WO1998018926A1 - Circularly permuted erythropoietin receptor agonists - Google Patents
Circularly permuted erythropoietin receptor agonists Download PDFInfo
- Publication number
- WO1998018926A1 WO1998018926A1 PCT/US1997/018703 US9718703W WO9818926A1 WO 1998018926 A1 WO1998018926 A1 WO 1998018926A1 US 9718703 W US9718703 W US 9718703W WO 9818926 A1 WO9818926 A1 WO 9818926A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- leu
- ala
- gly
- arg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/505—Erythropoietin [EPO]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- the present invention relates to human Erythropoietin (EPO) receptor agonists.
- EPO receptor agonists retain one or more activities of native EPO and may also show improved hematopoietic cell-stimulating activity and/or an improved activity profile which may include reduction of undesirable biological activities associated with native EPO and/or have improved physical properties which may include increased solubility, stability and refold efficiency.
- Colony stimulating factors which stimulate the differentiation and/or proliferation of bone marrow cells have generated much interest because of their therapeutic potential for restoring depressed levels of hematopoietic stem cell-derived cells.
- Erythropoietin is a naturally-occurring glycoprotein hormone with a molecular weight that was first reported to be approximately 39,000 daltons (T. Miyaki et al . , J. Biol . Chem . 252:5558-5564 (1977)).
- the mature hormone is 166 amino acids long and the
- prepro form of the hormone is 193 amino acids long (F. Lin, U.S. Patent No. 4,703,008).
- the mature hormone has a molecular weight, calculated from its amino acid sequence, of 18,399 daltons (K. Jacobs et al . , Na ture 313:806-810 (1985); J. K. Browne et al . , Cold Spring Harbor Symp . Quan t . Biol . 5:1693-702 (1986) .
- the first mutant erythropoietins (i.e., erythropoietin analogs), prepared by making amino acid substitutions and deletions, have demonstrated reduced or unimproved activity.
- replacement of the tyrosine residues at positions 15, 40 and 145 with phenylalanine residues, replacement of the cysteine residue at position 7 with an histidine, substitution of the proline at position 2 with an asparagine, deletion of residues 2-6, deletion of residues 163-166, and deletion of residues 27-55 does not result in an apparent increase in biological activity.
- the Cys"-to-His " mutation eliminates biological activity.
- glycosylation of erythropoietin is widely accepted to play a critical role in the in vivo activity of the hormone (P. H.. Lowy et al . , Nature 185:102-105
- Oligonucleotide-directed mutagenesis of erythropoietin glycosylation sites has effectively probed the function of glycosylation but has failed, as yet, to provide insight into an effective strategy for significantly improving the characteristics of the hormone for therapeutic applications.
- a series of single amino acid substitution or deletion mutants have been constructed, involving amino acid residues 15, 24, 49, 76, 78, 83, 143, 145, 160, 162, 163, 164, 165 and 166.
- the mutants have been administered to animals while monitoring hemoglobin, hematocrit and reticulocyte levels (EP No. 0 409 113) .
- the human erythropoietin molecule contains two disulfide bridges, one linking the cysteine residues at positions 7 and 161, and a second connecting cysteines at positions 29 and 33 (P.H. Lai et al . , J " . Biol . Chem . 261:3116-3121 (1986)). Oligonucleotide-directed mutagenesis has been used to probe the function of the disulfide bridge linking cysteines 29 and 33 in human erythropoietin. The cysteine at position 33 has been converted to a proline residue, which, mimics the structure of murine erythropoietin at this residue. The resulting mutant has greatly reduced in vi tro activity.
- WO 91/05867 discloses analogs of human erythropoietin having a greater number of sites for carbohydrate attachment than human erythropoietin, such as EPO (Asn 69 ) , EPO (Asn 125 , Ser 127 ) , EPO (Thr 125 ) , and EPO (Pro 124 , Thr 125 ) .
- WO 94 /24160 discloses erythropoietin muteins which have enhanced activity, specifically amino acid substitutions at positions 20, 49, 73, 140, 143, 146, 147 and 154.
- WO 94/25055 discloses erythropoietin analogs, including EPO (X 33 , Cys 139 , des-Arg 166 ) and EPO (Cys 139 , des- Arg 166 ) .
- the new sequence is joined, either directly or through an additional portion of sequence (linker), to an amino acid that is at or near the original N- terminus, and the new sequence continues with the same sequence as the original until it reaches a point that is at or near the amino acid that was N-terminal to the breakpoint site of the original sequence, this residue forming the new C-terminus of the chain.
- linker an additional portion of sequence
- proteins which range in size from 58 to 462 amino acids (Goldenberg & Creighton, J. Mol . Biol . 165:407-413, 1983; Li & Coffino, Mol . Cell . Biol . 13:2377-2383, 1993).
- the proteins examined have represented a broad range of structural classes, including proteins that contain predominantly ⁇ -helix ( interleukin-4 ; Kreitman et al . , Cytokine 7:311-318, 1995), ⁇ -sheet ( interleukin-1 ; Horlick et al . , Protein Eng.
- sequence rearranged protein appeared to have many nearly identical properties as its natural counterpart (basic pancreatic trypsin inhibitor, T4 lysozyme, ribonuclease Tl , Bacillus ⁇ -glucanase, interleukin-l ⁇ , ⁇ -spectrin SH3 domain, pepsinogen, interleukin-4) .
- the positions of the internal breakpoints used in the studies cited here are found exclusively on the surface of proteins, and are distributed throughout the linear sequence without any obvious bias towards the ends or the middle (the variation in the relative distance from the original N-terminus to the breakpoint is ca. 10 to 80% of the total sequence length) .
- the linkers connecting the original N- and C-termini in these studies have ranged from 0 to 9 residues. In one case (Yang & Schachman, Proc . Na tl . Acad . Sci . U. S . A . 90:11980-11984, 1993), a portion of sequence has been deleted from the original C-terminal segment, and the connection made from the truncated C-terminus to the original N-terminus.
- the modified human EPO receptor agonists of the present invention can be represented by the Formula:
- X is a peptide comprising an ammo acid sequence corresponding to the sequence of residues n+1 through J;
- X is a peptide comprising an amino acid sequence corresponding to the sequence of residues 1 through n; n is an integer ranging from 1 to J-1; and L is a linker.
- the constituent amino acids residues of human EPO are numbered sequentially 1 through J from the amino to the carboxyl terminus .
- a pair of adjacent amino acids within this protein may be numbered n and n+1 respectively where n is an integer ranging from 1 to J-1.
- the residue n+1 becomes the new N-terminus of the new EPO receptor agonist and the residue n becomes the new C-terminus of the new EPO receptor agonist.
- the present invention relates to novel EPO receptor agonists polypeptides comprising a modified EPO amino acid sequence of the following formula:
- N-terminus is joined to the C-terminus directly or through a linker capable of joining the N- terminus to the C-terminus and having new C- and N- termini at amino acids;
- said EPO receptor agonist polypeptide may optionally be immediately preceded by (methionine -1 ) , (alanine -1 ) or (methionine -2 , alanine "1 ) .
- the more preferred breakpoints at which new C- terminus and N-terminus can be made are; 23-24, 24-25, 25-26, 27-28, 28-29, 29-30, 30-31, 31-32, 32-33, 33-34, 34-35, 35-36, 36-37, 37-38, 38-39, 40-41, 41-42, 42-43, 52-53, 53-54, 54-55, 55-56, 77-78, 78-79, 79-80, 80-81, 81-82, 82-83, 83-84, 84-85, 85-86, 86-87, 87-88, 88-89, 109-110, 110-111, 111-112, 112-113, 113-114, 114-115, 115-116, 116-117, 117-118, 118-119, 119-120, 120-121, 121-122, 122-123, 123-124, 124-125, 125-126, 126-127, 127-128,
- breakpoints at which new C- terminus and N-terminus can be made are; 23-24, 24-25, 31-32, 32-33, 37-38, 38-39, 82-83, 83-84,85-86, 86-87, 87-88, 125-126, 126-127, and 131-132.
- the most preferred breakpoints include glycosylationn sites, non-nuetralizing antibodies, proteolyte cleavage sites.
- the EPO receptor agonists of the present invention may contain amino acid substitutions, such as those disclosed in WO 94/24160 or one or more of the
- EPO receptor agonists of the present invention may also have amino acid deletions at either/or both the N- and C- termini of the original protein and or deletions from the new N- and/or C- termini of the sequence rearranged proteins in the formulas shown above. ⁇
- linker (L) joining the N-terminus to the C-terminus is a polypeptide selected from the group consisting of: GlyGlyGlySer SEQ ID NO: 123; GlyGlyGlySerGlyGlyGlySer SEQ ID NO: 124;
- the present invention also encompasses recombinant human EPO receptor agonists co-administered or sequentially with one or more additional colony stimulating factors (CSF) including, cytokines, lymphokines, interleukins , hematopoietic growth factors which include but are not limited to GM-CSF, G-CSF, c- mpl ligand (also known as TPO or MGDF), M-CSF, IL-1, IL- 4, IL-2, IL-3, IL-5, IL 6, IL-7 , IL-8, IL-9, IL-10, IL- 11, IL-12, IL-13, IL-15, LIF, human growth hormone, B- cell growth factor, B-cell differentiation factor, eosinophil differentiation factor and stem cell factor (SCF) also known as steel factor or c-kit ligand (herein collectively referred to as "factors").
- CSF colony stimulating factors
- cytokines cytokines, lymphokines, interle
- co- administered mixtures may be characterized by having the usual activity of both of the peptides or the mixture may be further characterized by having a biological or physiological activity greater than simply the additive function of the presence of the EPO receptor agonists or the second colony stimulating factor alone.
- the co- administration may also provide an enhanced effect on the activity or an activity different from that expected by the presence of the EPO or the second colony stimulating factor.
- the co-administration may also have an improved activity profile which may include reduction IS of undesirable biological activities associated with native human EPO.
- IL-3 variants taught in WO 94/12639 and WO 94/12638 fusion protein taught in WO 95/21197, and WO 95/21254 G-CSF receptor agonists disclosed in WO 97/12977, c-mpl receptor agonists disclosed in WO 97/12978, IL-3 receptor agonists disclosed in WO 97/12979 and multifunctional receptor agonists taught in WO 97/12985 can be co-administered with the polypeptides of the present invention.
- IL-3 variants refer to IL-3 variants taught in WO 94/12639 and WO 94/12638.
- fusion proteins refer to fusion protein taught in WO 95/21197, and WO 95/21254.
- G-CSF receptor agonists refer to G-CSF receptor agonists disclosed in WO 97/12978.
- c-mpl receptor agonists refer to c-mpl receptor agonists disclosed in WO 97/12978.
- IL-3 receptor agonists refer to IL-3 receptor agonists disclosed in WO 97/12979.
- multi-functional receptor agonists refer to multi-functional receptor agonists taught in WO 97/12985.
- in vitro uses would include the ability to stimulate bone marrow and blood cell activation and growth before the expanded cells are infused into patients .
- EPO receptor agonists of the present invention would include blood banking applications, where the EPO receptor agonists are given to a patent to increase the number of red blood cells and blood products removed from the patient, prior to some medical procedure, and the blood products stored and transfused back into the patient after the medical procedure. Additionally, it is envisioned that uses of EPO receptor agonists would include giving the EPO receptor agonists to a blood donor prior to blood lie donation to increase the number of red blood cells, thereby allowing the donor to safely give more blood.
- Figure 1 schematically illustrates the sequence rearrangement of a protein.
- the N-terminus (N) and the C-terminus (C) of the native protein are joined through a linker, or joined directly.
- the protein is opened at a breakpoint creating a new N-terminus (new N) and a new C-terminus (new-C) resulting in a protein with a new linear amino acid sequence.
- a rearranged molecule may be synthesized de novo as linear molecule and not go through the steps of joining the original N-terminus and the C-terminus and opening of the protein at the breakpoint .
- Figure 2 shows a schematic of Method I, for creating new proteins in which the original N-terminus and C-terminus of the native protein are joined with a linker and different N-terminus and C-terminus of the protein are created.
- the sequence rearrangement results in a new gene encoding a protein with a new N-terminus created at amino acid 97 of the original protein, the original C-terminus (a. . 174) joined to the amino acid 11 (a. a. 1- 10 are deleted) through a linker region and a new C-terminus created at amino acid 96 of the original sequence.
- Figure 3 shows a schematic of Method II, for creating new proteins in which the original N-terminus and C-terminus of the native protein are joined without a linker and different N-terminus and C-terminus of the protein are created.
- the sequence rearrangement results in a new gene encoding a protein with a new N-terminus created at amino acid 97 of the original protein, the original C-terminus (a. a. 174) joined to the original N-terminus and a new C-terminus created at amino acid 96 of the original sequence.
- Figure 4 shows a schematic of Method III, for creating new proteins in which the original N-terminus and C-terminus of the native protein are joined with a linker and different N-terminus and C-terminus of the protein are created.
- sequence rearrangement results in a new gene encoding a protein with a new N-terminus created at amino acid 97 of the original protein, the original C-terminus (a. a. 174) joined to amino acid 1 through a linker region and a new C-terminus created at amino acid 96 of the original sequence .
- Figure 5 shows a DNA sequence encoding human mature EPO based on the sequence of Lin et al . ( PNAS 82:7580- 7584, 1985) .
- Receptor agonists of the present invention may be useful in the treatment of diseases characterized by decreased levels of red blood cells of the hematopoietic system.
- a EPO receptor agonist may be useful in the treatment or prevention of anemia.
- Many drugs may cause bone marrow suppression or hematopoietic deficiencies.
- examples of such drugs are AZT, DDI, alkylating agents and anti-metabolites used in chemotherapy, antibiotics such as chloramphenicol , penicillin, gancyclovir, daunomycin and sulfa drugs, phenothiazones, tranquilizers such as meprobamate, analgesics such as aminopyrine and dipyrone, anti-convulsants such as phenytoin or carbamazepine, antithyroids such as propylthiouracil and methimazole and diuretics.
- EPO receptor agonists may be useful in preventing or treating the bone marrow suppression or hematopoietic deficiencies which often occur in patients treated with these drugs .
- Hematopoietic deficiencies may also occur as a result of viral, microbial or parasitic infections and as a result of treatment for renal disease or renal failure, e.g., dialysis.
- the present peptide may be useful in treating such hematopoietic deficiency.
- Another aspect of the present invention provides plasmid DNA vectors for use in the method of expression of these novel EPO receptor agonists.
- These vectors contain the novel DNA sequences described above which code for the novel polypeptides of the invention.
- Appropriate vectors which can transform host cells capable of expressing the EPO receptor agonists include expression vectors comprising nucleotide sequences coding for the EPO receptor agonists joined to transcriptional and translational regulatory sequences which are selected according to the host cells used. ⁇ O
- Vectors incorporating modified sequences as described above are included in the present invention and are useful in the production of the modified EPO receptor agonist polypeptides .
- the vector employed in the method also contains selected regulatory sequences in operative association with the DNA coding sequences of the invention and capable of directing the replication and expression thereof in selected host cells.
- a method for producing the novel family of human EPO receptor agonists involves culturing suitable cells or cell line, which has been transformed with a vector containing a DNA sequence coding for expression of the novel EPO receptor agonist polypeptide.
- suitable cells or cell lines may include various strains of bacteria such as E. coli , yeast, mammalian cells, or insect cells may be utilized as host cells in the method of the present invention.
- compositions for treating the conditions referred to above.
- Such compositions comprise a therapeutically effective amount of one or more of the EPO receptor agonists of the present invention in a mixture with a pharmaceutically acceptable carrier.
- This composition can be administered either parenterally, intravenously or subcutaneously .
- the therapeutic composition for use in this invention is preferably in the form of a pyrogen- free, parenterally acceptable aqueous solution.
- the preparation of such a parenterally acceptable protein solution having due regard to pH, isotonicity, stability and the like, is within the skill of the art.
- Administration will be in accordance with a dosage regimen that will be readily ascertained by the skilled, ⁇ based on in vivo specific activity of the analog in comparison with human erythropoietin and based on what is now known in the art concerning the administration of human erythropoietin for inducing erythropoiesis and treating various conditions, such as anemia, in humans, including anemia in patients suffering from renal failure.
- Dosage of an analog of the invention may vary somewhat from individual to individual, depending on the particular analog and its specific in vivo activity, the route of administration, the medical condition, age, weight or sex of the patient, the patient's sensitivities to the analog or components of vehicle, and other factors which the attending physician will be capable of readily taking into account.
- Recombinantly produced EPO has proven especially useful for the treatment of patients suffering from impaired red blood cell production (Physicians Desk Reference (PDR) . 1993 edition, pp 602-605) .
- Recombinant EPO has proven effective in treating anemia associated with chronic renal failure and HIV-Infected individuals suffering from lowered endogenous EPO levels related to therapy with Zidovudine (AZT) (See PDR, 1993 edition, at page 6002) .
- Modifications of the EPO protein which would improve its utility as a tool for diagnosis or treatment of blood disorders are certainly desirable.
- modified forms of EPO exhibiting enhanced biological activity would be more effective and efficient than native EPO in the therapy setting when it is necessary to administer EPO to the patient, enabling administration less frequently and/or at a lower dose.
- Administration of reduced amounts of EPO would also presumably reduce the risk of adverse effects associated with EPO treatment, such as hypertension, seizures, headaches, etc. (See PDR, 1993 edition, at pp. 603-604).
- the EPO receptor agonists of the present invention may also have improved stability and hence increased half- life which would allow for the production of a non- glycosylated form of EPO in a bacterial expression system at a much lower cost. Due it's increased half- life this non-glycosylated form of EPO would have an increased in vivo activity compared de-glycosylated EPO.
- the therapeutic method and compositions may also include co-administration with other hematopoietic factors.
- a non-exclusive list of other appropriate hematopoietins , colony stimulating factors (CSFs) and interleukins for simultaneous or serial co- administration with the polypeptides of the present invention includes GM-CSF, G-CSF, c-mpl ligand (also known as TPO or MGDF), M-CSF, IL-1, IL-4, IL-2 , IL-3, IL-5, IL 6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL- 13, IL-15, LIF, human growth hormone, B-cell growth factor, B-cell dif erentiation factor, eosinophil differentiation factor and stem cell factor (SCF) also known as steel factor or c-kit ligand (herein collectively referred to as "factors”), or combinations thereof.
- SCF stem cell factor
- factors also known
- IL-3 variants taught in WO 94/12639 and WO 94/12638 fusion protein taught in WO 95/21197, and WO 95/21254 G-CSF receptor agonists disclosed in WO 97/12977, c-mpl receptor agonists disclosed in WO 97/12978, IL-3 receptor A3 agonists disclosed in WO 97/12979 and multi-functional receptor agonists taught in WO 97/12985 can be co- administered with the polypeptides of the present invention.
- the EPO receptor agonists of the present invention may be useful in the mobilization of hematopoietic progenitors and stem cells in peripheral blood.
- Peripheral blood derived progenitors have been shown to be effective in reconstituting patients in the setting of autologous marrow transplantation.
- EPO receptor agonists of the present invention may also be useful in the ex vivo expansion of hematopoietic progenitors.
- CSFs such as G-CSF
- G-CSF have been administered alone, co- administered with other CSFs, or in combination with bone marrow transplants subsequent to high dose chemotherapy to treat the anemia, neutropenia and thrombocytopenia which are often the result of such treatment .
- Another aspect of the invention provides methods of sustaining and/or expanding hematopoietic precursor cells which includes inoculating the cells into a culture vessel which contains a culture medium that has been conditioned by exposure to a stromal cell line such as HS-5 (WO 96/02662, Roecklein and Torok-Strob, Blood 85:997-1105, 1995) that has been supplemented with a EPO receptor agonist of the present invention.
- a stromal cell line such as HS-5 (WO 96/02662, Roecklein and Torok-Strob, Blood 85:997-1105, 1995) that has been supplemented with a EPO receptor agonist of the present invention.
- the length of the amino acid sequence of the linker can be selected empirically or with guidance from structural information, or by using a combination of the two approaches .
- a small series of linkers can be prepared for testing using a design whose length is varied in order to span a range from 0 to 50 A and whose sequence is chosen in order to be consistent with surface exposure
- linkers using a cassette sequence such as Gly-Gly-Gly-Ser repeated n times, where n is 1, 2, 3 or 4.
- cassette sequence such as Gly-Gly-Gly-Ser repeated n times, where n is 1, 2, 3 or 4.
- n is 1, 2, 3 or 4.
- sequences that vary in length or composition that can serve as linkers with the primary consideration being that they be neither excessively long nor short (cf., Sandhu, Cri tical Rev. Biotech . 12: 437-462, 1992); if they are too long, entropy effects will likely destabilize the three-dimensional fold, and may also make folding kinetically impractical, and if they are too short, they will likely destabilize the molecule because of torsional or steric strain.
- linkers may be composed of the original sequence, shortened or lengthened as necessary, and when lengthened the additional residues may be chosen to be flexible and hydrophilic as described above; or optionally the original sequence may be substituted for using a series of linkers, one example being the "Gly-Gly-Gly-Ser" cassette approach mentioned above; or optionally a combination of the original sequence and new sequence having the appropriate total length may be used.
- Sequences of EPO receptor agonists capable of folding to biologically active states can be prepared by appropriate selection of the beginning (amino terminus) and ending (carboxyl terminus) positions from within the original polypeptide chain while using the linker sequence as described above.
- Amino and carboxyl termini are selected from within a common stretch of sequence, referred to as a breakpoint region, using the guidelines described below.
- a novel amino acid sequence is thus generated by selecting amino and carboxyl termini from within the same breakpoint region. In many cases the selection of the new termini will be such that the original position of the carboxyl terminus immediately preceded that of the amino terminus.
- breakpoint regions examples include the location and type of protein secondary structure (alpha and 3-10 helices, parallel and anti-parallel beta sheets, chain reversals and turns, and loops; Kabsch & Sander, Biopolymers 22: 2577-2637, 1983; the degree of solvent exposure of amino acid residues, the extent and type of interactions of residues with one another
- the parental amino acid sequence is inspected to classify regions according to whether or not they are integral to the maintenance of secondary and tertiary structure.
- the occurrence of sequences within regions that are known to be involved in periodic secondary structure are regions that should be avoided.
- regions of amino acid sequence that are observed or predicted to have a low degree of solvent exposure are more likely to be part of the so- called hydrophobic core of the protein and should also be avoided for selection of amino and carboxyl termini.
- those regions that are known or predicted to be in surface turns or loops, and especially those regions that are known not to be required for biological activity, are the preferred sites for location of the extremes of the polypeptide chain. Continuous stretches of amino acid sequence that are preferred based on the above criteria are referred to as a breakpoint region.
- E. coli strains such as DH5 ⁇ TM (Life Technologies, Gaithersburg, MD) and TGI (Amersham Corp., Arlington Heights, IL) are used for transformation of ligation reactions and are the source of plasmid DNA for transfecting mammalian cells.
- E. coli strains such as MON105 and JM101, can be used for expressing the EPO receptor agonist of the present invention in the cytoplasm or periplasmic space.
- MON105 ATCC#55204 F-, lamda- , IN (rrnD, rrE)l, rpoD+ , rpoH358
- DH5 ⁇ IM F-, phi80dlacZdeltaM15, delta ( lacZYA-argF) U169 , deoR, recAl, endAl , hsdRl7 (rk- ,mk+) , phoA, supE441amda- , thi-1, gyrA96, relAl
- TGI delta (lac-pro) , supE, thi-1, hsdD5/F ' ( traD36 , proA+B+ , laclq, lacZdeltaMl5 )
- DH5 ⁇ TM Subcloning efficiency cells are purchased as competent cells and are ready for transformation using the manufacturer's protocol, while both E. coli strains TGI and MON105 are rendered competent to take up DNA using a CaCl 2 method.
- 20 to 50 mL of cells are grown in LB medium (1% Bacto-tryptone, 0.5% Bacto- yeast extract, 150 mM NaCl) to a density of approximately 1.0 optical density unit at 600 nanometers (OD600) as measured by a Baush & Lomb Spectronic spectrophoto eter (Rochester, NY) .
- the cells are collected by centrifugation and resuspended in one-fifth culture volume of CaCl 2 solution (50 mM CaCl 2 , 10 mM Tris-Cl, pH7.4) and are held at 4°C for 30 minutes.
- the cells are again collected by centrifugation and resuspended in one-tenth culture volume of CaCl 2 solution.
- Ligated DNA is added to 0.2mL of these cells, and the samples are held at 4°C for 1 hour.
- the samples are shifted to 42°C for two minutes and lmL of LB is added prior to shaking the samples at 37°C for one hour.
- Cells from these samples are spread on plates (LB medium plus 1.5% Bacto-agar) containing either ampicillin (100 micrograms/mL, ug/mL) when selecting for ampicillin- resistant transformants , or spectinomycin (75 ug/mL) when selecting for spectinomycin-resistant transformants .
- the plates are incubated overnight at 37°C.
- Single colonies are picked, grown in LB supplemented with appropriate antibiotic for 6-16 hours at 37°C with shaking.
- Colonies are picked and inoculated into LB plus appropriate antibiotic (100 ug/mL ampicillin or 75 ug/mL spectinomycin) and are grown at 37°C while shaking.
- PCR is carried out using a combination of primers that anneal to the EPO receptor agonist gene and/or vector. After the PCR is complete, loading dye is added to the sample followed by electrophoresis as described earlier. A gene has been ligated to the vector when a PCR product of the expected size is observed.
- Method I Creation of genes with new N-terminus/C- terminus which contain a linker region.
- the primer set (“new start” and “linker start”) is used to create and amplify, from the original gene sequence, the DNA fragment (“Fragment Start”) that contains the sequence encoding the new N- terminal portion of the new protein followed by the linker that connects the C-terminal and N-terminal ends of the original protein.
- the primer set (“new stop” and “linker stop”) is used to create and amplify, from the original gene sequence, the DNA fragment (“Fragment Stop”) that encodes the same linker as used above, followed by the new C-terminal portion of the new protein.
- the "new start” and “new stop” primers are designed to include the appropriate restriction enzyme recognition sites which allow cloning of the new gene into expression plasmids .
- Typical PCR conditions are one cycle 95°C melting for two minutes; 25 cycles 94°C denaturation for one minute, 50°C annealing for one minute and 72 °C extension for one minute; plus one cycle 72 °C extension for seven minutes.
- a Perkin Elmer GeneAmp PCR Core Reagents kit is used.
- a 100 ul reaction contains 100 pmole of each primer and one ug of template DNA; and lx PCR buffer, 200 uM dGTP, 200 uM dATP, 200 uM dTTP, 200 uM dCTP, 2.5 units AmpliTaq DNA polymerase and 2 mM MgCl 2 .
- PCR reactions are performed in a Model 480 DNA thermal cycler (Perkin Elmer Corporation, Norwalk, CT) .
- primers "new start” and “new stop” are added to the annealed fragments to create and amplify the full-length new N-terminus /C-terminus gene.
- Typical PCR conditions are one cycle 95°C melting for two minutes; 25 cycles 94°C denaturation for one minute, 60°C annealing for one minute and 72 °C extension for one minute; plus one cycle 72°C extension for seven minutes.
- a Perkin Elmer GeneAmp PCR Core Reagents kit is used.
- a 100 ul reaction contains 100 pmole of each primer and approximately 0.5 ug of DNA; and lx PCR buffer, 200 uM dGTP, 200 uM dATP, 200 uM dTTP, 200 uM dCTP, 2.5 units AmpliTaq DNA polymerase and 2 mM MgCl 2 .
- PCR reactions are purified using a Wizard PCR Preps kit (Promega) .
- New N-terminus/C-terminus genes without a linker joining the original N-terminus and C-terminus can be made using two steps of PCR amplification and a blunt end ligation.
- the steps are illustrated in Figure 3.
- the primer set (“new start” and "P-bl start”) is used to create and amplify, from the original gene sequence, the DNA fragment (“Fragment Start”) that contains the sequence encoding the new N-terminal portion of the new protein.
- the primer set (“new stop” and "P-bl stop”) is used to create and amplify, from the original gene sequence, the DNA fragment (“Fragment Stop”) that contains the sequence encoding the new C-terminal portion of the new 3 Z protein.
- the “new start” and “new stop” primers are designed to include appropriate restriction sites which allow cloning of the new gene into expression vectors. Typical PCR conditions are one cycle 95°C melting for two minutes; 25 cycles 94°C denaturation for one minute, 50°C annealing for 45 seconds and 72°C extension for 45 seconds. Deep Vent polymerase (New England Biolabs) is used to reduce the occurrence of overhangs in conditions recommended by the manufacturer.
- the "P-bl start” and “P-bl stop” primers are phosphorylated at the 5' end to aid in the subsequent blunt end ligation of "Fragment Start” and “Fragment Stop” to each other.
- a 100 ul reaction contained 150 pmole of each primer and one ug of template DNA; and lx Vent buffer (New England Biolabs), 300 uM dGTP, 300 uM dATP, 300 uM dTTP, 300 uM dCTP, and 1 unit Deep Vent polymerase.
- PCR reactions are performed in a Model 480 DNA thermal cycler (Perkin Elmer Corporation, Norwalk, CT) .
- PCR reaction products are purified using a Wizard PCR Preps kit (Promega) .
- the primers are designed to include appropriate restriction enzyme recognition sites which allow for the cloning of the new gene into expression vectors.
- "Fragment Start” is designed to create a Ncol restriction site
- “Fragment Stop” is designed to create a Hindlll restriction site.
- Restriction digest reactions are purified using a Magic DNA Clean-up System kit (Promega) . Fragments Start and Stop are resolved on a 1% TAE gel, stained with ethidium bromide and isolated using a Qiaex Gel Extraction kit (Qiagen) .
- New N-terminus/C-terminus genes can be made based on the method described in R. A. Horlick, et al Protein Eng. 5:427-431 (1992) . Polymerase chain reaction (PCR) amplification of the new N-terminus/C-terminus genes is performed using a tandemly duplicated template DNA. The steps are illustrated in Figure 4.
- PCR Polymerase chain reaction
- the tandemly-duplicated template DNA is created by cloning and contains two copies of the gene separated by DNA sequence encoding a linker connecting the original C- and N-terminal ends of the two copies of the gene.
- Specific primer sets are used to create and amplify a full-length new N terminus/C-terminus gene from the tandemly-duplicated template DNA. These primers are designed to include appropriate restriction sites which allow for the cloning of the new gene into expression vectors. Typical PCR conditions are one cycle 95°C melting for two minutes; 25 cycles 94°C denaturation for one minute, 50°C annealing for one minute and 72°C extension for one minute; plus one cycle 72°C extension for seven minutes .
- a Perkin Elmer GeneAmp PCR Core Reagents kit (Perkin Elmer Corporation, Norwalk, CT) is used.
- a 100 ul reaction contains 100 pmole of each primer and one ug of template DNA; and lx PCR buffer, 200 uM dGTP, 200 uM dATP , 200 uM dTTP , 200 uM dCTP , 2.5 units AmpliTaq DNA polymerase and 2 mM MgCl 2 .
- PCR reactions are performed in a Model 480 DNA thermal cycler (Perkin Elmer Corporation, Norwalk, CT) .
- PCR reactions are purified using a Wizard PCR Preps kit (Promega) . DNA isolation and characterization
- Plasmid DNA can be isolated by a number of different methods and using commercially available kits known to those skilled in the art. A few such methods are shown herein. Plasmid DNA is isolated using the Promega WizardTM Miniprep kit (Madison, Wl) , the Qiagen QIAwe11 Plasmid isolation kits (Chatsworth, CA) or Qiagen Plasmid Midi kit. These kits follow the same general procedure for plasmid DNA isolation. Briefly, cells are pelleted by centrifugation (5000 x g) , plasmid DNA released with sequential NaOH/acid treatment, and cellular debris is removed by centrifugation (10000 x g) .
- the supernatant (containing the plasmid DNA) is loaded onto a column containing a DNA-binding resin, the column is washed, and plasmid DNA eluted with TE. After screening for the colonies with the plasmid of interest, the E. coli cells are inoculated into 50-100 mLs of LB plus appropriate antibiotic for overnight growth at 37°C in an air incubator while shaking.
- the purified plasmid DNA is used for DNA sequencing, further restriction enzyme digestion, additional subcloning of DNA fragments and transfection into mammalian, E. coli or other cells.
- Purified plasmid DNA is resuspended in dH.O and quantitated by measuring the absorbance at 260/280 nm in a Bausch and Lomb Spectronic 601 UV spectrometer.
- DNA samples are sequenced using ABI PRISMTM DyeDeoxyTM terminator sequencing chemistry (Applied Biosystems Division of Perkin Elmer Corporation, Lincoln City, CA) kits (Part Number 401388 or 402078) according to the manufacturers suggested protocol usually modified by the addition of 5% DMSO to the sequencing mixture. Sequencing reactions are performed in a Model 480 DNA thermal cycler (Perkin Elmer Corporation, Norwalk, CT) following the recommended amplification conditions.
- Samples are purified to remove excess dye terminators with Centri-SepTM spin columns (Princeton Separations, Adelphia, NJ) and lyophilized. Fluorescent dye labeled sequencing reactions are resuspended in deionized formamide, and sequenced on denaturing 4.75% polyacrylamide-8M urea gels using an ABI Model 373A automated DNA sequencer. Overlapping DNA sequence fragments are analyzed and assembled into master DNA contigs using Sequencher v2.1 DNA analysis software (Gene Codes Corporation, Ann Arbor, MI) .
- the BHK-21 cell line can be obtained from the ATCC (Rockville, MD) .
- the cells are cultured in Dulbecco's modified Eagle media (DMEM/high-glucose) , supplemented to 2mM (mM) L-glutamine and 10% fetal bovine serum (FBS) .
- DMEM/high-glucose Dulbecco's modified Eagle media
- FBS fetal bovine serum
- This formulation is designated BHK growth media.
- Selective media is BHK growth media supplemented with 453 units/mL hygromycin B (Calbiochem, San Diego, CA) .
- the BHK-21 cell line was previously stably transfected with the HSV transactivating protein VP16, which transactivates the IE110 promoter found on the plasmid pMON3359 (See Hippenmeyer et al .
- the VP16 protein drives expression of genes inserted behind the IE110 promoter.
- BHK-21 cells expressing the transactivating protein VP16 are designated BHK-VP16.
- the plasmid pMON1118 (See Highkin et al., Poul try Sci . , 70: 970-981, 1991) expresses the hygromycin resistance gene from the SV40 promoter.
- a similar plasmid is available from ATCC, pSV2-hph.
- BHK-VP16 cells are seeded into a 60 millimeter (mm) tissue culture dish at 3 X 10 D cells per dish 24 hours prior to transfection.
- Cells are transfected for 16 hours in 3 mL of "OPTIMEM”TM (Gibco-BRL, Gaithersburg, MD) containing 10 ug of plasmid DNA containing the gene of interest, 3 ug hygromycin resistance plasmid, pMON1118, and 80 ug of Gibco-BRL "LIPOFECTAMINE”TM per dish.
- the media is subsequently aspirated and replaced with 3 mL of growth media.
- media from each dish is collected and assayed for activity (transient conditioned media).
- the cells are removed from the dish by trypsin-EDTA, diluted 1:10 and transferred to 100 mm tissue culture dishes containing 10 mL of selective media. After approximately 7 days in selective media, resistant cells grow into colonies several millimeters in diameter. The colonies are removed from the dish with filter paper (cut to approximately the same size as the colonies and soaked in trypsin/EDTA) and transferred to individual wells of a 24 well plate containing 1 mL of selective media. After the clones are grown to confluence, the conditioned media is re-assayed, and positive clones are expanded into growth media.
- E. coli strain MON105 or JM101 harboring the plasmid of interest are grown at 37°C in M9 plus casamino acids medium with shaking in a air incubator Model G25 from New Brunswick Scientific (Edison, New Jersey) . Growth is monitored at OD600 until it reaches a value of 1, at which time nalidixic acid (10 milligrams/mL) in 0.1 N NaOH is added to a final concentration of 50 ⁇ g/mL. The cultures are then shaken at 37°C for three to four additional hours. A high degree of aeration is maintained throughout culture period in order to achieve maximal production of the desired gene product. The cells are examined under a light microscope for the presence of inclusion bodies (IB) .
- IB inclusion bodies
- One mL aliquots of the culture are removed for analysis of protein content by boiling the pelleted cells, treating them with reducing buffer and electrophoresis via SDS-PAGE (see Maniatis et al . Molecular Cloning: A Laboratory Manual, 1982) .
- the culture is centrifuged (5000 x g) to pellet the cells.
- the cell pellet from a 330 mL E. coli culture is resuspended in 15 mL of sonication buffer (10 mM 2- amino-2- (hydroxymethyl) 1, 3-propanediol hydrochloride (Tris-HCl) , pH 8.0 + 1 mM ethylenediaminetetraacetic acid (EDTA) ) .
- sonication buffer 10 mM 2- amino-2- (hydroxymethyl) 1, 3-propanediol hydrochloride (Tris-HCl) , pH 8.0 + 1 mM ethylenediaminetetraacetic acid (EDTA)
- Tris-HCl 2- amino-2- (hydroxymethyl) 1, 3-propanediol hydrochloride
- EDTA ethylenediaminetetraacetic acid
- Extraction and refolding of proteins from inclusion body pellets Following the final centrifugation step, the IB pellet is resuspended in 10 mL of 50 mM Tris-HCl, pH 9.5, 8 M urea and 5 mM dithiothreitol (DTT) and stirred at room temperature for approximately 45 minutes to allow for denaturation of the expressed protein.
- DTT dithiothreitol
- the extraction solution is transferred to a beaker containing 70 mL of 5mM Tris-HCl, pH 9.5 and 2.3 M urea and gently stirred while exposed to air at 4°C for 18 to 48 hours to allow the proteins to refold.
- Refolding is monitored by analysis on a Vydac (Hesperia, Ca . ) C18 reversed phase high pressure liquid chromatography (RP- HPLC) column (0.46x25 cm).
- RP- HPLC reversed phase high pressure liquid chromatography
- a linear gradient of 40% to 65% acetonitrile, containing 0.1% trifluoroacetic acid (TFA) is employed to monitor the refold. This gradient is developed over 30 minutes at a flow rate of 1.5 mL per minute.
- Denatured proteins generally elute later in the gradient than the refolded proteins .
- contaminating E. coli proteins are removed by acid precipitation.
- the pH of the refold solution is titrated to between pH 5.0 and pH 5.2 using 15% (v/v) acetic acid (HOAc) . This solution is stirred at 4°C for 2 hours and then centrifuged for 20 minutes at 12,000 x g to pellet any insoluble protein.
- HOAc acetic acid
- the supernatant from the acid precipitation step is dialyzed using a Spectra/Por 3 membrane with a molecular weight cut off (MWCO) of 3,500 daltons.
- the dialysis is against 2 changes of 4 liters (a 50-fold excess) of lOmM Tris-HCl, pH 8.0 for a total of 18 hours. Dialysis lowers the sample conductivity and removes urea prior to DEAE chromatography.
- the sample is then centrifuged (20 minutes at 12,000 x g) to pellet any insoluble protein following dialysis.
- a Bio-Rad Bio-Scale DEAE2 column (7 x 52 mm) is used for ion exchange chromatography.
- the column is equilibrated in a buffer containing lOmM Tris-HCl, pH 8.0.
- the protein is eluted using a 0-to-500 mM sodium chloride (NaCl) gradient, in equilibration buffer, over 45 column volumes. A flow rate of 1 mL per minute is used throughout the run. Column fractions (2 mL per fraction) are collected across the gradient and analyzed by RP HPLC on a Vydac (Hesperia, Ca . ) C18 column (0.46 x 25 cm) .
- the folded proteins can be affinity purified using affinity reagents such as mAbs or receptor subunits attached to a suitable matrix.
- affinity reagents such as mAbs or receptor subunits attached to a suitable matrix.
- purification can be accomplished using any of a variety of chromatographic methods such as: ion exchange, gel filtration or hydrophobic chromatography or reversed phase HPLC.
- the purified protein is analyzed by RP-HPLC, electrospray mass spectrometry, and SDS-PAGE.
- the o protein quantitation is done by amino acid composition, RP-HPLC, and Bradford protein determination.
- tryptic peptide mapping is performed in conjunction with electrospray mass spectrometry to confirm the identity of the protein.
- This assay reflects the ability of colony stimulating factors to stimulate normal bone marrow cells to produce different types of hematopoietic colonies in vi tro (Bradley et al . , Aust . Exp Biol . Sci . 44:287-300, 1966), Pluznik et al . , J " . Cell Comp . Physio 66:319-324, 1965) .
- samples are diluted 1:5 with a IX PBS (#14040.059 Life Technologies, Gaithersburg, MD. ) solution in a 50 mL conical tube (#25339-50 Corning, Corning MD) .
- Ficoll Histopaque 1077 Sigma H-8889 is layered under the diluted sample and centrifuged, 300 x g for 30 min. The mononuclear cell band is removed and washed two times in IX PBS and once with 1% BSA PBS (CellPro Co., Bothel, WA) .
- CD34+ cells are counted and CD34+ cells are selected using the Ceprate LC (CD34) Kit (CellPro Co., Bothel, WA) column. This fractionation is performed since all stem and progenitor cells within the bone marrow display CD34 surface antigen.
- Cultures are set up in triplicate with a final volume of 1.0 mL in a 35 X 10 mm petri dish (Nunc#174926) .
- Culture medium is purchased from Terry Fox Labs. (HCC- 4230 medium (Terry Fox Labs, Vancouver, B.C., Canada) and erythropoietin (Amgen, Thousand Oaks, CA. ) is added HI to the culture media.
- 3,000-10,000 CD34+ cells are added per dish.
- EPO receptor agonist proteins in conditioned media from transfected mammalian cells or purified from conditioned media from transfected mammalian cells or E. coli , are added to give final concentrations ranging from .001 nM to 10 nM.
- Cultures are resuspended using a 3cc syringe and 1.0 mL is dispensed per dish.
- Control baseline response
- Positive control cultures received conditioned media (PHA stimulated human cells: Terry Fox Lab. H2400).
- Cultures are incubated at 37°C, 5% C0 2 in humidified air .
- Hematopoietic colonies which are defined as greater than 50 cells are counted on the day of peak response (days 10-11) using a Nikon inverted phase microscope with a 40x objective combination. Groups of cells containing fewer than 50 cells are referred to as clusters.
- colonies can be identified by spreading the colonies on a slide and stained or they can be picked, resuspended and spun onto cytospin slides for staining.
- Bone marrow cells are traditionally used for in vitro assays of hematopoietic colony stimulating factor (CSF) activity.
- CSF colony stimulating factor
- human bone marrow is not always available, and there is considerable variability between donors.
- Umbilical cord blood is comparable to bone marrow as a source of hematopoietic stem cells and progenitors (Broxmeyer et al . , PNAS USA 89:4109-113, 1992; Mayani et al . , Blood 81:3252-3258, 2993). In contrast to bone marrow, cord blood is more readily available on a regular basis.
- Mononuclear cells are isolated from cord blood within 24 hr . of collection, using a standard density gradient (1.077 g/mL Histopaque) .
- Cord blood MNC have been further enriched for stem cells and progenitors by several procedures, including immunomagnetic selection for CD14-, CD34+ cells; panning for SBA- , CD34+ fraction using coated flasks from Applied Immune Science (Santa Clara, CA) ; and CD34+ selection using a CellPro (Bothell, WA) avidin column. Either freshly isolated or cryopreserved CD34+ cell enriched fractions are used for the assay.
- Duplicate cultures for each serial dilution of sample (concentration range from 1 pM to 1204 pM) are prepared with 1x104 cells in 1ml of 0.9% methylcellulose containing medium without additional growth factors (Methocult H4230 from Stem Cell Technologies, Vancouver, BC . ) . After culturing for 7-9 days, colonies containing >30 cells are counted.
- Cell lines such as BHK or the murine pro B cell line Baf/3, can be transfected with a colony stimulating factor receptor, such as the human EPO receptor which the cell line does not have. These transfected cell lines can be used to determine the cell proliferative activity and/or receptor binding.
- a colony stimulating factor receptor such as the human EPO receptor which the cell line does not have.
- Genes encoding the sequence rearranged EPO ligands can be constructed by any one of the methods described herein or by other recombinant methods known to those i skilled in the art.
- the site of permutation is between residues 131 (Arg) and 132 (Thr) of EPO. This is a site which is susceptible to proteolytic cleavage, thereby indicating surface exposure with a relatively high degree of flexibility.
- fragment start a DNA fragment which encodes the new N-terminus. This fragment is termed "fragment start”.
- sequence underlined in the new start primer is the Ncol restriction site.
- New start primer gcgcgcCCATGGACAATCACTGCTGAC SEQ ID NO: 131
- fragment stop The sequence underlined in the new stop primer is the Hindlll restriction site.
- New stop primer gcgcgcAAGCTTATTATCGGAGTGGAGCAGCTGAGGCCGCATC SEQ ID NO: 133
- Blunt end primer GCCCCACCACGCCTCATCTGT SEQ ID NO: 134 H
- the two fragments created in the two PCR reactions are ligated together, digested with Ncol and Hindlll and cloned into an expression vector.
- the clones are screened by restiction analysis and DNA sequenced to confirm the proper sequence.
- the primers can be designed to create restriction sites other than Ncol and Hindlll to clone into other expression vectors
- sequence rearranged EPO receptor agonists of the present invention can be assayed for bioactivity by the methods described herein or by other assays know to those skilled in the art.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL97332960A PL189756B1 (pl) | 1996-10-25 | 1997-10-23 | Polipeptyd ludzkiego agonisty receptora erytropoetyny (EPO), sposób jego wytwarzania i zastosowanie, cząsteczka kwasu nukleinowego, kompozycja, sposób selektywnego namnażania ex vivo erytroidalnych komórek progenitorowych |
| NZ334546A NZ334546A (en) | 1996-10-25 | 1997-10-23 | Erythropoietin receptor agonist and use in the treatment of hematopoietic disorders |
| EP97913680A EP0939816A1 (en) | 1996-10-25 | 1997-10-23 | Circularly permuted erythropoietin receptor agonists |
| AU50810/98A AU721196B2 (en) | 1996-10-25 | 1997-10-23 | Circularly permuted erythropoietin receptor agonists |
| JP52052898A JP2001503266A (ja) | 1996-10-25 | 1997-10-23 | 環状に並べ替えたエリスロポイエチン受容体アゴニスト |
| CA002268001A CA2268001A1 (en) | 1996-10-25 | 1997-10-23 | Circularly permuted erythropoietin receptor agonists |
| BR9712675-6A BR9712675A (pt) | 1996-10-25 | 1997-10-23 | Agonistas do receptor de eritropoietina circularmente permutados. |
| NO991906A NO991906D0 (no) | 1996-10-25 | 1999-04-21 | Sirkulµrpermutert erythropoietin reseptoragonister |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US3404496P | 1996-10-25 | 1996-10-25 | |
| US60/034,044 | 1996-10-25 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1998018926A1 true WO1998018926A1 (en) | 1998-05-07 |
Family
ID=21873960
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1997/018703 Ceased WO1998018926A1 (en) | 1996-10-25 | 1997-10-23 | Circularly permuted erythropoietin receptor agonists |
Country Status (13)
| Country | Link |
|---|---|
| US (1) | US20060172932A1 (https=) |
| EP (1) | EP0939816A1 (https=) |
| JP (1) | JP2001503266A (https=) |
| KR (1) | KR20000052807A (https=) |
| CN (1) | CN1234073A (https=) |
| AU (1) | AU721196B2 (https=) |
| BR (1) | BR9712675A (https=) |
| CA (1) | CA2268001A1 (https=) |
| CZ (1) | CZ130199A3 (https=) |
| NO (1) | NO991906D0 (https=) |
| NZ (1) | NZ334546A (https=) |
| PL (1) | PL189756B1 (https=) |
| WO (1) | WO1998018926A1 (https=) |
Cited By (33)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6531121B2 (en) | 2000-12-29 | 2003-03-11 | The Kenneth S. Warren Institute, Inc. | Protection and enhancement of erythropoietin-responsive cells, tissues and organs |
| US7132280B2 (en) | 1999-04-15 | 2006-11-07 | Crucell Holland, B.V. | Recombinant protein production in a human cell |
| US7192759B1 (en) | 1999-11-26 | 2007-03-20 | Crucell Holland B.V. | Production of vaccines |
| US7291484B2 (en) | 2003-05-09 | 2007-11-06 | Crucell Holland B.V. | Processes for culturing E1-immortalized cells to increase product yields |
| US7297680B2 (en) | 1999-04-15 | 2007-11-20 | Crucell Holland B.V. | Compositions of erythropoietin isoforms comprising Lewis-X structures and high sialic acid content |
| US7309687B1 (en) | 1999-04-13 | 2007-12-18 | The Kenneth S. Warren Institute, Inc. | Methods for treatment and prevention of neuromuscular and muscular conditions by peripherally administered erythropoietin |
| US7345019B1 (en) | 1999-04-13 | 2008-03-18 | The Kenneth S. Warren Institute, Inc. | Modulation of excitable tissue function by peripherally administered erythropoietin |
| WO2007060213A3 (en) * | 2005-11-24 | 2008-08-14 | Serono Lab | Erythropoietin polypeptides and uses thereof |
| US7504248B2 (en) | 2001-12-07 | 2009-03-17 | Crucell Holland B.V. | Production of viruses viral isolates and vaccines |
| US7521220B2 (en) | 1999-11-26 | 2009-04-21 | Crucell Holland B.V. | Production of vaccines |
| US7527961B2 (en) | 1999-11-26 | 2009-05-05 | Crucell Holland B.V. | Production of vaccines |
| EP1844068A4 (en) * | 2005-01-25 | 2009-09-30 | Apollo Life Sciences Ltd | MOLECULES AND THEIR CHIMERIC MOLECULES |
| US7604960B2 (en) | 1999-04-15 | 2009-10-20 | Crucell Holland B.V. | Transient protein expression methods |
| EP2281828A2 (en) | 2000-12-29 | 2011-02-09 | The Kenneth S. Warren Institute, Inc. | Compositions comprising modified erythropoietin |
| US8236561B2 (en) | 1999-04-15 | 2012-08-07 | Crucell Holland B.V. | Efficient production of IgA in recombinant mammalian cells |
| US9156897B2 (en) | 2012-06-08 | 2015-10-13 | Alkermes, Inc. | Fusion polypeptides comprising an active protein linked to a mucin-domain polypeptide |
| US9163075B2 (en) | 2005-11-23 | 2015-10-20 | Acceleron Pharma Inc. | Isolated polynucleotide that encodes an ActRIIa-Fc fusion polypeptide |
| US9353356B2 (en) | 2007-09-18 | 2016-05-31 | Acceleron Pharma Inc. | Activin-actriia antagonists for treating a follicle-stimulating horomone-secreting pituitary tumor |
| US9399669B2 (en) | 2007-02-02 | 2016-07-26 | Acceleron Pharma Inc. | Variants derived from ActRIIB |
| US9439945B2 (en) | 2008-08-14 | 2016-09-13 | Acceleron Pharma Inc. | Isolated nucleotide sequences encoding GDF traps |
| US9480742B2 (en) | 2005-11-23 | 2016-11-01 | Acceleron Pharma Inc. | Method of promoting bone growth by an anti-actriia antibody |
| US9493556B2 (en) | 2010-11-08 | 2016-11-15 | Acceleron Pharma Inc. | Actriia binding agents and uses thereof |
| US9505813B2 (en) | 2008-08-14 | 2016-11-29 | Acceleron Pharma Inc. | Use of GDF traps to treat anemia |
| US9526759B2 (en) | 2007-02-01 | 2016-12-27 | Acceleron Pharma Inc. | Activin-actriia antagonists and uses for treating or preventing breast cancer |
| US9572865B2 (en) | 2005-11-23 | 2017-02-21 | Acceleron Pharma Inc. | Activin-actriia antagonists and uses for treating multiple myeloma |
| US9617319B2 (en) | 2009-11-17 | 2017-04-11 | Acceleron Pharma Inc. | ActRIIB proteins and variants and uses therefore relating to utrophin induction for muscular dystrophy therapy |
| US9745559B2 (en) | 2009-06-12 | 2017-08-29 | Acceleron Pharma Inc. | Method for decreasing the body fat content in a subject by administering an ActRIIB protein |
| US9790284B2 (en) | 2009-06-08 | 2017-10-17 | Acceleron Pharma Inc. | Methods for increasing thermogenic adipocytes |
| US9850298B2 (en) | 2014-06-13 | 2017-12-26 | Acceleron Pharma Inc. | Methods for treating ulcers in thalassemia syndrome with an ActRIIB polypeptide |
| US10093707B2 (en) | 2006-12-18 | 2018-10-09 | Acceleron Pharma Inc. | Antagonists of activin-ActRIIa and uses for increasing red blood cell levels |
| US10195249B2 (en) | 2012-11-02 | 2019-02-05 | Celgene Corporation | Activin-ActRII antagonists and uses for treating bone and other disorders |
| US11471510B2 (en) | 2014-12-03 | 2022-10-18 | Celgene Corporation | Activin-ActRII antagonists and uses for treating anemia |
| US11813308B2 (en) | 2014-10-09 | 2023-11-14 | Celgene Corporation | Treatment of cardiovascular disease using ActRII ligand traps |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110144010B9 (zh) | 2018-02-14 | 2021-01-05 | 上海洛启生物医药技术有限公司 | 阻断型pd-l1驼源单域抗体及其用途 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1992006116A1 (en) * | 1990-09-28 | 1992-04-16 | Ortho Pharmaceutical Corporation | Hybrid growth factors |
| WO1995021197A1 (en) * | 1994-02-04 | 1995-08-10 | G.D. Searle & Co. | Il-3 variant hematopoiesis fusion protein |
| WO1995027732A2 (en) * | 1994-04-08 | 1995-10-19 | The Government Of The United States Of America, Represented By The Secretary Of The Department Of Health And Human Services | Circularly permuted ligands and circularly permuted chimeric molecules |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4751180A (en) * | 1985-03-28 | 1988-06-14 | Chiron Corporation | Expression using fused genes providing for protein product |
-
1997
- 1997-10-23 AU AU50810/98A patent/AU721196B2/en not_active Ceased
- 1997-10-23 CA CA002268001A patent/CA2268001A1/en not_active Abandoned
- 1997-10-23 WO PCT/US1997/018703 patent/WO1998018926A1/en not_active Ceased
- 1997-10-23 KR KR1019990703627A patent/KR20000052807A/ko not_active Ceased
- 1997-10-23 JP JP52052898A patent/JP2001503266A/ja not_active Abandoned
- 1997-10-23 CZ CZ991301A patent/CZ130199A3/cs unknown
- 1997-10-23 PL PL97332960A patent/PL189756B1/pl not_active IP Right Cessation
- 1997-10-23 EP EP97913680A patent/EP0939816A1/en not_active Withdrawn
- 1997-10-23 CN CN97198973A patent/CN1234073A/zh active Pending
- 1997-10-23 BR BR9712675-6A patent/BR9712675A/pt not_active Application Discontinuation
- 1997-10-23 NZ NZ334546A patent/NZ334546A/xx unknown
-
1999
- 1999-04-21 NO NO991906A patent/NO991906D0/no not_active Application Discontinuation
-
2004
- 2004-10-25 US US10/972,962 patent/US20060172932A1/en not_active Abandoned
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1992006116A1 (en) * | 1990-09-28 | 1992-04-16 | Ortho Pharmaceutical Corporation | Hybrid growth factors |
| WO1995021197A1 (en) * | 1994-02-04 | 1995-08-10 | G.D. Searle & Co. | Il-3 variant hematopoiesis fusion protein |
| WO1995027732A2 (en) * | 1994-04-08 | 1995-10-19 | The Government Of The United States Of America, Represented By The Secretary Of The Department Of Health And Human Services | Circularly permuted ligands and circularly permuted chimeric molecules |
Non-Patent Citations (3)
| Title |
|---|
| HORLICK R A ET AL: "PERMUTEINS OF INTERLEUKIN 1 BETA-A SIMPLIFIED APPROACH FOR THE CONSTRUCTION OF PERMUTATED PROTEINS HAVING NEW TERMINI", PROTEIN ENGINEERING, vol. 5, no. 5, 1992, pages 427 - 431, XP002022097 * |
| KREITMAN R J ET AL: "A CIRCULARLY PERMUTED RECOMBINANT INTERLEUKIN 4 TOXIN WITH INCREASED ACTIVITY", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 91, no. 15, July 1994 (1994-07-01), pages 6889 - 6893, XP002022099 * |
| VIGUERA AR ET AL: "The order of secondary structure elements does not determine the structure of a protein but does affect its folding kinetics.", J MOL BIOL, APR 7 1995, 247 (4) P670-81, ENGLAND, XP002056595 * |
Cited By (66)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7309687B1 (en) | 1999-04-13 | 2007-12-18 | The Kenneth S. Warren Institute, Inc. | Methods for treatment and prevention of neuromuscular and muscular conditions by peripherally administered erythropoietin |
| US7410941B1 (en) | 1999-04-13 | 2008-08-12 | The Kenneth S. Warren Institute, Inc. | Methods for treatment of neurodegenerative conditions by peripherally administered erythropoietin |
| US7345019B1 (en) | 1999-04-13 | 2008-03-18 | The Kenneth S. Warren Institute, Inc. | Modulation of excitable tissue function by peripherally administered erythropoietin |
| US8236561B2 (en) | 1999-04-15 | 2012-08-07 | Crucell Holland B.V. | Efficient production of IgA in recombinant mammalian cells |
| US7491532B2 (en) | 1999-04-15 | 2009-02-17 | Crucell Holland, B.V. | Recombinant protein production in a human cell |
| US7297680B2 (en) | 1999-04-15 | 2007-11-20 | Crucell Holland B.V. | Compositions of erythropoietin isoforms comprising Lewis-X structures and high sialic acid content |
| US7604960B2 (en) | 1999-04-15 | 2009-10-20 | Crucell Holland B.V. | Transient protein expression methods |
| US7132280B2 (en) | 1999-04-15 | 2006-11-07 | Crucell Holland, B.V. | Recombinant protein production in a human cell |
| US7833753B2 (en) | 1999-04-15 | 2010-11-16 | Crucell Holland B.V. | Methods of producing erythropoietin isoforms comprising Lewis-X structures and high sialic acid content and compositions of the same |
| US7470523B2 (en) | 1999-04-15 | 2008-12-30 | Crucell Holland B.V. | Recombinant protein production in a human cell |
| US7833788B2 (en) | 1999-11-26 | 2010-11-16 | Crucell Holland B.V. | Production of vaccines |
| US7521220B2 (en) | 1999-11-26 | 2009-04-21 | Crucell Holland B.V. | Production of vaccines |
| US7527961B2 (en) | 1999-11-26 | 2009-05-05 | Crucell Holland B.V. | Production of vaccines |
| US7550284B2 (en) | 1999-11-26 | 2009-06-23 | Crucell Holland B.V. | Production of vaccines |
| US7964198B2 (en) | 1999-11-26 | 2011-06-21 | Crucell Holland B.V. | Production of vaccines |
| US7192759B1 (en) | 1999-11-26 | 2007-03-20 | Crucell Holland B.V. | Production of vaccines |
| EP2281828A2 (en) | 2000-12-29 | 2011-02-09 | The Kenneth S. Warren Institute, Inc. | Compositions comprising modified erythropoietin |
| US6531121B2 (en) | 2000-12-29 | 2003-03-11 | The Kenneth S. Warren Institute, Inc. | Protection and enhancement of erythropoietin-responsive cells, tissues and organs |
| US7504248B2 (en) | 2001-12-07 | 2009-03-17 | Crucell Holland B.V. | Production of viruses viral isolates and vaccines |
| US8802417B2 (en) | 2001-12-07 | 2014-08-12 | Crucell Holland B.V. | Production of viruses, viral isolates and vaccines |
| US8008043B2 (en) | 2003-05-09 | 2011-08-30 | Crucell Holland B.V. | Cultures of E1-immortalized cells and processes for culturing the same to increase product yields therefrom |
| US7608431B2 (en) | 2003-05-09 | 2009-10-27 | Crucell Holland B.V. | Fed-batch process for production of erythropoietin in human embryonic retina cells that express adenovirus E1A |
| US7291484B2 (en) | 2003-05-09 | 2007-11-06 | Crucell Holland B.V. | Processes for culturing E1-immortalized cells to increase product yields |
| EP2402450A1 (en) | 2004-12-30 | 2012-01-04 | Crucell Holland B.V. | Methods to obtain recombinant proteins with decreased LacdiNac structures |
| EP1844068A4 (en) * | 2005-01-25 | 2009-09-30 | Apollo Life Sciences Ltd | MOLECULES AND THEIR CHIMERIC MOLECULES |
| US9163075B2 (en) | 2005-11-23 | 2015-10-20 | Acceleron Pharma Inc. | Isolated polynucleotide that encodes an ActRIIa-Fc fusion polypeptide |
| US11129873B2 (en) | 2005-11-23 | 2021-09-28 | Acceleron Pharma Inc. | Method for promoting bone growth using activin-actriia antagonists |
| US9480742B2 (en) | 2005-11-23 | 2016-11-01 | Acceleron Pharma Inc. | Method of promoting bone growth by an anti-actriia antibody |
| US10239940B2 (en) | 2005-11-23 | 2019-03-26 | Acceleron Pharma Inc. | Method of promoting bone growth by an anti-actriia antibody |
| US10071135B2 (en) | 2005-11-23 | 2018-09-11 | Acceleron Pharma Inc. | Method of identifying an agent that promotes bone growth or increases bone density |
| US9572865B2 (en) | 2005-11-23 | 2017-02-21 | Acceleron Pharma Inc. | Activin-actriia antagonists and uses for treating multiple myeloma |
| WO2007060213A3 (en) * | 2005-11-24 | 2008-08-14 | Serono Lab | Erythropoietin polypeptides and uses thereof |
| US10093707B2 (en) | 2006-12-18 | 2018-10-09 | Acceleron Pharma Inc. | Antagonists of activin-ActRIIa and uses for increasing red blood cell levels |
| US9526759B2 (en) | 2007-02-01 | 2016-12-27 | Acceleron Pharma Inc. | Activin-actriia antagonists and uses for treating or preventing breast cancer |
| US10259861B2 (en) | 2007-02-02 | 2019-04-16 | Acceleron Pharma Inc. | Variants derived from ActRIIB and uses therefor |
| US9399669B2 (en) | 2007-02-02 | 2016-07-26 | Acceleron Pharma Inc. | Variants derived from ActRIIB |
| US9353356B2 (en) | 2007-09-18 | 2016-05-31 | Acceleron Pharma Inc. | Activin-actriia antagonists for treating a follicle-stimulating horomone-secreting pituitary tumor |
| US11168311B2 (en) | 2008-08-14 | 2021-11-09 | Acceleron Pharma Inc. | Methods for treating anemia in a subject in need thereof |
| US10377996B2 (en) | 2008-08-14 | 2019-08-13 | Acceleron Pharma Inc. | Methods of identifying ActRIIB variants |
| US11162085B2 (en) | 2008-08-14 | 2021-11-02 | Acceleron Pharma Inc. | Methods for treating anemia in a subject in need thereof |
| US11155791B2 (en) | 2008-08-14 | 2021-10-26 | Acceleron Pharma Inc. | Methods for treating anemia in a subject in need thereof |
| US9932379B2 (en) | 2008-08-14 | 2018-04-03 | Acceleron Pharma Inc. | Isolated nucleotide sequences encoding GDF traps |
| US9439945B2 (en) | 2008-08-14 | 2016-09-13 | Acceleron Pharma Inc. | Isolated nucleotide sequences encoding GDF traps |
| US10889626B2 (en) | 2008-08-14 | 2021-01-12 | Acceleron Pharma Inc. | Combined use of GDF traps and erythropoietin receptor activators to increase red blood cell levels |
| US10829533B2 (en) | 2008-08-14 | 2020-11-10 | Acceleron Pharma Inc. | Combined use of GDF traps and erythropoietin receptor activators to increase red blood cell levels |
| US9505813B2 (en) | 2008-08-14 | 2016-11-29 | Acceleron Pharma Inc. | Use of GDF traps to treat anemia |
| US10829532B2 (en) | 2008-08-14 | 2020-11-10 | Acceleron Pharma Inc. | Combined use of gdf traps and erythropoietin receptor activators to increase red blood cell levels |
| US10689427B2 (en) | 2008-08-14 | 2020-06-23 | Acceleron Pharma Inc. | Combined use of GDF traps and erythropoietin receptor activators to increase red blood cell levels |
| US9790284B2 (en) | 2009-06-08 | 2017-10-17 | Acceleron Pharma Inc. | Methods for increasing thermogenic adipocytes |
| US10968282B2 (en) | 2009-06-08 | 2021-04-06 | Acceleron Pharma Inc. | Methods for screening compounds for increasing thermogenic adipocytes |
| US10358633B2 (en) | 2009-06-12 | 2019-07-23 | Acceleron Pharma Inc. | Method for producing an ActRIIB-Fc fusion polypeptide |
| US11066654B2 (en) | 2009-06-12 | 2021-07-20 | Acceleron Pharma Inc. | Methods and compositions for reducing serum lipids |
| US9745559B2 (en) | 2009-06-12 | 2017-08-29 | Acceleron Pharma Inc. | Method for decreasing the body fat content in a subject by administering an ActRIIB protein |
| US10968262B2 (en) | 2009-11-17 | 2021-04-06 | Acceleron Pharma Inc. | Methods of increasing sarcolemmal utrophin |
| US9617319B2 (en) | 2009-11-17 | 2017-04-11 | Acceleron Pharma Inc. | ActRIIB proteins and variants and uses therefore relating to utrophin induction for muscular dystrophy therapy |
| US9493556B2 (en) | 2010-11-08 | 2016-11-15 | Acceleron Pharma Inc. | Actriia binding agents and uses thereof |
| US9359415B2 (en) | 2012-06-08 | 2016-06-07 | Alkermes, Inc. | Ligands modified by circular permutation as agonists and antagonists |
| US9296801B2 (en) | 2012-06-08 | 2016-03-29 | Alkermes, Inc. | Fusion polypeptides comprising mucin-domain polypeptide linkers |
| US9156897B2 (en) | 2012-06-08 | 2015-10-13 | Alkermes, Inc. | Fusion polypeptides comprising an active protein linked to a mucin-domain polypeptide |
| US9428563B2 (en) | 2012-06-08 | 2016-08-30 | Alkermes, Inc. | Ligands modified by circular permutation as agonists and antagonists |
| US10195249B2 (en) | 2012-11-02 | 2019-02-05 | Celgene Corporation | Activin-ActRII antagonists and uses for treating bone and other disorders |
| US9850298B2 (en) | 2014-06-13 | 2017-12-26 | Acceleron Pharma Inc. | Methods for treating ulcers in thalassemia syndrome with an ActRIIB polypeptide |
| US10487144B2 (en) | 2014-06-13 | 2019-11-26 | Acceleron Pharma Inc. | Methods for treating ulcers in a hemoglobinopathy anemia with a soluble actRIIB polypeptide |
| US11260107B2 (en) | 2014-06-13 | 2022-03-01 | Acceleron Pharma Inc. | Methods and compositions for treating ulcers |
| US11813308B2 (en) | 2014-10-09 | 2023-11-14 | Celgene Corporation | Treatment of cardiovascular disease using ActRII ligand traps |
| US11471510B2 (en) | 2014-12-03 | 2022-10-18 | Celgene Corporation | Activin-ActRII antagonists and uses for treating anemia |
Also Published As
| Publication number | Publication date |
|---|---|
| AU721196B2 (en) | 2000-06-29 |
| NO991906L (no) | 1999-04-21 |
| PL332960A1 (en) | 1999-10-25 |
| EP0939816A1 (en) | 1999-09-08 |
| JP2001503266A (ja) | 2001-03-13 |
| PL189756B1 (pl) | 2005-09-30 |
| AU5081098A (en) | 1998-05-22 |
| BR9712675A (pt) | 1999-10-19 |
| US20060172932A1 (en) | 2006-08-03 |
| CZ130199A3 (cs) | 1999-07-14 |
| NO991906D0 (no) | 1999-04-21 |
| CN1234073A (zh) | 1999-11-03 |
| NZ334546A (en) | 2000-12-22 |
| KR20000052807A (ko) | 2000-08-25 |
| CA2268001A1 (en) | 1998-05-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU721196B2 (en) | Circularly permuted erythropoietin receptor agonists | |
| AU734594B2 (en) | Circularly permuted polypeptides as novel stem cell factor receptor agonists | |
| US5830851A (en) | Methods of administering peptides that bind to the erythropoietin receptor | |
| US5773569A (en) | Compounds and peptides that bind to the erythropoietin receptor | |
| JP4050314B2 (ja) | エリトロポエチン受容体に結合する化合物およびペプチド | |
| US6660257B1 (en) | Circular permuteins of flt3 ligand | |
| WO1997026907A1 (en) | Novel administration of thrombopoietin | |
| KR100456212B1 (ko) | 다기능성조혈수용체아고니스트 | |
| WO1997012985A9 (en) | Multi-functional hematopoietic receptor agonists | |
| MXPA99003874A (es) | Agonistas del receptor de eritropoyetina circularmente permutados | |
| JP2001511641A (ja) | インターロイキン―5のアンタゴニスト | |
| MXPA99003875A (en) | NOVEL flt-3 RECEPTOR AGONISTS | |
| JP2002515729A (ja) | 新規g−csf受容体アゴニスト | |
| AU7390396A (en) | Interleuken-3 (il-3) receptor agonists | |
| HK1023145A (en) | Circularly permuted erythropoietin receptor agonists |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 97198973.7 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 50810/98 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 334546 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1997913680 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2268001 Country of ref document: CA Ref document number: 2268001 Country of ref document: CA Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PV1999-1301 Country of ref document: CZ |
|
| ENP | Entry into the national phase |
Ref document number: 1998 520528 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1019997003627 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/1999/003874 Country of ref document: MX |
|
| WWP | Wipo information: published in national office |
Ref document number: PV1999-1301 Country of ref document: CZ |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: 1997913680 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1019997003627 Country of ref document: KR |
|
| WWG | Wipo information: grant in national office |
Ref document number: 50810/98 Country of ref document: AU |
|
| WWR | Wipo information: refused in national office |
Ref document number: 1019997003627 Country of ref document: KR |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 1997913680 Country of ref document: EP |
|
| WWR | Wipo information: refused in national office |
Ref document number: PV1999-1301 Country of ref document: CZ |