of the various protein kinases, and reveal in greater detail the mysteries of the translation of cellular signals. Once one or more cellular protein substrates have been identified, similar assays can be used to identify drugs or other compounds that can modulate the activity of a given protein kinase on one or more substrates. For example, small amounts of solutions of a variety of such compounds can be added to test samples containing cell-free extract, mutant kinase, together with a labeled orthogonal substrate analog and / or inhibitor. The labeled proteins can then be identified, for example, by means of gel electrophoresis, followed by autoradiography, and compared with a duplicate test sample treated in the same manner, but to which no drug or other compound was added. If a protein is not labeled in a sample that has an added analogue substrate and / or inhibitor compound that is scored in a sample treated with the analog and / or inhibitor, this indicates that the added compound has caused the kinase phosphorylates a protein that does not act in the absence of the compound, that is, the compound positively modulates the activity of the kinase for that protein. Alternatively, if a labeled protein appears in a test sample to which the compound or drug was added, but does not appear in a test sample that does not have the compound or drug added, this indicates that the added compound has prevented the kinase phosphorylating a protein that acts in the absence of the compound, ie, the compound negatively modulates the activity of the kinase for that protein substrate. In addition, if quantitative measurements are made for each labeled protein, for example, by sweeping autoradiograms and integrating the data, more subtle effects on kinase activity can be detected.

For example, it can be found that a protein is more completely or less completely phosphorylated in the presence or in the absence of a given compound (i.e., it has been dramatically modulated). It can also be expected that some compounds will positively modulate the kinase activity for some proteins, and will negatively modulate the activity of others at the same time.

Use in selection of target kinases for drug design As mentioned above, since kinases play key roles in various diseases, it is of great interest to develop inhibitors that can specifically inhibit a single wild type kinase or a group of wild type kinases. By negatively modulating the activity of these kinases involved in disease, it should be possible to reduce the symptoms of the disease, or even cure the disease. However, the great difficulty that has been experienced in preparing such inhibitors of wild-type kinases, as briefly described above, limits the potential of that approach. The main difficulty is finding inhibitors that are specific and do not inhibit other kinases apart from the intended purpose. The reasons for such nonspecificity are (i) the nucleotide triphosphate binding sites of the kinases are conserved in evolution, and (ii) many kinases are "degenerate", that is, they have sufficiently similar activities and specificities to they can be replaced by other kinases that due to gene suppression or other reason, are absent or diminished in concentration in the cells. The problem of the similarities of the binding site can be overcome in many cases, for example, by careful rational design of the inhibitor, or by selection of inhibitors from combinatorial collections based on specificity. However, efforts to do so with a kinase that is truly degenerate with another kinase will probably be unsuccessful; any of the codegenerated kinases will be inhibited by even the best candidate candidate compounds, or even, if the target is inhibited, it will be impossible to say, because a kinase will "take over" the activity of the inhibited kinase. Because of this, there is a need for a way to select kinases to determine which wild-type kinases are degenerate, and thus candidates likely to be bad for specific inhibition, and which are not degenerate, and therefore the preferred candidates for specific inhibition. The present invention provides such a method. The present invention provides a means to generate a unique and specific kinase inhibitor for any kinase of interest, by making a mutant of the kinase that is specifically designed to be inhibited by selected candidate inhibitors, and then studying the effects of that inhibition. One way to achieve this is to test cells or cell extracts in vitro. For example, ATP can be added to that sample which has a type of mark (the "first mark") on the terminal phosphate, and add the specific inhibitor that is marked differently (the "second mark") on the phosphate terminal. The decrease in the appearance of the second tag on a given protein substrate (eg, observed by gel electrophoresis) indicates specific inhibition of the mutant kinase; and the appearance of the first tag on that same substrate indicates that the other kinases have taken over that phosphorylation function, the degree of which is shown by the relative degree of said tag. If it is later discovered that the designed kinase is specifically inhibited, and other kinases do not take over the phosphorylation of the designed kinase substrates when it is inhibited, or at least do not fully take over, then that kinase is not degenerate, or at least not completely; thus, it is probably not a good candidate for the development of a specific inhibitor of the wild type to be used as a drug to treat the disease with which it is related. Nevertheless, if the inhibition of the mutant kinase with an inhibitor of the present invention is not compensated by the other kinases, then it is a preferred candidate for the development of a wild-type kinase inhibitor. Another preferred method of such selection would be to produce animal models for the disease of interest, and then "knock out" the wild type gene and then, by genetic engineering, insert into the genome an active gene ("knock in"). ) encoding a mutant kinase of the present invention. Then, an inhibitor of the present invention, preferably one that has been seen in vitro that inhibits the mutant, can be used to down-regulate the mutant kinase. If the negative regulation leads to a reduction of the symptoms or morbidity of the disease in the animal model, or eliminates the disease, then that kinase is a preferred candidate for the development of a specific inhibitor of the wild-type form.

Applications of gene therapy Mutant kinases and inhibitors of the present invention can also be used directly to treat diseases in humans and animals. As described above for animal model systems, gene substitution can be used in patients with diseases mediated by those kinases. The wild type gene for one or more such wild-type kinases would be deleted, for example, by "knock-out" methods known in the art, and then specifically mutants that can be inhibited from such an animal would be added to the genome of the animal. or more kinases, for example, by means of gene therapy or knock-in methods that are known in the art. Then, the inhibitor can be used as a drug to negatively modulate those one or more mutant kinases, in such a manner as to diminish the disease at least to some degree, but the degree of activity of those kinases that may be required for normal cell function. Of course, kinases could be essentially "stopped" by strong inhibition, if that is seen to be therapeutically effective. Furthermore, if the disease is found to be much improved or cured during a period of negative regulation or comes to a halt, then the administration of the inhibitor can be discontinued, and one might expect that the disease would not return or be exacerbated. If not, then the inhibition could be discontinued in the long term or even on a permanent basis, and the mutants can be left to function in place of the wild-type kinase for the rest of the patient's life. Since the specific inhibitors of the present invention are not present in the medium, the mutant kinases should behave like the wild type (except insofar as the engineering has changed its activity or kinetics). And if the disease were to recur or sharpen again in the future, the patient would be treated again with the inhibitor, without the need to repeat the gene exchange.

Other enzymes of multiple substrates As mentioned above, the present invention is not limited to mutant kinases, orthogonal inhibitors and their synthesis and use. The present invention will work well for other multi-substrate enzymes that covalently transfer all or part of a substrate, called the donor here, to another substrate, here called the receptor; and surely there are still many such enzymes to discover. In any of these cases, a person skilled in the art who has studied the present specification will appreciate the applicability of the present invention to such enzymes. The closest tasks in such a case are very similar to those described in detail here for the kinases. First, it is necessary to identify which is the donor substrate and / or identify compounds that can inhibit that kinase, although they are not specific for that kinase. Second, it is necessary to consider where a bulky substituent could be added to the substrate or inhibitor so that it does not bind so easily to the wild-type kinase, or preferably does not substantially substantiate the wild-type kinase, and preferably does not bind absolutely. Of course, it is not really necessary, in the case of kinases or other multiple substrate enzymes as described above, to be restrictive with respect to which analogues they make; You can make a variety of them, including some that seem probably not ideal, and determine by selection which ones are the best. Additional guidelines on how to do this can be obtained from the following examples. The inhibition test, the results of which are shown in Figure 6, is a non-limiting example of a test particularly well suited for such selection. The third step is to design the kinase in such a way that one or more amino acids in the three-dimensional location where the bulky group would be expected to be if the analog binds, are replaced with amino acids that have less bulky side chains, "making room" in this way for the bulky portion of the inhibitor. Of course, steps two and three can be carried out in the reverse order. For example, transferase enzymes would be the most interesting candidates to study using the present invention. Following the teachings provided herein, mutant transferases accepting orthogonal inhibitors could be prepared, and these could be used together to identify the direct substrates of a particular transferase in a large family of homologous transferases, by the methods described above for the kinases. The methyl transferase family would be of obvious interest, and could be studied very easily using the methods provided herein. All of these enzymes use the same nucleotide-based cofactor, S-adenosylmethionine (AdoMet), as a methyl group (CH3) donor. Different members of the family can transfer the methyl group of AdoMet to a wide variety of cellular components such as proteins (in which case the methyl group is added to side chains of arginine, aspartate and glutamine), DNA (in which case the group methyl is added to the C-5 position of the cytosine, or the N-7 position of guanine), to cell membrane components such as phospholipids, and also to several small amine-containing hormones. Many new targets have also been identified for this diverse family of enzymes. The present invention provides the opportunity to decipher the enormously complex cellular mechanisms that these enzymes carry out. For example, you could synthesize a series of analogs of AdoMet containing additional bulky hydrophobic groups at the N-6 position, or at other positions of the ring, which orthogonal analogs could do, and thus not be as readily accepted by the wild-type methyl transferases as with the natural substrate; and the structure in the region of the methyl group transferred could be altered so that the methyl group is chemically more resistant to transfer; or, for example, S-adenosylcysteine could be used as the starting compound instead. Using the DNA methyltransferase crystal structures, M.Hhal and catechol methyltransferase and catechol O-methyltransferase (COMT), those amino acids can be identified in the adenine binding cavity which are candidates for the mutation. , as the authors of this have done for protein kinases; and someone of average skill in the art would be able to easily identify a series of residues to mutate them and accommodate the bulky hydrophobic groups of one or more orthogonal substrates. For example, large hydrophobic groups could be mutated to smaller residues of alanine or glycine, or replace amino acids from hydrogen bonds with others that favor the orthogonal analogues of AdoMet purine. Of course, a large number of other possible mutations may also work, and would be within the scope of the present invention. In addition, of the sequence alignments and crystal structures of the methyl transferases, they are known to have a common catalytic domain structure (70); so this approach is not limited to M.Hhal and COMT, but should be equally applicable to other methyltransferases. After identifying a mutant methyl transferase that accepts an orthogonal inhibitor, then radiolabeled AdoMet containing a labeled C-14 methyl group bound to the sulfur atom of AdoMet. When this radiolabelled analog is added to cells expressing a mutant methyl transferase, the direct substrates (eg, protein or DNA or polyamines) of all the methyl transferases in the sample will be radiolabelled specifically with the C-14 methyl group. But when this is done in the presence of the orthogonal inhibitor, the substrates specific for the methyl transferase of interest will be less marked compared to the sample that does not contain the inhibitor; preferably, substantially they will not be marked, and most preferably will not be marked at all. In this way, or through the use of other methods described herein for the study of kinases, direct substrates of methyl transferases that are important in cancer, embryonic development, chemotaxis of leukocyte polymorphonuclear leukocytes, or in neurological disorders can be identified. In addition, the methods of the present invention can then be used to determine whether compounds that modulate the activity of the enzyme can be identified. The other different aspects of the present invention, although perhaps not described here, can also be applied to methyl transferases, and also to other multiple substrate enzymes. The above discussion of the application of the present invention to methyl transferases is not intended to limit the scope of the present invention, but to illustrate the applicability thereof to enzymes of multiple substrates other than protein kinases. As will be appreciated by those skilled in the art, the present invention can be applied in a similar manner to other multi-substrate enzymes using similar approaches.

Terms As is generally the case in biotechnology, the description of the present invention has required the use of a substantial number of terms of the art. Although it is not practical to do so exhaustively, definitions of some of these terms are provided here for ease of reference. Definitions of other terms also appear in other parts of the description and these are not repeated here. It is important to note that it is not intended to give a meaning to the terms defined here or elsewhere in the description, different from what experts in the field would understand when they are used in the field, and therefore it is recommended to consult other sources to interpret the meaning of these terms and those defined in any other part of the description. However, the definitions provided here and in any other part of the description should always be considered when determining the intended scope and meaning of the defined terms. The term "orthogonal" is used herein to refer to a compound that is similar, structurally and / or geometrically, to the natural substrate for a given enzyme, or to an inhibitor of the wild type form of the enzyme, but has chemical structure differences that they make that compound less able to bind to the wild-type form of the enzyme, which is the natural substrate. By "natural" substrate is meant that substrate that is used by the wild-type form of the enzyme. The orthogonal inhibitors of the present invention can be referred to here in different ways; for example, they are sometimes referred to as "modified substrates", "modified inhibitors", "analogs", "derivatives", such as "substrates" or "inhibitors", and perhaps also by other terms. However, in each case the same meaning is intended. Of course, the meaning of "orthogonal" and its synonyms is further explained in the descriptions of the invention provided above. The putative orthogonal substrates and inhibitors of the described embodiments of the invention were made by adding bulky substituents to an atom on the natural substrate or known kinase inhibitor, respectively. However, the present invention is not so limited. For example, it is possible to make an orthogonal substrate that is smaller than a known inhibitor or the natural substrate, e.g., by preparing an analogue lacking one or more atoms or substituents that are present in the natural substrate. With such putative orthogonal substrates or inhibitors, the enzyme can be mutated to contain one or more amino acids having side chains more bulky than those found in the wild type amino acid sequences, so that when the orthogonal substrate or inhibitor is bound, those Lateral chains of bulky amino acids completely or partially fill the extra space created by missing atoms or substituents. In this way, the mutant would be expected to bind and be inhibited by the orthogonal substrate or inhibitor, but without substantially using the normal substrate because the bulky amino acids added present a steric hindrance to their binding. Such an approach would allow a highly selective control of the resulting mutant. It is important to keep in mind that although the substrates and inhibitors of the examples herein are of the non-competitive type, this should not be considered as limiting the scope of the present invention. Many different types of enzyme substrates and inhibitors are known, e.g., competitive, noncompetitive, decompressive, "suicidal" inhibitors, etc. Competitive inhibitors compete with a substrate for its binding site; but in view of the fact that the inhibitor can not participate in the catalytic reaction that this enzyme carries out, it retards the catalysis. Non-competitive inhibitors bind to the active site, but then they become covalently or ionically bound to the protein structure of the enzyme, so that it can not be released. Thus, they inhibit catalysis by putting enzyme molecules out of the entire reaction. More detailed descriptions of these and other competitive mechanisms can be found in a variety of sources (eg, 72). Applying the understanding of the art with respect to such mechanisms for the design of inhibitors of the present invention, all of these types of inhibitors can be made. For example, an analogue that can bind, but not react, would provide competitive inhibition, and an analogue that becomes covalently bound to the enzyme after binding would be a non-competitive inhibitor, ie, a poison. All these types of inhibitors are within the scope of the present invention. The term "homologous" has been used to describe how information can be derived on how to modify an enzyme from information regarding the three-dimensional structure of other related enzymes. As those with average knowledge in the field know well, a part of an enzyme that is "homologous" to part of a second enzyme has a protein sequence that is related to that of that second enzyme. This relationship is that they have a number of amino acids in the same location relative to each other. For example, the imaginary sequence Asp-Met-Phe-Arg-Asp-Lys-Glu and the imaginary sequence Asp-Met-lle-Arg-Glu-Lys-Asp have four amino acids in the same relative location, and three that are different , and it could be said that they have homologous sequences. Note that the three amino acids that are different between the chains are "conservative" differences, since the substitutions in the second sequence with respect to the first, are with amino acids that have similar functionalities in their side chains. For example, Glu and Arg both have aliphatic side chains terminated by carboxylic acid groups, and both Phe and lie are hydrophobic. Although this is frequently the case with homologous protein sequences, it is not required to be so, and these two imaginary sequences would be considered homologous even if the differences were non-conservative. It can not be said if a particular sequence or domain ßs homologous to another with some particularity, eg, using percentages, since there is no such absolute pattern; The technique should be left to define which sequences are considered "homologous" or not. Reference 71 gives a good review of which domains of known kinases are considered by the art to be "homologous". Furthermore, although the technique may not agree in general, it is intended here that sequences that are identical to one another are also considered "homologous" with respect to each other. The term "domain" is also well known in the art, and refers to a region of a protein that has been identified as having a particular functionality. For example, the three domains in the protein kinases discussed here and their functions are also discussed here. Frequently, as is the case with kinases, different enzymes of the same family will have the same number of domains each serving the same function, and often (but probably not always) are arranged in the same order along the sequence of protein. Interestingly, as is the case with kinases, one enzyme may have a different length of protein sequence between its domains than another. However, since the domains of two related enzymes are generally homologous with one another (but probably not always), this generally does not interfere with the identification of the corresponding domains. In describing the broader aspects of the present invention, the term "multi-substrate" is used. It refers to enzymes that bind to two or more substrates. Those enzyme of multiple substrates of greatest interest here are those that are catalytically bound by at least part of a substrate to at least one other substrate. Kinases and transferases are only two families of such multi-substrate enzymes, and those skilled in the art will readily recognize that there are other such enzymes and families of enzymes. The term "recognizes" is sometimes used herein to describe the ability of a substrate to specifically bind to the active site of an enzyme. This simply refers to the fact that an enzyme substrate (or sometimes substrate derivatives or even completely different compounds that mimic the substrate) can make contact and bind to the active site of the enzyme, but other compounds will not. This concept is well known in the art. Enzymologists often say that the enzyme has affinity for its substrate, or that the substrate has an affinity for the enzyme. They also say that an enzyme has "substrate specificity". All this really describes the same phenomenon. A related term is the term "unite". An inhibitor generally binds, or adheres, to an active site by one or more hydrophobic, hydrophilic, hydrogen and / or ionic bonds, or in the case of non-competitive inhibitors, by covalent linkages. Although the complex understanding in the art regarding binding of the inhibitor and the reasons for inhibition may be of interest, such understanding is not essential for the understanding of the present invention. It suffices to simply observe that binding with an inhibitor causes inhibition of the catalytic reaction. The terms "mutant" and "designed form", when used to describe the enzymes of the present invention, simply mean that they have sequences with a different amino acid at one or more positions when compared to the wild-type sequence. In describing said mutants, two letters separated by a number indicate the amino acid mutations made. The letters are single-letter amino acid codes, and the numbers are the positions of the amino acid residue in the intact wild-type enzyme. For example, GST-XD4 is a fusion protein that contains a fragment, XD4, which has the same sequence as a specific part of the wild-type v-Src. In the designation GST-XD4 (V323A, I338A), the valine in the XD4 fragment sequence of v-Src representing position 323 in the complete sequence of wild-type v-Src, has been replaced by alanine, and the soleucine in the XD4 fragment representing position 338 in the complete sequence of wild-type v-Src, has also been replaced with alanine. As described in the following examples, using the present invention, the authors of this invention have designed, performed and demonstrated the utility of a v-Src kinase that shows high specificity for a synthetic inhibitor while maintaining its wild-type specificity for peptides and protein that make contact with tyrosine, satisfying the initial goals of the research. By exploiting the highly conserved nature of the ATP binding site through the superfamy of the kinases, and the availability of information on structures of other protein kinases, the authors of the present invention were able to devise novel inhibition specificity for v-Src. without any detailed structural information on the same v-Src. The fact that they have used an unrelated kinase as a heliography to design orthogonal analogs of ATP to label direct v-src cell substrates, and have prepared inhibitors of similar origins, demonstrates that this approach should work for other kinases as well.

EXAMPLES The following examples are provided to describe and illustrate the present invention. As such, they should not be considered as limiting the scope of the invention. Those of ordinary skill in the art will appreciate that many other embodiments may also be within the scope of the invention, as described above and in the claims.

EXAMPLE 1 Synthesis of ATP analogues Twelve different ATP orthogonal analogs were synthesized. Figure 2 is a schematic representation of its structure. The figure shows adenosine triphosphate (ATP), with an "X" linked in position 6; and in the chart below schematic representations are provided for the twelve side chains that take the place of "X" in each of the orthogonal ATP analogs described in the examples (which are always referred to by the numbers 1-12 indicated in letters bold). The analogues are: 1- N6- (methoxy) ATP 2- N6- (ethoxy) ATP 3- N6- (acetyl) ATP 4- N6- (i-propoxy) ATP 5- N6- (benzyl) ATP 6- N6- (benzyloxy) ATP 7- N6- (pyrrolidino) ATP 8- N6- (cyclopentyl) ATP 9- N6- (cyclopentyloxy) ATP 10- N6- (piperidino) ATP 11- N6- (cyclohexyl) ATP 12- N6- (cyclohexyloxy) ATP Analogs 1, 2, 4, 6, 9 and 12 were synthesized by transposition of Dimroth of the corresponding derivatives of N ^ -alkoxyadenine in four steps, starting from adenosine, according to the procedure of Fujii et al. (43). Analog 5 was synthesized in a similar manner by transposition of Dimroth of N ^ -benzyladenosine (44). Analog 3 was prepared by in situ protection of the hydroxyl groups of adenosine as trimethylsilyl ethers and subsequent treatment with acetyl chloride, according to McLaughlin et al. (45). Analogs 7, 8, 10 and 11 were synthesized by treatment of 6-chloropurine riboside (Aldrich) with pyrroiidine, cyclopentylamine, piperidine and cyclohexylamine, respectively (46). The synthesis of triphosphate was carried out according to the method of Ludwig (47) with the exception of the preparation of pyrophosphate. Consequently, bis-tri-N-butylammonium pyrophosphate was prepared by mixing 1 equivalent of pyrophosphoric acid with 2 equivalents of tributylamine in a water: ethanol (1: 1) mixture until a homogeneous solution was obtained. The solvent was removed under vacuum to dryness and the pyrophosphate was stored on P2O5 overnight. All non-radioactive nucleotides were characterized by means of 1 H-NMR, mass spectrum analysis and strong anion exchange HPLC (SAX) (Rainin # 83-E03-ETI). [-32p] N6- (cyclopentyl) ATP was synthesized according to the method of Hecht and Kozarich (48). The radiolabelled analogue was purified by means of column chromatography with DEAE (A-25) Sephadex (Pharmacia), and the triphosphate was identified by co-injection of the radiolabeled material with an authentic sample of N6- (cyclopentyl) ATP on an HPLC column. SAX anion exchange (Rainin, 5-750 mM ammonium phosphate linear gradient, pH 3.9 in 10 min at 0.5 ml / min.). The chemical yield of the reaction ranged from 70% to 80%.

EXAMPLE 2 Selection of nucleotide analogs To identify compounds that would not be accepted as substrates by some existing cell kinases (53), a panel of synthetic analogues of ATP was selected in a lysate of murine lymphocytes (CF) rich in protein tyrosine kinases (13). The tests were carried out using splenocytes (male C57 / B6 mice and 8-30 week old females from Princeton University Animal Facility) which were isolated and washed in RPMI-1640 medium with 5% calf serum (BCS), Hepes 1% and DNase I (1 μg / ml). Red blood cells were used at 4 ° C by treatment with 17 mM ammonium tris-chloride pH 7.2. The cells were hypotonicly used on ice for 10 minutes in 1 mM Hepes pH 7.4, 5 mM MgCl 2, leupeptin (10 μg / ml), aprotinin (10 μg / ml) and 100 μM PMSF, according to Fukaza a and others method ( 51). After mixing with vortex and centrifugation at 500 x g, the supernatant was collected. The cells were stored at 4 ° C for 20 minutes to attenuate the basal level of protein phosphorylation, after which the buffer was adjusted to 20 mM Hepes pH 7.4, 10 mM MgCl 2 and 1 mM NaF. Sodium vanadate (100 μM) was then added to inhibit the phosphotyrosine phosphatases activity. Each nucleotide triphosphate was added to a final concentration of 100 μM at 5 x 10 ^ cell equivalents and incubated at 37 ° C for 5 minutes, after which Laemmli 4X gel loading buffer was added to the cell lysate to quench the reaction. The proteins were separated by SDS 12.5% -PAGE and transferred to Protran BA85 (Schleicher-Schuell). The blot was probed with the anti-phosphotyrosine monoclonal antibody 4G10 (Upstate Biotechnology) and the bound antibody was detected by increased chemiluminescence (Pierce, cat 34080) after treatment with goat anti-mouse antibody coupled with HRP (VWR cat.7101332) according to the manufacturer's instructions. The results are shown in Figure 3, which is an immunoblot of anti-phosphotyrosine protein that shows the protein tyrosine phosphorylation level after treatment of a murine lymphocyte cell lysate (CF) with 100 μM of ATP or ATPs ( 1-12). The cell lysate used includes the tyrosine kinases Src, Fyn, Lck, Lyn, Yes, Fgr, Hck, Zap, Syk, Btk, Blk, and other tyrosines present in B and T lymphocytes, macrophages, and follicular dendritic cells (13). Molecular size standards (in kilodaltons) are indicated. The ATPs containing the smaller N6 substituents, 1 (methoxy), 2 (ethoxy), and 3 (acetyl) showed some capacity to serve as cellular tyrosine kinase substrates (Figure 3, lanes 3-5). ATPs with sterically demanding substituents N, 4 (-propoxy), 5 (benzyl), and 6 (benzyloxy), and all analogues containing cyclic aliphatic substituents (7-12) showed little or no protein phosphorylation (FIG. 3, lanes 6-8, 11-16). To test the possible metathesis of orthogonal ATPs (7-12) with cellular ADP to give A * DP and ATP, 1 mM ADP was added to cell lysate kinase reactions identical to those shown in Figure 3 (data not shown ); The phosphoprotein pattern was the same, indicating that no significant ATP metathesis occurs in a whole cell lysate system. Based on these results, it appears that the analogs (7-12) are "dead substrates" for wild-type tyrosine kinases, ie, the wild-type substrates do not substantially accept, or at all, these as a phosphate donor substrate. . These analogs were then chosen as the most preferred targets for redesigning the nucleotide binding site of v-Src.

EXAMPLE 3 Design of the mutant v-Src To date, crystal structures of any tyrosine kinase in an active conformation have not been solved, although several structures of inactive kinases have been resolved (54,55). However, two crystal structures of catalytically active ser / thr kinases have been resolved (56,57). There is a high degree of functional homology between the ser / thr and the tyrosine kinase catalytic domains as shown by the affinity labeling of the identical catalytically active lysine residue in both kinase families (K72 in cAMP dependent kinase (PKA), K295 in v-Src) (58.58). Inspection of PKA (56) and cyclin-dependent kinase 2 (CDK2) -cycline crystal structures (57) revealed two side chains of amino acids within a 4 Á sphere of the N6 amino group of bound ATP: V104 / M120 ( PKA) and V64 / F80 (CDK2) (60). Figure 4 shows an approach view of the binding site of ATP in cAMP-dependent protein kinase (PKA), which binds ATP. Three residues within a 4 A sphere of the N6 amine of ATP (VaM 04, Metl20 and Glu121) and the catalytically essential lysine residue (Lys72) are shown in representation of ball and stick. In the rest of the protein it is shown in tape format. This figure was created by feeding the Molscript output into the creation program Raster3D (68,69). Note that in the model, the Glu121 side chain is targeted away from the adenine ring binding region, and therefore Glu121 was not a candidate for alteration. The sequence alignment of the ATP binding regions of PKA (SEQ ID No. 1), CDK2 (SEQ ID No. 2) and v-Src (SEQ ID No. 3) are shown below. The residues shown in bold correspond to the amino acids with side chains in a 5A sphere of the N6 amino group of ATP bound to kinase.

Subdomain IV V PKA (SEQ ID No. 1) (99) NFPFLVKLEFSFKDNSNLYMVMEYVPG (125) CDK2 (SEQ ID No. 2) (59) NHPNIVKLLDVIHTENKLYLVFEFLHQ (85) v-Src (SEQ ID No. 3) ( 318) RHEKLVQLYAWSE-EPIYIVIEYMSK (343) Based on the functional similarity between the kinases described above, it has been decided to mutate the V323 and 1338 positions in the catalytic domain of v-Src, which correspond to V104 / M120 in PKA and V64 / F80 in CDK2. By mutating these residues to alanine, it was expected to create an additional "pocket" at the nucleotide binding site of v-Src to allow binding of one of the preferred orthogonal ATPs (4-12).

EXAMPLE 4 Synthesis, expression and purification of mutant The mutant (V323A, 1338A) was made as described below.

Both the wild-type and the double-alanine mutant of the catalytic domain of v-Src (the XD4 fragment) were made as fusion proteins (GST-XD4) of glutathione S-transferase (GST) (61, 62). These were made in E. coli, which is a suitable expression host because it lacks any endogenous tyrosine kinase, as described in the following example. The XD4 fragment of v-Src was used because it contains an intact SH1 catalytic domain but lacks the non-catalytic regulatory SH3 and SH2 domains, and exhibits higher specific activity than full-length v-Src.

Overlap extension PCR was used to make GST-XD4 (V323A.1338A) (49). Pfu polymerase (Stratagene) was used in the PCR reactions according to the manufacturer's protocol. Six synthetic oligonucleotides were used: SEQ. ID. No. 4 (5'-TTTGG / .7"CCATGGGGAGTAGCAAGAGCAAG), SEQ ID No. 5 (5'-TpGAA7TCCTACTCAGCGACCTCCAACAC), SEQ ID No. 6 (5-TGAGAAGCTGGCTCAACTGTACGCAG), SEQ ID No. 7 ( 5'-CTGCGTACAGTTGAGCCAGCTTCTCA), SEQ ID No. 8 (5'-CTACATCGTCUGCTGAGTACATGAG), SEQ ID No. 9 (5'-CTCATGTACTCAGCGACGATGTAG) The primer SEQ ID No. 4 contains a BamHI site and the primer SEQ. ID No. 5 contains an EcoR1 site (shown in italics.) The primers SEQ ID NO 6 and SEQ ID NO 7 contain the changes of the nucleotide sequence to introduce the V323A mutation (the nucleotides encoding mutations are shown in bold.) The primers SEQ ID No. 8 and SEQ ID No. 9 contain the non-pairing of 1338 A. The XD4 gene of the Yep51-XD4 plasmid (a gift from B. Cochran at Tufts Medical School) was amplified with initiators SEQ ID No. 4 and SEQ ID No. 5. The PRC product was digested with BamW and EcoR1 and ligated into pGEX-KT digested with ßat? H1 and £ coR1 and then transformed into strain DH5a d E. E. coli. The GST-XD4 (V323A) was constructed using the SEQ primer. ID NO. 4, SEQ. ID NO. 5, SEQ. ID NO. 6 and SEQ. ID NO. 7 with the GST-XD4 pyramid as the mold. The PCR product of the two-step procedure was digested with BamH1 and EcoR1, ligated into pGEX-KT digested with Sa H1 and EcoR1, and transformed into DH5a cells of E.coli. It became GST-XD4 (V323A, 1338A) in the same manner using the SEQ primers. ID NO. 8 and SEQ. ID NO. 9 with GST-XD4 (V323A) as the mold. The expression and purification of the GST fusion kinases were carried out in the E. coli strain DH5a as described by Xu et al. (50), with the exception that the cells were stored at 4 ° C overnight before centrifugation and lysis by French press (storage at night is essential to produce highly active kinases). Expression of 6-His-XD4 and 6-His-XD4 (V323A, 1338A) in Sf9 insect cells was achieved using the BAC-to-BAC system from Life Technologies. Briefly, the 6-His-XD4 and 6-His-XD4 genes (V323A.1338A) were generated by PCR using the corresponding pGEX vectors as templates with SEQ primers. ID NO. 4 and SEQ. ID NO 5, followed by digestion with BamHl and EcoR1. The resulting PCR fragment was cloned into pFASTBAC that had been digested with BamHI and EcoR1. Transformation of HB10BAC cells and subsequent transfection of Sf9 cells with the bacmid containing XD4 or XD4 (V323A.1338A) were carried out as suggested by the manufacturer. In an alternative procedure carried out in this, transfection of mutant kinase v-src or v-src (1338G) was carried out by cloning the v-src gene of vector pGEX-v-Src (4) in the vector pBabe (5) containing the Itr promoter for high level of expression in NIH 3T3 cells. The v-Src plasmid (1338G) from pBabe was transfected into a BOSC 23 (6) viral packaging cell line and the viral particles were harvested two days later as described (6). NIH 3T3 cells were infected as described (7) with these viral particles and stable transfectants were selected in medium containing puromycin as described (5). Stable transfectants were maintained in medium containing puromycin to ensure no loss of v-Src expression. The final results are shown in Figure 1, which is a diagram showing the domino structure of v-Src including the homology domain to Src 3, 2 and 1 (SH2 &; SH1), with the domain boundaries indicated by the numbers of amino acid residues listed on each domain enclosed in a box. The domain structure of XD4 is also represented, which contains a deletion of residues 77-225 (? 77-225). The organizations of the domains of the fusion of glutathione-S-transferase (GST) with XD4 (numbering of v-Src) and the dually mutated GST-XD4 (representing both V323A, I338A and I338G) are also shown schematically.

EXAMPLE 5 Test of mutant v-Src to validate its ability to bind orthogonal ATP analogues The ability of the substituted N6 ATP analogues (1-12) to differentially inhibit the phosphorylation of wild-type and RR-Src mutant kinase with [y-32?] ATP was then assessed, which is a measure of their ability to join the respective ATP binding sites. Tests were carried out in triplicate at 37 ° C in a final volume of 30 μL regulated at pH 8.0 containing 50 mM Tris, 10 mM MgCl2, 1.6 mM glutathione, 1 mg / mL BSA, 1 mM peptide RR-Src with GST-XD4 (100 nM) or GST-XD4 (V323A, I338A) (100 nM) and 10 μM of [y-32?] ATP (1000 cpm / pmol) [Dupont NEN]. Cold ATP or analogs of ATP (100 μM) (1-12) were added before the addition of the kinase. After 30 minutes the reactions were quenched by spraying 25 μL of the reaction volume on p81 phosphocellulose discs (Whattman) and these were immersed in 250 mL of 10% acetic acid for > 30 minutes followed by washing and counting by scintillation in accordance with standard methods (52). The results are shown in Figure 1. The relative inhibition of GST-XD4 is shown with dark bars, and the relative inhibition by GST-XD4 (V323A, I338A) is represented by the bars filled with diagonal lines. Percent inhibition (1-v? / Vo) is reported as a ratio of vi (cpm in the presence of 100 μM of the indicated triphosphate and 10 μM of [? - ^ P] ATP (1000 cpm / pmol) alone - cpm background due to non-specific binding of 10 μM of [y- ^ P] ATP to phosphocellulose disks (<0.1% of total input counts)). The error bars represent the S.D. determined from four separate experiments with three replicates. The wild-type GST-XD4 kinase shows poor binding affinity for most of the ATP analogues (Figure 6, dark bars) as expected from the lymphocyte kinase test (Figure 3). In contrast, the dually mutated GST-XD4 (V323A, I338A) shows excellent inhibition by more sterically demanding substituted N6 analogs (Figure 6, shaded bars). More significantly, the mutant GST-XD4 (V323A, I338A) is inhibited by ATP analogs 5, 8, 9 and 11 almost also as the wild-type kinase, GST-XD4 is inhibited by its natural substrate ATP. It has been confirmed that GST-XD4 (V323A, I338A) and full-length GST-v-Src (V323A, I338A) display the same inhibition pattern with ATPs (1-12) (data not shown). Four of the nine "dead" substrates identified in wild-type kinase specificity analysis (Figure 3) bind well to the mutant kinase. This high success rate for identifying new substrates for a mutant v-Src that is not accepted for wild-type par kinase suggests that a key feature of the v-Src nucleotide binding site has been identified, namely residues that establish a narrow adaptation around the N6 amino group of ATP. It should be mentioned that wild type kinase proteins containing an alanine are not known in the position corresponding to 1338 in v-Src (position 120 in PKA). If a sterically demanding amino acid side chain in this position also plays a critical role in determining the specificity of other kinases, it should be possible to design them to accept orthogonal substrates using a very similar approach to that described here, and such designed kinases would be within the scope of the present invention.

EXAMPLE 6 Determination of the catalytic efficiency of mutant v-Src with the orthogonal ATP analogue which is more preferred It was chosen to test the ability of N6- (cyclopentyl) ATP, 8, to serve as a catalytically competent substrate of both wild type GST-XD4 and mutant GST-XD4 (V323A, I338A) on the other three analogues of ATP 5, 9 and 11 because analog 8 exhibited a slightly lower level of phosphorylation with wild-type kinases (Figure 3, line 12). The phosphorylation of RRP-Src dependent on ATP and N6- (cyclopentyl) ATP (1 mM) by GST-XD4 (V323A, I338A) and GST-XD4 was carried out at low substrate conversion (<5%) in triplicate. The kinetic constants were determined by the analysis of Lineweaver-Burk plots of the index data (64). Tests were carried out in triplicate at 37 ° C in a final volume of 30 μL regulated at pH 8.0 containing 50 mM Tris, 10 mM MgCl2, 1.6 mM glutathione, 1 mg / mL BSA, 1 mM peptide RR-Src with GST-XD4 (100 nM) or GST-XD4 (V323A, I338A) (100 nM) and 10 μM of [? - PjATP (1000 cpm / pmol) or [y-32?] N6- (cyclopentyl) ATP (5000 cpm / pmol) as indicated.

TABLE 1 Kinetics for phosphate donor substrates GST-XD4 _ GST-XD4 (V323A, I338A) Nucleotide Kcat K Kcat / KM Kcat KM Kcat / K (min "1) (μM) (min ^ M" 1) (min "1) (μM) (min" 1M '1) ATP 2 + 0.5 12 + 3 1.6x105 0.8 + 0.2 150 + 20 5.3x103 N6- (cycle- 2000 (Ki) (5 + 2) x10"2 15 + 3 3.3x103 pentii) ATP As shown in Table 1 above, the wild type kinase GST-XD4 did not substantially phosphorylate the RR-Src peptide with [α- ^ PjN6- (cyclopentii) ATP, confirming previous observations that this analog is not a substrate significant for the wild-type kinase. In contrast, GST-XD4 (V323A, I338A) displayed Michaelis-Menten kinetics with orthogonal ATP, [? -32?] N6- (cyclopentyl) ATP. The KM of the mutant for the orthogonal substrate is very close to the KM of GST-XD4 for ATP. On the other hand, the mutant has a KM for ATP that is ten times higher than the KM of GST-XD4 for ATP. The parameter used to qualify catalysts for competent substrates is the ratio of the restart number to the Michaelis-Menten Kcat / KM constant (the "specificity constant") (64). The Kcat / K of the GST-XD4 (V323A, I338A) mutant designed with the orthogonal substrate [? - ^ P] N6- (cyclopentyl) ATP is only 50 times lower than the Kcat / KM value of the wild-type kinase with its natural substrate, ATP. This catalytic efficiency with the orthogonal ATP substrate, coupled with the lower catalytic efficiency of the mutant ATP kinase when compared to the wild type, satisfies two of the designs and design criteria described above. It is even more significant that the new substrate, [? - ^ PjN6- (cyclopentyl) ATP, is not substantially used by wild type GST-XD4, as evidenced by the apparent complete inability of GST-XD4 to use this analog as a phosphodonator for autophosphorylation; this is illustrated in FIG. 5 © lane 3. FIG. 5 © is an autoradiogram showing the autophosphorylation dependent on [? - ^ PjATP of GST-XD4 lane 1 or GST-XD4 (V3213A, I338A), lane 2 and; and phosphorylation dependent on [? - ^ PJN6- (cyclopentyl) ATP of GST-XD4, lane 3 or phosphorylation of GST-XD4 (V323A, I338A), lane 4. Note that in contrast to GST-XD4, the designed kinase is efficiently autophosphorylated with [? - ^ PjN ^ cyclopenti ATP (Fig. 5 (c), lane 4).

EXAMPLE 7 Confirmation of retention of protein substrate specificity As shown in Table 2 below, it has been found that the wild-type GST-XD4 kinase phosphorylated a well-characterized v-Src peptide substrate, RR-Src, with kinetics consistent with literature reports (63). This indicates that the design of the sequence did not substantially affect the catalytic activity of the enzyme with respect to its protein substrates.

TABLE 2 Kinetics for the RR-Src protein substrate GST-XD4 GST-XD4.V323A. I338A) Nucleotide KwmM) mM) (Saturated) ATP 2.6 + 0.9 3.1 + 0.9 N6- (Cyclo-2.1 + 0.9 Pentil) ATP Tests for the phosphorylation of GST-XD4 and GST-XD4 (V323A, I338A) of RR-Src were carried out in triplicate at 37 ° C in a final volume of 30 μL regulated at pH 8.0 containing 50 mM Tris, 10 mM MgCl2, 1.6 mM glutathione, 1 mg / mL BSA, 1 mM RR-Src peptide with GST-XD4 (100 mM) or GST-XD4 (V323A, I338A) (100 nM) and 10 μM of [? - ^ PJATP (1000 cpm / pmol) [Dupont NEN]. To determine whether the alanine mutations have any effect on the specificity of the protein substrate, the KMs of the wild-type and mutant fusion proteins were measured for the RR-Src peptide. At saturating concentrations of [? - ^ PJATP the wild type and mutant display essentially the same KM for RR-Src, 2.6 ± 0.9 mM and 3.1 ± 0.9 mM, respectively (63). In addition, the K of the mutant for the protein substrate in the presence of saturating amounts of the orthogonal substrate was also essentially the same, 2.1 + 0.9 mM. These findings suggest that alanine mutations in the ATP binding pocket, which is close to the adjacent phospho-receptor binding site, do not affect the white specificity of the protein. To support this, the designed kinase phosphorylates the same broad set of proteins that are phosphorylated by wild-type XD4 when each is expressed in Sf9 insect cells. This is shown in Figure 5 (a), which shows an antiphosphotyrosine protein blot of cell lysates (equivalents of 108 cells / lane) of Sf9 insect cells expressing 6-HIS-XD4, lane 2 or 6-HisXD4 (V323A, I338A), lane 3. These blots were carried out after lysis of 106 cells in a pH buffer containing Triton-X-100 ai 0.1%, 50 mM Tris, pH 8.0, using a similar procedure to that of the blots of example 2. The Sf9 insect cell system is a suitable host for expressing small amounts of tyrosine kinases because these cells contain the majority of the same machinery necessary to carry out the post-translational modifications to proteins, giving as a result kinases that are more similar in activity to those found in mammalian cells. Moreover, the uninfected Sf9 cells lack endogenous tyrosine kinase activity, as shown in Figure 5 (a), lane 1, and thus the phosphotyrosine-containing proteins in lanes 2 and 3 of Figure 5 ( a) are substrates of the expressed 6-His-XD4 or 6-His-XD4 mutant kinases. Small differences in the level of phosphorylation of particular proteins are attributed to the lower catalytic activity of the XD4 (V323A, I338A) mutant as compared to the wild-type kinase. Taken together, these data show that the peptide specificity of the designed kinase is virtually identical to that of wild-type v-Src.

EXAMPLE 8 Confirmation that the designed kinase accepts the preferred orthogonal substrate, but the wild-type kinase does not accept it substantially The ultimate goal of this work is to use specific mutant kinases for synthetic substrate analogs to label direct protein substrates in whole cells or cell lysates. For this it is preferred that no wild type kinases, including specific kinases ser / thr (those that carry out the bulk of cellular phosphorylation, since only 0.03% of all phosphoamino acids are tyrosine) (65), substantially accept the substrate synthetic. To establish that [? - ^ PJN6- (cyclopentii) ATP is essentially a "dead substrate" for all wild-type cell kinases, in vitro kinase reactions with [? - ^ PJATP or [? - ^ PJN ^ cyclopenti ATP] carried out with murine lymphocyte lysates. These tests were carried out in a manner similar to the procedure described in Example 2, with the exception of the use of [? -32P] ATP or [? -32P] N6- (cyclopentyl) ATP (500 cpm / pmol) radioactively labeled and added to a final concentration of 100 μM with equivalents of 5 x 10 6 cells and incubated at 37 ° C for 10 minutes, after which 4X Laemmli gel loading buffer was added to the cell lysate to quench the reaction. The proteins were separated by 12.5% SDS-PAGE. The gel was immersed in 10% acetic acid and 10% isopropane for 1 hour, after which it was dried in a gel dryer and exposed to Biomax MS film (Kodak # 111-1681) for 1 hour. The results are shown in Fig. 5 (b), which is an autoradiogram showing the level of phosphorylation in murine lymphocytes hypothesized lysates with [? - ^ PJATP, lane 1 or [? - ^ PJN ^ cyclopenti ATP, lane 2 There are no radioactive labeled phosphoproteins in the cell lysate after the addition of [? - ^ PJN ^ cyclopenti ATP, confirming the true orthogonal nature of N6- (cyclopentyl) ATP with respect to all wild-type kinase proteins. The same result was found when in vitro kinase reactions were used with [α-32P] ATP or [α- ^ PJN ^ cyclopenti ATP and NIH 3T3 cell lysates in place of freshly isolated murine lymphocytes (not shown). In principle, the ability to follow the activity of a protein kinase in the presence of all other cell kinases would allow the identification of direct kinase targets in particular in a particular cell type. To achieve this, membrane permeabilization (66) and a permeable cell form of ATP are currently used to introduce [? - PJATP in cells (67).

EXAMPLE 9 Construction and Analysis of Single Mutation v-Src Mutants To determine if an individual mutation would be sufficient to allow N6 (cyclopentyl) ATP to be used efficiently as a substrate, three additional v-Src-derived mutants were prepared, using methods comparable to those of Example 4. However, these had only single mutations at position 338. These were again expressed as GST-XD4 fusion proteins. These mutants, GGST-XD4 (I338A), GST-XD4 (I338S) and GST-XD4 (I338G), were then tested as described in Example 8. The results are shown in Figure 7. The gel lanes shown on the upper left of Figure 7 show that the mutant with alanine in position 338 was able to use the natural substrate, ATP, more easily than the mutant with serine in the same position. The gel lanes shown on the lower left portion of Figure 7 show that the alanine mutant at position 338 is also more capable of using ATP as a substrate than the mutant with glycine at that position. The panels on the right-hand side of Figure 7 tell an even more interesting story. From the right upper panel, it is clear that the mutant with serine in position 338 is not able to use N6 (cyclopentyl) ATP almost as well as does the mutant with alanine in that position. Nevertheless, the lower panel shows that the glycine mutant at position 338 is more capable of using N6 (cyclopentyl) ATP as a substrate than the mutant with alanine at that position. These results are more promising. It seems that a single mutation is sufficient to allow the use of this orthogonal substrate. Notably, the mutant with glycine at position 338 appears to be the best-designed v-Src mutant that has been produced to date. Moreover, it is quite surprising that a glycine substitution will work here. In general, glycine substitution is not normally expected to work in such situations, because it introduces too much flexibility in the structure of the enzyme, and thus deleteriously affects the desired development.

EXAMPLE 11 Identification of v-Src substrates A schematic representation of an experimental approach for identifying substrates of v-Src is shown in Figure 8. The designed v-Src, such as GST-XD4 (V323A, I338A), is added to cell extracts or permeabilized cells, together with a radioactively labeled orthogonal substrate, such as [α- ^ PjN ^ cyclopenti ATP. Typically, this would be done in triplicate. After incubation, the cells would be used (if they were not already used) and the resulting samples would be separated by electrophoresis with polyacrylamide gel. A western blot analysis taken from the gel and labeled with an antiphosphotyrosine would show all the phosphorylated proteins in the sample; and an autoradiogram of the gel would reveal which of those were phosphorylated by v-Src.

EXAMPLE 12 Synthesis of inhibitors The base structure of pyrazolopyrimine for the first six inhibitors is shown in Figure 11A. The synthesis of 4-amino-1-tert-butyl-3-phenylpyrazolo [3,4-d] pyrimidine, which has a phenyl group in the "R" position, compound 1 (which is the same structure as that of PP1, shown in Figure 10, but without the para-methyl group on the phenyl ring) was carried out ading to the method of Hanefeld et al. (76). Compounds 2-6 (FIG 11 B), which have cyclobutoyl, cyclopentoyl, cyclohexoyl, benzoyl and 2-furyl substituents in the "R" position, respectively, were synthesized by treatment of 1 with cyclobutoyl chloride, cyclopentoyl chloride , cyclohexoyl chloride, benzoyl chloride or furoyl chloride, respectively in dry pyridine for one hour at room temperature. The structures of each of the substituents are shown in Figure 11B. Purification by chromatography with silica gel gave pure products in a yield of 16-84%. Compounds 1-6 were characterized by 1 H NMR and mass spectral methods.

EXAMPLE 13 Analysis of inhibitors that are orthogonal to wild type kinases To identify compounds that would not inhibit any existing cellular kinase, the panel of synthetic pyrazolopyramidine analogues (1-6) against two closely related purified tyrosine kinases, v-Src and Fyn, was analyzed in a peptide phosphorylation assay using [? - ^ PjATP as the radioactively labeled tracer of kinase activity, as described in Shah et al. (79). The results showed that each of compounds 2-6 had IC50 values of more than 400 μM for the inhibition of Src, and compounds 3 and 5 showed IC50 values of more than 400 μM for inhibition of wild type Fyn, indicating that these analogs (2 and 5) are orthogonal to (do not inhibit) these representative wild-type kinases.

EXAMPLES 14-16 Deconvolution of protein kinase signaling pathways using conventional biochemical and genetic approaches has been difficult due to the overwhelming number of closely related kinases. If permeable cell inhibitors of each individual kinase could be designed, the role of each protein kinase would be determined in a systematic way.

Results An approach combining chemistry and genetics has been envisioned to develop the first cell-permeable inhibitor unique to the oncogenic tyrosine kinase protein, v-Src. A silent and functional active site mutation in v-Src was made to distinguish it from all other cell kinases. A narrow binding cell permeable inhibitor (ICso = 430 nM) of this mutant kinase that does not inhibit wild-type kinases was designed and synthesized. In vitro tests and whole cell assays established the unique specificity of the v-Src mutant / inhibitor pair. This inhibitor reverses the effects of cell expression transformation of the designed v-Src, but does not interrupt cell transformation mediated by wild-type v-Src. These cell lines differ only by a single amino acid in a single protein kinase, establishing that dramatic changes in cell signaling can be directly attributed to the specific inhibition of the designed kinase. The generality of this method was tested by designing another tyrosine kinase, Fyn, to contain the corresponding silent mutation. The same compound was found to be a potent inhibitor (IC5o = 830 nM) of this mutant kinase as well, confirming the generality of the strategy towards making specific inhibitors of multiple tyrosine kinase alleles.

Conclusions The individual allele-specific cell-permeable kinase inhibitors of the Src family can be rapidly developed using a combined chemical and genetic approach. The treatment of NIH 3T3 fibroblasts transformed by mutant v-Src with a uniquely specific v-Src reverses the morphological transformation marks. The inhibitor exhibits no effect on cells transformed by the wild-type v-Src allele, strongly suggesting that the phenotype induced by inhibitor treatment is a result of a single inhibitory invention. The ability to rapidly generate specific kinase inhibitors in a generalizable form will be useful for the deconvolution of kinase-mediated cell pathways and for validating novel kinases as suitable targets for drug discovery, both in vitro and in vivo. As stated before, a combined chemical and genetic strategy has been envisioned that allows the generation of "chemical sensitive" mutant kinases that are inhibited only by a rationally designed small molecule inhibitor. The present approach includes designing a single cavity in the active site of the kinase of interest with a functionally silent mutation. A specific inhibitor of the designed kinase is then synthesized by deriving a known kinase inhibitor with a bulky pool designed to adapt to the novel active site cavity. The bulky group eliminates the inhibitor potency for wild-type kinases. Therefore, a successful complementary design leads to favorable binding interactions that are only possible in the designed kinase / inhibitor complex. The transfection of cells with the gene that codes for the designed kinase generates a cell in which only one kinase can be blocked by the designed inhibitor (see figure 14). Importantly, since the mutant kinase serves the same function as the wild-type kinase, an inhibitor of the mutant would affect cell signaling in the same way as a selective inhibitor of the wild-type kinase in non-transfected cells. The ability to observe the cell phenotype after the selective inhibition of any protein kinase provides a rapid method to determine the unique roles of individual kinases in cascades of signal transduction. The tyrosine kinase proteins of the Src family have been identified for a specific inhibitor design due to their adequate importance to mediate the function of the cells. Despite intensive research, the roles of individual members of the Src family have been difficult to determine due to cell co-localization and their high sequence identities. Although some potent inhibitors of kinases of the Src family are known, no molecules that effectively discriminate (20-fold selectivity for a member of the Src family) have been identified among these closely related enzymes. Two functionally important src kinases, v-Src and Fyn, were selected as the primary targets of mutant pair kinase / inhibitor design. The src kinase has emerged as an outstanding target drug due to its involvement in the oncogenesis of breast, lung and colon cancers. Although v-Src is the prototype of oncogenic tyrosine kinases, no small molecule inhibitors have been discovered that are highly selective for this kinase. Fyn is a tyrosine kinase of the src family that is important in the activation of lymphocytes mediated by T cell receptors. Src and Fyn share a similar domain structure, and have approximately 85% amino acid identity in their catalytic domains. The close structural relationship of the members of the src family provides the ideal test for the ability to design the specific enzyme / inhibitor character between highly homologous kinases. If it is possible to discriminate between these closely related src members using a cell-permeable inhibitor, it is possible that the specificity for members of other protein kinase families can also be achieved using a similar approach.

Results and discussion Enzyme design Based on previous efforts to design kinases with specific character of novel ATP, a functionally conserved residue was identified in the ATP binding cavity of v-Src (Me 338), which could be mutated to glycine without altering the specific character of phosphoaceptor or the biological function of the kinase. The mutation that creates space causes only a moderate decrease in kcat_ a moderate increase in Km for ATP, and no quantitative change in the level of transformation of fibroblasts (Shah K, unpublished results). The biological substrates of mutant v-Src remain unchanged and v-Src I338G performs the same biological functions as wild-type v-Src. All crystalline structures of protein kinases bound to ATP have revealed an interaction by close contact between the residue corresponding to 338 (Src numbering) and ATP. Analysis of the protein kinase sequence alignments confirmed that residue 338 contains a bulky side chain (usually Thr, lie, Leu, Met or Phe) in all known eukaryotic protein kinases. Thus, a glycine mutation in position 338 should create a novel cavity that is not present in any wild-type kinase. Due to the expanded ATP binding site, the mutant kinases in glycine must accept bulky inhibitors that can not bind to the wild-type kinases. Using standard methods, the glutathione-S-transferase (GST) fusion protein was cloned, expressed and purified from the catalytic domains of v-Src WT and I338G as described above. Fyn WT, Fyn T339G (Src numbering) and Abl WT were also expressed and purified as GST fusion proteins.

Inhibitor design and synthesis To test the basic design strategy, the SH1 domains of v-Src WT and I338G were selected against a previously synthesized panel of N-6 substituted adenosine molecules for selective inhibition of v-Src I338G over v-Src WT. Because adenosine is only a moderate inhibitor of the tyrosine kinases of the src family, we did not expect to discover a potent inhibitor of the designed kinase.

As expected, all N-6 adenosine analogs inhibited v-Src I338G more potently than v-Src WT (data not shown). The most potent inhibitor found in this analysis was cyclopentyloxyadenosine N-6 (1, Fig. 15a) with a 50% inhibitory concentration (ICso) of 1 mM for v-Src I338G. Subsequent experiments to test the selectivity showed that cyclopentyloxyadenosine N-6 showed no detectable inhibition of v-Src or Fyn WT in vitro at concentrations up to 400 mM. This first selection led to the strategy to develop novel inhibitors of v-Src I338G, since the design had easily overcome the selectivity barriers that are important problems in the conventional discovery of the inhibitor. As inhibitors, adenosine analogs are not ideal due to the many cellular functions carried out by adenosine, as well as due to the large number of cellular proteins that bind to it. The N-6 adenosine analogues have been shown to act as agonists and antagonists of the adenosine receptor, and it is possible to imagine that the N-6 adenosine analogues act as substrates for nucleoside kinases. For these reasons, we turned to a class of known tyrosine kinase inhibitors that are not direct analogs of biologically known molecules. The design strategy required a central structure that exhibits potent inhibition of wild type multiple kinases and is easily synthesized. Similarly, the binding orientation of the molecule at the active site of the enzyme must be known or should be easily predictable.

In addition, the molecule must be joined in such a way that the site pointing towards Ile338 can be easily modified. As a central inhibitor structure, 4-amino-1-tert-butyl-3-phenylpyrazolo [3,4-d] pyrimidine (2, Fig 15b) was chosen. This molecule is a derivative of 4-amino-1-tert-butyl-3- (p-methylphenyl) pyrazolo [3,4-djpyrimidine (PP1), which was reported by Hanke et al. As a potent inhibitor of the kinase of the src family. Based on the co-crystalline structure of the kinase of the src family, Hck, linked to the general kinase inhibitor quercetin (5, Fig. 16), it was postulated that 2 binds to the kinase of the src family in a conformation similar to that of the ATP. The predicted binding orientation of 2 in Hck is shown in a shell with the known Hck co-crystalline structures of AMP PNP (6) and quercetin (Fig. 16b). In this conformation, the easily derivable N-4 position of 2 corresponds to the N-6 position of ATP (close contact with residue 338, Fig. 16c), and the tert-butyl portion almost corresponds to the ribose ring of the ATP . It was further assumed that in this orientation, the phenyl ring at C-3 of 2 could be bound in a cavity surrounding the N-7 of ATP, as observed in the co-crystalline structure of Hck / quercetin. This analysis led to the synthesis of a small panel of analogs of 2 N-4 derivatives (Fig. 2).

Identification of a selective only inhibitor The pyrazolo [3,4-d] pyrimidines panel was selected against v-Src WT and I338G kinases (see Fig. 13). All analogs are better inhibitors of v-Src designed, comparatively with the wild type, confirming the prediction of binding orientation of 2 in the active site of the kinase. Any derivation of 2 at the N-4 position destroys the inhibitory activity against v-Src WT (no detectable inhibition at the solubility limit, 300 mM). The 10 analogues demonstrated measurable inhibition of v-Src I338G, and several of the compounds have ICso's on the low scale of mM. The N-4- (p-tert-butyl-) benzoiio analogue (3g) is the most potent inhibitor of v-Src I338G in the panel (IC50 = 430 nm). This molecule shows no inhibition of v-Src WT at 300 mM, suggesting that 3 g is an at least 1000-fold better inhibitor of v-Src mutant compared to the wild type. The large size of the derivation necessary to achieve submicromolar potency for the active site of v-Src I338G was rather unexpected. Only four carbon atoms were removed from the ATP binding site, and the original molecule was derived with eleven carbon atoms. This discrepancy may be due to an imperfection in the prediction of the union. Similarly, the Gly mutation may confer greater flexibility to the active site of the enzyme, allowing the mutant kinase to accept a larger inhibitory analogue than predicted. To confirm that 3g inhibits v-Src I338G at the ATP binding site, its inhibition kinetics were investigated at various concentrations of ATP. The Lineweaver-Burk analysis confirmed that 3g competitively inhibits v-Src I338G with respect to ATP with an inhibitory constant (K,) of approximately 400 nM (data not shown). The panel of analogs of the inhibitor was then screened against Fyn WT to investigate its potential to cross-react with this kinase. Fyn WT was chosen as the "worst case" control of wild type kinases because the published original molecule, PP1, and 2 are highly potent Fyn inhibitors (at low nM value). Many of the 10 synthetic analogs did not show high selectivity for the target kinase (see Fig. 13). N-acyl analogs with saturated ring systems (Sa3c), effectively inhibited wild-type Fyn. The N-methylene compounds (4b, 4d, 4e) are sufficiently orthogonal to Fyn WT, but hardly show poor to moderate inhibition of v-Src designed. Importantly, 3g, the most potent inhibitor of v-Src mutant, very weakly inhibited Fyn WT (IC5o = 300 mM). Thus, 3g inhibits v-Src designed more than 700 times more efficiently than Fyn WT, which is likely to be the wild-type cell kinase that is most capable of binding to the molecule. It was also tested if other kinases not from the src family were fortuitously inhibited by 3g in vitro. Serine / threonine kinases PKCd and PKA were not detectably inhibited at concentrations up to 300 mM. Similarly, 3g exhibited only weak inhibition (IC5o> 300 mM) of the Abl tyrosine kinase. Therefore, 3g satisfied the four initial design requirements for the potent selective inhibition of a designed kinase.

Selectivity in intact cells To better demonstrate that 3g does not inhibit wild-type tyrosine kinases, the effects of 3g treatment on the cascade of B-cell receptor (BCR) -mediated phosphorylation was investigated. It is known that tyrosine kinases from the src family (Fyn, Lyn, Lck, Blk) and not from the src family (Btk, Syk) are activated after BCR entanglement. Due to the amplification nature of the cascade mediated by BCR, the inhibition of any of these kinases would dramatically alter the distribution and intensity of cellular phosphotyrosine after activation. Since 3g was designed to be sterically incompatible with the active sites of the wild type kinases, must not interrupt signaling dependent on tyrosine phosphorylation in wild type B cells. Figure 17 (band 3) demonstrates that the treatment, with 3g to 100mM, of murine B cells intertwined with the antigen receptor, has no effect on the pattern of B cell stimulation by phosphotyrosine (comparatively with band 2) . The signal intensities of the main bands remain unchanged, and only a slight depletion of some minor bands is detectable, confirming that 3g does not appreciably inhibit the panel of tyrosine kinases that are activated by BCR entanglement. However, treatment of B cells at 2 to 100 mM causes a significant decrease in tyrosine phosphorylation (Figure 4, band 4), which is consistent with their potent inhibition of kinases from the wild-type src family. .

Selective inhibition of v-Src 1338G in NIH3T3 cells To use the selective inhibitor to study a Src-mediated pathway, v-Src WT and I338G were retrovirally introduced into NIH3T3 fibroblasts. These cells acquire a transformed phenotype, which depends on the expression of v-Src. We sought to show that 3g could selectively alter the Src-dependent signal transduction pathway of cells transformed by v-Src I338G, without affecting the cells transformed by v-Src WT. The treatment of cells infected with v-Src WT (3 g at 100 mM) does not cause loss of tyrosine phosphorylation compared to control bands treated with DMSO (Figure 18), demonstrating that the designated inhibitor does not inhibit v-Src WT or some of the other tyrosine kinases that are activated by cell transformation mediated by v-Src. The equivalent treatment of cells transformed with v-Src I338G, results in a dramatic decrease in tyrosine phosphorylation of the putative v-Src substrate, p36, as well as a moderate overall decrease in the phosphotyrosine cell level. Previously, it has been shown that treatment of v-Src transformed cells with general tyrosine kinase inhibitors causes a reduction in tyrosine phosphorylation of a 36 kD protein. It is thought that p36 is associated with a specific phosphotyrosine phosphatase, possibly explaining its rapid dephosphorylation in cells treated with inhibitor. The IC50 of 3g for the phosphotyrosine signal of p36 in cells expressing v-Src I338G (50 mM), is almost 100 times the value in vitro (data not shown). This is probably due to the fact that the inhibitor must compete with millimolar concentrations of ATP for the active kinase site in the cell experiments.

Selective inhibition of mutant v-Src 1338G reverses the morphology of transformed cells v-Src activity is required for the transformation of mammalian cells by the Rous sarcoma virus. The treatment of NIH 3T3 cells expressing v-Src I338G with 3 g at 100 mM, caused dramatic changes in cell morphology, which are consistent with the inversion of the transformation (Fig. 19). The mutant cells that were treated with 3g inhibitor were flat and did not show the growth characteristics of the transformed cells (ie the ability to grow on one another). Under identical conditions, the cells infected by v-Src WT demonstrated the prototypical rounded morphology and the overlapping growth patterns of the transformed cells. To better demonstrate the selective reversal of cell morphology, fluorescence microscopy was used to observe the 3g treated cells after staining the cell polymerized actin with phalloidin-FITC (Fig. 19). Untransformed NIH3T3 cells show long spindles of actin that are formed through the cells. Cells transformed with v-Src (WT and I338G) were rounded without discernible pattern of actin formation. In accordance with the optical microscopy data, the v-Src WT expressing cells treated with inhibitor could not be distinguished from untreated cells expressing v-Src WT. However, cells expressing v-Src I338G treated with 3g show defined polymerized actin filaments, which closely resemble the actin formations of non-transformed NIH3T3 fibroblasts. These inhibitor-treated cells have an exaggerated flattened morphology, and show peripheral actin staining that is not present in non-transformed NIH3T3 cells. These data show that 3g can induce only morphological changes in cells that are designed to contain a single amino acid change in the kinase of interest. This is the first demonstration that a small selective inhibitory molecule for a tyrosine kinase oncogene product can reverse the morphological changes associated with cell transformation. Previous examples of morphological reversal of transformation by herbimycin A (and other benzoquinone ansamycins), have recently shown that it works by a mechanism unrelated to kinase inhibition, which consists in directing oncogenic tyrosine kinase to protein-mediated proteasome. thermal shock (hsp90).

Generalization to other kinases The advantage of using mutagenesis to provide a unique molecular difference between the enzyme of interest and others used is that, due to the conserved kinase fold, the alternative must be extendable through the kinase superfamily. Almost all known kinases contain a bulky side chain in the position corresponding to residue 338 of v-Src. Therefore, a mutation that generates a space in this position should make multiple kinases susceptible to selective inhibition. To test this, the inhibition of the analogs against Fyn T339G was measured (Table 1). There is a remarkable similarity in structure activity relationships of the analogs for v-Src I338G and Fyn T339G. In agreement with the data for v-Src I338G, 3g was the most potent inhibitor analog against Fyn T339G, exhibiting an IC50 of 830 nM. This corresponds to a selectivity greater than 300 times for Fyn T339G on Fyn WT. The implication of these data is that multiple tyrosine kinases can be systematically designed to preferentially accept an inhibitory analog without the need to screen large libraries of putative inhibitors.

Conclusion In this report, we describe a novel approach to the selective inhibition of protein kinase through the complementary design of reasonably designed chemical-sensitive kinases and inhibitors. It is demonstrated that high selectivity for the target kinase can be achieved in intact cells, and that inhibition of the active site of an oncogenic tyrosine kinase may be sufficient to disrupt the morphology of the transformed cells. Because the approach is easily generalized, it must have far-reaching applications in the clearance of signal transduction pathways, as well as in the validation of kinases as targets for drug design. The pace of effective drug discovery is limited by the identification and validation of important drug targets. This is not a trivial problem in an environment of 2000 homologous proteins. The use of mutants of chemical-sensitive kinases, expands the ability to probe the cellular and physiological effects of pharmacological inhibition of the kinase. Since it is now possible to rapidly generate transformed cell lines and even "knock-in" mice, the approach should greatly facilitate the procedure for testing the effects of selective inhibition of a given kinase in an animal model or in intact cells. . As more kinase-bound kinase structures are available, this strategy will allow the systematic investigation of the effects of time-dependent inhibition and dose of some given kinase in the panorama of a complete cascade of signal transduction.

Materials and methods Glymic synthesis All starting materials and synthetic reagents were purchased from Aldrich, unless otherwise indicated. All compounds were characterized by 1 H NMR and high resolution mass spectrometry. 4-Amino-1-tert-butyl-3-phenylpyrazolo [3,4-d-pyrimidine (2) was synthesized according to Hanefeld et al.

General procedure for N-4 acylation of 2 (3a-3g). To a solution of 2 (100 mg) dissolved in 2 ml of pyridine, 10 equivalents of the desired acyl chloride were added at 0 ° C. The reaction mixture was allowed to warm to room temperature, and was stirred for 12 hours. The reaction was warmed by the addition of 25 ml of water. The resulting mixture was extracted with Et 2 O, and the combined Et O extracts were washed with 1 N HCl and 5% NaHCO 3. The Et2O layer was dried over MgS? and it evaporated. The residue was purified by flash chromatography on 25 g of silica gel by elution with 1: 1 Et 2 O / hexanes to produce pure 3a-3g. 4-cyclobutylamido-1-tert-butyl-3-phenylpyrazolo [3,4-dlpyrimidine (3a): yield 0.0116 g (16%), white powder; HRMS (El), molecular ion calculated for C8H8NsO 349.19049, found 349.18762; 1 H NMR (300 MHZ, üCh, ppm) d 1.86 (9H, s), 1.89-2.27 (6H, m), 3.58 (1 H, m), 7.26-7.67 (5H, m), 8.69 (1 H, s ). 4-cyclopentylamido-1-tert-butyl-3-phenylpyrazolo [3,4-dlpyrimidine (3b): yield 0.0456 g (68%), white powder; HRMS (El), molecular ion calculated for C ^ H ^ NsO 363.20615, found 363.20398; 1 H NMR (270 MHZ, CDCl 3, ppm) d 1.41-1.91 (8H, m), 1.87 (9H, s), 2.97 (1 H, m), 7.51-7.67 (5H, m), 8.70 (1 H, s). 4-cyclohexalamido-1-tert-butyl-3-phenylpyrazolf3,4-dlpyrimidine (3c): yield 0.0575 g (84%), white powder; HRMS (El), calculated on C22H27N5O; 1 H NMR (270 MHZ, CDCb, ppm) d 1.21-1.93 (10H, m), 1.86 (9H, s), 2.43 (1 H, m), 7.51-7.67 (5H, m), 8.70 (1 H, s ). • 4-2'-furyl amido-1-tert-butyl-3-phenylpyrazolo3,4-dlpyrimidine (3d): yield 0.0342 g (60%), white powder; HRMS (El), molecular ion calculated for C2oH19N5? 2 361.15407, found 361.15254; 1 H NMR (270 MHz, CDCb, ppm) d 1.87 (9H, s), 6.52 (1 H, d), 7.23 (1 H, d), 7.43-7.53 (5H, m), 7.95 (1 H, s), 8.59 (1 H, s). 4-benzamido-1-tert-butyl-3-phenylpyrazolo [3,4-dlpyrimidine (3e): yield 0.1309 g (56%), white powder; HRMS (El), molecular ion calculated for C ^ H ^ NsO 371.17933, found 371.17324; 1 H NMR (270 MHZ, CDCb, ppm) d 1.41-1.91 (8H, m), 7.22-8.11 (10H, m), 8.48 (1 H, s). 4- (p-methyl) benzamido-1-tert-butyl-3-phenyipyrazofof.4,4-dlpyrimidine (3fí: yield 0.0751 g (33%), white powder; HRMS (El), calculated molecular ion for CH NsO 385.19499, found 385.18751; 1H NMR (270 MHZ, CDCb, ppm) d 1.88 (9H, s), 2.42 (3H, s), 7.19 (2H, d), 7.41-8.11 (7H, m), 8.49 (1 H, s). 4- (p-tert-butyl) benzamido-1-tert-butyl-3-phenylpyrazof3,4-dlpyrimidine (3g): yield 0.1050 g (42%), white powder; HRMS (El), calculated on molecular weight for C H NsO 427.23747, found 427.23474; 1 H NMR (270 MHZ, CDCl 3, ppm) d 1.35 (9H, s), 1.88 (9H, s), 7.38-7.99 (9H, m), 8.50 (1H, s).

General procedure for the reduction of N-4 acyl compounds in methylene compounds N-4 (4b, 4d, 4e). A round bottom flask was charged with 30 mg of LYAH4. The flask was equipped with a dropping funnel for pressure equalization, and flushed with dry argon. The LIAIH4 was suspended in 3 ml of THF on an ice bath. Approximately 100 mg of the corresponding acyl analog N-4 was dissolved in 5 ml of THF, and added dropwise to the suspension of UAIH4. The reaction mixture was stirred for 30 minutes on the ice bath, and subsequently heated to reflux for 30 minutes. The reaction was quenched by sequential additions by dripping 1 ml of EtOAc, 1 ml of water and 1 ml of NaOH at 6N. After stirring for 5 minutes, the reaction mixture was filtered through a pad of celite, diluted with water and extracted with Et2O. The Et 2 O extracts were combined, dried over MgSO 4 and evaporated. The residue was purified by flash chromatography on 10 g of silica gel by elution with hexanes / EtOAc 4: 1. 4-Cyclopentylmethylamino-1-tert-butyl-3-phenylpyrazoloyl-3,4-dlpyrimidine (4b): yield 0.0649 g (75%), clear oil; HRMS (El), molecular ion calculated for C2? H27N5 349.22691, found 349.22420; 1 H NMR (270 MHZ, CDCb, ppm) d 1.16-2.14 (9H, m), 1.84 (9H, s), 3.54 (2H, d), 5.51 (1H, s), 7. 46-7.67 (5H, m), 8.43 (1 H, s). 4-2'-furylmethylamino-1-tert-butyl-3-phenylpyrazofof.4.4-dlpyrimidine (4d): yield 0.0620 g (66%), beige powder; HRMS (El), molecular ion calculated for C2oH2? N5O 347.17483, found 347.17330; 1 H NMR (270 MHz, CDC b, ppm) d 1.83 (9 H, s), 4.75 (2 H, d), 5.64 (1 H, s), 6.25 (2 H, d), 7.34-7.63 (6 H, m), 8.45 (1 H, s). 4-benzylamino-1-tert-butyl-3-phenylprazrazi3,4-d1pyrimidine (4eV yield 0.0520 g (54%), white powder; HRMS (El), calculated molecular ion for CH Ns 357.19559, found 357.19303; 1H NMR (270 MHZ, CDCb, ppm) d 1.82 (9H, s), 4.76 (2H, d), 5.63 (1 H, s), 7.28-7.63 (10H, m), 8.44 (1 H, s).

Expression and purification of proteins. As described above, site-directed mutagenesis and cloning of genes for the glutathione-S-transferase fusion proteins of the SH1 domain of v-Src WT, SH1 of v-Src were carried out as described above.

I338G, Fyn WT, Fyn T339G and Abl WT in the pGEX-KT plasmid. These kinases were expressed in E. coli DH5a and purified on immobilized glutathione spheres (Sigma). PKA (Pierce) was purchased, and used without further purification. PKCd was expressed as the 6-His construct using the Bac expression system by Bac (vector B from pFastBac). PKCd was purified using a Ni-NTA agarose column expressing QIA.

In vitro kinase inhibition test ICso's were determined for putative kinase inhibitors by measuring the counts per minute (cpm) of transferred P to a peptide substrate optimized for src family kinases (lYGEFKKK). Various concentrations of inhibitor were incubated with 50 mM Tris (pH 8.0), 10 mM MgCl2, 1.6 mM glutathione, 1 mg per ml of BSA, 133 mM of YGEFKKK, 3.3% DMSO, 0.05 mM kinase and 2 mCi from [g- ^ PjATP to 11 nM (6000 Ci / mmoles, NEN), in a total volume of 30 ml for 30 minutes. The reaction mixtures (25 ml) were stained on a phosphocellulose disc, submerged in 10% HOAc, and washed with 0.5% H3PO. The transfer of ^ P was measured by standard scintillation counting. The IC 50 was defined as the concentration of inhibitor at which the cpm was 50% of the control disc. When the IC50 decreased between two measured concentrations, it was calculated based on the assumption of an inversely proportional relationship between the inhibitor concentration and the cpm between two data points. Because the solubility limit of the inhibitor analogues in aqueous solutions is 300 μM, the IC8 values of 250 μM are approximate, since full titrations could not be tested towards the upper inhibition limit. The IC 50 for kinases of the non-src family were measured in equivalent form with the following exceptions. Kemtide (Pierce, 133 mg / ml) was used as a substrate for PKA. An optimized Abl substrate (EAIYAAPFAKKK, 133 mg / ml) was used for Abl tests. PKCd tests were carried out in the presence of 17 ng / ml of diacyl glycerol (Sigma) and 17 ng / ml of phosphatidyl serine (Sigma) with 170 ng / ml of histone (Sigma) as a kinase substrate.

Murine B-cell test Splenic lymphocytes were isolated from Balb / c or C57 / B6 mice for 6 to 20 weeks. The cells were washed from the spleen in RPMI media containing 1 mg per ml of DNase I, and the erythrocytes were lysed in tris-ammonium chloride at 17 mM, pH 7.2. Approximately 4x106 cells were incubated at 37 ° C for 30 minutes with 100 mM of 3g or 2 in DMSO at 1.1%. Stimulation of the B cells was initiated by the addition of 2 mg of goat anti-mouse IgM (Jackson Immuno Research, Category No. 115-005-075) and subsequent incubation for 5 minutes at 37 ° C. Cells were isolated by centrifugation (13,000 rpm, 2 min) and used (lysis pH regulator: Triton X-100 at 1%, tris at 50 mM, pH 7.4, EDTA at 2 mM, NaCl at 150 mM, PMSF at 100 mM, sodium orthovanadate at 2 mM, 10 mg per ml of leupeptin, 10 mg per ml of apoprotin). The cell debris was then transformed to pellets at 13,000 rpm for 15 minutes. Cell proteins were separated by 10% polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane by Western blotting. Proteins containing phosphotyrosine were visualized by immunoblotting with antiphosphotyrosine antibody (Upstate Biotechnology, Inc.).

Retroviral infection of NIH 3T3 fibroblasts Genes coding for v-Src WT and I338G were transfected into a line of packaging cells, and NIH 3T3 fibroblasts were retrovirally infected using the pBabe retroviral vector and a puromycin selectable marker (2.5 ml / ml) , as described (Shah, K., Liu, Y., Shokat, KM, in preparation). Cells transformed with v-Src WT and I338G were cultured in 10% DMEM / BCS containing 2.5 mg per ml of puromycin.

Inhibition of v-Src in fibroblasts NIH3T3 Non-transformed NIH3T3 cells, NIH3T3 cells transformed with v-Src WT and NIH3T3 cells transformed with v-Src I338G, were incubated at 37 ° C with DMSO at 1.1% or 3g at 100 mM in 1.1% DMSO. After 12 hours, the cells were washed with PBS and used (lysis pH regulator: Triton X-100 at 1%, tris at 50 mM, pH 7.4, EDTA at 2 mM, NaCl at 150 mM, phenylmethylsulfonyl fluoride at 100 mM, sodium orthovanadate at 2 mM, 10 mg per ml of leupeptin, 10 mg per ml of apoprotin). The lysate was clarified by centrifugation at 13,000 rpm for 15 minutes. The lysate protein concentrations were normalized, and equal volumes of the lysate were electrophoretically resolved and analyzed for phosphotyrosine content, as described above.

Microscopy Untransformed NIH3T fibroblasts, transformed with v-Src WT and transformed with v-Src I338G, were cultured in 10% DMEM / BCS on tissue-treated slides. Cells expressing v-Src were treated with 1.1% DMSO or 100mM 3g in 1.1% DMSO. After 48 hours, the cells were photographed at a magnification of 400 x in a Nikon TMS optical microscope. Immediately after the optical microscopy, the cells were fixed for 20 minutes in formaldehyde at 3.7% / PBS, and permeabilized for 60 seconds in Triton X-100 at 0.2% / PBS. The permeabilized cells were incubated with 200 ng / ml phalloidin-FITC / PBS for 20 minutes. The slides were rinsed with PBS, and the polymerized actin was visualized by fluorescence microscopy at a magnification of 600X in a Zeiss fluorescence microscope.

EXAMPLE 6 Confirmation of the retention of the biological activity and the specific character of the protein substrate This could be carried out as described in (79). In addition, the stereotyped role of v-Src in the oncogenic transformation of NIH 3T3 cells can be determined by observing the morphological change in cells expressing v-Src. NIH 3T3 cells expressing mutant v-Src I338G, show the identical morphological characteristics of cells expressing wild-type v-Src, which are dramatically different from NIH 3T3 cells that do not express v-Src kinase, confirming that the I338G does not lead to any loss or gain of biological function of normal v-Src. In addition, a test to determine the ability of NIH 3T3 cells to grow without "contact inhibition" can be evaluated in a tissue culture-based test containing agarose, a viscous growth medium. NIH 3T3 cells expressing mutant v-Src and wild type v-Src show the same exact ability to also form high growth colonies in this stereotyped test, further confirming their identical functions (including substrate specificity, kinetics, distribution of cells, etc.) in fibroblasts.

EXAMPLE 7 Confirmation that orthogonal inhibitor does not inhibit wild-type kinases in cells expressing multiple tyrosine kinases To confirm the initial tests regarding the orthogonal nature of compound 3 in purified kinases described in example 2, inhibition experiments were carried out using intact cells (see figure 4, 2 bands on the left). Antiphosphotyrosine blots of NIH 3T3 cells treated with pyrazolo pyrimidine (2-6) (25 μM) expressing v-Src kinase were carried out, using the cells in modified pH regulator RIPA, in accordance with the Coussens method and others. (84). The cells were also treated several times before lysis and detection of antiphosphotyrosine. Proteins were separated by 12.5% SDS-PAGE and transferred to Protan BA85 (Scheilecher-Schuell). The blot was probed with the antiphosphotyrosine monoclonal antibody 4G10 (gift from Dr. Brian Druker, Oregon Health Sciences Center Portiand, Oregon), and the bound antibody was detected by increased chemiluminescence (cat 34080, Pierce), after treatment with goat anti mouse antibody coupled to HRP (VWR, cat 7101332) in accordance with the manufacturer's instructions.

EXAMPLE 8 Identification of substrates Figure 1 shows a schematic representation of an experimental alternative to identify substrates of v-Src, and in figure 4 the data showing the experimental validation are given. The tests were carried out by performing antiphosphotyrosine blots of NIH 3T3 cells treated with pyrazolo pyrimidine (2-6) (25 μM) expressing v-Src or v-Src (I338G) kinases, and using the cells in pH regulator RIPA modified, in accordance with the method of Coussens et al. (84). The cells were also treated several times (in a CO2 incubator for cell culture) before lysis and detection of antiphosphotyrosine. Proteins were separated by 12.5% SDS-PAGE and transferred to Protan BA85 (Scheilecher-Schuell). The blot was treated with a probe with the antiphosphotyrosine monoclonal antibody 4G10 (gift of Dr. Brian Druker, Oregon Health Sciences Center Portland, Oregon), and the bound antibody was detected by increased chemiluminescence (cat 34080, Pierce), after treatment with goat anti mouse antibody coupled to HRP (VWR, cat 7101332) in accordance with manufacturer's instructions. As described in Example 7, the two bands on the left of Figure 4 show the same pattern of phosphoprotein bands indicating that the orthogonal inhibitor 3 does not inhibit the wild-type v-Src kinase. The series of bands in the gel on the right shows a prominent band at the bottom of the gel (corresponding to the molecular weight of 3 kilodaltons of the protein), which is lost after treatment with 100 μM of compound 3. This inhibition Specificity of a phosphoprotein is a hallmark of a specific kinase inhibitor. The specific character of the inhibition is confirmed in the last bands of the gel, where the inhibitor is diluted and the phosphorylation of the 36 kilodaltons band reappears when the concentration of the inhibitor is less than 5μM (the IC50 measured in vitro is 5μM, see text). This protein has been tentatively identified based on its unique molecular weight, as a protein called annexin II, an actin-binding protein of unknown function.

REFERENCES 1. Mustelin, T. 1994. T cell antigen receptor signaling: three families of tyrosine kinases and one phosphatase. Immunity 1 p. 351-356. 2. Renshaw, M.W., E.T. Kipreos, M.R. Albrecht, and J.Y.J. Wang 1992. Oncogenic v-Abl tyrosine kinase can inhibit or stimulate growth, depending on the context of the cell. EMBO J. 11 (11): p. 3941-3951. 3. Cohen, G.B., R. Ren, and D. Baltimore 1995. Modular binding domains in signal translation proteins. Cell. 80: p. 237-248. 4. Hunter, T. 1987. One hundred protein kinases. Cell. 50: p. 823-829. 5. Eiseman, E. and J.B. Bolen, 1992. High-affinity IgE receptor coupling activates tyrosine kinases related to src protein.

Nature 355. 6. Murray, A. W. 1994. Cyclin-dependent kinases. Chem. And Bio. 1 (4): p. 191-195. 7. White, M.F. 1991. Mini-Review: Structure and Function of Tyrosine Kinase Receptors. J. Bioenergetics Biomem. 23 (1): p. 63-83. 8. Hunter, T. 1995. Protein kinases and phosphatases: The Yin and Yang protein phosphorylation and signaling. Cell. 80: p. 225-236. 9. Sawyers, C.L. 1992. The bcr-abl gene in a chronic myelogenous leudemy. Cancer Surveys. 15: p. 37-51. 10. Crabtree, G.R. and N.A. Clipstone 1994. Transmission of signals between the plasma membrane and the T lymphocyte nucleus. Annu. Rev.

Biochem. 63: p. 1045-1083. 11. Kurzrock, R., J.U. Gutterman, and M. Talpaz 1988. Molecular genetics of positive leukemias of the Philadelphia chromosome. New Engl. J.

Med. 319 (15): p. 990-998. 12. Ullrich, A. and J. Schlessinger 1990. Signal translation by receptors with tyrosine kinase activity. Cell. 61: p. 203-212. 13. Bolen, J.B., R.B. Rowley, C. Spana, and A. Y. Tsygankov 1992.

The Src family of protein tyrosine kinases in Hemopoietic signal translation. FASEB, 6: p. 3403-3409. 14. Cicchetti, P., B.J. Mayer, G. Thiel, and D. Baltimore 1992. Identification of a protein that binds to the SH3 region of Abl. Science, 257: p. 803-806. 15. Sawyers, C.L., J. McLaughlin, A. Goga, M. Havlik, and O. Witte 1994. Nuclear tyrosine kinase c-Abl down regulates cell growth. Cell, 77: p. 121-131. 16. Kipreos, E.T. and J.Y.J. Wang 1992. Union regulated by the cell cycle of tyrosine kinase a-abl to DNA. Science, 256: p. 382-385. 17. Velazquez, L, M. Fellous, G.R. Stark, and S. Pellegrini 1992. Cell, 70: p. 313-320. 18. Duyster, J., R. Baskaran, and J.Y.J. Wang 1995. Domain 2 of Src homology as a determinant of specificity in tyrosine phosphorylation mediated by c-Abl of the carboxy terminal repeat domain of RNA poiimerase II. Proc. Nati Acad. Sci., USA, 92: p. 1555-1559. 19. Mayer, B.J. P.K. Jackson, and D. Baltimore 1991. Segment 2 of non-catalytic tyrosine kinase homology src binds to tyrosine-phosphorylated cellular proteins with high affinity. Proc. Nati Acad. Sci., USA. 88: p. 627-631. 20. Kamps, M.P., J.E. Buss, and B.M. Sefton 1986. Trsnsformant protein of Rous sarcoma virus lacking myristic acid phosphorylates known polypeptide substrates without inducing transformation. Cell. 45: p. 105-112. 21. Muller, A.J., A.-M. Pendergast, K. Parmar, M.H. Havlik, N. Rosenberg, and O.N. Witte 1993. Substitution In Bloc domain of region 2 homology Src activates the transformant potential of protein tyrosine kinase c-abl. Proc. Nati Acad. Sci ,. USES. 90: p. 3457-3461. 22. Mayer, B.J. and D. Baltimore 1994. Mutagenic analysis of the functions of the SH2 and SH3 domains in the regulation of the tyrosine kinase abl. Mol. Cell. Bio. 14 (5): p. 2883. 23. Mayer, B.J., P.K. Jackson, R.A. Van Etten, and D. Baltimore 1992. Point mutations in the abl SH2 domain coordinately impaired phosphotyrosine binding in vitro and transformation activity in vivo. Mol. Cell. Bio. 12 (2): p. 609-618. 24. Koyama, S., H. Yu, D.C. Dalgarno, T.B. Shin, L.D. Zydowsky, and S.L. Schreiber 1993. Structure of the PI3K SH3 domain and analysis of the SH3 family. Cell. 72: p. 945-952. 25. Yu, H., M.K. Rosen, T.B. Shin, C. Seidel-Dugan, J.S. Brugge, and S.L. Schreiber 1992. Structure in solution of the SH3 domain of Src and identification of its binding site. Science. 258: p. 1665-1668. 26. Kohda, D., H. Hatanaka, M. Odaka, V. Mandiyan, A. Ullrich, J. Schlessinger, and F. Inagaki 1993. Structure in solution of the SH3 domain of phospholipase C-gamma. Cell. 72: p. 953-960. 27. Waksman, G., S.E. Shoelson, N. Pant, D. Cowburn, and J. Kuriyan 1993. Crystal structure / NMR of SH2. Cell. 72: p. 779-790. 28. Eck, M.J., S.E. Shoelson, and S.C. Harrison 1993. Crystal structure of SH2. Nature 362: p. 87. 29. Wang, J.Y.J., C. Queen, and D. Baltimore 1982. Expression of a protein encoded by the Abelson murine leukemia virus in Escherichia coli causes extensive phosphorylation of tyrosine residues. J. Biol. Chem. 257 (22): p. 13181-13184. 30. Schwartzerg, P.L., A.M. Stall, J.D. Hardin, K.S. Bowdish, T. Humaran, S. Boast, M.L. Harbison, E.J. Robertson, and S.P. Goff 1991. The homozygosity of mice for the abl mu mu shows low viability and deletion of selected populations of B and T cells. Cell. 65: p. 1165-1175. 31. Tybulewicz, V.L., CE. Crawford, P.K. Jackson, R.T. Bronson, and R.C. Mulligan 1991. Neonatal lethality and lymphopenia in mice with a homozygous interruption of the c-abl protogen. Cell. 65: p. 1153-1163. 32. Brugge, J.S. & Erikson, R.L. 1977. Natura 269 (5626), 346-8. 33. Jove, R. and Hanafusa, H. 1987. Ann. Rev. Cell Biol. 3.31-56. 34. Erpel, T. & Conrtneidge, S.A. 1995. Curr. Op. In Cell Biology 7, 176-182. 35. Pawson, T. 1995. Nature 373, 573-580. 36. Waksman, G., Kominos, D., Robertson, SC, Pant, N., Baltimore, D., Birge, RB, Cowburn, D., Hanafusa, H., Mayer, BJ, Overduin, M., Resh , MD, Ríos, CB, Silverman, L. and Kuriyan, J. 1992. Nature 358, 646-653. 37. Taylor, S.J. & Shalloway, D. 1993. Curr. Opin. Genet Dev. 3. 26-34. 38. Brown, M.T. & Cooper, J.A. 1996. Biochemica et Biophysica Acta 1287, 121-149. 39. Songyang, Z., Carraway, K.L.I., Eck, M.J., Harrison, S.C., Feldman, R.A., Mohammadi, M., Schlessinger, J., Hubbard, S.R., Smith, D.P., Eng, C., Lorenzo, M.J., Ponder, B.A.J., Mayer, B.J. and Cantley, L.C. 1995. Nature 373. 536-539. 40. Kamps, M.P. & Sefton, B.M. 1988. Oncogene Res. 3, 105-115. 41. Weijland, A. and Parmeggiani, A. 1993. Science 259, 1311-1314. 42. Belshaw, PJ, Schoepfer, JG, Liu, K.-Q., Morrison , KL and Schreiber, S.L. 1995. Angew. Chem. Int. Ed. Engl. 34 (19), 2129-2132. 43. Fujii, T., Wu, C.C., Itaya, T., Moro, S. and Saito, T. 1973. Chem. Pharm. Bull. 21 (8), 1676-1682. 44. Robins, M.J. and Trip, E.M. 1973. Biochemistry 12 (12), 217921187. 45. McLaughlin, T.W., Skin, N. and Hellmann, T. 1985. Synthesis, 322-3. 46. Kikugawa, K., lizuka, K. and Ichino, M. 1973. J. Med. Chem. 16, 358-364. 47. Ludwig, J. 1981. Acta Biochim. et Biophys. Acad. Sci. Hung. 16 (304), 131-133. 48. Hecht, S.M. and Kozarich, J.W. 1973. Biochim. Biophy. Act 331, 307-309. 49. Reikofski, J. and Tao, B.Y. 1992. Biotech. Adv. 10, 535-554. 50. Xu, B., Bird, G.V. and Miiler, T.W. 1995. J. Biol. Chem. 270, 29825-29830. 51. Fukazawa, H., Li, P., Mizuno, S. and Uehara, Y. 1993. Analytical Biochemistry, 212, 106-110. 52. Lee, T.R., Niu, J. and Lawrence, D.S. 1995. J. Biol. Chem. 270 (10), 5375-5380. 53. Kwiatkowski, A.P. and King, M.M. 1987. Biochemistry 26, 7636-7640. 54. Hubbard, S.R., Wei, L, Ellis, L. and Hendrickson, W.A. (1994) Nature 372, 746-754. 55. Mohammadi, M., Schlessinger, J. and Hubbard, S.R. 1996. Cell 86, 577-587. 56. Zheng, J., Knighton, D.R., Ten Eyck, L.F., Karlsson, R., Zuong, N.-H., Taylor, S.S. and Sowadski, J.M. 1993. Biochemistry 32, 2154-2161. 57. Jeffrey, P.D., Russo, A.A., Polyak, K., Gibbs, E., Hurwitz, J., Massague, J. and Pavletich, N.P. 1995. Nature 376, 313-320. 58. Kamps, M.P., Taylor, S.S. and Sefton, B.M. 1984). Nature 310, 589-592. 59. Zoller, M.J., Nelson, N.C. and Taylor, S.S. 1981. J. Biol. Chem. 256, 10837-10842. 60. Taylor, S.S. and Radzio-Andzelm, E. 1995. Structure 2, 345-355. 61. DeClue, J.E. and Martin, G.S. 1989. J. Virol. 63 (2), 542-554. 62. Seidel-Dugan, C, Meyer, B.E., Thomas, S.M. and Brugge, J.S. 1992. Mol. Cell Biol. 12 (4), 1835-45. 63. Czemilofsky, A.D., Levison, A.D., Varmus, H.E., Bishop, J.M., Tischer, E. and Goodman, H.M. 1980. Nature (London) 287, 198-200. 64. Fersht, A., Enzyme Structure and Mechanism. Second ed. 1985, New York: W.H. Freeman and Co. 475. 65. Hunter, T. and Sefton, B.M. 1980. Proc. Nati Acad. Sci. USA 77 (3), 1311-1315. 66. Ozawa, K., Szallasi, Z., Kazanietz, M.G., Blumberg, P.M., Mischak, H., Mushinski, J.F. and Beaven, M.A. 1993. J. Biol. Chem. 268 (3), 1749-1756. 67. Schultz, C, Vajanaphanich, M., Genieser, H.-G., Jastorff, B., Barret, K.E. and Tsien, R.Y. 1994. Mol. Pharm. 46, 702-708. 68. Merritt, E.A. and Murphy, M.E.P. 1994. Acta Cryst. D50, 869-873. 69. Bacon, D.J. and Anderson, W.F. 1988. J. Molec. Graphics 6, 219-220. 70. Schluckebeir, G., O-Gara, M., Saenger, W., and Chen, X.

"Universal catalytic domain structure of AdoMet-dependent methyl transferases" 1995. Mol. Biol. 247 p. 16-20. 71. Protein Kinase Facts Book, G. Hardie and S. Hanks, Eds. nineteen ninety five.

Academic Press, San Diego, ISBN O-12-324719-5. 72. Principies of Biochemistry, A. Lehninger, D. Nelson and M. Cox, 2nd Ed., 1993. Worth Publishers, New York, ISBN O-87901-500-4. 73. C.R. Faltynek et al., 1995. Biochemistry 34, 12404-10. 74. J. Hanke et al., 1996. J. Biol. Chem. 271, 695-701. 75. B.J. Druker et al., 1996. Nat. Med. 5, 561-6. 76. U. Hanefelf, C. W. Rees, A. J.P. White, D.J. Williams (1996).

Synthesis in a single container of tetrasubstituted pyrazoles-regiochemistry test, J. Chem. Soc. Perkin Trans 1, 1545-1552. 77. J. Reikofski, B.Y. Tao (1992). Polymerase chain reaction (PCR techniques for site-directed mutagenesis) Biotech. Adv. 10, 535-554. 78. B. Xu, G.V. Bird, T. W. Miller (1995). Substrate specificities of the catalytic domains of insulin tyrosine kinase receptor 1 and insulin-like growth factor. J. Biol. Chem. 270, 29825-29830. 79. K. Shah, Y. Liu, C. Deirmengian, K.M. Shokat (1997). Design of non-natural nucleotide specificity for tyrosine kinase of Rous sarcoma virus to uniquely label its direct substrates, Proc. Nati Acad. Sci 94, 3565-3570. 80. J.P. Morgenstem, H. Land (1990). Advanced transfer of mammalian genes: high titre retroviral vectors with multiple drug selection markers and a free packaging cell line of complementary helpers, Nucleic Acids Res. 18, 3587-3596. 81. W.S. pear, G.P. Nolan, M.L. Scott, D. Baltimore (1993). Production of high titre-free retroviruses of helpers by transient transfection, Proc. Nati Acad. Sci. USA 90, 8392-8396. 82. O. Danos, R.C. Mulligan (1988). Safe and efficient generation of recombinant retroviruses with ranges of amphotropic and ecotropic hosts. Proc Nati Acad Sci USA 85, 6460-4. 83. T.R. Lee, J. Niu, D.S. Lawrence (1995). The extraordinary specificity of the active substrate site of pp60c-src. A multiple protein kinase specificity. J. Biol. Chem. 270, 5375-5380. 84. P.M. Coussens, J.A. Cooper, T. Hunter, D. Shalloway (1985).

Restriction of the in vitro and in vivo tyrosine kinase activities of pp60c-src with respect to pp60v-Src Molecular and Cell. Biol., 2753-2763.

The invention can be modalized in other forms or it can be carried out in other forms without departing from the spirit or essential characteristics thereof, therefore, the present description should be considered in all illustrative aspects and not restrictive the scope of the invention being indicated by the appended claims, and it is intended that all changes included within the meaning and scale of equivalence be covered therein.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: SHOKAT, KEVAN (ii) TITLE OF THE INVENTION: PROTEIN KINASES DESIGNED BY ENGINEERING THAT CAN USED MODIFIED SUBSTRATES OF NUCLEOTIDE TRIFOSPHATE (iii) SEQUENCE NUMBER: 9 (iv) CORRESPONDENCE ADDRESS: (A) ADDRESS: Klauber & Jackson (B) STREET: 411 Hackensack Avenue, 4th. Floor (C) CITY: Hackensack (D) STATE: New Jersey (E) COUNTRY: UNITED STATES OF NORTH AMERICA (F) POSTAL CODE: 07601 (v) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIUM: Flexible disk (B) COMPUTER: COMPATIBLE WITH IBM PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PROGRAMS: Patentln Relay # 1.0, Version # 1.30 (vi) COMMON DATA OF THE APPLICATION: (A) APPLICATION NUMBER: US (B) SUBMISSION DATE: (C) CLASSIFICATION: (viii) EMPLOYEE / AGENT INFORMATION: (A) NAME: Jackson Esq., David A. (B) REGISTRATION NUMBER: 26,742 (C) CASE NUMBER / REFERENCE: 2275-1-004 (ix) TELECOMMUNICATIONS INFORMATION: (A) TELEPHONE: 201 -487-5800 (B) TELEFAX: 201-343-1684 (C) TELEX: 133521 (2) INFORMATION FOR SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 27 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: not relevant (D) TOPOLOGY: not relevant (ii) TYPE OF MOLECULE: peptide (iii) HYPOTHETICAL: NO (iv) ANTICIPATE: NO (v) TYPE OF FRAGMENT: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo sapiens (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1: Asn Phe Pro Phe Leu Val Lys Leu Glu Phe Ser Phe Lys Asp Asn Ser 1 5 10 15 Asn Leu Tyr Met Val Met Glu Tyr Val Pro Gly 20 25 (2) INFORMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 27 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: not relevant (D) TOPOLOGY: not relevant (ii) TYPE OF MOLECULE: peptide (iii) HYPOTHETIC: NO (iv) ANTI-SENSE: NO (v) TYPE OF FRAGMENT: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo sapiens (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2: Asn His Pro Asn lie Val Lys Leu Leu Asp Val lie His Thr Glu Asn 1 5 10 15 Lys Leu Tyr Leu Val Phe Glu Phe Leu His Gln 20 25 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 26 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: not relevant (D) TOPOLOGY: not relevant (ii) TYPE OF MOLECULE: peptide (iii) HYPOTHETIC: NO (iv) ANTI-SENSE: NO (v) TYPE OF FRAGMENT: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Rous sarcoma virus (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: Arg His Glu Lys Leu Val Gln Leu Tyr Ala Val Val Ser Glu Glu Pro 1 5 10 15 He Tyr He Val He Glu Tyr Met Ser Lys 20 25 (2) INFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (vi) ORIGINAL SOURCE: (A) ORGANISM: Rous sarcoma virus (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4: rGGATCCA TGGGGAGTAG CAAGAGCAAG 30 (2) INFORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YESAL SOURCE: (A) ORGANISM: Rous sarcoma virus (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: TTTGAATTCC TACTCAGCGA CCTCCAACAC 30 (2) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (iii) ) HYPOTHETICAL: NO (iv) ANTICIPATION: YES (vi) ORIGINAL SOURCE: (A) ORGANISM: Rous sarcoma virus (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: TGAGAAGCTG GCTCAACTGT ACGCAG 26 (2) INFORMATION FOR SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (vi) ORIGINAL SOURCE: (A) ORGANISM: Rous sarcoma virus (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7: CTGCGTACAG TTGAGCCAGC TTCTCA 26 (2) INFORMATION FOR SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (vi) ORIGINAL SOURCE: (A) ORGANISM: Rous sarcoma virus (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8: CTACATCGTC GCTGAGTACA TGAG 24 (2) INFORMATION FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (vi) ORIGINAL SOURCE: (A) ORGANISM: Rous sarcoma virus (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9: CTCATGTACT CAGCGACGAT GTAG_24_

Claims (43)

NOVELTY OF THE INVENTION CLAIMS

1. - A mutant multiple substrate enzyme that accepts at least one orthogonal substrate analogue, whereby the catalytic activity causes the combination of all or part of said orthogonal substrate with at least one other substrate of said enzyme.

2. The mutant enzyme according to claim 1, further characterized in that said multi-substrate enzyme is a transferase.

3. The mutant enzyme according to claim 1, further characterized in that said multi-substrate enzyme is a signal translation mediator.

4. A mutant protein kinase that accepts an orthogonal nucleotide triphosphate analogue as a phosphate donor substrate.

5. The mutant protein kinase according to claim 4, further characterized in that said mutant protein kinase binds orthogonal nucleotide triphosphate with an affinity that is greater than its affinity for the nucleotide triphosphate which is the intracellular phosphate donor substrate. primary for the wild-type protein kinase.

6. The mutant protein kinase according to claim 4, further characterized in that said orthogonal nucleotide triphosphate analog is an orthogonal analogue of ATP.

7. The mutant protein kinase according to claim 4, further characterized in that said orthogonal nucleotide triphosphate analog is an ATP derivative having a substituent that 5 comprises at least three carbon atoms covalently linked to the N6 position of said ATP.

8. The mutant protein kinase according to claim 7, further characterized in that said orthogonal nucleotide triphosphate analog is selected from the group consisting of N ^ -i (cyclopentyl) ATP, N6- (cyclopentyloxy) ATP, N6- ( cyclohexyl) ATP, N6- (cyclohexyloxy) ATP, N6- (benzyl) ATP, N6- (benzyloxy) ATP, N6- (pyrrolidino) ATP, and N6- (piperidino) ATP.

9. The mutant protein kinase according to claim 4, further characterized in that said orthogonal nucleotide triphosphate analog is N6- (cyclopentyl) ATP.

10. The mutant protein kinase according to claim 4, further characterized in that it is a mutant protein tyrosine kinase.

11. The mutant protein kinase according to claim 10, further characterized in that it is a mutant of a tyrosine kinase of Src protein.

12. The mutant protein kinase according to claim 10, further characterized in that it is a mutant of a Src protein tyrosine kinase of Rous sarcoma virus.

13. The mutant protein kinase according to claim 4, further characterized in that the amino acid sequence differs from the sequence of the wild type protein kinase, in which at least one amino acid has been replaced in a position homologous to the position selected from the group consisting of position 323 of v-Src and position 338 of v-Src, with an amino acid selected from the group consisting of alanine and glycine.

14. The mutant protein kinase according to claim 4, further characterized in that the amino acid in a position homologous to position 338 of v-Src, has been replaced with glycine.

15. The mutant protein kinase according to claim 4, further characterized in that the amino acid in a position homologous to position 323 of v-Src and the amino acid in a position homologous to position 338 of v-Src, have been replaced with alanine.

16. The mutant protein kinase according to claim 4, further characterized in that said mutant protein kinase has been expressed as a fusion protein.

17. The mutant protein kinase according to claim 16, further characterized in that it has been expressed as a fusion protein selected from the group consisting of a glutathione S-transferase fusion protein and a G-Histidine fusion protein.

18.- A nucleotide sequence that encodes a mutant multiple substrate enzyme that accepts at least one orthogonal substrate analog, by means of which the catalytic activity of said enzyme causes the combination of all or part of said orthogonal substrate with at least one other substrate of said enzyme.

19. A nucleotide sequence that encodes a mutant protein kinase that accepts an orthogonal nucleotide triphosphate analogue as a phosphate donor substrate.

20. The nucleotide sequence according to claim 19, further characterized in that said nucleotide sequence is selected from the group consisting of mRNA, cDNA, gDNA, mitochondrial DNA, chloroplast DNA, satellite DNA, plasmid DNA, viral RNA and Viral DNA

21. A method for producing a nucleic acid sequence encoding a mutant protein kinase accepting an orthogonal nucleotide triphosphate analogue as a substrate donor substrate, comprising the steps of: (a) identifying, the crystal structure of an identical or homologous enzyme bound to its phosphate donor substrate, one or more amino acids other than glycine that are sufficiently close to an atom of said bound phosphate donor substrate, so that they can sterically exclude an orthogonal substituent attached to the corresponding atom in said orthogonal nucleotide triphosphate analog; and (b) mutating a nucleotide sequence encoding the wild-type protein kinase so that the nucleotide triplets that encode one or more of the identified amino acids are converted into nucleotide triplets that encode amino acids that have side chains that are sterically less voluminous than the amino acids identified.

22. The method according to claim 21, further characterized in that said amino acids of step (a) are in the space of about five angstroms of said atom of said attached phosphate donor substrate.

23. The method according to claim 21, further characterized in that said phosphate donor substrate is ATP.

24. The method according to claim 23, further characterized in that said atom is the N6-amino group of ATP.

25. A method for producing a mutant protein kinase accepting an orthogonal nucleotide triphosphate analogue as a phosphate donor substrate, comprising expressing the mutant sequence of claim 21, whereby said mutant protein kinase is produced.

26. A method for producing a nucleic acid sequence encoding a mutant protein kinase accepting an orthogonal nucleotide triphosphate analogue as a phosphate donor substrate, comprising the steps of: (a) identifying, the crystal structure of an identical or homologous enzyme bound to its phosphate donor substrate, one or more amino acids other than glycine that are sufficiently close to an atom of said bound phosphate donor substrate, so that it can sterically exclude the orthogonal substituent attached to the corresponding atom in said orthogonal analog of nucleotide triphosphate; (b) preparing a plurality of nucleotide sequences encoding mutant protein kinase having one or more mutations in one or more nucleotide triplets encoding amino acids in the space of ten amino acids of the one or more amino acids mentioned, both in amino terminal as terminal carboxy; (c) expressing said plurality of nucleotide sequences encoding mutant kinase to produce a plurality of mutant kinases; and (d) testing said plurality of mutant kinases to select one or more having the ability to use said orthogonal nucleotide triphosphate analog as the phosphate donor substrate.

27. A method for producing a mutant protein kinase accepting an orthogonal nucleotide triphosphate analogue as a phosphate donor substrate, comprising expressing one or more mutant sequences of claim 26 which is found to express said mutant protein kinase, by which produces said mutant protein kinase.

28. A method for producing a nucleic acid sequence that encodes a mutant multiple substrate enzyme that accepts at least one orthogonal analog of donor substrate, whereby the catalytic activity causes the combination of all or part of said orthogonal substrate of donor with at least one other substrate receiving said enzyme, comprising the steps of: (a) identifying from the crystal structure of an identical or homologous enzyme attached to its donor substrate, one or more different amino acids of glycine, which are sufficiently about one atom of said attached donor substrate to sterically exclude an orthogonal substituent attached to the corresponding atom in said orthogonal analogue of donor substrate; and (b) mutating a nucleotide sequence encoding the wild-type form of said multi-substrate enzyme, such that the nucleotide triplets that encode one or more of the identified amino acids are converted into nucleotide triplets encoding amino acids. that have side chains that are sterically less bulky than the identified amino acids.

29. The method according to claim 28, further characterized in that said amino acids of step (a) are in the space of about five angstroms of said atom of the attached donor substrate.

30. A method for producing a multiple substrate enzyme that accepts at least one orthogonal donor substrate analog, which comprises expressing the mutant sequence of claim 28, whereby said mutant multiple substrate enzyme is produced. 31.- A method for producing a nucleic acid sequence that encodes a mutant multiple substrate enzyme that accepts at least one orthogonal substrate donor analog, by which the catalytic activity causes the combination of all or part of said orthogonal substrate donor with at least one other substrate receiving said enzyme; the method comprises the steps of: (a) identifying from the crystal structure of an identical or homologous enzyme linked to its donor substrate, one or more different amino acids of glycine that are sufficiently close to an atom of said attached phosphate donor substrate to sterically exclude the orthogonal substituent attached to the corresponding atom in said donor substrate analogue; (b) preparing a plurality of nucleotide sequences encoding mutant multiple substrate enzyme, having one or more mutations in one or more triplets of nucleotides encoding amino acids in the space of ten amino acids of said one or more amino acids, both in the terminal amino as in terminal carboxy direction; (c) expressing said plurality of nucleotide sequences encoding mutant multiple substrate enzyme to produce a plurality of mutant multiple substrate enzymes; and (d) testing said plurality of mutant multiple substrate enzymes to select one or more that have the ability to use said orthogonal donor substrate analog as the donor substrate. 32.- A method for producing a mutant multiple substrate enzyme that accepts at least one orthogonal analog of donor substrate as a donor substrate, comprising expressing one or more mutant sequences of claim 31 found to express said mutant, thereby said enzyme is produced from multiple substrates. 33.- A method of detecting one or more intracellular components that are substrates receptors of a multiple substrate enzyme that covalently transfers all or part of a donor substrate to a receptor substrate, comprising: (I) combining (a) selected cells from the group consisting of permeabilized cells, cells used, and cells that are naturally permeable to the orthogonal analog of donor substrate; said cells express a mutant of said multi-substrate enzyme, said mutant accepts said orthogonal analog of donor substrate as a donor substrate; and (b) said orthogonal substrate analog, having a detectable entity on the portion thereof, which is catalytically transferred to a receiving substrate by said multi-substrate enzyme; (II) incubating said cells under conditions sufficient to allow the mutant multiple substrate enzyme to transfer all or part of the labeled orthogonal donor substrate to the receiving substrate; and (III) detecting the presence or absence of said detectable label on cellular components, whereby the presence of said label on a cellular component, indicates that said component is a substrate receiving said multiple substrate enzyme, and the absence of said mark on a cellular component, indicates that said component is not a substrate substrate of said enzyme of multiple substrates. 34.- A method of detecting one or more intracellular protein substrates for a protein kinase, comprising: (I) combining (a) cells selected from the group consisting of permeabilized cells, used cells, and cells that are naturally permeable to orthogonal analog of nucleotide triphosphate substrate; said cells express a mutant of said protein kinase, said mutant accepting said orthogonal nucleotide triphosphate analogue as a substrate donor substrate; and (b) said orthogonal nucleotide triphosphate analog, having a detectably labeled terminal phosphate; (II) incubating said cells under conditions sufficient to allow the mutant protein kinase to phosphorylate its one or more protein substrates using said orthogonal nucleotide triphosphate as a phosphate donor; and (III) detecting the presence or absence of said detectably labeled phosphate on cellular proteins, whereby the presence of said label on a cellular protein indicates that said protein is a substrate of said protein kinase., and the absence of said tag on a cellular protein indicates that said protein is not a substrate of said protein kinase. The method according to claim 34, further characterized in that said mutant binds to said substrate with an affinity that is greater than its affinity for the primary intracellular phosphate donor substrate for the wild-type protein kinase. 36.- A method for determining whether a test compound modulates the activity of a multiple substrate enzyme, comprising the steps of: (I) combining (a) cells selected from the group consisting of permeabilized cells, used cells, and cells that are naturally permeable to the orthogonal analog of donor substrate; said cells express a mutant of said multi-substrate enzyme, said mutant accepts said orthogonal analog of donor substrate as a donor substrate; (b) said orthogonal substrate analog, having a detectable entity on the portion thereof, which is catalytically transferred to a receiving substrate by said multi-substrate enzyme; and (c) said test compound; (II) incubating said cells under conditions sufficient to allow the enzyme from multiple mutant substrates to transfer to the recipient substrate all or part of the labeled orthogonal donor substrate; and (III) detecting whether there has been an increase or decrease in the presence or absence of said detectable label on cellular components, with respect to that observed in one or more control experiments where the test compound was omitted, thereby a relative increase of the presence of said mark on a cellular component, indicates that said test compound has positively modulated the action of said enzyme of multiple substrates on that component, and a relative decrease in the presence of said mark on a cellular component, indicates that said test compound has negatively modulated the action of said multi-substrate enzyme on that component. 37.- A method for determining whether a test compound modulates the activity of a protein kinase, comprising the steps of: (I) combining (a) cells selected from the group consisting of permeabilized cells, used cells, and cells that are naturally permeable to the orthogonal analog of nucleotide triphosphate substrate; said cells express a mutant of said protein kinase, said mutant accepting said orthogonal nucleotide triphosphate analogue as a phosphate donor substrate; (b) said orthogonal nucleotide triphosphate analog, having a detectably labeled terminal phosphate; and (c) said test compound; (II) incubating said cells under conditions sufficient to allow the mutant protein kinase to phosphorylate its one or more protein substrates using said orthogonal nucleotide triphosphate as a phosphate donor; and (III) detecting whether there has been an increase or decrease in the presence or absence of said detectable label on cellular proteins, with respect to that observed in one or more control experiments where the test compound was omitted, thereby a relative increase in the presence of said tag on a cellular protein indicates that said test compound has positively modulated the action of said protein kinase on that component, and a relative decrease in the presence of said tag on a cellular protein, indicates that said Test compound has negatively modulated the action of said protein kinase on that component. 38.- A protein kinase or enzyme of multiple substrates designed by engineering, which can be inhibited, selected from kinases prepared according to the present description, synthetic analogues thereof, active fragments thereof, congeners thereof, and combinations of these, for use in both diagnostic and therapeutic procedures selected from drug trials, methods of treatment or intervention in diseases such as cancer, HIV or the like. 39.- A transgenic animal that can function as a "knock out" model for drug selection, wherein the wild-type gene corresponding to a particular kinase associated with a particular disease is replaced with a gene encoding a kinase mutant, and said selection is used by interacting said model with a kinase inhibitor of the present invention. 40.- A method for the transformation of a target cell in an animal by preparing a vector that contains DNA molecules that code for the expression of a material selected from the group consisting of mutant kinases that are claimed in claim 1, kinase inhibitors, antagonists and agonists thereof, analogs thereof, degenerate variants thereof, mutants thereof, and combinations thereof. 41.- A method of drug selection and an associated selection method using an agent selected from the mutant kinase claimed in claim 1, variants thereof, inhibitors thereof, active fragments thereof, analogs of the same, and combinations of them. 42.- A pharmaceutical composition comprising an active agent selected from a mutant multiple substrate enzyme as claimed in claim 1, inhibitors thereof, agonists thereof, active fragments thereof, alleles thereof, analogs thereof, conserved variants thereof, and a pharmaceutically acceptable carrier.

43. - The use of the pharmaceutical composition claimed in claim 41, for the treatment of a disease selected from cancer, HIV, Alzheimer's disease.