WO1998013502A2 - Procedes d'identification de composes pour la rupture des interactions entre proteines - Google Patents

Procedes d'identification de composes pour la rupture des interactions entre proteines Download PDF

Info

Publication number
WO1998013502A2
WO1998013502A2 PCT/US1997/017276 US9717276W WO9813502A2 WO 1998013502 A2 WO1998013502 A2 WO 1998013502A2 US 9717276 W US9717276 W US 9717276W WO 9813502 A2 WO9813502 A2 WO 9813502A2
Authority
WO
WIPO (PCT)
Prior art keywords
protein
binding
dna
host cell
selectable marker
Prior art date
Application number
PCT/US1997/017276
Other languages
English (en)
Other versions
WO1998013502A3 (fr
Inventor
Richard H. Goodman
Merl F. Hoekstra
Original Assignee
Icos Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Icos Corporation filed Critical Icos Corporation
Priority to EP97944479A priority Critical patent/EP0915976A2/fr
Priority to AU45965/97A priority patent/AU4596597A/en
Publication of WO1998013502A2 publication Critical patent/WO1998013502A2/fr
Publication of WO1998013502A3 publication Critical patent/WO1998013502A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/635—Externally inducible repressor mediated regulation of gene expression, e.g. tetR inducible by tetracyline
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1055—Protein x Protein interaction, e.g. two hybrid selection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters

Definitions

  • the present invention relates to a novel method to identify inhibitors of protein/protein interactions.
  • Modulation of protein/protein interactions is an attractive target for drug discovery and development.
  • Potential methods by which drugs can regulate protein/protein interactions are numerous, including, for example, regulation of expression of one or more of the binding proteins, modulation of post-translational modification, and direct interference with the capacity of one protein to bind to one or more binding partners.
  • supramolecular protein complexes involving two or more binding proteins, play an important and essential roles in signal transduction, gene expression, cell proliferation and duplication, and cell cycle progression. For example, in the repair of UV damaged DNA, a so-called "repairsome" that contains over ten individual proteins is assembled into a complex which can then carry out the necessary repair. Likewise, gene transcription occurs through the concerted action of greater than twenty proteins.
  • Signal transduction proteins such as receptor protein kinases
  • receptor protein kinases are part of large complexes with many proteins.
  • SH2 Src homology type 2
  • Protein/protein interactions have been discovered and characterized by a variety of methods: (i) standard biochemical affinity methods such as chromatography or co-immunoprecipitations; (ii) gel overlay methods; (iii) co-purification by traditional biochemistry; and (iv) two-hybrid analysis [Fields and Song, Nature 340:245-246 (1989); Fields, Methods: A Companion to Methods in Enzymology 5: 116-124 (1993); U.S. Patent 5,283, 173 issued February 1 , 1994 to Fields, et al.]. The most recent of these approaches, the two hybrid method, has enjoyed broad application because of its relative ease of use for gene identification from cDNA fusion libraries.
  • the two hybrid system is based on targeting and identifying a protein/protein interaction through the use of a reporter system.
  • the described two hybrid systems either use the yeast Gal4 DNA binding domain or the E. coli lexA DNA binding domain and couple this region to a transcriptional activator such as Gal4 or VP16 that drives a reporter like ⁇ galactosidase or HIS3.
  • the two hybrid assay could be used for drug screening. [See WO 96/03501 and WO 96/03499.]
  • loss of ⁇ galactosidase or HIS3 activity would be identified after the yeast strain is treated with a compound.
  • use of the two hybrid system is technically undesirable for several reasons.
  • the ⁇ galactosidase or HIS3 protein arc employed as the reporter protein, a loss of activity is particularly difficult to detect because the expressed reporter protein is too long lived to be used in a high throughput mode. If a candidate binding inhibitor compound is metabolized faster than the previously expressed reporter protein is turned over, it is difficult to detect inhibitory action of the candidate drug while a reporter protein is still active.
  • the present invention provides materials that are useful for the identification of compounds which inhibit interaction between known binding partner proteins. See Figure 1.
  • the invention provides host cells transformed or transfected with DNA comprising: (i) a repressor gene encoding DNA binding protein that acts as a repressor protein, said repressor gene under transcriptional control of a promoter; (ii) a selectable marker gene encoding a selectable marker protein; said selectable marker gene under transcriptional control of an operator; said operator regulated by interaction with said repressor protein; (iii) a first recombinant fusion protein gene encoding a first binding protein or binding fragment thereof in frame with either a DNA binding domain of a transcriptional activating protein or a transactivating domain of a transcriptional activating protein; and (iv) a second recombinant fusion protein gene encoding a second binding protein or binding fragment thereof in frame with either a DNA binding domain of a transcriptional activating protein or a transactivating domain of a transcriptional activating
  • the invention comprehends host cells wherein the various genes and regulatory sequences are encoded on a single DNA molecule as well as host cells wherein one or more of the repressor gene, the selectable marker gene, the first recombinant fusion protein gene, and the second recombinant fusion protein gene are encoded on distinct DNA expression constructs
  • the host cells are transformed or transfected with DNA encoding the repressor gene, the selectable marker gene, the first recombinant fusion protein gene, and the second recombinant fusion protein gene, each encoded on a distinct expression construct.
  • each transformed or transfected DNA expression construct further comprises a selectable marker gene sequence, the expression of which is used to confirm that transfection or transformation was, in fact, accomplished.
  • selectable marker genes encoded on individually transformed or transfected DNA expression constructs are distinguishable from the selectable marker under transcriptional regulation of the tet operator in that expression of the selectable marker gene regulated by the tet operator is central to the preferred embodiment; i.e. , regulated expression of the selectable marker gene by the tet operator provides a measurable phenotypic change in the host cell that is used to identify a binding protein inhibitor.
  • Preferred host cells of the invention include transformed S. cerevisiae strains designated YI596 and YI584 which were deposited August 13, 1996 with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852, and assigned Accession Numbers ATCC 74384 and ATCC 74385, respectively.
  • the host cells of the invention include any cell type capable of expressing the heterologous proteins required as described above and which are capable of being transformed or transfected with functional promoter and operator sequences which regulate expression of the heterologous proteins also as described.
  • the host cells are of either mammal, insect or yeast origin.
  • the most preferred host cell is a yeast cell.
  • the preferred yeast cells of the invention can be selected from various strains, including the S. cerevisiae yeast transformants described in Table 1.
  • Alternative yeast specimens include S.pombe, K.lactis, P.pastoris, S.carlsbergensis and C.albicans.
  • Preferred mammalian host cells of the invention include Chinese hamster ovary (CHO), COS, HeLa, 3T3, CV1 , LTK, 293T3, Ratl , PC 12 or any other transfectable cell line of human or rodent origin.
  • Preferred insect cells lines include SF9 cells.
  • the selectable marker gene is regulated by an operator and encodes an enzyme in a pathway for synthesis of a nutritional requirement for said host cell such that expression of said selectable marker protein is required for growth of said host cell on media lacking said nutritional requirement.
  • transcription of the selectable marker gene is down-regulated and the host cells are identified by an inability to grow on media lacking the nutritional requirement and an ability to grow on media containing the nutritional requirement.
  • the selectable marker gene encodes the HIS3 protein, and host cells transformed or transfected with a HIS3-encoding DNA expression construct are selected following growth on media in the presence and absence of histidine.
  • the invention comprehends any of a number of alternative selectable marker genes regulated by an operator.
  • Gene alternatives include, for example URA3, LEU2, LYS2 or those encoding any of the multitude of enzymes required in various pathways for production of a nutritional requirement which can be definitively excluded from the media of growth.
  • reporter genes such as chloramphenicol acetyltransferase (CAT), firefly luciferase, 0-galactosidase ( ⁇ -gal), secreted alkaline phosphatase (SEAP), green fluorescent protein (GFP), human growth hormone (hGH), / S-glucuronidase, neomycin, hygromycin, thymidine kinase (TK) and the like may be utilized in the invention.
  • CAT chloramphenicol acetyltransferase
  • ⁇ -gal 0-galactosidase
  • SEAP secreted alkaline phosphatase
  • GFP green fluorescent protein
  • hGH human growth hormone
  • TK thymidine kinase
  • the host cells include a repressor protein gene encoding the tetracycline resistance protein which acts on the tet operator to decrease expression of the selectable marker gene.
  • the invention also encompasses alternatives to the tet repressor and operator, for example, E. coli trp repressor and operator, his repressor and operator, and lac operon repressor and operator.
  • the DNA binding domain and transactivating domain components of the fusion protein may be derived from the same transcription factor or from different transcription factors as long as bringing the two domains into proximity permits formation of a functional transcriptional activity protein that increases expression of the repressor protein with high efficiency.
  • a high efficiency transcriptional activating protein is defined as having both a DNA binding domain exhibiting high affinity binding for the recognized promoter sequence and a transactivating domain having high affinity binding for transcriptional machinery proteins required to express repressor gene mRNA.
  • the DNA binding domain component of a fusion protein of the invention can be derived from any of a number of different proteins including, for example, LexA or Gal4.
  • the transactivating component of the invention's fusion proteins can be derived from a number of different transcriptional activating proteins, including for example, Gal4 or VP16.
  • polynucleotides encoding binding partner proteins CREB and CBD are inserted in plasmids pVP16- CREB and pLexA-CBD, respectively, which were deposited with the ATCC and assigned Accession Numbers ATCC 98138 and ATCC 98139, respectively.
  • the promoter sequence of the invention which regulates transcription of the repressor protein can be any sequence capable of driving transcription in the chosen host cell.
  • the promoter may be a DNA sequence specifically recognized by the chosen DNA binding domain of the invention, or any other DNA sequence with which the DNA binding domain of the fusion protein is capable of high affinity interaction.
  • the promoter sequence of the invention is either a HIS3 or alcohol dehydrogenase (ADH) promoter.
  • ADH promotor is employed in the invention.
  • the invention encompasses numerous alternative promoters, including, for example, those derived from genes encoding HIS3, ADH, TJRA3, LEU2 and the like.
  • the invention provides methods to identify molecules that inhibit interaction between known binding partner proteins.
  • the invention provides a method to identify an inhibitor of binding between a first binding protein or binding fragment thereof and a second binding protein or binding fragment thereof comprising the steps of (a) growing host cells transformed or transfected as described above in the absence of a test compound and under conditions which permit expression of said first binding protein or binding fragment thereof and said second binding protein or binding fragment thereof such that said first binding protein or fragment thereof and second binding protein or binding fragment thereof interact bringing into proximity said DNA binding domain and said transactivating domain forming a functional transcriptional activating protein; the transcriptional activating protein acting on said promoter to increase expression of said repressor protein; said repressor protein interacting with said operator such that said selectable marker protein is not expressed; (b) confirming lack of expression of said selectable marker protein in said host cell; (c) growing said host cells in the presence of a test compound; and (d) comparing expression of said selectable marker protein in the presence and absence of said test compound wherein increased expression
  • the invention provides a method to identify an inhibitor of binding between a first binding protein or binding fragment thereof and a second binding protein or binding fragment thereof comprising the steps of: (a) transforming or transfecting a host cell with a first DNA expression construct comprising a first selectable marker gene encoding a first selectable marker protein and a repressor gene encoding a repressor protein, said repressor gene under transcriptional control of a promoter; (b) transfo ⁇ ning or transfecting said host cell with a second DNA expression construct comprising a second selectable marker gene encoding a second selectable marker protein and a third selectable marker gene encoding a third selectable marker protein, said third selectable marker gene under transcriptional control of an operator, said operator specifically acted upon by said repressor protein such that interaction of said repressor protein with said operator decreases expression of said third selectable marker protein; (c) transforming or transfecting said host cell with a third DNA expression construct comprising a fourth
  • the methods of the invention encompass any and all of the variations in host cells as described above.
  • the invention encompasses a method wherein: the host cell is a yeast cell; the selectable marker gene encodes HIS3; transcription of the selectable marker gene is regulated by the tet operator; the repressor protein gene encodes the tetracycline resistance protein; transcription of the tetracycline resistance protein is regulated by the HIS3 promoter; the DNA binding domain is derived from LexA; and the transactivating domain is derived from VP16.
  • the invention encompasses a method wherein: the host cell is a yeast cell; the selectable marker gene encodes HIS3; transcription of the selectable marker gene is regulated by the tet operator; the repressor protein gene encodes the tetracycline resistance protein; transcription of the tetracycline resistance protein is regulated by the alcohol dehydrogenase promoter; the DNA binding domain is derived from LexA; and the transactivating domain is derived from VP16.
  • variations include the use of mammalian DNA expression constructs to encode the first and second recombinant fusion genes, the repressor gene, and the selectable marker gene, and use of selectable marker genes encoding antibiotic or drug resistance markers (i.e. , neomycin, hygromycin, thymidine kinase).
  • antibiotic or drug resistance markers i.e. , neomycin, hygromycin, thymidine kinase.
  • libraries used for the identification of small molecule modulators. These include: (1) chemical libraries, (2) natural product libraries, and (3) combinatorial libraries comprised of random peptides, oligonucleotides or organic molecules.
  • Chemical libraries consist of structural analogs of known compounds or compounds that are identified as "hits" via natural product screening.
  • Natural product libraries are collections of microorganisms, animals plants or marine organisms which are used to create mixtures for screening by: (1) fermentation and extraction of broths from soil, plant or marine microorganisms or (2) extraction of plants or marine organisms.
  • Combinatorial libraries are composed of large numbers of peptides, oligonucleotides or organic compounds as a mixture. They are relatively easy to prepare by traditional automated synthesis methods, PCR, cloning or proprietary synthetic methods. Of particular interest are peptide and oligonucleotide combinatorial libraries. Still other libraries of interest include peptide, protein, peptidomimetic, multiparallel synthetic collection, recombinatorial, polypeptide libraries.
  • Host cells of the invention are useful to demonstrate in vivo binding capacity of both known and suspected binding partner proteins in a recombinant system. Such an expression system permits systematic analysis of the structure and function of a particular binding protein, thus permitting identification and/or synthesis of potential modulators of the physiological activity of the binding proteins.
  • the methods of the invention are particularly useful to identify and improve molecules which are capable of inhibiting specific and general protein/protein interactions. Inhibitors identified by the methods of the invention can then be examined for utility in vivo as therapeutic and/or prophylactic medicaments for conditions associated with various protein/protein interactions.
  • Figure 1 describes the mechanics of the split hybrid assays.
  • the present invention relates generally to methods designated split hybrid assays to identify inhibitors of protein/protein interactions and is illustrated by the following examples describing various methods for making and using the invention.
  • Example 1 relates to construction of various plasmids and expression constructs utilized in the invention.
  • Example 2 described generation of various yeast transformants used to identify inhibitor compounds.
  • Examples 3, 4, 5 and 6 address use of the split hybrid assay to examine CREB/CBD binding, Tax/SRF binding, CKI/CREB binding and AKAP 79 binding to various partner protein, respectively.
  • Example 7 describe general application of the split hybrid assay.
  • Example 8 relates to use of the split hybrid assay for weakly interacting binding partners.
  • Example 9 describes general assay methods.
  • Example 10 addresses use of the split hybrids assay to identify agents that prevent receptor desensitization and drug tachyphylaxis.
  • Two primary PCR reactions using pRS313 as a template were performed which utilized a 5 ' terminal oligonucleotide designated Eco47III-5' and a 3 '-inner oligonucleotide designated Tetop internal 3' to yield a primary 5'-PCR product and a 5 '-inner oligonucleotide designated Tetop internal 5 ' and a 3 '-terminal oligonucleotide designated Nhe I 3' to yield a primary 3' -PCR product.
  • 5' and 3' inner oligonucleotides contain complementary sequence such that 3' sequence of the primary 5' PCR product overlaps with 5' sequence of the primary 3' PCR product.
  • the 5' terminal oligonucleotide contains the restriction site Eco4 /lil while the 3' te ⁇ ninal oligonucleotide contains the restriction site Nliel in order to facilitate subsequent subcloning.
  • the primary PCR reactions were performed with Pfii DNA polymerase (Stratagene, La Jolla, CA) using reaction conditions described by the manufacturer. PCR products were isolated by BiolOl (Vista, CA) Gene Clean EQ gel extraction.
  • the primary 5' and 3' PCR products were then combined in a second PCR reaction and amplified using the 5'- and 3'- terminal oligonucleotides, Eco47 ⁇ i-5' and Nhe 1 3'.
  • the second PCR reaction was performed with Vent DNA polymerase (New England Biolabs, Beverly, MA) using reaction conditions described by the manufacturer, except that the reactions were supplemented with 4 mM Mg + .
  • the final PCR product contained one tet operator sequence inserted into position -53 of the HIS3 promoter and nucleotides 52-48 deleted in the construction.
  • the final PCR product was isolated, digested with Eco4im and Nliel and cloned into pRS313 previously digested with Eco lTQ.
  • the resulting plasmid was designated pRS313/ 1 xtetop.
  • DNA sequencing confirmed the presence of one copy of the tet operator sequence in pRS313/1 xtetop and confirmed integrity of the Eco4im and Nhel junctions.
  • a Mlul restriction enzyme site was engineered into position -22 in the HIS3 promoter of pRS313/1 xtetop by utilizing PCR using Vent DNA polymerase using pRS313/1 xtetop as template.
  • One PCR construct was amplified using the 5' terminal oligonucleotide Eco47 m-5' (SEQ ID NO: 1) containing an £ ⁇ 47i ⁇ restriction site and a 3 '-oligonucleotide designated Mlu I 3' containing a Mlul restriction site.
  • a second PCR product was amplified using the 3 '-terminal oligonucleotide Nhe I 3' (SEQ ID NO: 4) containing a Nhel restriction site and a 5'- oligonucleotide designated Mlu I 5' containing a Mlul restriction site.
  • the first PCR product was isolated and digested with Eco lUl and Mlul, while the second PCR product was isolated and digested with Mlul and Nhel. These digested products were isolated and ligated in a triple ligation with pRS313 previously digested with £co47I ⁇ and Nhel.
  • the resulting plasmid was designated pRS313/lxtetop-MluI.
  • DNA sequencing confirmed the presence of the MM site in pRS313/lxtetop-MluI and confirmed that integrity of the £co47III and Nliel junctions were maintained.
  • a pRS303/lxtetop-MluI plasmid was constructed by first removing the EcoAlTMNhel fragment containing the altered HIS3 promoter from the pRS313/lxtetop- M vector and ligating the isolated fragment into pRS303 previously digested with £c ⁇ 47III and Mel. DNA sequencing confirmed proper insertion of the EcoAlT ⁇ INhel fragment.
  • the tet operator was created by annealing two complementary oligonucleotides tetop- 1 and tetop-2.
  • the tet operator sequence When annealed, the tet operator sequence contains flanking Mlul sites. Both oligonucleotides were phosphorylated using T4 polynucleotide kinase (Gibco BRL, Grand Island, NY) at 37°C for one hour and annealed by first heating at 70°C for 10 minutes and then cooling to room temperature. The annealed oligonucleotides were isolated and ligated into pRS303/lxtetop- M previously digested with Mlul. The resulting plasmid was designated pRS303/2xtetop. DNA sequencing confirmed insertion of one copy of the tet operator sequence in the Mlul site.
  • T4 polynucleotide kinase Gibco BRL, Grand Island, NY
  • the LYS2 gene was digested from pLYS2 [Hollenberg, S.M. et al , Mol. Cell.BioL 15:3813-3822 (1995)] with EcoRI and Hindlll and the isolated fragment blunt ended using the large fragment of DNA polymerase I (Gibco BRL, Grand Island, NY). Phosphorylated Sstl linkers (New England Biolabs, Beverly, MA) were ligated to the fragment, the fragment digested with Sstl, and the resulting fragment ligated into pRS313 previously digested with Sstl. The resulting plasmid was designated pRS313/LYS2.
  • the LYS2 fragment was removed from pRS313/LYS2 with Sstl digestion and inserted into pRS303/2xtetop previously digested with Sstl.
  • the resulting plasmid was designated pRS303/2xtetop-LYS2.
  • the annealed oligonucleotide contained flanking Mlul sites.
  • the oligonucleotide was phosphorylated, annealed, and isolated as above.
  • the isolated annealed and M-digested oligonucleotide was ligated into pRS303/ 1 xtetop- wI-LYS2 previously digested with Mlul to yield pRS303/3xtetop-LYS2.
  • the presence of two copies of the tet operator sequence in the Mlul site was confirmed by DNA sequencing.
  • PCR products were separated on an agarose gel and the ladder of different sized DNA fragments was isolated, digested with Mlul, and ligated into the Mlul restriction site of pRS303/ 1 xtetop-MluI-LYS2.
  • DNA sequenc- ing revealed that either three or seven copies of tet operators were inserted into the Mlu site of pRS303/lxtetop- ⁇ M-LYS2 to provide either pRS303/4xtetop-LYS2 or pRS303/8xtetop-LYS2.
  • a Sphl restriction enzyme site was introduced at position -85 in the HIS3 promoter of pRS303/3xtetop-LYS2 using PCR with Vent DNA polymerase as described. Plasmid pRS303/3xtetop-LYS2 was used as a template DNA. A first fragment was amplified using the 5 '-terminal oligonucleotide Eco47 ⁇ i-5' (SEQ ID NO: 1) described above containing an EcoAim. restriction site and a 3 '-oligonucleotide Sph I 3' containing a Sphl restriction site.
  • a second PCR product was amplified using the 3 '-terminal oligonucleotide Nhe I 3' (SEQ ID NO: 4) described above containing a Nhel restriction site and a 5 '-oligonucleotide containing a Sphl restriction site.
  • Sph I 5' SEQ ID NO: 13 5'CATGGCATGCTTAGCGATTGGCATTATCACAT
  • the PCR products were isolated as described above.
  • the first PCR product was digested with Eco lTR and Sphl, and the second PCR product was digested with Sphl and Nhel. Both digestion products were ligated in a triple ligation along with pRS303/3xtetop-LYS2 previously digested with both EcoAim and Nhel.
  • the resulting plasmid was designated pRS303/3xtetop- SphI-LYS2.
  • the presence of the Sphl site in pRS303/3xtetop-SphI-LYS2 was confi ⁇ ned by DNA sequencing analysis.
  • a Mlul restriction enzyme site was engineered into position -22 in the HIS3 promoter of pRS313 utilizing PCR and Vent DNA polymerase as noted above. Plasmid pRS313 was used as a template for these PCR reactions.
  • One PCR construct was amplified using the 5 ' terminal oligonucleotide Eco47 m-5' (SEQ ID NO: 1) containing an Eco47HI restriction site and a 3 ' oligonucleotide Mlu I 3' (SEQ ID NO: 5) containing a Mlul restriction site.
  • a second PCR product was amplified using ths 3 ' te ⁇ ninal oligonucleotide Nhe I 3' (SEQ ID NO: 4) containing a Nhel restriction site and the 5 ' oligonucleotide Mlu I 5' (SEQ ID NO: 6) containing a Mlul restriction site.
  • the first PCR product was isolated and digested with Eco47m and Mlul, while the second PCR product was isolated and digested with Mlul and Nhel.
  • the digested products were partially purified and joined in a triple ligation with pRS313 which had been previously digested with Eco47Hl and Nhel.
  • the resulting plasmid was designated pRS313/MluI.
  • pRS303/MluI was constructed in exactly the same manner as pRS313/MluI except that pRS303 was used in place of pRS313.
  • pRS313/1 xtetop is an intermediate in the construction of pRS303/lxtetop-MluI.
  • tet operator sequence One copy of the tet operator sequence was created by annealing two complementary oligonucleotides tetop- 1 and tetop-2 (SEQ ID NO: 7 and SEQ ID NO: 8).
  • the annealed tet operator sequence contains flanking Mlul sites.
  • the oligonucleotides were phosphorylated using T4 polynucleotide kinase (Gibco BRL, Grand Island, NY) at 37°C for one hour and annealed by first heating at 70°C for 10 minutes followed by cooling to room temperature.
  • annealed oligonucleotides were isolated and ligated separately into Mlul- digested pRS313/MluI and pRS303/MluI, the resulting plasmids being designated pRS313/MluI- 1 xtetop and pRS303/MluI- 1 xtetop.
  • DNA sequencing confirmed the presence of one copy of the tet operator in the Mlul sites of both plasmids.
  • annealed oligonucleotides described above were ligated together overnight at 16°C. After isolation of the ligation products, they were inserted into the Mlul of pRS313/MluI. DNA sequencing analysis confirmed that one clone, pRS313/MluI-4xtetop, was produced which contained four copies of tet operator in the Mlul site. However, upon further examination of this clone it was discovered that it had been subjected to a recombination event and was therefore not useful for further cloning steps. Continued attempts to insert multiple copies of the tet operator into the Mlul site of pRS313/MluI by ligating multimers of the tet operator have been unsuccessful.
  • Annealed oligonucleotides were ligated into the Mlul site of pRS313/lxtetop-MluI to yield pRS313/2xtetop.
  • DNA sequencing confi ⁇ ned the presence of two copies of the tet operator in the Mlul site.
  • the LYS2 gene was digested from pLYS2 with Ec ⁇ RI and Hindlll digestion.
  • the EcoRI/H di ⁇ fragment was blunt ended using the large fragment of DNA polymerase I (Gibco BRL, Grand Island, NY) and ligated with phosphorylated Sstl linkers (New England Biolabs, Beverly, A).
  • the resulting fragment was digested with Sstl and ligated into pRS313 previously digested with Sstl.
  • the resulting plasmid was designated pRS313/LYS2.
  • KS2 fragment was shown to have inserted into pRS313 in both orientations
  • plasmids with the LYS2 gene in both orientations were transformed separately into the yeast strain SEY6210 ⁇ _(M47 ⁇ _ leu2- 3,112 ura3-52 his3-A200 trpl-A901 lys2-801 suc2-A9 [Robinson et al. , Mol. Cell. Biol. 8:4936-4948 (1988)]. Both clones allowed the yeast to grow in the absence of lysine indicating that orientation of the LYS2 gene in pRS313 did not affect the expression of an active gene.
  • the LYS2 fragment was removed from pRS313/LYS2 with Sstl and ligated into the Sstl site of:
  • pRS313/lxtetop-MluI giving plasmid pRS313/lxtetop-MluI-LYS2, pRS313/2xtetop giving plasmid pRS313/2xtetop-LYS2, pRS303/lxtetop-MluI giving plasmid pRS303/lxtetop-MluI-LYS2, and pRS303/2xtetop giving plasmid pRS303/2xtetop-LYS2.
  • pRS306/HIS3 TetR Tenn
  • the 5' promoter sequence of the yeast HIS3 gene encompassing nucleotides -75 to +23, was ligated to the translational start of TetR.
  • the DNA sequence encoding the simian vims 40 (SV40) large T antigen nuclear localization signal was ligated in frame with the nucleotide sequence encoding the last amino acid residue of TetR.
  • the chimeric fragment was created by the same PCR strategy as described above.
  • the HIS3 promoter fragment, the primary 5'-PCR product was amplified by PCR from plasmid p601 [Grueneberg,D.A.
  • the primary 3' PCR product containing the TetR coding sequence was amplified from pSLF104 [Forsburg, Nucl. Acid. Res. 21:2955-2956 (1993)] with a 5 '-inner oligonucleotide 5 '-TetR inner primer and a 3 '-terminal oligonucleotide 3 '-TetR terminal primer.
  • Oligonucleotides LexAop (100a) and LexAop (1 0b) containing a single copy of LexA operator were phosphorylated with T4 polynucleo ide kinase (Gibco BRL, Grand Island, NY) at 37 °C for one hour.
  • LexAop (100a) SEQ ID NO: 18 5 ' - AATTGCTCGAGTACTGTATGTAC ATACAGTAG
  • the oligonucleotides were annealed by heating at
  • oligonucleotide containing 5 ' and 3 ' EcoW overhanging ends was subcloned into pRS306/HIS3:TetR/Term previously digested with Ec ⁇ RI. The number of copies of inserted oligonucleotide was confirmed by DNA sequencing.
  • the plasmid containing a single copy of the LexA operator was designated pRS306/ lxLexAop/HIS3:TetR.
  • oligonucleotides SH101A and SH101B were utilized in PCR to amplify the LexA binding site multimer from the plasmid SHI 8-
  • SH101A SEQ ID NO: 20 5'-CCGGAATTCTCGAGACATATCCATATCTAATC
  • a PCR strategy was used to link the 5' promoter sequence of the yeast HIS3 gene encompassing nucleotides-75 to +23 to the translational start of TetR. Sequences encoding the SV40 large T antigen nuclear localization signal were fused in frame with the nucleotide sequence encoding the last amino acid residue of TetR.
  • the PCR product was digested with Ec ⁇ RI and BamHl and inserted into pRS306/Term previously digested with Ec ⁇ RI and BamHl.
  • the resulting plasmid was designated pRS306/HIS3:TetR/Term, and was shown to encode the complete TetR protein in frame with the nuclear localization signal of SV40 large T antigen.
  • the fusion protein is followed by four amino acids generated by the vector backbone (Arg-Ile-His-Asp).
  • the LexA binding site multimer from the plasmid pSH18- 34 ⁇ Spe [Hollenberg, S.M. et al. , Mol. Cell. Biol. 15:3813-3822 (1995)] was amplified by PCR, digested with Ec ⁇ 91, and subcloned into the EcoW site of pRS306/HIS3:TetR Tern ⁇ resulting in plasmid pRS306/8xLexAop/TetR.
  • TetR The DNA coding sequence of TetR was amplified by PCR from pSLF104 using two oligonucleotides, NcoI-TetR and 3'-TetR terminal primer (SEQ ID NO: 17).
  • NcoI-TetR SEQ ID NO: 22 5 ' -C ATGCC ATGGCC ATGTCTAGATTAG ATAAAAG
  • the resulting product was gel-purified, digested with Ncdl and BamHl, and subcloned into a pBTMl l ⁇ [Bartel, et al. , in Cellular Interactions in Development: a Practical Approach. Hartley (ed.), IRL Press; Oxford, pp. 153-179 (1993)] shuttle vector containing an ADH promoter, previously digested with Ncdl and BamHl.
  • TetR protein encoded from this construct is expressed containing additional amino acids Met ⁇ 2 -Ala " ' before the initiating methionine and also contains the nuclear localization signal of SV40 large T antigen located after the last amino acid of TetR as described above.
  • a fragment encoding the ADH promoter and TetR was removed from plasmid pADH/TetR with Xhol and blunted-ended with the large fragment of DNA polymerase I (Gibco BLR, Grand Island, NY). EcoSl linkers (New England BioLabs, Beverly, MA) were added and the fragment was digested with EcoW and BamHl. The resulting fragment was gel-purified and ligated into pRS306/Term previously digested with £ ⁇ ?RI and BamHl.
  • LexA operator into pRS306/ADH:TetR/Te ⁇ n was the same as described p r e v i o u s l y f o r p R S 3 06 / 4 x L e x A o p / H I S 3 : T e t R a n d pRS306/8xLexAop/HIS3:TetR. ⁇ i. Plasmids Encoding Binding Proteins
  • the amplification product was digested with EcoR and BamHl, and ligated into plasmid pBTM1 16 [Bartel, et al , in Cellular Interactions in Development: a Practical Approach, (ed) Hartley, D.A. (IRL Press. Oxford), pp. 153-179 (1993)] previously digested with EcoKl and BamHl.
  • a DNA fragment encoding the CBP sequence was excised from pLexA-CBD by digestion with £coRI and BamHl. Plasmid pLexA-CBD was linearized with Ec ⁇ 91 digestion, the resulting overhanging ends blunt-ended using the Klenow fragment of DNA polymerase I, and the ends ligated with BamHl linkers. The resulting fragment was inserted into pVP16 [Hollenberg, et al , Mol. Cell. Biol 15:3813-3822 (1995)] previously digested with into BamHl. C. pVP16 CREB
  • Plasmid pcDNA3/CREB283 [Sun and Maurer, J. Biol. Chem. 270:7041-7044 (1995)], containing the VP16 transactivation domain fused to sequences of the rat CREB transactivation domain (1 to 283 aa) was linearized with Xhol and BamHl linkers (New England BioLab) ligated to the resulting blunt-ended Xhol sites.
  • DNA encoding the VP16/CREB chimeric protein was removed with Hindlll and BamHl digestion and following gel purification, ligated into the Hind ⁇ l and BamHl sites of pVP16 which encodes the LEU2 gene.
  • a DNA fragment encoding ⁇ -galactosidase was PCR amplified from plasmid pSV- -galactosidase vector (Promega, Madison, WI) using a pair of oligonucleotides, 5 ' / 3-gal primer and 3 ' 3-gal primer and inserted into the N ⁇ tl site of pVP16 to produce pVP16-LacZ.
  • a PCR fragment containing CREB sequences encoding amino acid residues 1 to 283 was amplified from plasmid pRSV-CREB341 [Kwok, et al , Nature
  • PCR was used to engineer a BgUl site using oligonucleotides 5 ' BgUl primer and 3 ' BgUl primer, at nucleotides 273 to 278 and a Sacll site using oligonucleotides 5' SacU primer and 3' Sacll primer at nucleotides 500 to 505 of the CREB activation domain.
  • E. pT ⁇ x A-CRFR 983 A DNA fragment containing the rat CREB transactivation domain (amino acids 1 to 283) was excised from pcDNA/CREB283 [Sun and Maurer, supra] with Smal and Xbal digestion. The 5 ' Xbal site was blunt ended with the large fragment of DNA polymerase I (Gibco BRL, Grand Island, NY) and Sail linkers (New England Biolabs, Beverly, MA) added. The fragment was digested with Sail and subcloned into the Sail site of pBTMl l ⁇ .
  • a DNA fragment containing the rat CREB 341 cDNA was amplified by PCR from pcDNA/CREB341 [Kwok, supra] using a pair of oligonucleotides, 5 ' CREB 341 primer (SEQ ID NO: 25) and 3 ' CREB 341 primer.
  • the PCR product was digested with BamHl, and subcloned into the BamHl site of pBTMl l ⁇ .
  • a DNA fragment containing the rat CREB sequence with a mutation changing serine at position 133 to alanine was amplified by PCR from plasmid Rc/RSV CREB-Ml [Kwok. et al , supra] using the same set of primers as described for pLexA-CREB 341 , 5 ' CREB 341 primer (SEQ ID NO: 25) and 3 ' CREB 341 primer (SEQ ID NO: 26).
  • the resulting amplification product was gel-purified, digested with BamHl, and subcloned into the BamHl site of pBTMl 16.
  • a PCR fragment containing CREB sequences coding for amino acid residues 1 to 283 including the serine 133 mutation to alanine was amplified using a pair of oligonucleotides, 5 ' CREB 283 primer and 3 ' CREB
  • the PCR fragment was gel-purified, digested with BamHl and inserted into the BamHl site of pVPl ⁇ .
  • a DNA sequence encoding full length Tax protein was excised from pS6424 [Kwok, R.P.S., et al , Nature 380:642-646 (1996)] with Ba Hl digestion and was inserted into pVP16 previously digested with BamHl.
  • Plasmid pVP16 was digested with H dlJI and BamHl to remove the fragment encoding the VP16 transactivation domain.
  • the digested vector was blunt-ended and self-ligated.
  • the VP16 transactivation domain was PCR amplified from pGal-VP16 [Sadowski, et al , Nature 335:563-564 (1988)] with a pair of oligonucleotides, 5 -VP16S ⁇ and 3 VP16SH and the resulting amplification product was digested with Clal, blunt-ended, and inserted into pBTMl l ⁇ .
  • the alcohol dehydrogenase (ADH) terminator sequence was excised from plasmid pBTM1 16 [Bartel, et al , in Cellular Interactions in Development: a Practical Approach, (ed) Hartley, D.A. (IRL Press, Oxford), pp. 153-179 (1993)] with Sphl and Pstl restriction enzymes and both 3'- overhanging sequences were blunted by T4 DNA polymerase (Gibco BLR, Grand Island, NY). The fragment was gel-purified and subcloned into the blunt-ended Notl site in pRS306 [Sikorski and Hieter, Genetics: 122: 19-27 (1989)]. The orientation of inserted fragment was determined by DNA sequencing.
  • the subcloning protocol for inserting the ADH terminator sequence into pRS316 was the same as described for inserting the ADH sequence in pRS306.
  • Selection of an appropriate yeast assay strain is an empirical determination based on growth characteristics of the transformed alternatives.
  • a general method to make the appropriate selection is described as follows.
  • Candidate yeast assay strains were transformed individually with reporter gene constructs and/or a plasmid encoding one of the experimental binding proteins. Assay strains thus transformed were then compared for relative differences in growth characteristics, with an optimal assay strain showing negligible growth on media lacking histidine and vigorous growth on media containing histidine. In practical application of this first step in selection using various plasmids transformed into assay strain YI584, the following results were observed. When the plasmid pLexA-VP 16 encoding both the LexA DNA binding domain and the VP16 transactivating domain as a single protein was introduced into the assay cells, growth in the absence of histidine in the media was significantly reduced three days after transformation. In assays including transformation with plasmids encoding multiple copies of the tet operator upstream of the HIS3 gene, the following plasmids were separately utilized:
  • pRS303/ 1 xtetop-H/S (encoding a single tet operator sequence), pRS303/2xtetop-H/S (encoding two tet operator sequences), pRS303/3xtetop-H7S (encoding three tet operator sequences), pRS303/4xtetop-H7S (encoding four tet operator sequences), pRS303/6xtetop-H/S (encoding six tet operator sequences), pRS303/8xtetop-HJS (encoding eight tet operator sequences), or pRS303/10xtetop-H7S (encoding ten tet operator sequences).
  • Table 1 The various cell lines constructed by the methods described above are shown in Table 1 , wherein various transformed yeast strains are identified (Strain tf) along with the number of LexA operator sequences in the plasmid encoding TetR, the number of tetracycline operator sequences regulating expression of HIS3, and relative growth rate of the transfo ⁇ ned strain on media containing histidine. It is important to note that growth variation of transformed cells in media containing histidine is observed, even in cell lines identically transformed.
  • the number of " + " signs in Table 1 is indicative of the host cell's relative ability to grow on media lacking histidine in the absence of transformation with plasmids encoding potential binding proteins.
  • a subscript "a” is indicative of transformation with a plasmid bearing the alcohol dehydrogenase promoter; absence of a subscript "a” indicates use of the HIS3 promoter. Table 1
  • CBP has been shown to require the phosphorylation of the CREB serine residue at position 133 in a region designated the "kinase-inducible domain"
  • the technique used for mutagenic PCR was a modification of that described by Uppaluri and Towle [Mol. Cell. Biol. 15, 1499-1512 (1995)].
  • the reaction mixture contained 20 ng of pVP16-CREB(BgLLI-SacII)- LacZ, 16 mM (NH 4 ) 2 SO 4 , 67 mM Tris-HCI, pH 8.8, 6.
  • the resultant PCR product was gel purified, digested with BgUl and SacU, and inserted into the BgUl and Sacll sites of pVP16-CREB(BglII-SacII)- LacZ (construction of which is described above).
  • the resulting plasmids were transformed into DH5 ⁇ bacterial cells. Transformants were pooled and plasmid DNA was isolated by CsCI gradient centrifugation.
  • a DNA fragment encoding the /3-galactosidase gene was fused in frame to the carboxyl-terminal end of VP16-CREB as described above.
  • the carboxy-terniinal tag allowed identification of clones that contain frame- shift and nonsense mutations; colonies that remain positive for 3-galactosidase were presumed to contain an open reading frame throughout the mutated region.
  • a cassette version of the CREB cDNA was generated that contained BgUl and a S ⁇ cII sites flanking the 5 ' and 3 ' ends of the KID, respectively. These modifications altered the amino acid residue at position 168 from valine to alanine.
  • the cDNA altered in this manner was indistinguishable from the original VP16- CREB and from VP16-CREB-LacZ when tested in the split hybrid assay.
  • Primers complementary to regions flanking the KID were used in mutagenic PCR amplification reactions as described above under conditions which were optimized to achieve one to three mutations in the 177 bp region encoding the KID.
  • PCR products were introduced into pVPl 6-CREB( ⁇ £/II-S ⁇ cII)-LacZ in place of wild-type sequence.
  • a library of mutated sequences was transformed into yeast assay strain YI584 expressing LexA-CBD. Approximately 27,000 yeast transformants were screened, yielding about 5,000 colonies that were capable of growing on selective media supplemented with 10 ⁇ g/ml of tetracycline and 1 M of 3AT, determined as described below.
  • filter /3-galactosidase assays were performed by standard methods [Vojtek, et al , Cell 74:205-214 (1993)] on the 5,000 colonies which exhibited positive growth on media lacking tryptophan, histidine, uracil, leucine, and lysine to eliminate expressed proteins having frame-shift and nonsense mutations. Five hundred thirty six colonies developed a dark blue color, whereas 412 colonies turned white and were presumed to express mutants containing either frame-shift or nonsense mutations. The other colonies developed a pale blue color, and control experiments suggested that these colonies may have expressed unstable lacZ fusion proteins. Pale blue colonies were not analyzed further.
  • DNA from 536 dark blue colonies was isolated and transformed into E.coli MC1066 cells.
  • One hundred ninety three pVP16-CREB-(Bgi ⁇ - SacIT)-LacZ cDNAs were then isolated.
  • the 193 cDNAs were separately re- transformed along with pLexA-CBD into the split-hybrid strain as well as into the two-hybrid L40 strain [Vojtek, et al. , supra] in order to identify false positives and confi ⁇ n that the mutant CREB proteins did not interact with CBP.
  • 152 did not interact with CBP in the yeast two-hybrid system, 15 interacted weakly, and 26 interacted like wild type CREB.
  • the 152 CREB mutants were sequenced. Seventy CREB mutants were found to contain a single amino acid change. Sixty four CREB mutants contained two amino acid residue mutations and 13 mutants contained more than two amino acid mutations. Mutants containing more than one amino acid alteration were not analyzed further. The expression level of mutant proteins having one amino acid change were determined using a standard ⁇ -galactosidase assay. The CREB mutations identified in the split-hybrid screen were shown to carry amino acid changes centered around the phosphorylation site at serine at position 133. No disrupting mutations were found to contain amino acid alterations outside of the region between amino acids 130 to 141.
  • arginine residues in the phosphorylation site are critical for electrostatic interactions with acidic amino acid residues in the catalytic subunit of PKA [Knighton, et al , Science 253, 414-420 (1991)], and consistent with this observation.
  • CREB mutants with changes at arginine residues 130 and 131 were identified in the split hybrid assay that did not interact with CBP. Results also showed that CREB mutations at amino asids proline at residue 132 and tyrosine 134 were unable to bind CBP. It is likely that the mutations at these residues adversely affect the structure of the phosphorylation motif, although these positions are generally thought to be less critical to CBP binding.
  • PKA protein substrates containing a phosphorylatable threonine residue are known to exist in nature (i.e. , protein phosphatase inhibitor 1 and yelin basic protein), although they are less common than those with phosphorylatable serines [Zetterqvist, et al. , in Peptides and Protein Phosphorylation. (ed.) Kemp, B.E.
  • the second category of mutations were identified adjacent the PKA phosphorylation motif.
  • Amino acids isoleucine at position 137 and leucine at position 138 have previously been suggested to be important for hydrophobic interactions of CREB with CBP [Parker, et al. , Mol. Cell. Biol 16, 694-703 (1996)].
  • most of the mutations at position 137 and 138 converted these hydrophobic residues to polar amino acids.
  • changes at these positions affect protein folding.
  • the mutation at position 141 substituted a polar residue for the wild-type hydrophobic leucine, and this mutation also has the potential to affect protein folding.
  • Hrr25 In another example of use of the split hybrid assay to examine protein/protein interactions, Hrr25, a yeast casein kinase isofo ⁇ n, or human casein kinase I isoform ⁇ , was employed in the assay with a known binding partner protein. Previous work using the two hybrid assay had identified three genes encoding proteins which interact with the yeast casein kinase isoform Hrr25. Proteins encoded by the genes were designated TEH1 , TIH2, and TEH3. The Hrr25 expression construct which was generated for use in the two hybrid assay was used in combination with the individual TIH encoding constructs in the split hybrid assay to determine if interaction between the binding partners would decrease growth of assay yeast cells on media lacking histidine. Construction of the Hrr25 expression plasmid and isolation of plasmids encoding TEH proteins is discussed below.
  • plasmid library encoding fusions between the yeast GAL4 activation domain and S. cerevisiae genomic fragments (“prey” components) was screened for interaction with a DNA binding domain hybrid that contained the E. coli lexA gene fused to HRR25 ("bait" component).
  • the fusions were constructed in plasmid pBTM1 16 which contains the yeast TRPl gene, a 2 ⁇ origin of replication, and a yeast ADHI promoter driving expression of the E. coli lexA protein containing a DNA binding domain (amino acids 1 to 202).
  • Plasmid pBTM1 16: :HRR25 encoding the lexA: :HRR25 fusion protein was constructed in several steps.
  • the DNA sequence encoding the initiating methionine and second amino acid of HRR25 was changed to a Smal restriction site by site-directed mutagenesis using a MutaGene mutagenesis kit from BioRad (Richmond, California).
  • the DNA sequence of HRR25 is set out in SEQ ID NO: 39.
  • the oligonucleotide used for the mutagenesis is set forth below, wherein the Smal site is underlined.
  • the resulting altered HRR25 gene was ligated into plasmid pBTMl l ⁇ at the Smal site to create the lexA: :HRR25 fusion construct.
  • Strain CTY10-5d was first transformed with plasmid pBTM116: :HRR25 by lithium acetate-mediated transformation [Ito, et al , J.Bacteriol. 153: 163-168 (1983)]. The resulting transformants were then transformed with a prey yeast genomic library prepared as GAL4 fusions in the plasmid pGAD [Chien, et al , Proc.NatlAcad.Sci (USA) 27:9578-9582 (1991)] in order to screen the expressed proteins from the library for interaction with HRR25.
  • a total of 500,000 double transformants were assayed for ⁇ -galactosidase expression by replica plating onto nitrocellulose filters, lysing the replicated colonies by quick-freezing the filters in liquid nitrogen, and incubating the lysed colonies with the blue chromogenic substrate 5-bromo-4-chloro-3-indolyl-/3-D-galactoside (X-gal) .
  • 3-galactosidase activity was measured using Z buffer (0.06 M Na 2 HPO 4 , 0.04 M NaH 2 PO 4 , 0.01 M KC1, 0.001 M MgSO 4 , 0.05 M / 8-mercaptoethanol) containing X-gal at a concentration of 0.002 % [Guarente, Meth. Enzymol. 707.181-191 (1983)]. Reactions were terminated by floating the filters on 1M Na 2 CO 3 and positive colonies were identified by their dark blue color.
  • Library fusion plasmids that conferred blue color to the reporter strain co-dependent upon the presence of the HRR25/DNA binding domain fusion protein partner (bait construct) were identified.
  • the sequence adjacent to the fusion site in each library plasmid was determined by extending DNA sequence from the GAL4 region. The sequencing primer utilized is set forth below.
  • DNA sequence was obtained using a Sequenase version II kit (US Biochemicals, Cleveland, Ohio) or by automated DNA sequencing with an ABI373A sequencer (Applied Biosystems, Foster City, California).
  • TEH proteins 1 through 4 for Targets Interacting with HRR25-like protein kinase isoforms.
  • the TEH1 portion of the TEH1 c lone insert corresponds to nucleotides 1528 to 2580 of SEQ ID NO: 40; the TEH2 portion of the TEH2 clone insert corresponds to nucleotides 2611 to 4053 of SEQ ID NO: 41 ; and the TIH3 portion of the TEH3 clone insert corresponds to nucleotides 248 to 696 of SEQ ID NO: 42.
  • TIH1 and TEH3 were novel sequences that were not representative of any protein motif present in the GenBank database (July 8, 1993).
  • TEH2 sequences were identified in the database as similar to a yeast open reading frame having no identified function. (GenBank Accession No. Z23261 , open reading frame YBL0506)
  • Hrr25/TIH3 binding previously determined to be weaker than Hrr25/TEH2 or Hrr25/TEH1 interactions, produced the lowest level of growth in the transformed yeast strain.
  • CKI ⁇ /L40 MAT a his3 ⁇ 200 trpl-901 leu2-3 1 12 ade2 LYS::(lexAop) 4 HIS3 URA3::(lexAop) 8 - lcZ GAL 4).
  • CKI ⁇ /L40 was subjected to a large scale transformation with a cDNA library made from mouse embryos staged at days 9.5 and 10.5.
  • an anchoring protein for the cAMP dependent protein kinase was utilized separately with binding partner proteins including the cAMP protein kinase regulatory subunit type I (Rl), the cAMP dependent protein kinase regulatory subunit type II (RH) or calcineurin (CaN). Plasmids used in the assay were constructed as described below .
  • Plasmid pAS 1 is a 2 micron based plasmid with an ADH promoter linked to the Gal4 DNA binding subunit [amino acids 1-147 as described in Keegan et al. , Science. 231 : 699-704 (1 86)], followed by a hemagglutin (HA) tag, polyclonal site and an ADH terminator.
  • the expressed protein was therefore a fusion between AKAP 79 and the DNA binding domain of Gal4.
  • Plasmids encoding Rl, RU or CaN were isolated from a pACT murine T cell library in a standard two hybrid assay using the AKAP 79 expression construct described above. Plasmid pACT is a leu2, 2 micron based plasmid containing an ADH promoter and terminator with the Gal4 transcription activation domain II [amino acids 768-881 as described in Ma and Ptashne, Cell, 48:847-853 (1987)], followed by a multiple cloning site. Rl, RU and CaN encoding plasmids were isolated as described below.
  • LiSORB 100 mM lithium acetate, 10 mM Tris pH8, 1 M EDTA pH8, and 1 M Sorbitol
  • the DNA was prepared for transformation by boiling 400 ⁇ l 10 mg/ml salmon sperm DNA for 10 minutes after which 500 ⁇ l LiSORB was added and the solution allowed to slowly cool to room temperature.
  • DNA from a Mu T cell library was added (40-50 ⁇ g) from a 1 mg/ml stock.
  • the iced yeast cell culture was dispensed into 10 Eppendorf tubes with 120 ⁇ l of prepared DNA. The tubes were incubated at 30°C with shaking at 220 RPM. After 30 minutes, 900 ⁇ l of 40% PEG 3350 in 100 mM Li acetate, 10 mM Tris, pH 8, and 1 mM EDTA, pH 8, was mixed with each culture and incubation continued for an additional 30 minutes.
  • the samples were pooled and a small aliquot (5 ⁇ l) was removed to test for transformation efficiency and plated on SC-Leu-Trp plates. The remainder of the cells were added to 100 ml SC-Leu-T ⁇ -His media and grown for one hour at 30 °C with shaking at 220 RPMS.
  • Harvested cells were resuspended in 5.5 ml SC-Leu-T ⁇ -His containing 50 mM 3AT (3-amino triazole) media and 300 ⁇ l aliquots plated on 150 mm SC-Leu-T ⁇ -His also containing 50mM 3AT. Cell were left to grow for one week at 30 °C.
  • the library was rescreened using the same AKAP 79 bait and fifteen positives were detected from approximately 520,000 transformants. Of these fifteen, eleven were found to be homologous to the rat regulatory subunit type I of PKA. Each of these isolates were fused to the 5' untranslated region of Rl and remained open through the initiating methionine.
  • a plasmid was first constructed for expression of a LexA:AKAP 79 fusion protein.
  • An AKAP 79 coding region was excised from pAS AKAP 79 as an Ncoll BamHl fragment and inserted into pBTM 116 previously digested with the same enzymes.
  • the resulting plasmid was designated pBTMl 16-AKAP79.
  • W303 yeast cells (strain YI665, see Table 1) in logarithmic growth were rinsed in media lacking histidine, suspended in 100 ⁇ l to 200 ⁇ l of the same media, and plated on agar lacking histidine (to select for absence of protein/protein interaction) and also lacking leucine and tryptophan (to select for transformants bearing expression constructs encoding AKAP 79 and its binding partner).
  • RII was employed as the AKAP 79 binding partner
  • 2 to 4 ⁇ M tetracycline and 5 mM 3AT were required to prevent the transformed host from growing under conditions where the expressed proteins interacted.
  • the inhibitor compound is added to the agar over a range of concentrations. Ideally, the compound is diluted to the point that host cell growth is essentially not detectable.
  • a 96 well plate is used and the compounds of interest are serially diluted across one row of a 96 well plate, one compound per row.
  • Media lacking histidine, tryptophan, and leucine is added (presuming that the expression plasmids encoding the binding partners also encode t ⁇ and leu proteins) along with the appropriately transformed host yeast strain.
  • Tetracycline and 3AT are added at concentration previously determined to extinguish growth of the transformed host cell.
  • the plate wells are read at approximately 600 n using a plate reader. The concentration of inhibitor half way between zero and the lowest concentration that permits growth of the host cell to the level observed on media containing histidine is estimated to be IC 50 .
  • a modification of this second method is particularly amenable for use in a high throughput screen of large numbers of candidate inhibitors. For example, rather than attempting to determine the IC 50 for a previously identified inhibitor, separate candidate inhibitors are added to each well of a 96 well plate, preferably at more than one concentration, and host cell growth determined after several days incubation. Inhibitory activity of compounds identified in this manner is confi ⁇ ned on an agar plate and the IC 50 dete ⁇ nined on 96 well plates, each assay as described above.
  • A. Yeast Assay Strain Construction Yeast transformants used in assays indicated below were derived from LYS2-deficient strains AMR69 (Mat a his3 lys2 leu2 trpl, URA3:LexA::LacZ) and AMR70 (Mat a his3 lys2 trpl leu2, URA3:LexA::LacZ) [Hollenberg, et al., Mol. Cell. Biol 15, 3813-3822 (1995); Chien, et al , Proc. Natl. Acad. Sci. (USA) 88:97578-9582 (1991); Fields and Song, Nature 340:245-246 (1989)].
  • Yeast were grown in YEPD or selective minimal medium using standard conditions [Sherman, F. , et al. , Methods in Yeast Genetics. Cold Spring Harbor Lab., Cold Spring Harbor, NY (1986): Methods in Enzymology, Vol. 194 Guide to Yeast Genetics and Molecular Biology. Eds. Christine and Fink]. Derivatives of both AMR69 and AMR70 strains lacking URA3 were first generated by streaking cells on synthetic media containing 5 mg/ml 5-fluoro-orotic acid (5FOA) [Methods in Enzytnology , Vol. 194 Guide to Yeast Genetics and Molecular Biology. Eds. Christine and Fink].
  • 5FOA 5-fluoro-orotic acid
  • URA3 deficient mutants Two URA3 deficient mutants were required due to the fact that these strains were subsequently mated. URA3 -deficient colonies were confirmed by testing for uracil auxotrophy and deletion of the URA:LexA: :LacZ locus was confirmed by an absence of / 8-galactosidase activity assayed by standard methods. The mutant strains selected were designated 69-4 and 70-1.
  • pRS306/8xLexAop/TetR Targeted integration of pRS306/8xLexAop/TetR was carried out by transforming [Hollenberg, et al , Mol Cell. Biol. 15, 3813-3822 (1995)] the 69-4 strain with plasmid linearized at a unique Ncol site.
  • the reporter gene construct was constructed using parental plasmid pRS306 which encodes URA3 as a selectable marker. Stably integrated plasmid thereby permitted selection on media lacking uracil.
  • the positive uracil prototrophic strains were examined by Southern analysis to confirm insertion of the plasmid sequences.
  • the AMR69 derivative strain (MAT a) containing the pRS303/2xtetop-LYS insertion was mated with the AMR70-derivative strain (MAT a) containing pRS306/8xLexAop/TetR and mated cells were selected on media lacking both lysine and uracil. Single colonies were grown up> and tested for the ability to grow on media lacking histidine. The resulting strain was designated YI584. In instances where yeast strains were transformed with other reporter gene pair combinations, the strains were uniquely designated. Yeast bearing integrated reporter gene constructs were subsequently transformed [Hollenberg, et al , supra] with plasmids encoding chimeric binding protein.
  • Plasmids encoding the LexA DNA binding region were generally derived from parental plasmid pBTMl l ⁇ which also encodes TRPl as a selectable marker. Plasmids encoding the VP16 transactivating domain were generally derived from parental plasmid pVP16 which also encodes LEU2 as a selectable marker. Yeast cells which were successfully transformed with the four exogenous plasmids were therefore selected by an ability to grow on media lacking lysine, uracil, tryptophan, and leucine. Plasmids encoding various binding proteins were transformed into the yeast assay strain as indicated below.
  • the utility of the split-hybrid assay was first determined using well characterized binding proteins and various controls.
  • YI584 cells were transformed with plasmids pLexA-VP16 and pLeu. While the expressed proteins from the two plasmids do not interact, pLexA-VP16 encodes a fusion protein containing the VP16 activation domain fused directly to LexA which contains a DNA binding domain.
  • the chimeric LexA-VP16 protein is a strong transactivator for a promoter containing LexA operators.
  • Plasmid pLeu is essentially a blanJk used as a control co-transformation plasmid.
  • Yeast transformed with the Lex A- VP 16 plasmid were able to express TetR protein as indicated by gel shift analysis using a tet operator oligonucleotide.
  • the cells were unable to grow on media in the absence of histidine.
  • these observations suggested that overexpressed TetR protein was capable of binding to tet operators and preventing the expression of HIS3.
  • the transformed yeast grew on plates containing histidine, further indicating that overexpression of TetR did not have a toxic effect on the assay cells.
  • the results were consistent with previous observations and supported the earlier suggestion that activation of TetR expression, either through a single transcription factor or association of individual transcription factor domains, is capable of preventing assay cell growth on media lacking histidine, presumably by eliminating HIS3 production.
  • Protein/protein interaction was examined in the split-hybrid assay to determine utility of the system using two fusion proteins known to interact weakly.
  • the binding proteins were a 283 amino acid fragment of a cAMP regulatory binding protein (CREB283) fused to LexA and a fragment of the CREB binding protein consisting of the CREB binding domain (CBD) fused to VP16.
  • CREB283 cAMP regulatory binding protein
  • CBD CREB binding domain
  • yeast strain YI584 described above was employed and transformation carried out as previously described.
  • plasmids pLexA-CREB and pVP16-CBD were transformed into the cells and cell growth was observed in the absence of histidine in the media. Expression of the fusion proteins was confi ⁇ ned by Western blotting. Attempts to decrease cell growth by titration with 3AT were unsuccessful in that the concentration of 3AT required to reduce growth in cells transformed with pLexA-CREB and pVP16-CBD also eliminated growth in cells transformed with pLexA-CREB and the control plasmid pVP16.
  • TetR will be expressed and growth of the assay strain media lacking histidine will be depressed proportional to the level of TetR expression.
  • the initially transformed assay yeast strains arc grown in the presence of increasing concentrations of tetracycline which binds to the TetR gene product and prevents TetR binding to the tet operator.
  • the cells are transformed with the second plasmid encoding the second fusion binding protein.
  • growth of each candidate assay strain is examined on media in the presence and absence of histidine.
  • a desirable yeast assay strain is chosen which shows vigorous growth in the presence of histidine and negligible growth on media lacking histidine (indicative of the expected protein/protein interaction and resultant decreased expression of HIS3).
  • TetR expression may not be sufficiently increased to abolish HIS3 expression and cells expressing the resultant low levels of HIS3 will still grow on media which lacks histidine.
  • Cells which show this low level of viability are grown in the presence of increasing concentrations of 3- aminotriazole (3 AT), a competitive inhibitor in the histidine synthesis pathway, in order to reduce cell growth to negligible levels when plated on media lacking histidine.
  • 3-AT 3- aminotriazole
  • addition of 3AT to the media is designed to increase the signal-to-noise ratio by providing significant changes in growth in the presence and absence of histidine in the media.
  • CBP CREB binding protein
  • tetracycline was able to relieve growth repression in a dose dependent manner, and at increasing concentrations of tetracycline, the difference in growth between the two colonies was increasingly magnified, with the most distinct growth difference observed following addition of tetracycline at 10 ⁇ g/ml. Addition of tetracycline was therefore able to overcome the intrinsic transactivating capability of the LexA- CBD fusion protein. Because the ultimate use of the split-hybrid system is for structure-function studies, mutagenesis studies, drug identification and library screens, it is important to minimize background growth that might be confused with disrupted protein-protein associations. This can be accomplished by the addition of 3AT, a competitive inhibitor of the HIS3 gene product.
  • the yeast strain transfonned with pLexA-CBD and pVP16-CREB still conferred approximately 12% growth of that observed in the presence of his + media.
  • increasing concentrations of 3 AT were added to the media in the presence of 10 ⁇ g/ml of tetracycline.
  • the growth of the yeast strain expressing LexA-CBD and VP16-CREB was below 5 % , while the growth of the control strain was still maintained at 70% of control levels.
  • a number of control experiments can be employed which lend insight into expression of a desired protein from the transformed plasmid.
  • standard immunological methodologies i.e. , immunoprecipitation, ELISA, etc.
  • ELISA ELISA
  • a variation of the gel shift assay can be used to determine both if a protein is expressed and if the expressed protein is capable of DNA binding.
  • a yeast extract is required which can be prepared as follows.
  • Extracts were prepared as described by Uppaluri and Towle [Mol Cell. Biol. 15: 1499-1512 (1995)] and were used for electrophoretic mobility shift assays as discussed below.
  • Cells were harvested and washed with 5 ml of EB (containing 0.2 M Tris-HCI, pH 8.0, 400 mM (NH 4 ) 2 SO 4 , 10 mM MgCl 2 , 1 mM EDTA, 10% glycerol, and 7 mM ⁇ - mercaptoethanol).
  • Cells were transferred to microcentrifuge tubes and collected by centrifugation. After resuspending in 200 ⁇ l EB containing 1 mM phenylmethylsulfonyl fluoride (PMSF), l ⁇ g/ml leupeptin, and l ⁇ g/ l pepstatin, a one-half volume of glass beads was added. The suspension was frozen in a -80°C freezer for 1 hour and thawed on ice. Thawed cells were vortexed at 4°C for 20 minutes, after which an additional 100 ⁇ l EB was added, and cells were left on ice for 30 minutes.
  • PMSF phenylmethylsulfonyl fluoride
  • the suspension was centrifuged for 5 minutes, the supernatant was transferred to a new tube which was centrifuged for 1 hour in a microcentrifuge. The supernatant was then made to 40% with (NH 4 ) 2 SO 4 and gently rocked for 30 minutes. After a 10 minute centrifugation, the pellet was resuspended in 300 ⁇ l of 10 M HEPES, pH 8.0, 5 mM EDTA, 7 mM ,3-mercaptoethanol, 1 mM PMSF, 1 ⁇ g/ml leupeptin, and 1 ⁇ g/ml pepstatin, and 20% glycerol. The resulting suspension was dialyzed against the same buffer, and aliquots were stored at - 80°C.
  • Electrophoretic mobility shift assays were performed as described by
  • Double- stranded tet operator oligonucleotides were prepared by combining equivalent amounts of complementary single-stranded DNA (SEQ ID NOS: 7 and 8) in a solution containing 50 mM Tris-HCI, pH 8.0, 10 mM MgCl 2 , and 50 mM NaCl 2 , heating the mixture to 70°C for 10 minutes, and then cooling to room temperature.
  • the annealed oligonucleotides were labeled by filling in overhanging 5 ' ends using the Klenow fragment of E. coli DNA polymerase I with [ ⁇ - 2 P]dCTP.
  • Binding reactions were carried out in 20 ⁇ l containing 10 mM Tris-HCI, pH 7.5, 50 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 5 % glycerol, and 2 mg of poly[d(I C)].
  • a typical reaction contained 20,000 cpm (0.5-1 ng) of end-labeled DNA with 3-5 ⁇ g of yeast extract. Following incubation at 22°C for 30 minutes, samples were separated on a 4.5 % nondenaturing polyacrylamide gel containing 50 M Tris, 384 mM glycine, and 2 mM EDTA, pH 8.3.
  • homologous desensitization The coupled mechanisms of activation and deactivation together have been termed “homologous desensitization, " while the inability of a drug to maintain its efficacy is known as “tachyphylaxis. " Even though the mechanisms underlying homologous desensitization have been worked out in great detail over the past few years, there are currently no useful pharmacological approaches available that prevent the inactivation mechanism. The potential clinical utility of agents that could prevent or modulate drug desensitization is enormous.
  • G protein-coupled receptor desensitization involves three classes of proteins including arrestins, kinases and G- proteins, all of which have been cloned [Lefkowitz, Nature Biotechnology 14:283-286 (1996)]. Following activation of a seven transmembrane receptor, a region is phosphorylated by one or more G protein-coupled receptor kinases (known as GRKs 1-6).
  • GRKs 1-6 G protein-coupled receptor kinases
  • the cytoplasmic tail is phosphorylated
  • jSAR / 3-adrenergic receptor
  • rhodopsin the cytoplasmic tail is phosphorylated
  • ⁇ ARK appears to be targeted to the membrane by association with G protein ⁇ y subunits [Pitcher, et al. , Science 257: 1264-1267 (1992); Inglese, et al , Nature 359: 147-150 (1992)].
  • the substrate receptor for each kinase is activated, presumably by ligand binding, the kinase associates and phosphorylates serine and threonine residues on the receptor.
  • the phosphorylated receptor then becomes a binding target for one or more other proteins.
  • phosphorylation allows binding of arresting which prevents association with G proteins and promotes receptor sequestration and desensitization.
  • the split hybrid system can be used to identify small molecules that: (i) prevent interaction between 0ARK and the G protein ⁇ subunit; (ii) inhibit 3ARK activity; and (iii) disrupt the ⁇ ARK: arresting complex.
  • the study of G-protein receptor kinases in the split-hybrid system involves three or more recombinant proteins or two or more recombinant proteins and a recombinant peptide library.
  • two yeast primary expression plasmids are employed: pBTM1 16 [Bartel et al , Cellular Interactions in Development: a Pracdcal Approach, (ed) Hartley, IRL Press, Oxford, pp. 153-179 (1993)], which encodes the LexA-fusion protein and the TRPl selectable marker, and pVP16 [Hollenberg et al.
  • a DNA fragment comprising the ADH promoter and LexA sites, the TetR encoding gene, the nuclear localization signal, and the ADH te ⁇ ninator sequence are removed from pRS306/4xLexAop/ ADH: : TetR with Sad, blunt-ended, and digested with Sail.
  • the fragment is isolated and ligated into pRS303/2xtetop-LYS2 which has previously been digested with Noil, blunt-ended, and digested with Sail.
  • the resulting plasmid, designated pDRM is integrated into the LYS2 locus in the yeast genome as described above, and the resulting strain designated YIDRM. Placing the repressor gene and selectable marker reporter gene in the LYS2 locus allows ERA3 to be used a selectable marker.
  • Plasmid pRS426 is further modified in the following manner:
  • the ADH promoter sequence is amplified by PCR from BTM116 using primers which inco ⁇ orate into the amplification product the DNA sequence encoding the SV40 large T antigen nuclear localization signal (NLS) and an initiating ATG sequence 3' to the ADH promoter.
  • the ADH promoter/NLS/ATG sequence is inserted into the polylinker of pRS426.
  • the ADH terminator sequence is amplified by PCR from BTM 1 16 using primers which inco ⁇ orate into the product a DNA sequence encoding an antibody tag, for example, FLAG, hemagglutinin protein (HA), or thioredoxin (Thio) (FLAG, HA, and Thio antibodies are available through Santa Cruz Biotechnology, Santa Cruz, CA) and DNA sequences encoding stop codons in all three frames to the 5 ' end of the ADH terminator sequence.
  • the antibody tag/stop codon/ADH terminator sequence is inserted into the polylinker of pRS426.
  • PCR is used to engineer unique restriction sites, including for example, BgtH, Eco47 ⁇ l, Mlul, Nhel, and Sphl, immediately adjacent the 5' and 3' ends of the URA3 cassette in pRSURA3.
  • the URA3 cassetle is digested from pRSURA3 and replaced with the ADE2 cassette which is amplified by PCR.
  • Plasmid pBTM1 16/AD4 A fragment containing the ADH promoter, polylinker, and
  • ADH terminator is digested from pAD4 [Young et al. , Proc. Nat 'I Acad. Sci. (USA), S6V7989-7993 (1989)] with BamHl, blunt-ended and inserted into the blunt-ended Pvul site of BTM1 16 as described [Keegan et al , Oncogene, 72.1537-1544 (1996)], and the resulting vector designated pBTM116/AD4.
  • PCR is also used to engineer a nuclear localization signal 3' of the ADH promoter as described above.
  • This vector contains the TRPl selectable marker and can encode two recombinant proteins: (i) a LexA-fusion protein and (ii) a protein expressed from the pAD4 region of the vector.
  • a DNA fragment containing the entire coding sequence of G ⁇ [Fong et al , Proc. Nat'l Acad. Sci.
  • Split-hybrid yeast strains containing /3ARK and G/3 2 subunits are used to screen libraries of small molecules.
  • small molecule libraries can be examined in the split-hybrid assay, including for example, chemical libraries, libraries of products naturally produced by microorganisms, animals, plants and/or marine organisms, combinatorial, recombinatorial, peptidomimetic, multiparallel synthetic collection, protein, peptide and polypeptide libraries.
  • a library of small peptides can be cloned into pRSURA3 as described [Yang et al , Nuc. Acids Res. , 23:1 152-1156 ( 1995) and Colas et al. , Nature, iSO/548-550)] .
  • P-GR phosphorylated G-protein coupled receptor
  • a DNA fragment contaming the carboxy-terminal tail of the / 3 2 AR is PCR amplified [Kolbilka et al , JBC, 262.7321-7327 (1987)] and the gel purified product inserted into pBTM116/Ad4 to produce a LexA-/3 2 AR fusion gene.
  • the resulting plasmid is designated pBTM- / 3 2 AR/AD4.
  • a DNA fragment containing the third cytoplasmic loop of the human m2 muscarinic receptor is amplified from pGEX-I3m2 [Haga et al , JBC, 269.
  • pBTM-m2/AD4 The entire bovine /3ARK1 coding sequence [Benovic et al. , Science, 246:235- 240 (1989)] is PCR amplified and cloned into the polylinker region originating from AD4 in pBTM- / 8 2 AR/AD4 and pBTM-m2/AD4.
  • the resulting plasmids are designated pBTM-/3 2 AR/AD4- / 3ARK and pBTM-m2/AD4-/?ARK, respectively.
  • PCR is used to amplify the DNA fragment containing bovine /3arresting- 1 (amino acids 1 to 437) [Lohse, et al , Science, 248: 1547- 1550 (1990)]. This fragment is inserted into pVP16 and is designated pVP16- ⁇ arresting- 1. PCR is used to amplify the DNA fragment containing rat j3arresting-2 (amino acids 1 to 428) [Attramadal, et al , JBC, 267:17882- 17890 (1992)] which is inserted into pVPl ⁇ to give plasmid pVP16-j3arresting- 2.
  • a PCR strategy is also used to clone arresting into the pBTM116/AD4- 0ARK plasmid and the /3AR and m2 fragments into pVP16.
  • the yeast split-hybrid YIDRM strain is transfo ⁇ ned with the P-GR-arresting along with peptide libraries (cloned into pRSURA3) or grown following transfo ⁇ nation in the presence of combinatorial drug libraries.
  • Inhibitors identified in the split hybrid assay should effect disruption of protein/protein interaction either by: (i) inhibiting 0ARK phosphorylation of the receptor, thus preventing recognition of the receptor by arresting, or (ii) by physical disruption of binding between the receptor and arresting.
  • Agents that allow yeast growth for trivial reasons, i.e. , tetracycline analogues, can be easily identified through use of simple controls.
  • cytoplasmic /3ARK enzyme must be targeted to the substrate receptor and, once targeted, must phosphorylate the receptor at appropriate sites.
  • ⁇ y association serves to target ⁇ ARK to the cell membrane; the ⁇ subunit binds to both the ⁇ ARK PH domain and the isoprenylated y subunit in association with the membrane.
  • One possible means to encourage the necessary specific interactions is to target the binding components in the assay by tagging the proteins with nuclear localization signals, i.e. , /3ARK , the receptor cytoplasmic tail, and arresting, to the nucleus.
  • the plasmids proposed for the study of the P-GR-arresting interaction all contain nuclear localization signal sequences adjacent to recombinant gene sequence.
  • a second problem is somewhat more difficult to approach.
  • the current model is that receptors must be activated by ligand binding before being phosphorylated by ⁇ ARK, i.e. , targeting of ⁇ ARK via ⁇ y is not sufficient for receptor phosphorylation. There are two possible explanaiions for this requirement. The first is that phosphorylation sites on the receptor are masked in the absence of ligand and ligand binding causes a conformational change which "unmasks" the phosphorylation sites.
  • a fragment of the receptor containing the immediate phosphorylation site may be used as the 3ARK target.
  • peptides representing portions of the ⁇ AR cytoplasmic tail can be phosphorylated by ⁇ ARK, the; K m for the phosphorylation reaction is poor, suggesting that the kinase may require some other part of the receptor for binding and that the unmasking of this binding site by agonist is a critical step.
  • the m2 muscarinic receptor is used in place of the ⁇ AR in view of previous results which indicate that the m2 protein is a good substrate for ⁇ ARK.
  • the Ihird cytoplasmic loop of the m2 receptor serves as both the binding site and phosphorylation site for kinase and which should allow use of a LexA/m2 receptor third cytoplasmic loop fusion gene as one component in the screening system.
  • An alternative approach is to artificially mimic the activated state of the receptor. Haga, et al. [J. Biol Chem.
  • mastoporan a bee venom peptide.
  • Mastoporan is believed to mimic the cytoplasmic face of an activated receptor and has been shown to increase the affinity of /3ARK for a GST-m2 receptor fusion protein by over four orders of magnitude. The same effect can be seen by using peptides representing the flanking regions of the m2 third cytoplasmic loop.
  • mastoporan should also activate ⁇ ARK in the two-hybrid yeast strains, allow phosphorylation of the receptor fusion protein, and promote interaction with arresting.
  • oligonucleotides containing the coding and non-coding nucleotide sequences of the 14-mer peptide are annealed and ligated into prSADE2.
  • the yeast split-hybrid strain YIDRM is transformed with pBTM-/3AR (or m2)/AD4- ⁇ ARK, pVP16-arresting, pRSADE2-masto ⁇ aran, and a pRSURA3-peptide library or combinatorial drug library.
  • MOLECULE TYPE DNA (x ⁇ ) SEQUENCE DESCRIPTION: SEQ ID NO : 6 : CGCACGCGTA TACTAAAAAA TGAGCAGGCA AG 32
  • MOLECULE TYPE DNA
  • SEQUENCE DESCRIPTION SEQ ID NO: 28:
  • GAGTATCACA ACGACCACTT GTTCGATTGG ACAATGTTGC GTTACACAAA GGCGATGGTG 900
  • GAGAAGCAAA GGGACCTCCT CATCGAAAAA GGTGATTTGA ACGCAAATAG CAATGCAGCA 960
  • CAA GGT AAA AAT TAC AAA ATA TTT TTG ATA TCT GGT GTT TCA GAA GTC 1359 Gin Gly Lys Asn Tyr Lys He Phe Leu He Ser Gly Val Ser Glu Val 175 180 185
  • AGT AAT AAT AAT GCG GTC TCC AAC GGA CAG GTA CCC TCG AGC CAA GAG 1695 Ser Asn Asn Asn Ala Val Ser Asn Gly Gin Val Pro Ser Ser Gin Glu 285 290 295 300
  • AAG CCA AAG CTT AAA ATC TTA CAG AGA GGA ACG GAC TTG AAT TCA CTC 2223 Lys Pro Lys Leu Lys He Leu Gin Arg Gly Thr Asp Leu Asn Ser Leu 465 470 475
  • AAAGGTTACG TTATATAACG AAAGAAAAGA AACGAGCGAA GTGCCAACTA TAGCCCAATA 300
  • AACTCCTTAC AGTGTTCGCT TAGCTGCTCG CTATCACCTT CATTAACAGC ATCGATTAAA 840
  • AGA GGA CTA GCC TTT GCG AAT TTC ACC ACT CCT GAA GAA ACT ACT CAA 2472 Arg Gly Leu Ala Phe Ala Asn Phe Thr Thr Pro Glu Glu Thr Thr Gin 130 135 140
  • CAA ACT CAA CAA CGG GTA CCA GTG GCA TAC 3768 Gin Pro Pro Ala Gin Ser Gin Thr Gin Gin Arg Val Pro Val Ala Tyr 560 565 570
  • AAACACGCTC ATTATCCAGT TTGGATGATT TCAACTATAT TATTAAAATC GATTCTTGGA 6573
  • AGA CCA AGA AGG GGA GAC GTG TTG TAACAGAGTA ATCATGTAAT ATTGTATGTA 726 Arg Pro Arg Arg Gly Asp Val Leu 225 230

Abstract

Cette invention se rapporte d'une façon générale à des substances et à des procédés servant à identifier les inhibiteurs des interactions entre des protéines partenaires de liaison connues.
PCT/US1997/017276 1996-09-27 1997-09-26 Procedes d'identification de composes pour la rupture des interactions entre proteines WO1998013502A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP97944479A EP0915976A2 (fr) 1996-09-27 1997-09-26 Procedes d'identification de composes pour la rupture des interactions entre proteines
AU45965/97A AU4596597A (en) 1996-09-27 1997-09-26 Method to identify compounds for disrupting protein/protein interactions

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US72173096A 1996-09-27 1996-09-27
US08/721,730 1996-09-27

Publications (2)

Publication Number Publication Date
WO1998013502A2 true WO1998013502A2 (fr) 1998-04-02
WO1998013502A3 WO1998013502A3 (fr) 1998-07-16

Family

ID=24899077

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/017276 WO1998013502A2 (fr) 1996-09-27 1997-09-26 Procedes d'identification de composes pour la rupture des interactions entre proteines

Country Status (4)

Country Link
EP (1) EP0915976A2 (fr)
AU (1) AU4596597A (fr)
CA (1) CA2236867A1 (fr)
WO (1) WO1998013502A2 (fr)

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999067376A1 (fr) * 1998-06-25 1999-12-29 Institut Pasteur Analyse exhaustive d'interactions de proteines virales au moyen d'un criblage a deux hybrides et selection de polypeptides a interaction virale correctement plies
WO1999067375A2 (fr) * 1998-06-22 1999-12-29 Universität Zürich Systeme de criblage
WO2000034464A1 (fr) * 1998-12-09 2000-06-15 Institut National De La Sante Et De La Recherche Medicale Procede de criblage en levure de modulateurs de proteine-kinases specifiques de cellules eucaryotes superieures, y compris les cellules humaines
US6200746B1 (en) 1999-08-25 2001-03-13 Pharmacia & Upjohn Company Methods of identifying anti-viral agents
WO2001023616A2 (fr) * 1999-09-29 2001-04-05 Genetic Vectors, Inc. Procede pour identifier des cryptocoques pathogenes
WO2001046403A1 (fr) * 1999-12-22 2001-06-28 Iconix Pharmaceuticals, Inc. Crible synthetique d'expression letale
US6344549B1 (en) 1999-10-14 2002-02-05 Icos Corporation ATR-2 cell cycle checkpoint
WO2002020500A2 (fr) * 2000-09-01 2002-03-14 Icos Corporation Substances potentialisant un traitement anticancereux et methodes a cet effet
WO2002022869A2 (fr) * 2000-09-13 2002-03-21 Medical Research Council Procede d'evolution dirigee
WO2003004643A2 (fr) 2001-07-03 2003-01-16 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Piege a interaction proteine-proteine de mammifere inverse
WO2003035887A1 (fr) * 2001-09-20 2003-05-01 Immunex Corporation Selection de cellules exprimant des polypeptides heteromeres
WO2003070759A2 (fr) 2002-02-20 2003-08-28 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Procede permettant d'enrayer l'evolution et le pouvoir envahissant des tumeurs
US6641994B2 (en) 1999-08-25 2003-11-04 Pharmacia & Upjohn Company Methods of identifying anti-viral agents
US7138233B2 (en) 1997-07-07 2006-11-21 Medical Research Council IN vitro sorting method
US7429467B2 (en) 2001-11-16 2008-09-30 Medical Research Council Emulsion compositions
US7569668B2 (en) 2002-02-20 2009-08-04 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Method to control tumor progression and invasiveness
WO2010040515A1 (fr) * 2008-10-07 2010-04-15 Thiesen H-J Procédé d'identification de principes actifs activateurs géniques
US7842457B2 (en) 2003-01-29 2010-11-30 454 Life Sciences Corporation Bead emulsion nucleic acid amplification
AU2007200686B2 (en) * 2001-09-20 2011-07-14 Immunex Corporation Selection of cells expressing heteromeric polypeptides
US8048627B2 (en) 2003-07-05 2011-11-01 The Johns Hopkins University Method and compositions for detection and enumeration of genetic variations
US8404681B2 (en) 2003-03-24 2013-03-26 Luitpold Pharmaceuticals, Inc. Xanthones, thioxanthones and acridinones as DNA-PK inhibitors
US9017623B2 (en) 2007-02-06 2015-04-28 Raindance Technologies, Inc. Manipulation of fluids and reactions in microfluidic systems
US9029083B2 (en) 2004-10-08 2015-05-12 Medical Research Council Vitro evolution in microfluidic systems
US9068699B2 (en) 2007-04-19 2015-06-30 Brandeis University Manipulation of fluids, fluid components and reactions in microfluidic systems
US9074242B2 (en) 2010-02-12 2015-07-07 Raindance Technologies, Inc. Digital analyte analysis
US9839890B2 (en) 2004-03-31 2017-12-12 National Science Foundation Compartmentalised combinatorial chemistry by microfluidic control
US9857303B2 (en) 2003-03-31 2018-01-02 Medical Research Council Selection by compartmentalised screening
US10052605B2 (en) 2003-03-31 2018-08-21 Medical Research Council Method of synthesis and testing of combinatorial libraries using microcapsules
US10351905B2 (en) 2010-02-12 2019-07-16 Bio-Rad Laboratories, Inc. Digital analyte analysis
US10520500B2 (en) 2009-10-09 2019-12-31 Abdeslam El Harrak Labelled silica-based nanomaterial with enhanced properties and uses thereof
US10533998B2 (en) 2008-07-18 2020-01-14 Bio-Rad Laboratories, Inc. Enzyme quantification
US10647981B1 (en) 2015-09-08 2020-05-12 Bio-Rad Laboratories, Inc. Nucleic acid library generation methods and compositions
US10837883B2 (en) 2009-12-23 2020-11-17 Bio-Rad Laboratories, Inc. Microfluidic systems and methods for reducing the exchange of molecules between droplets
US11077415B2 (en) 2011-02-11 2021-08-03 Bio-Rad Laboratories, Inc. Methods for forming mixed droplets
US11168353B2 (en) 2011-02-18 2021-11-09 Bio-Rad Laboratories, Inc. Compositions and methods for molecular labeling
US11174509B2 (en) 2013-12-12 2021-11-16 Bio-Rad Laboratories, Inc. Distinguishing rare variations in a nucleic acid sequence from a sample
US11193176B2 (en) 2013-12-31 2021-12-07 Bio-Rad Laboratories, Inc. Method for detecting and quantifying latent retroviral RNA species
US11268887B2 (en) 2009-03-23 2022-03-08 Bio-Rad Laboratories, Inc. Manipulation of microfluidic droplets
US11351510B2 (en) 2006-05-11 2022-06-07 Bio-Rad Laboratories, Inc. Microfluidic devices
US11390917B2 (en) 2010-02-12 2022-07-19 Bio-Rad Laboratories, Inc. Digital analyte analysis
US11511242B2 (en) 2008-07-18 2022-11-29 Bio-Rad Laboratories, Inc. Droplet libraries
US11635427B2 (en) 2010-09-30 2023-04-25 Bio-Rad Laboratories, Inc. Sandwich assays in droplets
CN116496365A (zh) * 2022-12-08 2023-07-28 济南宜明医疗科技有限公司 一种提高重组蛋白表达效率的酸性表面助溶短肽标签
US11901041B2 (en) 2013-10-04 2024-02-13 Bio-Rad Laboratories, Inc. Digital analysis of nucleic acid modification
US11898193B2 (en) 2011-07-20 2024-02-13 Bio-Rad Laboratories, Inc. Manipulating droplet size

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050221339A1 (en) 2004-03-31 2005-10-06 Medical Research Council Harvard University Compartmentalised screening by microfluidic control
WO2007081386A2 (fr) 2006-01-11 2007-07-19 Raindance Technologies, Inc. Dispositifs microfluidiques et leurs procédés d'utilisation
US9562837B2 (en) 2006-05-11 2017-02-07 Raindance Technologies, Inc. Systems for handling microfludic droplets
WO2008021123A1 (fr) 2006-08-07 2008-02-21 President And Fellows Of Harvard College Tensioactifs fluorocarbonés stabilisateurs d'émulsions
US9366632B2 (en) 2010-02-12 2016-06-14 Raindance Technologies, Inc. Digital analyte analysis
US8841071B2 (en) 2011-06-02 2014-09-23 Raindance Technologies, Inc. Sample multiplexing

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5283173A (en) * 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
WO1995020652A1 (fr) * 1994-01-28 1995-08-03 Medigene Gmbh Procede pour determiner l'activite d'un facteur regulateur et application de ce procede
WO1995032284A1 (fr) * 1994-05-24 1995-11-30 Ciba-Geigy Ag Facteur agissant en interaction avec des proteines nucleaires
WO1996001313A1 (fr) * 1994-07-01 1996-01-18 Hermann Bujard Modulateurs de transcription regules par la tetracycline
WO1996003501A1 (fr) * 1994-07-22 1996-02-08 Ciba-Geigy Ag Systeme double hybride
WO1996003499A1 (fr) * 1994-07-22 1996-02-08 President And Fellows Of Harvard College Methode de dosage de recepteurs et de ligands

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5283173A (en) * 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
WO1995020652A1 (fr) * 1994-01-28 1995-08-03 Medigene Gmbh Procede pour determiner l'activite d'un facteur regulateur et application de ce procede
WO1995032284A1 (fr) * 1994-05-24 1995-11-30 Ciba-Geigy Ag Facteur agissant en interaction avec des proteines nucleaires
WO1996001313A1 (fr) * 1994-07-01 1996-01-18 Hermann Bujard Modulateurs de transcription regules par la tetracycline
WO1996003501A1 (fr) * 1994-07-22 1996-02-08 Ciba-Geigy Ag Systeme double hybride
WO1996003499A1 (fr) * 1994-07-22 1996-02-08 President And Fellows Of Harvard College Methode de dosage de recepteurs et de ligands

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
J.C. CHRIVIA ET AL.: "Phosphorylated CREB binds specifically to the nuclear protein CBP" NATURE, vol. 365, 28 October 1993, MACMILLAN JOURNALS LTD., LONDON,UK, pages 855-859, XP002052727 cited in the application *
P. SUN AND R. MAURER: "An inactivating point mutation demonstrates that interaction of cAMP response element binding protein (CREB) with the CREB binding protein is not sufficient for transcriptional activation" J. BIOL. CHEM., vol. 270, no. 13, 31 March 1995, AM. SOC. BIOCHEM. MOL.BIOL.,INC.,BALTIMORE,US, pages 7041-7044, XP002052726 cited in the application *
SHIH H-M ET AL: "A positive genetic selection for disrupting protein-protein interactions: Identification of CREB mutations that prevent association with the coactivator CBP." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA 93 (24). 1996. 13896-13901. ISSN: 0027-8424, 16 November 1996, XP002052728 *

Cited By (92)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7638276B2 (en) 1997-07-07 2009-12-29 454 Life Sciences Corporation In vitro sorting method
US8367326B2 (en) 1997-07-07 2013-02-05 Medical Research Council In vitro sorting method
US9528106B2 (en) 1997-07-07 2016-12-27 Medical Research Council In vitro sorting method
US7582446B2 (en) 1997-07-07 2009-09-01 Medical Research Council In vitro sorting method
US7252943B2 (en) 1997-07-07 2007-08-07 Medical Research Council In Vitro sorting method
US7138233B2 (en) 1997-07-07 2006-11-21 Medical Research Council IN vitro sorting method
WO1999067375A2 (fr) * 1998-06-22 1999-12-29 Universität Zürich Systeme de criblage
EP0974649A1 (fr) * 1998-06-22 2000-01-26 Universität Zürich Système de criblage
WO1999067375A3 (fr) * 1998-06-22 2000-02-24 Univ Zuerich Systeme de criblage
US6821728B1 (en) 1998-06-22 2004-11-23 Esbatech Ag Screening system
WO1999067376A1 (fr) * 1998-06-25 1999-12-29 Institut Pasteur Analyse exhaustive d'interactions de proteines virales au moyen d'un criblage a deux hybrides et selection de polypeptides a interaction virale correctement plies
WO2000034464A1 (fr) * 1998-12-09 2000-06-15 Institut National De La Sante Et De La Recherche Medicale Procede de criblage en levure de modulateurs de proteine-kinases specifiques de cellules eucaryotes superieures, y compris les cellules humaines
FR2787119A1 (fr) * 1998-12-09 2000-06-16 Inst Nat Sante Rech Med Procede de criblage en levure d'inhibiteurs de proteines kinases specifiques de cellules humaines et de mammiferes
US6641994B2 (en) 1999-08-25 2003-11-04 Pharmacia & Upjohn Company Methods of identifying anti-viral agents
US6200746B1 (en) 1999-08-25 2001-03-13 Pharmacia & Upjohn Company Methods of identifying anti-viral agents
WO2001023616A3 (fr) * 1999-09-29 2002-01-24 Genetic Vectors Inc Procede pour identifier des cryptocoques pathogenes
WO2001023616A2 (fr) * 1999-09-29 2001-04-05 Genetic Vectors, Inc. Procede pour identifier des cryptocoques pathogenes
US6344549B1 (en) 1999-10-14 2002-02-05 Icos Corporation ATR-2 cell cycle checkpoint
US6815532B2 (en) 1999-10-14 2004-11-09 Icos Corporation ATR-2 cell cycle checkpoint
WO2001046403A1 (fr) * 1999-12-22 2001-06-28 Iconix Pharmaceuticals, Inc. Crible synthetique d'expression letale
WO2002020500A2 (fr) * 2000-09-01 2002-03-14 Icos Corporation Substances potentialisant un traitement anticancereux et methodes a cet effet
US7179912B2 (en) 2000-09-01 2007-02-20 Icos Corporation Materials and methods to potentiate cancer treatment
US8242115B2 (en) 2000-09-01 2012-08-14 Luitpold Pharmaceuticals, Inc. Materials and methods to potentiate cancer treatment
WO2002020500A3 (fr) * 2000-09-01 2003-07-31 Icos Corp Substances potentialisant un traitement anticancereux et methodes a cet effet
WO2002022869A2 (fr) * 2000-09-13 2002-03-21 Medical Research Council Procede d'evolution dirigee
WO2002022869A3 (fr) * 2000-09-13 2002-10-17 Medical Res Council Procede d'evolution dirigee
US7514210B2 (en) 2000-09-13 2009-04-07 Medical Research Council Compartmentalised self replication method for in vitro evolution of molecular libraries
WO2003004643A2 (fr) 2001-07-03 2003-01-16 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Piege a interaction proteine-proteine de mammifere inverse
US8048986B2 (en) 2001-07-03 2011-11-01 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Reversed mammalian protein-protein interaction trap
US7968313B2 (en) 2001-09-20 2011-06-28 Amgen Inc. Selection of cells expressing heteromeric polypeptides
US7691605B2 (en) 2001-09-20 2010-04-06 Immunex Corporation Selection of cells expressing heteromeric polypeptides
AU2007200686B2 (en) * 2001-09-20 2011-07-14 Immunex Corporation Selection of cells expressing heteromeric polypeptides
WO2003035887A1 (fr) * 2001-09-20 2003-05-01 Immunex Corporation Selection de cellules exprimant des polypeptides heteromeres
US7429467B2 (en) 2001-11-16 2008-09-30 Medical Research Council Emulsion compositions
US8153402B2 (en) 2001-11-16 2012-04-10 Medical Research Council Emulsion compositions
US8153364B2 (en) 2001-11-16 2012-04-10 Mrc Emulsion compositions
US7569668B2 (en) 2002-02-20 2009-08-04 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Method to control tumor progression and invasiveness
WO2003070759A2 (fr) 2002-02-20 2003-08-28 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Procede permettant d'enrayer l'evolution et le pouvoir envahissant des tumeurs
US7842457B2 (en) 2003-01-29 2010-11-30 454 Life Sciences Corporation Bead emulsion nucleic acid amplification
US10982274B2 (en) 2003-01-29 2021-04-20 Roche Molecular Systems, Inc. Bead emulsion nucleic acid amplification
US8012690B2 (en) 2003-01-29 2011-09-06 454 Life Sciences Corporation Bead emulsion nucleic acid amplification
US8748102B2 (en) 2003-01-29 2014-06-10 454 Life Sciences Corporation Bead emulsion nucleic acid amplification
US8765380B2 (en) 2003-01-29 2014-07-01 454 Life Sciences Corporation Bead emulsion nucleic acid amplification
US10240192B2 (en) 2003-01-29 2019-03-26 454 Life Sciences Corporation Bead emulsion nucleic acid amplification
US11187702B2 (en) 2003-03-14 2021-11-30 Bio-Rad Laboratories, Inc. Enzyme quantification
US8404681B2 (en) 2003-03-24 2013-03-26 Luitpold Pharmaceuticals, Inc. Xanthones, thioxanthones and acridinones as DNA-PK inhibitors
US9857303B2 (en) 2003-03-31 2018-01-02 Medical Research Council Selection by compartmentalised screening
US10052605B2 (en) 2003-03-31 2018-08-21 Medical Research Council Method of synthesis and testing of combinatorial libraries using microcapsules
US9328343B2 (en) 2003-07-05 2016-05-03 The Johns Hopkins University Method and compositions for detection and enumeration of genetic variations
US10604797B2 (en) 2003-07-05 2020-03-31 The Johns Hopkins University Method and compositions for detection and enumeration of genetic variations
US8048627B2 (en) 2003-07-05 2011-11-01 The Johns Hopkins University Method and compositions for detection and enumeration of genetic variations
US11821109B2 (en) 2004-03-31 2023-11-21 President And Fellows Of Harvard College Compartmentalised combinatorial chemistry by microfluidic control
US9839890B2 (en) 2004-03-31 2017-12-12 National Science Foundation Compartmentalised combinatorial chemistry by microfluidic control
US9925504B2 (en) 2004-03-31 2018-03-27 President And Fellows Of Harvard College Compartmentalised combinatorial chemistry by microfluidic control
US9029083B2 (en) 2004-10-08 2015-05-12 Medical Research Council Vitro evolution in microfluidic systems
US11786872B2 (en) 2004-10-08 2023-10-17 United Kingdom Research And Innovation Vitro evolution in microfluidic systems
US11351510B2 (en) 2006-05-11 2022-06-07 Bio-Rad Laboratories, Inc. Microfluidic devices
US9017623B2 (en) 2007-02-06 2015-04-28 Raindance Technologies, Inc. Manipulation of fluids and reactions in microfluidic systems
US11819849B2 (en) 2007-02-06 2023-11-21 Brandeis University Manipulation of fluids and reactions in microfluidic systems
US10603662B2 (en) 2007-02-06 2020-03-31 Brandeis University Manipulation of fluids and reactions in microfluidic systems
US9068699B2 (en) 2007-04-19 2015-06-30 Brandeis University Manipulation of fluids, fluid components and reactions in microfluidic systems
US11224876B2 (en) 2007-04-19 2022-01-18 Brandeis University Manipulation of fluids, fluid components and reactions in microfluidic systems
US10675626B2 (en) 2007-04-19 2020-06-09 President And Fellows Of Harvard College Manipulation of fluids, fluid components and reactions in microfluidic systems
US11618024B2 (en) 2007-04-19 2023-04-04 President And Fellows Of Harvard College Manipulation of fluids, fluid components and reactions in microfluidic systems
US10357772B2 (en) 2007-04-19 2019-07-23 President And Fellows Of Harvard College Manipulation of fluids, fluid components and reactions in microfluidic systems
US10960397B2 (en) 2007-04-19 2021-03-30 President And Fellows Of Harvard College Manipulation of fluids, fluid components and reactions in microfluidic systems
US10533998B2 (en) 2008-07-18 2020-01-14 Bio-Rad Laboratories, Inc. Enzyme quantification
US11596908B2 (en) 2008-07-18 2023-03-07 Bio-Rad Laboratories, Inc. Droplet libraries
US11534727B2 (en) 2008-07-18 2022-12-27 Bio-Rad Laboratories, Inc. Droplet libraries
US11511242B2 (en) 2008-07-18 2022-11-29 Bio-Rad Laboratories, Inc. Droplet libraries
WO2010040515A1 (fr) * 2008-10-07 2010-04-15 Thiesen H-J Procédé d'identification de principes actifs activateurs géniques
US11268887B2 (en) 2009-03-23 2022-03-08 Bio-Rad Laboratories, Inc. Manipulation of microfluidic droplets
US10520500B2 (en) 2009-10-09 2019-12-31 Abdeslam El Harrak Labelled silica-based nanomaterial with enhanced properties and uses thereof
US10837883B2 (en) 2009-12-23 2020-11-17 Bio-Rad Laboratories, Inc. Microfluidic systems and methods for reducing the exchange of molecules between droplets
US10351905B2 (en) 2010-02-12 2019-07-16 Bio-Rad Laboratories, Inc. Digital analyte analysis
US11254968B2 (en) 2010-02-12 2022-02-22 Bio-Rad Laboratories, Inc. Digital analyte analysis
US11390917B2 (en) 2010-02-12 2022-07-19 Bio-Rad Laboratories, Inc. Digital analyte analysis
US9074242B2 (en) 2010-02-12 2015-07-07 Raindance Technologies, Inc. Digital analyte analysis
US10808279B2 (en) 2010-02-12 2020-10-20 Bio-Rad Laboratories, Inc. Digital analyte analysis
US11635427B2 (en) 2010-09-30 2023-04-25 Bio-Rad Laboratories, Inc. Sandwich assays in droplets
US11077415B2 (en) 2011-02-11 2021-08-03 Bio-Rad Laboratories, Inc. Methods for forming mixed droplets
US11168353B2 (en) 2011-02-18 2021-11-09 Bio-Rad Laboratories, Inc. Compositions and methods for molecular labeling
US11747327B2 (en) 2011-02-18 2023-09-05 Bio-Rad Laboratories, Inc. Compositions and methods for molecular labeling
US11768198B2 (en) 2011-02-18 2023-09-26 Bio-Rad Laboratories, Inc. Compositions and methods for molecular labeling
US11965877B2 (en) 2011-02-18 2024-04-23 Bio-Rad Laboratories, Inc. Compositions and methods for molecular labeling
US11754499B2 (en) 2011-06-02 2023-09-12 Bio-Rad Laboratories, Inc. Enzyme quantification
US11898193B2 (en) 2011-07-20 2024-02-13 Bio-Rad Laboratories, Inc. Manipulating droplet size
US11901041B2 (en) 2013-10-04 2024-02-13 Bio-Rad Laboratories, Inc. Digital analysis of nucleic acid modification
US11174509B2 (en) 2013-12-12 2021-11-16 Bio-Rad Laboratories, Inc. Distinguishing rare variations in a nucleic acid sequence from a sample
US11193176B2 (en) 2013-12-31 2021-12-07 Bio-Rad Laboratories, Inc. Method for detecting and quantifying latent retroviral RNA species
US10647981B1 (en) 2015-09-08 2020-05-12 Bio-Rad Laboratories, Inc. Nucleic acid library generation methods and compositions
CN116496365A (zh) * 2022-12-08 2023-07-28 济南宜明医疗科技有限公司 一种提高重组蛋白表达效率的酸性表面助溶短肽标签

Also Published As

Publication number Publication date
WO1998013502A3 (fr) 1998-07-16
EP0915976A2 (fr) 1999-05-19
CA2236867A1 (fr) 1998-04-02
AU4596597A (en) 1998-04-17

Similar Documents

Publication Publication Date Title
EP0915976A2 (fr) Procedes d'identification de composes pour la rupture des interactions entre proteines
CA2266543C (fr) Procedes et compositions pour identifier des modulateurs de recepteur
EP1362913B1 (fr) Système de piégeage d'intéraction pour l'isolation de protéines
EP1012265B1 (fr) Systeme de trans-activateur reprime pour la caracterisation d'interactions proteine-proteine
Stuart et al. The mutant type 1 protein phosphatase encoded by glc7-1 from Saccharomyces cerevisiae fails to interact productively with the GAC1-encoded regulatory subunit
US5955280A (en) Reverse two-hybrid system
US6074829A (en) Relating to assay systems
US5679566A (en) Yeast NMD2 gene
US20020025552A1 (en) Screening interactor molecules with whole genome oligonucleotide or polynucleotide arrays
Banuett Pathogenic development in Ustilago maydis: a progression of morphological transitions that results in tumor formation and teliospore production
US6410315B1 (en) Genes encoding polypeptides containing signal sequences
CN115772535A (zh) Tt2-sct1/sct2-wr2调控通路在植物热胁迫耐受中的应用
Lin et al. A homologue of Cdk8 is required for spore cell differentiation in Dictyostelium
US7932030B2 (en) System for pulling out regulatory elements using yeast
JP2009502158A (ja) 酵母のストレス耐性を増加させる遺伝子類の同定方法類、およびそれらの遺伝子類の酵母株改良のための使用
Freeman-Cook Identification and characterization of S. pombe SIR2 silencing gene homologues
JP2007535314A (ja) ＩκＢαタンパク質ユビキチン化を調節する薬剤のスクリーニング方法および該方法を実施する手段
Lee Characterization of the interaction between the yeast HAC1 transcription factor and the MCK1 protein kinase
Kastenmayer The XRN family of 5'-3'exoribonucleases in Arabidopsis thaliana
WO2000042167A1 (fr) Systeme permettant d'identifier des modulateurs de gene articule autour de cellules eucaryotes
JP2002534127A (ja) 酵母におけるトランス−作用因子

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU BR CA CN CZ FI HU IL JP MX NO PL RU SK

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

ENP Entry into the national phase in:

Ref country code: CA

Ref document number: 2236867

Kind code of ref document: A

Format of ref document f/p: F

Ref document number: 2236867

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1997944479

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWP Wipo information: published in national office

Ref document number: 1997944479

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1997944479

Country of ref document: EP