WO1998006861A2 - Administration d'antigenes tolerogeniques via des plantes comestibles ou des produits derives de plantes - Google Patents

Administration d'antigenes tolerogeniques via des plantes comestibles ou des produits derives de plantes Download PDF

Info

Publication number
WO1998006861A2
WO1998006861A2 PCT/US1997/013634 US9713634W WO9806861A2 WO 1998006861 A2 WO1998006861 A2 WO 1998006861A2 US 9713634 W US9713634 W US 9713634W WO 9806861 A2 WO9806861 A2 WO 9806861A2
Authority
WO
WIPO (PCT)
Prior art keywords
antigen
plant
protein
cells
autoimmune
Prior art date
Application number
PCT/US1997/013634
Other languages
English (en)
Other versions
WO1998006861A3 (fr
Inventor
Lisa M. Welter
Original Assignee
Agrivax Incorporated
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agrivax Incorporated filed Critical Agrivax Incorporated
Priority to AU38254/97A priority Critical patent/AU3825497A/en
Priority to EP97935275A priority patent/EP0939826A2/fr
Priority to CA002263730A priority patent/CA2263730A1/fr
Publication of WO1998006861A2 publication Critical patent/WO1998006861A2/fr
Publication of WO1998006861A3 publication Critical patent/WO1998006861A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43513—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
    • C07K14/43531—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from mites
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0008—Antigens related to auto-immune diseases; Preparations to induce self-tolerance
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/35—Allergens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • C07K14/43572—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from bees
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4713—Autoimmune diseases, e.g. Insulin-dependent diabetes mellitus, multiple sclerosis, rheumathoid arthritis, systemic lupus erythematosus; Autoantigens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70539—MHC-molecules, e.g. HLA-molecules
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70567—Nuclear receptors, e.g. retinoic acid receptor [RAR], RXR, nuclear orphan receptors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin or cold insoluble globulin [CIG]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8206—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated
    • C12N15/8207—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated by mechanical means, e.g. microinjection, particle bombardment, silicon whiskers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • C12N15/8258—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon for the production of oral vaccines (antigens) or immunoglobulins
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs

Definitions

  • the present invention relates to a method for producing autoantigens and allergens in plants and the use of the plants or plant-derived products as medicinal food in treatment or prophylaxis of autoimmune diseases and allergic reactions.
  • T H helper cells
  • CD4 cells Two types of CD4 cells have been defined in mice (19) .
  • T H1 cells mediate delayed-type hypersensitivity and are thought to assist T cells, which bear the molecular marker molecule, CD8 , in becoming cytotoxic T lymphocytes (CTL, T( - , while T H2 cells collaborate with B lymphocytes in the production of antibodies.
  • CTL cytotoxic T lymphocytes
  • T H1 and T H2 ce ll s can b e distinguished from one another by the type of cytokine they produce.
  • T H1 cells secrete proinflammatory cytokines, such as interleukin-2 (IL2), ⁇ -interferon (IFN- ⁇ ) and tumor necrosis factor (TNF) while T H2 cells produce anti-inflammatory cytokines, such as IL-4 , IL-6 and IL-10.
  • cytokines such as interleukin-2 (IL2), ⁇ -interferon (IFN- ⁇ ) and tumor necrosis factor (TNF)
  • T H2 cells produce anti-inflammatory cytokines, such as IL-4 , IL-6 and IL-10.
  • Cytokines secreted from T helper cells mediate cellular interactions interacting with receptors on appropriate cells, e.g., CTLs expressing IL-2 receptors enable them to respond to T H1 cells.
  • the ratio of T H1 to T H2 cells generated during an immune response varies according
  • Lymphocytes require two signals to become activated. One is antigen-specific and involves the recognition, by receptors expressed on T cells (TCRs) , of degraded foreign antigen in association with class I or class II molecules, encoded in the MHC (20) .
  • TCRs T cells
  • the second signal is not antigen-specific and is mediated by soluble cytokines. Most pertinent to this invention is the observation that lymphocytes receiving stimulation from specific antigens in the absence of the second signal, not only fail to become activated but are refractory to further stimuli (21) .
  • T cells The ability of T cells to specifically recognize foreign antigens while simultaneously being unresponsive or tolerant of self antigens is not totally understood, but appears to be determined by two selection processes which occur in the thymus .
  • T cell development when these cells undergo gene rearrangements to produce TCRs , only T cells which can interact with self MHC molecules and foreign peptides are positively selected, and subsequently, in a second round of negative selection, those TCRs which interact very strongly with self antigens expressed in the thymus are eliminated or deleted, thus ensuring self tolerance.
  • T cells are not, however, exposed to all self-antigens in the thymus, since many proteins have specialized functions and are synthesized only in specific tissues.
  • T cells which can recognize these antigens are not deleted but enter into the state of anergy, since the tissue cells ' can not provide co-stimulatory activity. While clonal deletion and anergy as mechanisms of tolerance induction have been unequivocally demonstrated in experimental systems, a third mechanism, that of dominant suppression, is the subject of much controversy. In this model T cells play an active role in suppressing the activity of the other T cells which potentially mediate tissue damage (21,22,23).
  • the brain is immunologically silent, in that brain tissue does not normally express molecules which regulate (MHC) or mediate (cytokines) immune reactions.
  • MHC molecules which regulate
  • cytokines mediate
  • activated T cells in small numbers routinely cross the BBB and patrol the brain. Only if these activated cells detect antigen to which they respond, do they take up residence and initiate an immune reaction (27). Paradoxically, therefore, an antigen which is sequestered in an immunologically privileged site can become the target for autoimmune attack.
  • Multiple sclerosis is an autoimmune disease of the central nervous system in which the myelin sheath surrounding neurons is destroyed. This can result in paralysis, sensory deficits, and visual problems.
  • the etiology of the disease is unknown, although infectious agents and possibly environmental factors are suspected (9, 10) .
  • MS class HLA-DR2 allele compared to 20-30% in normal individuals (11,12) .
  • MS is characterized by a T cell and macrophage infiltrate in the brain and autoreactive, myelin-specific T cells have been isolated from MS patients, although T cells of the same specificity have been detected in normal individuals (13, 14, 15).
  • the evidence, therefore, that MS is caused by pathogenic T cells is necessarily indirect, but the close resemblance which the characteristics of the disease bear to those of the murine model, experimental autoimmune encephalomyelitis (EAE) suggests that MS is indeed caused by an aberrant immune response mediated by T cells (16, 17, 18).
  • EAE experimental autoimmune encephalomyelitis
  • EAE can be inhibited by inhalation; this has been achieved with a single encephalogenic peptide in PL/J mice (44) .
  • a list of encephalitogenic peptides of MBP, PLP, and MOG are listed in table 15.1.1 of chapter 15 of Current Protocols in Immunology, supplement 19 (73) . This, too, has difficulty in the delivery system and one does not know what the bioavailability would be in a chronic human disease.
  • Induction of tolerance has been studied in a number of animal disease models for use in the treatment of autoimmune diseases, such as: multiple sclerosis by tolerizing with myelin basic protein (MBP) or proteolipid protein (PLP) ; rheumatoid arthritis by tolerizing with type II collagen; uveoretinitis by tolerizing with S-antigen or interphotoreceptor retinoid-binding protein; type I diabetes by tolerizing with insulin or glutamate decarboxylase; myasthenia gravis by tolerizing with acetylcholine receptor; and thyroiditis by tolerizing with thyroglobulin.
  • MBP myelin basic protein
  • PGP proteolipid protein
  • Induction of tolerance is also currently being investigated for preventing transplant rejection by tolerizing with alloantigen or MHC peptide, and for prevention of allergic immune responses including allergic reactions to cats and bee stings by tolerizing with Fel dl or PLA-2 peptides, respectively (5,6) .
  • Induction of tolerance to autoantigens has recently been applied in human clinical trials for multiple sclerosis, rheumatoid arthritis, uveoretinitis, and type I diabetes (5) .
  • Transgenic plants have been used to produce a variety of heterologous or foreign proteins . Some examples to date are the production of interferon in tobacco (Goodman et al . , 1990, (64) , enkephalins in tobacco, Brassica napus and Ababidopsis thaliana
  • transgenic tobacco expressing the murine GAD67 protein were found to retain its T-cell recognition and stimulator specificity.
  • This demonstrates the potential use of transgenic plants expressing tolerogenic or autoantigens for the induction of tolerance in susceptible animal models, and that oral delivery of the autoantigens or allergens expressed in the plants could be effective to protect or prevent autoimmune diseases or anaphylaxis challenge in animals including humans.
  • vaccine antigens produced in transgenic potato plants the expression levels were found to be largely affected by the site of DNA integration into the plant genome which occurs in a random fashion. RNA expression in tuber material appears to be more stable than in the leaves.
  • the present invention tolerizes animals, especially humans, against immune-mediated diseases and conditions, such as autoimmune diseases and allergic reactions, by feeding to the animal a tolerizing dose of a suitable tolerogenic antigen.
  • This antigen is administered in the form of a transgenic plant, or a plant part or plant product which retains the antigen in a tolerizing amount and form, the plant having been genetically engineered to express the antigen.
  • the plant is itself edible.
  • the tolerogenic antigen is an autoimmune antigen and provides for protection against autoimmune diseases such as multiple sclerosis, rheumatoid arthritis, diabetes, and the like.
  • the tolerogenic antigen is an allergen, and provides tolerance induction for the prevention of anaphylactic reactions to the tolerizing antigen.
  • the tolerogenic antigen is an MHC alloantigen for protection against transplant rejection.
  • the invention provides for preparation of food (including a beverage) comprising or derived from the transgenic plants of the present invention.
  • the food may comprise a transgenic plant, plant organ or plant seed which includes an expression cassette to the invention, along with nutritionally acceptable adjuvants such as flavorings, seasonings, and carriers.
  • the food may incorporate the plant, plant organs or seeds thereof in a raw or processed state .
  • the transgenic plants which produce tolerogenic antigens are obtained by introducing into the plant an expression construct comprising a DNA sequence encoding a tolerogenic antigen and regulatory sequences capable of directing the expression of the autoimmune or tolerogenic antigen in the plant, plant organ, or seeds.
  • the expression construct provides for the stable transformation of the plants.
  • the transgenic plants, plant organs, seeds or other plant -derived food (including beverage) product containing the antigen may be used as a practical delivery system of the antigen to a patient afflicted with an autoimmune disease or a patient afflicted with an allergy.
  • the antigen can be isolated and administered to patients in the form of a pharmaceutical composition to stimulate active or passive suppression.
  • the tolerogenic antigen can also be isolated and purified for use in diagnostic assays.
  • Tolerogenic Antigens include both autoimmune antigens and antigens involved in eliciting specific allergic reactions (allergens) . Such that induction of tolerance to the antigen prevents or otherwise inhibits the development of an autoimmune disease or of a detrimental allergic response with the same (or cross- reactive) antigen.
  • transgenic plants are generated which express tolerogenic antigens (tolerogens) . These antigens are used to treat patients suffering from autoimmune diseases or allergic reactions, or to prevent such conditions.
  • the tolerogenic antigens can be administered orally, in the form of the plant, a plant part, or a food or beverage derived from said plant.
  • autoimmune antigen and allergen include molecules which are immunologically cross-reactive with the native autoimmune antigen or allergen, and capable of acting as tolerogenic antigens specifically suppressing the response to the native antigens.
  • the methods and compositions are directed towards treating and protecting humans as well as animals, including domestic animals. Protection against disease includes amelioration to the symptoms of the disease, decrease in mortality and morbidity, or decrease in sensitivity to the antigen. While it is not meant to be a limitation of the invention, it is believed that the act of chewing the transgenic plant or food containing the transgenic plant can result in delivering the tolerogenic antigen both orally and through the oral mucosa, including the tonsils.
  • transgenic plant material can permit the passage of the autoimmune or tolerogenic antigen containing material to the intestinal tract without inactivation of the tolerogenic antigen.
  • Treatment of patients with the autoantigens produced according to the present invention should result in the amelioration of symptoms, decrease in morbidity, and prevention of further disease development.
  • the autoimmune diseases treated by the method of the present invention include but are not limited to diabetes mellitus type I, multiple sclerosis, rheumatoid arthritis, myasthenia gravis, uvoretinitis , and thyroiditis.
  • autoimmune antigens include human myelin basic protein, type II collagen, proteolipid protein, S-antigen, interphotoreceptor binding protein, insulin, glutamate decarboxylase , acetylcholine receptor, and thyroglobulin .
  • allergens for the prevention of allergic reactions or hypersensitivity to the allergens include but are not limited to the expression of allergens of feline FEL di , bee venom PLA-2, mite allergen 70-80 kD, for the prevention of allergic reactions to the defined allergens, or MHC alloantigen for the prevention of transplant rejection.
  • Certain tolerizing proteins for these diseases are known, and these tolerizing proteins can readily be generated in transgenic plants according to the present invention and used to treat patients suffering from these diseases.
  • Amino acid sequences are available from GenBank, as set forth below.
  • the native DNA sequence may also be retrieved from GenBank, or a DNA sequence may be designed de novo with the aid of the Genetic Code.
  • MBP Human Myelin basic protein
  • PGP Human myelin proteolipid protein
  • IRBP Human Interphotoreceptor retinoid- M22453 binding protein
  • Dust mite Mite allergen (Der f I) D10448;
  • amino acid sequence of a protein of interest may be determined by (a) purifying and sequencing the protein, or (b) isolating the corresponding genomic or cDNA, using a primer or hybridization probe, sequencing the isolated DNA, and inferring the a. a. sequence. Suitable probes or
  • 35 primers may be DNAs encoding related proteins (use relaxed hybridization conditions suitable for DNAs with 50-70% identity), or DNAs encoding one or more known partial a. a. sequence (s) of the protein of interest (if this is a mixed probe, use stringent conditions, T of 5-10°C below Tm; if the probe is a unique probe based on codon preferences or containing inosine, use relaxed conditions).
  • the DNA sequence encoding a tolerogenic antigen may be a genomic DNA, a cDNA, a synthetic DNA, or a combination thereof. If a synthetic DNA, it may be designed for compatibility with the codon preferences of the host plant, to avoid formation of secondary structures, to facilitate later manipulation, etc.
  • the coding sequence is operably linked to transcriptional and translational control regions conducive to expression in the host plant. Transcriptional and translational control regions include promoters, enhancers, cis regulatory elements, polyadenylation sequences, transcriptional and translational initiation regions, and transcriptional termination sequences.
  • the promoters are preferably those that provide for a sufficient level of expression of a heterologous gene to provide for enough tolerogenic antigen to treat a patient by oral administration.
  • the promoters are those that are functional in plants and preferably provide for a level of heterologous gene expression about the same as or greater than that provided by the 35S cauliflower mosaic virus (35S CaMV) (cp. USP 5,623,066) promoter in the particular plant type.
  • the especially preferred promoters are those that provide for a level of gene expression of about 0.1% to 10% of the total cell protein. Promoters can be inducible or constitutive, and they can be expressed in all tissues or only in specific tissues.
  • promoters include the 35S CaMV promoter, the nopaline synthase promoter, the chlorophyl A/B binding promoter, the phaseolin promoter, the waxy promoter, and napin promoter, the ubiquitin promoter, the (AOCS)3AMAS Pmas promoter and the following:
  • Transcriptional and translational control regions are typically present in expression vectors .
  • expression vectors are selected for compatibility and stability in the type of plant cell to be transformed.
  • Some expression vectors including promoters and the 3' regulatory regions are commercially available such as CaMV vector, binary vectors such as pBHOl (Available from Clone Tech, Palo Alto, CA) .
  • Expression vectors can also include those used in amplification and selecting steps such as the baculovirus vector, or phage lambda, or other plasmid vectors useful in amplification and cloning of DNA sequences.
  • an expression cassette is formed and subcloned into an appropriate vector system, it can be transformed into suitable host cells.
  • suitable host cells include bacteria such as E. coli , Agrobacterium tumefasciens, Sf9 insect cells for baculovirus and plant cells or tissues such as corn suspension cultures, wheat callus suspension cultures, rice protoplast , soy bean tissue, sunflower tissue, alfalfa tissue, green bean tissue, and other edible plant cells and tissue.
  • the expression system and vector selected is one that is compatible with and stable in the selected host cell.
  • vectors are preferably selected to maximize stable integration of the foreign DNA into the plant cell genome .
  • Methods of transforming cells depend on the type of host cell selected.
  • methods of transformation include the freeze/thaw method, calcium phosphate precipitation, and electroporation.
  • preferred methods of transformation include Agrobacterium mediated transformation, direct transformation of protoplast using electroporation, or direct transfer into protoplast or plant tissue using microparticle bombardment, or combinations of these methods .
  • plant cells and tissues to be transformed include those plants useful as food plants, including alfalfa sprouts, barley, beans, corn, flax, lentils, sorghum, mustard and rapeseed, oats, rye, Perilla, sesame, safflower, soybeans, sugar beets, sunflowers, spinach, tomatoes, potatoes, bananas, peanuts, broccoli, carrots and wheat and those listed in Table A of PCT publication number WO 95/23229 , the entire contents of which are hereby incorporated by reference.
  • the preferred plants are those which can be readily incorporated into a conventional diet for oral administration.
  • the plants may be monocots or dicots.
  • the tolerogenic antigen protein may be expressed in the seed of seed-producing plants (cp. W091/13993; EP 295,959; EP 255,378; USP 5,504,200; USP 5,215, 912) , such as sunflower, which can be used as a source of food either whole or in the form of flour or oil.
  • seed-producing plants cp. W091/13993; EP 295,959; EP 255,378; USP 5,504,200; USP 5,215, 912
  • sunflower which can be used as a source of food either whole or in the form of flour or oil.
  • constitutive expression is preferred.
  • tissue specific expression is preferred.
  • Transformed plant cells are cultured under conditions that select for those cells having the expression cassette, typically by selecting for those cells that exhibit antibiotic resistance. Antibiotic resistance genes are typically used as selectable marker genes.
  • the transformed cells are also grown under conditions that favor regeneration of the cells and/or tissue into plants. These techniques are known to those of skill in the art.
  • the presence of the desired DNA sequence coding for at least one tolerogenic antigen in the plant cells or tissues can be determined by hybridization with a probe or by detecting expression by assaying for the presence of the tolerogenic antigen and other like assays.
  • transgenic plants Once transgenic plants are obtained, they can be grown under appropriate field conditions until they produce seed.
  • the presence of the DNA sequence encoding for the autoimmune or tolerogenic antigen and expression of the autoimmune or tolerogenic antigen in the transgenic plant can be determined and quantitated by conventional techniques.
  • An expression cassette encoding at least one tolerogenic antigen is preferably stably integrated into the plant cell genome. Stable integration of an expression cassette into a plant cell genome may be established when found in three successive generations. Methods for detection of expression of a protein encoded for by the inserted DNA include SDS-PAGE electrophoresis, Western blot, ELISA and other methods known in the art .
  • the presence of the DNA sequence encoding for the tolerogenic antigen in the plant genome or chromosomal material can be verified and the copy number can be quantitated using hybridization methods known to those skilled in the art.
  • the level of gene expression can be quantitated using quantitative Northern blots or by measuring the amount of specific mRNA synthesis by quantitative PCR.
  • Transgenic plants that express the most tolerogenic antigen as a percentage of the total plant cell protein are preferably selected for further propagation. These plants preferably express the tolerogenic antigen within the range of about 0.1 to about 10% of the total plant protein.
  • Transgenic plants can be crossed with known parental strains and the progeny plants evaluated for the presence of a DNA sequence encoding the tolerogenic antigen and/or expression of the tolerogenic antigen.
  • the especially preferred transgenic plants of the present invention are those that can transmit the DNA sequence encoding the tolerogenic antigen to the next generation of plants.
  • the term "transgenic plants” includes not only the originally engineered plants, but also progeny who retain the transgene in functional form. It also includes hybrids of transgenic and nontransgenic plants if the hybrids express the transgene.
  • Transgenic seed can be collected from transgenic plants and the level of gene expression of the tolerogenic antigen in the seed can be determined as described above. The level of gene expression of the tolerogenic antigen in the seed is preferably that amount that provides for effective prevention, inhibition or treatment of the particular autoimmune disease or allergic reaction treated.
  • the transgenic plants of the present invention can be incorporated into a patient's diet in the form of a food.
  • the term "food” or “food product” as used herein, is intended to include articles defined as "food” by the Federal Food, Drug and Cosmetic Act, Sec. 201(g), i.e., "(1) articles used for food or drink for man or other animals, (2) chewing gum, and (3) articles used for components of any other such article” . It also includes “food additives", as defined by Section 201 (s) of that act.
  • the food may be a fresh, partially processed, or fully processed food, including a canned, frozen or dry food, or a beverage.
  • the USFDA has standards of identity for, e.g., frozen desserts (part 135) , bakery products (part 136) , cereal flours (part 137) , macaroni and noodle products (part 139) , canned fruits (part 145) , canned fruit juices (part 146) , fruit butters, jellies, preserves and related products (part 150), fruit pies (part 152) , canned vegetables (part 155) , vegetable juices (part 156), frozen vegetables (part 158), cacao products (part 163), tree nut and peanut products (part 164), nonalcoholic beverages (part 165) , sweetners and table syrups (part 168) , and food dressings and flavorings (part 169) , which could derived in whole or part from a transgenic plant.
  • the food products are not limited to standardized foods.
  • the whole plant, a plant part, or a product derived from the plant e.g., a juice, soup, candy bar, cake, or cracker, may be fed to the patient.
  • the transgenic plants or parts thereof can be incorporated in standard recipes using conventional food or beverage preparation techniques.
  • the amount of the transgenic plant, plant part or other plant derived material added to the diet is that amount that provides sufficient tolerogenic antigen to prevent, inhibit, treat or otherwise protect against the autoimmune disease or allergic reaction.
  • the amount of tolerogenic antigen administered in the diet will vary depending upon the type of autoimmune disease or allergic reaction, the frequency of administration, the weight of the patient, and the frequency of administration.
  • the appropriate quantity of the tolerogenic antigen contained in the plant materials can be determined using standard methodology. Once the amount of tolerogenic antigen in the food is determined, the amount of the food to be included in the diet can be calculated.
  • the food can be administered by incorporating the plant, plant organs and/or seed material into a patient's daily diet, either daily or on another periodic basis.
  • tolerizing agents such as the histamine derivatives of W093/13772, may, if orally compatible, likewise be incorporated into the food or beverage .
  • Transgenic plant or plant parts or other plant -derived food products, containing a tolerogenic antigen provide a low cost, easy to administer composition for treating autoimmune disease or allergic reaction.
  • a pharmaceutical composition may be prepared.
  • the pharmaceutical composition may include an extract including the tolerogenic antigen from a transgenic plant which provides for protection from the autoimmune disease or allergic reaction for which the antigen is specific.
  • oral administration of a pharmaceutical composition of the present invention can be used to treat a patient suffering from an autoimmune disease or allergic reaction as well as to prevent development of an autoimmune diseases or allergic reaction.
  • the pharmaceutical composition of the invention is preferably administered orally, such as by preparing the transgenic plant as part of the diet of the patient.
  • An effective oral dose of the pharmaceutical composition can be readily determined by one skilled in the art.
  • intranasal administration may be appropriate. However, any standard route, e.g., intravenous, subcutaneous or intramuscular, may be employed.
  • EXAMPLES Examples 2-7 are based on WO94/02620 (USP 5,563,055) and WO97/10347.
  • Plant vectors Containing MBP Plant vectors were constructed which contain huMBP by isolating huMBP cDNA from human brain Quick-Clone cDNA (Clonetech, Palo Alto, CA) using polymerase chain reaction and MBP spe c i f i c ol igome rs : 5 ' o l igomer 5 ' TCCCCCGGGATGGCATCACAGAAGAGACCC3 ' containing the restriction enzyme site for Smal and 3' oligomer 5 ' GCTCTAGAGCTCTCAGCGTCTCGCCATGGGAGA3 ' containing the restriction enzyme sites for Sad and Xbal.
  • the 516 base pair PCR fragment coding for human MBP was digested with Sad and Xbal and cloned into the Sad and Xbal sites of the baculovirus transfer expression vector pVL1393 (PharMingen, San Diego, CA)
  • the clone MBP1393 containing the huMBP was isolated and confirmed by DNA sequencing . This clone was used to generate recombinant huMBP baculovirus.
  • Baculovirus expressed huMBP is analyzed for reactivity with a panel of MBP specific monoclonal antibodies obtained from (Biogenesis , Inc . Sandown,NH) . This material is used as a positive control in western and ELISA analysis of MBP expression in transgenic plants.
  • the Smal/SacI fragment containing the huMBP fragment was subcloned from MBP1393 into the Sad and Smal sites of plant expression vectors IBT140 and IBT110, obtained from Dr. Hugh Mason, Boyce Thompson Institute for Plant Research.
  • the IBT110 vector is described in Tariq et al . (49) and the IBT140 vector is described in Mason et al (50) .
  • the IBT110 expression cassette contains a dual enhancer 35S promoter, whereas the IBT140 expression cassette contains a patatin promoter.
  • the 35S promoter is a constitutive promoter, whereas the patatin promoter is tuber specific.
  • Both expression vectors contain an NTP II cassette for selection of kanamycin resistance, the TEV leader sequence at the 5' end of the inserted gene to enhance translation, the soybean vspB terminator at the 3' end of the inserted gene, and T-DNA boarder sequences for transfer of the foreign DNA into the plant genomic DNA.
  • the recombinant MBP110 and MBP140 clones were isolated and confirmed by DNA sequence analysis.
  • the huMBP fragment was modified to containing a 6xhis- tag-peptide sequence at the carboxy terminus to facilitate concentration or screening of the recombinant proteins expressed in transgenic plants.
  • the huMBP-6xhis was generated from clone MBP1393 using PCR and the following oligomers: 5' oligomer 5 ' AGAGAGGCTGAAGCTAGATCTGGATCCA ATGGCGTCACAGAAGAGACCCTCC3 ' containing the restriction enzyme sites for Bglll and BamHI and 3' oligomer
  • Plant vectors were constructed which contain 833 base pair huPLP were constructed in a similar fashion from human brain Quick-Clone cDNA (Clonetech, Palo Alto, CA) using polymerase chain reaction and huPLP specific oligomers: 5' oligomer 5 ' CGCATGGATCCGTTAGAGTGCTGTGCAAGATGTCT3 ' containing the restriction enzyme site BamHI and 3' oligo 5 ' TCGCGAGCTCGGGATCAGAAC3 ' containing the restriction enzyme site Sad .
  • the PCR fragment was cloned into the pGemT vector (Promega, Corp. Madison, WI).
  • Recombinant MBP110 and MBP140 clones were isolated from E. coli and transferred to Acjrobacterium tumefaciens strain LBA4404.
  • the transformed Agrobacterium strains carrying either the MBP140 of MBP110 were used to transform potato plants (Solarium tuberosumn, variety "Frito-Lay” 1607) by leaf-disc co-cultivation methods (49, 51) .
  • Kanamycin-resistant calli are transferred to shoot-induction media, and individual shoots are isolated form the calli and transferred to rooting media.
  • MBP positive transformants are propagated vegetatively by stem tissue culture. After multiplying, the transformants are transferred to soil and grown in a plant growth chamber for production of tuber material for animal feeding. Previous reports indicate a mouse will consume 5 grams of tuber material within a 2 to 6 hour time period (49) . The amount of MBP per gram of tuber is quantitated prior to feeding. Low yields of huMBP6xhis can be concentrated using TALON metal affinity resin (Clonetech Laboratories, Palo Alto, CA) .
  • An expression cassette for expression of Type II collagen in corn which is useful for treating rheumatoid arthritis, can be formed as follows:
  • the DNA sequence coding for human type II collagen is isolated from cDNA obtained from human chondrocytes (61) , using polymerase chain reaction and hu-type II collagen specific oligomers.
  • the plasmid contains the T6 ubiquitin promoter and intron with a Pinll termination sequence.
  • the gene can be blunt end ligated into the sites or additional cloning sites could be inserted to make this compatible with other genes that provide for constitutive expression of a heterologous gene under control of the ubiquitin promoter.
  • cDNA can be prepared from mRNA using reverse transcriptase and oligo dT primers or a specific primer designed from the known DNA sequence (GenBank accession number L10347) .
  • Double stranded cDNA can be dC-tailed using terminal transferase and annealed to a dG-tailed restriction endonuclease cleaved vector, or cDNA can be amplified using PCR and specific primers which incorporate restriction enzyme sites at the 5' ends to facilitated site directed cloning of the PCR product encoding the hu-type II collagen into the compatibility cleaved vector.
  • the vectors can be introduced into a bacterial host cell, and transformants carrying antigen inserts can be identified using probes designed for the known DNA sequence or by using antibodies specific for the type II collagen.
  • DNA sequence coding for type II collagen can be subcloned into plant expression vectors such as the modified vector sites so that the expression of this DNA sequence is under control of the ubiquitin promoter. Plasmids including the DNA sequence coding the type II collagen can be selected by examining the restriction digest patterns from plasmids that were isolated from cells growing on ampicillin. This sequence is confirmed by DNA sequencing.
  • transgenic corn plants Once formed, a vector carrying a DNA sequence coding for type II collagen under control of a promoter functional in the plant can be used to form transgenic corn plants.
  • a method for formation of transgenic corn plants is described in European Patent Application No. 0442 174A1, the entire contents of which are hereby incorporated by reference. A brief description of that methodology follows.
  • a vector carrying a DNA sequence coding for type II collagen formed as described in Example 2 can be introduced into corn tissue suspension cells by microparticle bombardmen .
  • a construct containing a 35S expression cassette can be cotransformed with the type II collagen to allow for easy selection of transformed plants.
  • the 35S cassette is disclosed in Gordon-Kamm et al . , The Plant Cell 2:603-18 (1990).
  • 35S contains the BAR gene, which has been shown to impart resistance to glufosinate selective agents in cells.
  • germ cells are used, including those derived from a meristem of immature embryos.
  • Suspension cell lines are also available to generate embryogenic suspension cultures.
  • embryogenic suspension cultures can be derived from type II embryogenic culture according to the method of Green et al . , Molecular Genetics of Plants and Animals, editors Downey et all, Academic Press, NY 20, 147 (1983) .
  • the callus can be initiated from maize inbreds .
  • Suspension cultivars of the cultivar "Black Mexican Sweet" (BMS) can be obtained from Stanford University.
  • the cultures can be maintained in Murashige and Skoog (MS) medium as described in Murashige et al., Physio.
  • the suspension cultures are passed through a 710 micron sieve seven days prior to the experiment and filtrate can be maintained in MS medium.
  • cells are harvested from the suspension culture by vacuum filtration on a Buchner funnel (Whatman No. 614). Alternatively, callus cells can be passed through a sieve and used for bombardment .
  • a 100 ml (fresh weight) of cells Prior to the microparticle bombardment, a 100 ml (fresh weight) of cells are placed into a 3.3 cm petri plate. The cells are dispersed in 0.4 mL fresh culture medium to form a thin layer of cells The uncovered petri plate is placed in the sample chamber of a particle gun device manufactured by Biolistics Inc., Geneva, NY. A vacuum pump is used to reduce the pressure in the chamber to 0.1 atmosphere to reduce deceleration of the microparticles by air friction. The cells are bombarded with tungsten particles having an average diameter of about 1.2 microns, obtained from GTE Sylvania Precision Materials Group, Towanda, PA.
  • the microparticles have a DNA loading consisting of equal mixtures of the selectable and nonselectable plasmids.
  • the DNA is applied by adding 5 microliters of 0.1 g% suspension of 50 mg of tungsten particles per mL distilled water in a 1.5 mL Eppendorf tube. Particles become agglomerated and settle.
  • Cultures of transformed plant cells containing the foreign gene are cultivated for 4-8 weeks in 560R medium (N6-based medium with 3 mg/mL of bialophos) . After this time, only cells that received the BAR gene are able to proliferate. These events are rescued and identified as transformants. The putative transformants are then tested for the presence of integration of Type II Collagen DNA by PCR.
  • Transient expression of the DNA sequence coding for the type II collagen at 24-72 hours after bombardment can be detected using Western blots, ELISA and antibodies to the type II collagen.
  • Embryo formation can then be induced from the embryogenic cultures to the stage of maturing and germination into plants.
  • a two culture medium sequence is used to germinate somatic embryos observed on callus maintenance medium.
  • Callus is transferred first to a culture medium (maturation medium) which, includes 5.0 mg/L indoleacetic acid.
  • the callus culture remains on this medium for ten to fourteen days while callus proliferation continues at a slower rate.
  • an amount of 50 mg of callus per plate is especially preferred.
  • somatic embryos Toward the end of this culture phase, observation under a dissecting microscope often indicates somatic embryos have begun germinating, although they are white in color because this culture phase is conducted in darkness.
  • callus is transferred from "maturation" medium to a second culture medium which further promotes germination of the somatic embryos into a plantlet.
  • This culture medium has a reduced level of IAA versus the first culture medium, preferably a concentration of about 1 mg/L.
  • the cultures are placed into the light.
  • Germinating somatic embryos are characterized by a green shoot which elongates often with a connecting root access. Somatic embryos germinate in about ten days and are then transferred to medium in a culture tube
  • the plants are about 7-10 cm tall, and are of sufficient size and vigor to be hardened off to greenhouse conditions.
  • plants are removed from the sterile containers and solidified agar medium is rinsed off the roots.
  • the plantlets are placed in a commercial potting mix in a growth chamber with a misting device which maintains the relative humidity near 100% without excessively wetting the plant roots. Approximately three or four weeks are required in the misting chamber before the plants are robust enough for transplantation into pots or into field conditions. At this point, many plantlets, especially those regenerated from short term callus cultures, will grow at a rate into a size similar to seed derived plants.
  • Ten to fourteen days after pollination the plants are checked for seed set. If there is seed, the plants are then placed into a holding area in the greenhouse to mature and dry down.
  • the DNA sequence coding for type II collagen can be inserted into an expression cassette under control of the waxy promoter for seed specific expression.
  • a cassette is present in a vector that has the waxy regulatory sequences and a heterologous gene encoding sequence, and can be inserted into appropriate restriction enzyme sites.
  • the heterologous gene can be blunt end ligated or additional cloning sites can be added to make them compatible with the coding sequence of the heterologous gene .
  • Transgenic corn containing the DNA sequence coding for human type II collagen can be obtained as described in Example 3 or as described in US patent 5 , 591, 616 , the entire contents of which are hereby incorporated by reference . A brief description of that methodology follows. This method of transforming a cultured tissue during dedifferentiation process or a dedifferentiated cultured tissue of said monocotyledon with bacterium belonging to genus Agrobacterium containing a desired gene.
  • This DNA sequence can be inserted into the multiple cloning site in the plasmid using standard methods.
  • a plasmid including a DNA sequence coding for human type II collagen under control of a seed specific promoter can be selected and isolated by examining the restriction patterns of the recombinant plasmid and sequencing.
  • Corn cells are transformed by microparticle bombardment as describe in Example 3. Transformed cells containing a DNA sequence coding for human type II collagen can be identified and selected by PCR. Transgenic corn plants and seeds can be regenerated as described in Example 3. Expression of human type II collagen in seeds can be confirmed and quantitated by ELISA or Western blot analysis. Stability of the expression of the human type II collagen can be evaluated by these same methods over successive generations.
  • An expression cassette can be formed for expression of S-antigen and/or interphotoreceptor retinoid-binding protein under control of the promoter for the seed storage protein phaseolin.
  • the expression cassette can be formed with a DNA sequence encoding S-antigen and a DNA sequence encoding interphotoreceptor retinoid-binding protein under control of the single promoter to form a dicistronic construct, or each DNA sequence can be placed under control of its own promoter but the same promoter.
  • the expression cassette is present in a vector such as pPHI4852.
  • Plasmid is prepared by linking the phaseolin upstream regulator region adjacent to the downstream region of the phaseolin gene, but not including the coding sequence of the gene itself. Plasmid has restriction enzyme sites that can be used to insert heterologous genes downstream form the phaseolin promoter. The phaseolin promoter has been used successfully to express the Brazil nut protein in soybeans, canola and tobacco.
  • a DNA sequence coding for S-antigen can be obtained using standard methods as described in Maniatis et al . , op. cit.
  • a DNA sequence encoding S-antigen or interphotoreceptor retinoid-binding protein can be obtained by PCR amplification of S-antigen cDNA using specific primers. Briefly, cDNA synthesis of mRNA can be conducted using reverse transcriptase and specific primers. Primers can be designed from a known DNA sequence for S-antigen (GenBank Accession X12453) or interphotoreceptor retinoid-binding protein (GenBank Accession M22453) .
  • Double stranded cDNA synthesis can be performed and adaptors can be ligated onto the ends of the cDNA sequence to provide for ease of cloning into a vector or cDNA can be amplified using PCR and specific primers which incorporate restriction enzyme sites at their 5' ends to facilitated site directed cloning of the PCR product encoding the antigen into the compatibly cleaved vector.
  • the cDNA sequences can then be introduced into a vector such as pucl9 and amplified in bacterial host cells.
  • Transformants containing S-antigen or interphotoreceptor retinoid-binding protein inserts can be screened by hybridization to a probe designed based on a known DNA sequence for S-antigen or interphotoreceptor retinoid-binding protein. Once the DNA sequence encoding the desired protein is isolated, the DNA sequence can be ligated into plant expression vectors at an appropriate cloning sites so that its expression is controlled by the phaseolin promoter. Plasmid, including a DNA sequence encoding S-antigen or interphotoreceptor retinoid-binding protein, can be selected, amplified, and isolated by examining the restriction digestion patterns of plasmids form cells growing in kanamycin.
  • the DNA sequence coding for interphotoreceptor retinoid-binding protein can be obtained in another manner. Briefly, mRNA from host tissue is isolated, poly-A selected and reverse transcribed with oligo dT priming. Single stranded cDNAs are tailed at 3' ends with oligo d(C) and primed with oligo d(G) and transcribed with reverse transcriptase or cDNA can be amplified using PCR and specific primers which incorporate restriction enzyme sites at their 5' ends to facilitated site directed cloning of the PCR product encoding the antigen into the compatibility cleaved vector. Double stranded cDNAs are inserted at a restriction endonuclease site of a vector.
  • Transformants having inserts encoding interphotoreceptor retinoid- binding protein can be identified by hybridization to probes designed from the known sequence of interphotoreceptor retinoid-binding protein. Once isolated and identified, cDNA sequence encoding interphotoreceptor retinoid-binding protein can be subcloned from a plasmid such as pucl9 to a binary vector.
  • the DNA sequence coding for interphotoreceptor retinoid-binding protein can be subcloned in to a plant expression vector appropriate cloning site so that its expression is controlled by the phaseolin promoter. Alternatively, it can be subcloned immediately downstream from the DNA sequence coding for S-antigen to form a dicistronic construct under control of a single phaseolin promoter. Plasmid pPHI4752, including a DNA sequence encoding
  • S-antigen can be selected, amplified, and isolated as above.
  • the expression cassette can then be subcloned into a binary vector.
  • the binary vector carrying the expression cassette coding for S-antigen and/or interphotoreceptor retinoid-binding protein is introduced in Agrobacterium tumesfasciens LBA4404 (available form Clone Tech, Palo Alto, CA) or other disarmed A. tumesfasciens strains by the freeze-thaw method.
  • Transgenic soybean plants can be formed according to the method described in U.S. Patent Application Serial No. 07/920,409, the entire contents of which are hereby incorporated by reference.
  • Soybean (glycine max) seed is surface sterilized by exposure to chlorine gas evolved in a glass bell jar. The gas is produced by adding 3.5 mL hydrochloric acid (34 to 37% w/w) to 100 mL 5.25% w/w sodium hypochlorite . Exposure is for 16 to 20 hours in a container approximately one cubic foot in volume. Surface sterilized seed is stored in petri dishes at room temperature. Seed is germinated by plating 1/10 strength agar solidified medium according to Ga bourg [B5 basal medium with minimal organics, Sigma Chemical Catalog No.
  • LB4404 harboring the modified binary plasmid pPHI1680 as described above are grown to log phase in minimal A medium containing 1 microgram/mL tetracycline, are pooled, and an optical density measurement is taken at 550 nanometers.
  • the inoculation medium consists of 3.2 g/L B5 salts (G5893); 2.0% w/v sucrose; 45 ⁇ moles 6-benzylaminopurine (BAP) ; 0.5 ⁇ M indolebutyric acid (IBA); 100 ⁇ M acetosyringone; and was buffered to pH 5.5 with 10 mM MES. Resuspension is by vortexing. The inoculum is then poured into a petri dish containing a prepared seed and the cotyledonary nodes are macerated with a surgical blade. This is accomplished by dividing the seed in half by the longitudinal section through the shoot apex, preserving the two whole cotyledons.
  • the two halves of the shoot apex are then broken off of their respective cotyledons by prying them away with a surgical blade.
  • the cotyledonary node is then macerated with a surgical blade by repeated scoring along the axis of symmetry. Care was taken not to cut entirely through the explant to the abaxial side.
  • Explants are prepared in roughly about five minutes and then incubated for 30 minutes at room temperature without agitation. After 30 minutes, the explants are transferred into plates of the same medium solidified with 0.2% w/v/ Gelrite (Merck & Company, Inc.) .
  • Explants are imbedded with the adaxial side up and leveled with the surface of the medium and cultured at 22 °C for three days under cool white fluorescent light, approximately 20 ⁇ EM 2 S 1 . After three days, the explants are moved to liquid counterselection medium.
  • the counterselection medium consisted of 3.2 g/L B5 salts, 2% w/v sucrose; 5 ⁇ M BAP; 0.5 ⁇ M IBA, 200 ⁇ g/L vancomycin; 500 ⁇ g/mL cefotaxime; and was buffered to pH 5.7 with 3 mM MES. Explants are washed in each petri dish with constant slow gyratory agitation at room temperature for four days. Counterselection medium is replaced four times.
  • the explants are then picked to agarose/solidified selection medium.
  • the selection medium consisted of 3.2 g/L B5 salts, 2% w/v sucrose, 5.0 ⁇ M BAP, 0.5 ⁇ M IBA, 50 ⁇ g/mL kanamycin sulfate, 100 ⁇ g/mL vancomycin, 30 ⁇ g/mL cefotaxime, 30 ⁇ g/mL timentin, and is buffered to pH 5.7 with 3 mM MES.
  • Selection medium was solidified with 0.3 w/v Seakem Agarose .
  • the explants are imbedded in the medium, adaxial side down, and cultured at 28°C with a 16 hour day length in cool while fluorescent illumination of 60 to 80 ⁇ EM 2 S 1 .
  • explants After two weeks the explants are again washed with liquid medium on the gyratory shaker. The wash is conducted overnight, in counterselection medium containing 50 ⁇ g/mL kanamycin sulfate. The following day, explants are placed to agarose/solidified selection medium. They are imbedded in the medium with the adaxial side down and cultured for another two week period.
  • Elongation medium consists of 3.2 g/L B5 salts, 2% w/v sucrose, 3.3 ⁇ M IBA, 1.7 ⁇ M gibberellic acid, 100 ⁇ g/mL vancomycin, 30 ⁇ g/mL cefotaxime, and 30 ⁇ g/mL timentin, buffered to pH 5.7 with 3 mM MES.
  • Elongation medium is solidified with 0.2% w/v Gelrite. The green sectors are embedded with adaxial side up and cultured as before.
  • Rooting medium consists of 3.2 g/L B5 salts, 15 g/L sucrose, 20 ⁇ M nicotinic acid, 900 mg/L pyroglutamic acid, and 10 ⁇ M IBA.
  • the rooting medium is buffered to pH 5.7 with 3 mM MES and solidified with 0.2% w/v Gelrite.
  • the shoots are transferred to the same medium without IBA or PGA. Shoots are rooted and held in these tubes under the same environmental conditions as before.
  • the plantlet is transferred to sterile soil mixed in plantcons. Temperature, photoperiod and light intensity remain the same as before.
  • S-antigen and/or interphotoreceptor retinoid-binding protein in transgenic soybean plants can be confirmed by PCR and quantitated using ELISA or Western blot analysis. Stability of expression can be evaluated by these same methods over successive generations.
  • An expression cassette encoding S-antigen and/or interphotoreceptor retinoid binding protein can be used to generate transgenic sunflower seeds and plants.
  • the DNA sequence coding for S-antigen and/or interphotoreceptor retinoid-binding protein can be inserted into an expression cassette under control of the napin promoter for seeds specific expression.
  • Plasmid includes a plant transcription unit for the gene NPTII, which can be used in selecting transformed cells and appropriate cloning sites that provides for seed specific expression under control of the napin promoter. This promoter has been used successfully to express WGA and beta-glucuronidase genes in canola seeds .
  • a DNA sequence encoding S-antigen and/or interphotoreceptor retinoid-binding protein can be obtained as described in Example 5. The DNA sequence can be subcloned into the plant expression vector. Plasmids having a DNA sequence encoding S-antigen and/or interphotoreceptor retinoid binding protein be selected, amplified, and isolated by using phage cDNA libraries as described in Maniatis et al .
  • This expression cassette is then subcloned into a binary vector using the appropriate cloning sites and transferred to Agrobacterium tumesfasciens strain LBA4404.
  • Sunflower plants can be transformed with Agrobacterium strain LBA4404 by microparticle bombardment as described by Bidney et al . , Plant Mol . Bio. 18:301 (1992). Briefly, sunflower seeds are dehulled and the surface sterilized. The seeds are imbibed in the dark at 26°C for eighteen hours on filter paper moistened with water. The cotyledons and root radical are removed and meristem explants cultured on 374BGA medium (MS salts, Shephard vitamins, 40 ml/L adenine sulfate, 3% sucrose, 0.8% phytagar pH 5.6, plus 0.5 mg/L BAP, 0.25 ml/L IAA and 0.1 mg/L GA.
  • the primary leaves are removed to expose the apical meristem and the explants are placed with the apical dome facing upward in a 2 cm circle in the circle of a 60 mM by 20 mM petri plate containing water agar.
  • the explants are bombarded twice with tungsten particles suspended in TE buffer as described above, or with particles associated with the plasmid.
  • Some of the TE/particle bombardment explants are further treated with Agrobacterium tumesf asciens strain carrying the plasmid by placing a droplet of bacteria suspended in the inoculation medium, OD6002.00, directly onto the meristem .
  • the meristem explants are co-cultured on 374BGA medium in the light at 26°C for an additional 72 hours.
  • Agrobacterium treated meristems are transferred following the 72 hour co-culture period to medium 374 (374BGA with 1% sucrose plug 50 mg/L kanamycin sulfate and no BAP, IAA or GA3 ) and supplemented with 250 ⁇ g/mL cefotaxime.
  • the plantlets are allowed to develop for an additional two weeks under sixteen hour day and 26°C incubation conditions.
  • Green or unbleached plantlets are transferred to medium 374 and grown until they develop seed.
  • the presence of S-antigen and interphotoreceptor retinoid-binding protein can be confirmed and quantitated as described in Example 5.
  • Rheumatoid arthritis Adjuvant Arthritis II collagen in the rat. Collagen- Induce Arthritis in mouse or rats.
  • mice Experimental autoimmune encephalitis (EAE) is induced in six week old female SJL/J mice by inoculation of either MBP-protein or mouse spinal cord homogenate (MSCH) , together with complete Freunds adjuvant. A second immunization is given one week later (53) . The mice develop EAE in about 14-21 days and the first relapse is generally be between 55 and 60 days. Animals showing clinical signs are graded and separated from asymptomatic animals. Animals with R-EAE (relapsing-remitting experimental autoimmune encephalitis) are divided into two groups, those that are fed transgenic plant material expressing MBP and those that are not. The controls include animals receiving complete Freunds adjuvant but not MBP or MSCH, and normal age and sex match animals.
  • mice are observed for clinical signs several days a week until the first relapse, at which time they are observed daily.
  • the grading system used has been described by Kolowski et al . (54) and Kennedy et al . (55) in chronic EAE in SJL/J: Grade 0, no abnormality Grade 1, slow, sluggish; Grade 2, limp tail; Grade 3, limp tail and hind limb weakness (waddling gait) ; Grade 4, partial hind limb paralysis; Grade 5, complete hind limb paralysis; Grade 6, animal immobile; Grade 7, moribund.
  • the length of time to relapse is evaluated and the change in grade, if present at the end of relapse, is assessed.
  • Controls include R-EAE animals and normal animals. All animals are subjected to clinical and histological examination. No disease is induced in normal control animals treated with MBP.
  • This animal model displays many of the histopathological and clinical similarities to relapsing-remitting forms of MS (28) .
  • the mechanisms involved in the disease process have been the subject of intense study for several years using a mouse model of experimental autoimmune encephalitis (EAE) .
  • EAE can be induced in SJL mice by injection of mouse spinal cord homogenate (MSCH) , MBP, or PLP, the injection of synthetic peptides whose sequence corresponds to the major encephalitogenic epitopes of myelin basic protein MBP 84-104 and proteolipid protein PLP 139-151 or by adoptive transfer of activated CD4+ T H 1 cells, but not T H2 cells, specific for encephalitogenic epitopes.
  • MSCH mouse spinal cord homogenate
  • MBP myelin basic protein
  • PLP proteolipid protein
  • the disease is characterized by a relapsing-remitting course of neurological dysfunction (R-EAE) , perivascular mononuclear infiltration and demyelination .
  • CNS damage is mediated by inflammatory cytokines which can activate additional monocytes and macrophages non-specifically (29,30).
  • the PL/J or H-2 mouse is unlikely to have a relapsing course although EAE is more specifically a MBP induced disease in this strain than it is in SJL/J.
  • the (SJL/J x PL/J) Fl also develops a chronic relapsing disease that has a combination of encephalogenic epitopes that it sees (33, 34) .
  • mice are observed daily over a six month period in order to determine their clinical status, assessed as described above. Differences among experimental groups are analyzed for statistical significance, using the
  • MBP is efficacious for the animals in which disease was induced by MBP since determinant spreading in the MSCH-induced disease appears to focus mainly on secondary PLP epitopes.
  • animals graded as to clinical condition, are sacrificed after 15, 30 and 90 days.
  • the brain and spinal cord are rapidly removed.
  • a small area of each brain and two 5 mm areas of the spinal cord, cervical and thoracic, are fixed for histology and the degree of severity of the inflammatory response is graded by counting inflammatory foci. Sections are taken from the same region of the brain and the cervical and thoracic of the spinal cord for each mouse . Grading of the inflammatory response is accomplished in 20 consequence fields and assessed 150 microns apart at 100 x magnification.
  • the response are graded as 1+ mild, 1-3 small foci; 2+, moderate, more than 3-7 foci and containing at least 10 cells per foci; 3+, severe, large foci of 15 to 25 cells including perivascular and meningeal collections.
  • the studies are read in a blind fashion. Evaluation for histological scores include mean grading of 20 sections per animal, and comparisons of individual animals by Student's t test. Clinical pathologic correlations are made comparing the clinical grade with the pathological score after the code is broken. Statistical analysis has been described above.
  • PLP proteolipid protein
  • mice are treated with antibody to MBP.
  • the alteration of serum concentration of MBP is measured and compared with the clinical and histological status of the mice. If the mice suffer relapse, extinction of the protein becomes a critical parameter and serum MBP is important. If the mice do not relapse, they are again challenged with either MBP or MSCH in order to determine whether disease can be reinduced and whether the severity of the disease has been altered.
  • the protocol of Lindsey et al . (56) is followed with the highest reinduction at 12 weeks.
  • MSCH are used and reinduced just prior to the second relapse.
  • Potato contains a large percentage of protein/gram weight of tissue.
  • tuber specific promoter from a gene encoding patatin; this family of protein accounts for 40% of the protein in potato tubers (52) . Expression with this promoter directs synthesis of the MBP in the tuber portion of the potato.
  • Additional benefits of using potato include the short amount of time required to generate transgenic plants and tube material
  • a more palatable delivery vehicle may be in the form of vegetable or tomato juice or an edible fruit or vegetable
  • the potato material can be incorporated into a shake and flavored according to personal preference by addition of strawberries, bananas, etc.
  • Additional plant promoters and plant expression vectors have been reported in the literature that can also be used.
  • researchers have succeeded in producing recombinant proteins in plant seeds that constitute over ten percent of the seed's total protein. In soybeans this accounts for four percent of the dry weight of the seed. Foreign proteins expressed in this system are protected from degradation due to the natural environment of the seed which is lyophilized and low in proteases .
  • Preferred plant promoters are those that express the foreign protein at about 0.1 to about 10% of the total plant protein. Based upon nutrient analysis figures obtained from the USDA, a potato weighing 202 grams is comprised of 71% water, 25% carbohydrate, 2.5% protein, with the remaining portion being comprised of various nutrients. Assuming expression levels between 10 and 0.1% of the total protein, this results in 500 mg to 5 mg per MBP potato, respectively.
  • the current dose used in human clinical trials for treatment of MS is 300 mg of bovine derived myelin containing approximately 7.5 mg of MBP and 15 mg of PLP (6, 57, 60) or a dose of 0.1 to 0.5 mg of chicken type II collagen or 1 to 10 mg of bovine type II collagen for the treatment of rheumatoid arthritis (59) .
  • Recent studies on the effects of low dose (ranging from 0.5 mg to 5 mg) vs. high dose (ranging from 20 mg to 500 mg) induction of tolerance in rats or mice indicate active suppression at low doses and anergy and/or deletion at high doses (2,3,4).
  • the delivery of the antigen by consumption of the transgenic plant may facilitate its passing through the stomach and into the gut and thereby enhance the presentation and uptake in a soluble form that would induce tolerance .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Insects & Arthropods (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Veterinary Medicine (AREA)
  • Rheumatology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Botany (AREA)
  • Nutrition Science (AREA)
  • Polymers & Plastics (AREA)
  • High Energy & Nuclear Physics (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)

Abstract

L'invention concerne l'expression d'auto-antigènes et d'allergènes dans des plantes transgéniques et les plantes, ou des produits qui en sont dérivés, utilisées sous forme de produits alimentaires ou de boissons pour prévenir ou traiter des maladies auto-immunitaires ou des réactions allergiques.
PCT/US1997/013634 1996-08-15 1997-08-05 Administration d'antigenes tolerogeniques via des plantes comestibles ou des produits derives de plantes WO1998006861A2 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU38254/97A AU3825497A (en) 1996-08-15 1997-08-05 Delivery of tolerogenic antigens via edible plants or plant-derived products
EP97935275A EP0939826A2 (fr) 1996-08-15 1997-08-05 Administration d'antigenes tolerogeniques via des plantes comestibles ou des produits derives de plantes
CA002263730A CA2263730A1 (fr) 1996-08-15 1997-08-05 Administration d'antigenes tolerogeniques via des plantes comestibles ou des produits derives de plantes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US2397396P 1996-08-15 1996-08-15
US60/023,973 1996-08-15

Publications (2)

Publication Number Publication Date
WO1998006861A2 true WO1998006861A2 (fr) 1998-02-19
WO1998006861A3 WO1998006861A3 (fr) 1998-05-14

Family

ID=21818189

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/013634 WO1998006861A2 (fr) 1996-08-15 1997-08-05 Administration d'antigenes tolerogeniques via des plantes comestibles ou des produits derives de plantes

Country Status (4)

Country Link
EP (1) EP0939826A2 (fr)
AU (1) AU3825497A (fr)
CA (1) CA2263730A1 (fr)
WO (1) WO1998006861A2 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998027202A1 (fr) * 1996-12-17 1998-06-25 Meristem Therapeutics S.A. Collagenes recombinants et proteines derivees produits par les plantes, leurs procedes d'obtention et leurs utilisations
WO2000008142A2 (fr) * 1998-08-03 2000-02-17 Mpb Cologne Gmbh Molecular Plant & Protein Biotechnology Proteine de fibre et sa production
WO2000020612A2 (fr) * 1998-10-07 2000-04-13 Syngenta Participations Ag Proteines vegetales a action therapeutique
WO2000047610A2 (fr) * 1999-02-10 2000-08-17 Panacea Pharmaceuticals, Llc Procede de modification des reponses immunes, indesirables, aux polypeptides
WO2001077353A2 (fr) * 2000-04-05 2001-10-18 Syngenta Participations Ag Proteines therapeutiquement actives dans des vegetaux
FR2841906A1 (fr) * 2002-07-05 2004-01-09 Stallergenes Sa Molecule d'acide nucleique codant une preproproteine d'allergene d'un acarien du genre dermatophagoides ou euroglyphus et son utilisation pour la production dudit allergene dans les plantes
EP1615491A2 (fr) * 2003-03-18 2006-01-18 Rutgers, The State University Transformation vegetale amelioree
US7112719B2 (en) * 1997-02-27 2006-09-26 Biogemma Use of male sterility to prevent transgene spread in plants

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990008161A1 (fr) * 1989-01-12 1990-07-26 The Blood Center Of Southeastern Wisconsin Modulation par peptides mediateurs de la reconnaissance d'antigenes par les lymphocytes t, utilises comme moyens d'affectation de reactions immunitaires
WO1992006708A1 (fr) * 1990-10-15 1992-04-30 Brigham And Women's Hospital Traitement de maladies auto-immunes par administration orale d'auto-antigenes
WO1994020135A1 (fr) * 1993-03-04 1994-09-15 Edible Vaccines Inc. Vaccins exprimes dans des plantes
WO1995008347A1 (fr) * 1993-09-21 1995-03-30 London Health Association Procedes et produits destines a la regulation de reponses immunes chez les mammiferes
WO1995027500A1 (fr) * 1994-04-08 1995-10-19 Brigham And Women's Hospital TRAITEMENT DE MALADIES AUTO-IMMUNES AVEC DES AGENTS D'INDUCTION DE TOLERANCE ET/OU DES CYTOKINES DE RENFORCEMENT DES Th2 ADMINISTRES PAR VOIE ORALE
WO1995028424A1 (fr) * 1994-04-14 1995-10-26 Immulogic Pharmaceutical Corporation Formulations pharmaceutiques a base de peptides utiles pour traiter l'allergie aux acariens detriticoles
WO1995030435A2 (fr) * 1994-05-10 1995-11-16 Immulogic Pharmaceutical Corporation Compositions et traitement de la sclerose en plaques
WO1996012737A2 (fr) * 1994-10-25 1996-05-02 Immulogic Pharmaceutical Corporation Compositions et traitement pour la sclerose en plaques
WO1996040229A1 (fr) * 1995-06-07 1996-12-19 Thomas Jefferson University Vaccins synthetises a l'aide de plantes transgeniques

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990008161A1 (fr) * 1989-01-12 1990-07-26 The Blood Center Of Southeastern Wisconsin Modulation par peptides mediateurs de la reconnaissance d'antigenes par les lymphocytes t, utilises comme moyens d'affectation de reactions immunitaires
WO1992006708A1 (fr) * 1990-10-15 1992-04-30 Brigham And Women's Hospital Traitement de maladies auto-immunes par administration orale d'auto-antigenes
WO1994020135A1 (fr) * 1993-03-04 1994-09-15 Edible Vaccines Inc. Vaccins exprimes dans des plantes
WO1995008347A1 (fr) * 1993-09-21 1995-03-30 London Health Association Procedes et produits destines a la regulation de reponses immunes chez les mammiferes
WO1995027500A1 (fr) * 1994-04-08 1995-10-19 Brigham And Women's Hospital TRAITEMENT DE MALADIES AUTO-IMMUNES AVEC DES AGENTS D'INDUCTION DE TOLERANCE ET/OU DES CYTOKINES DE RENFORCEMENT DES Th2 ADMINISTRES PAR VOIE ORALE
WO1995028424A1 (fr) * 1994-04-14 1995-10-26 Immulogic Pharmaceutical Corporation Formulations pharmaceutiques a base de peptides utiles pour traiter l'allergie aux acariens detriticoles
WO1995030435A2 (fr) * 1994-05-10 1995-11-16 Immulogic Pharmaceutical Corporation Compositions et traitement de la sclerose en plaques
WO1996012737A2 (fr) * 1994-10-25 1996-05-02 Immulogic Pharmaceutical Corporation Compositions et traitement pour la sclerose en plaques
WO1996040229A1 (fr) * 1995-06-07 1996-12-19 Thomas Jefferson University Vaccins synthetises a l'aide de plantes transgeniques

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BRINER, T.J., ET AL.: "PERIPHERAL T-CELL TOLERANCE INDUCED IN NAIVE AND PRIMED MICE BY SUBCUTANEOUS INJECTION OF PEPTIDES FROM MAJOR CAT ALLERGEN FEL d1" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE USA, vol. 90, August 1993, pages 7608-7612, XP002056822 *
GRIFFITH I J ET AL: "EXPRESSION AND GENOMIC STRUCTURE OF THE GENES ENCODING FDI, THE MAJOR ALLERGEN FROM THE DOMESTIC CAT" GENE, vol. 113, 1992, pages 263-268, XP002033869 *
MA, S.-W., ET AL.: "TRANSGENIC PLANTS EXPRESSING AUTOANTIGENS FED TO MICE TO INDUCE ORAL IMMUNE TOLERANCE" NATURE MEDICINE, vol. 3, no. 7, July 1997, pages 793-796, XP002056824 *
MASON H S ET AL: "TRANSGENIC PLANTS AS VACCINE PRODUCTION SYSTEMS" TRENDS IN BIOTECHNOLOGY, vol. 13, no. 9, September 1995, pages 388-392, XP002024035 *
MUELLER U ET AL: "SUCCESFUL IMMUNOTHERAPY WITH T-CELL EPITOPES OF BEE VENOM PHOSPHOLIPASE A2 (PLA) IN PATIENTS WITH BEE VENOM (BV) ALLERGY" JOURNAL OF ALLERGY AND CLINICAL IMMUNOLOGY, vol. 97, no. 1, PART 03, January 1996, page 426 XP002035179 *
SAYEGH, M.H., ET AL .: "INDUCTION OF IMMUNITY AND ORAL TOLERANCE WITH POLYMORPHIC CLASS II MAJOR HISTOCOMPATIBILITY COMPLEX ALLOPEPTIDES IN THE RAT" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE USA, vol. 89, August 1992, pages 7762-7766, XP002056823 *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998027202A1 (fr) * 1996-12-17 1998-06-25 Meristem Therapeutics S.A. Collagenes recombinants et proteines derivees produits par les plantes, leurs procedes d'obtention et leurs utilisations
US7112719B2 (en) * 1997-02-27 2006-09-26 Biogemma Use of male sterility to prevent transgene spread in plants
WO2000008142A2 (fr) * 1998-08-03 2000-02-17 Mpb Cologne Gmbh Molecular Plant & Protein Biotechnology Proteine de fibre et sa production
WO2000008142A3 (fr) * 1998-08-03 2000-06-08 Mpb Cologne Gmbh Molecular Pla Proteine de fibre et sa production
AU758817B2 (en) * 1998-10-07 2003-04-03 Syngenta Participations Ag Therapeutically active proteins in plants
WO2000020612A2 (fr) * 1998-10-07 2000-04-13 Syngenta Participations Ag Proteines vegetales a action therapeutique
WO2000020612A3 (fr) * 1998-10-07 2000-07-06 Novartis Ag Proteines vegetales a action therapeutique
JP2002526116A (ja) * 1998-10-07 2002-08-20 シンジェンタ・パティシペーションズ・アクチェンゲゼルシャフト 植物における治療活性タンパク質
WO2000047610A2 (fr) * 1999-02-10 2000-08-17 Panacea Pharmaceuticals, Llc Procede de modification des reponses immunes, indesirables, aux polypeptides
WO2000047610A3 (fr) * 1999-02-10 2000-11-30 Panacea Pharm Llc Procede de modification des reponses immunes, indesirables, aux polypeptides
WO2001077353A3 (fr) * 2000-04-05 2002-04-11 Syngenta Participations Ag Proteines therapeutiquement actives dans des vegetaux
WO2001077353A2 (fr) * 2000-04-05 2001-10-18 Syngenta Participations Ag Proteines therapeutiquement actives dans des vegetaux
FR2841906A1 (fr) * 2002-07-05 2004-01-09 Stallergenes Sa Molecule d'acide nucleique codant une preproproteine d'allergene d'un acarien du genre dermatophagoides ou euroglyphus et son utilisation pour la production dudit allergene dans les plantes
WO2004005334A2 (fr) * 2002-07-05 2004-01-15 Stallergenes Sa Molecule d'acide nucleique codant une preproproteine d'allergene d'un acarien du genre dermatophagoides ou euroglyphus et son utilisation pour la production dudit allergene dans les plantes
WO2004005334A3 (fr) * 2002-07-05 2004-05-06 Stallergenes Sa Molecule d'acide nucleique codant une preproproteine d'allergene d'un acarien du genre dermatophagoides ou euroglyphus et son utilisation pour la production dudit allergene dans les plantes
EP1615491A2 (fr) * 2003-03-18 2006-01-18 Rutgers, The State University Transformation vegetale amelioree
EP1615491A4 (fr) * 2003-03-18 2006-07-12 Univ Rutgers Transformation vegetale amelioree

Also Published As

Publication number Publication date
WO1998006861A3 (fr) 1998-05-14
AU3825497A (en) 1998-03-06
EP0939826A2 (fr) 1999-09-08
CA2263730A1 (fr) 1998-02-19

Similar Documents

Publication Publication Date Title
AU758817B2 (en) Therapeutically active proteins in plants
US7683238B2 (en) Production of pharmaceutically active proteins in sprouted seedlings
KR20060035596A (ko) 외래유전자도입 식물로부터 유래된 면역보호성 조성물을제조하기 위한 벡터와 세포
US7361331B2 (en) Plant bioreactors
US7692063B2 (en) Production of foreign nucleic acids and polypeptides in sprout systems
JP4512816B2 (ja) アレルゲン特異的ｔ細胞抗原決定基を植物へ集積させる方法、および該抗原決定基を集積させた植物
EP0939826A2 (fr) Administration d'antigenes tolerogeniques via des plantes comestibles ou des produits derives de plantes
JP5008811B2 (ja) ライノウイルス感染を防止するための免疫接着物
CA2172398C (fr) Methodes et produits pour le controle des reactions immunitaires chez les mammiferes
TW201139672A (en) Immunization of fish with plant-expressed recombinant proteins
JP4500493B2 (ja) 安定なトランスジェニック植物医薬品の作製方法および組成物ならびに避妊薬としてのその使用
EP2206776A1 (fr) Riz à antigène de mite
WO2001077353A2 (fr) Proteines therapeutiquement actives dans des vegetaux
JP3813597B2 (ja) 植物細胞培養でヒトラクトフェリンを大量生産する方法
AU2022426775A1 (en) Expression of eimeria sequences in plants and plant produced vaccine for same
GluB Outline of the Biological Diversity Risk Assessment Report
ZA200102814B (en) Therapeutically active proteins in plants.
MXPA01003465A (en) Therapeutically active proteins in plants
JP2002085068A (ja) 免疫寛容の誘導方法
US20040268434A1 (en) Plant transformation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

AK Designated states

Kind code of ref document: A3

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2263730

Country of ref document: CA

Ref country code: CA

Ref document number: 2263730

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 09242296

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 1997935275

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1998509808

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1997935275

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1997935275

Country of ref document: EP