WO1998005769A2 - Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase - Google Patents

Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase Download PDF

Info

Publication number
WO1998005769A2
WO1998005769A2 PCT/CA1997/000540 CA9700540W WO9805769A2 WO 1998005769 A2 WO1998005769 A2 WO 1998005769A2 CA 9700540 W CA9700540 W CA 9700540W WO 9805769 A2 WO9805769 A2 WO 9805769A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
oligonucleotide
antisense
ribonucleotide reductase
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA1997/000540
Other languages
English (en)
French (fr)
Other versions
WO1998005769A3 (en
Inventor
Jim A. Wright
Aiping H. Young
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genesense Technologies Inc
Original Assignee
Genesense Technologies Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AT97932690T priority Critical patent/ATE309345T1/de
Application filed by Genesense Technologies Inc filed Critical Genesense Technologies Inc
Priority to CA002262776A priority patent/CA2262776C/en
Priority to NZ333802A priority patent/NZ333802A/en
Priority to AU36175/97A priority patent/AU738592C/en
Priority to IL12812497A priority patent/IL128124A0/xx
Priority to EP97932690A priority patent/EP0917569B1/en
Priority to JP50741098A priority patent/JP4301576B2/ja
Priority to DE69734589T priority patent/DE69734589T2/de
Publication of WO1998005769A2 publication Critical patent/WO1998005769A2/en
Publication of WO1998005769A3 publication Critical patent/WO1998005769A3/en
Priority to IL128124A priority patent/IL128124A/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0093Oxidoreductases (1.) acting on CH or CH2 groups (1.17)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/027Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a retrovirus

Definitions

  • TTTLE ANTITUMOR ANTISENSE SEQUENCES DIRECTED AGAINST Rl AND R2 COMPONENTS OF RIBONUCLEOTIDE REDUCTASE
  • the field of this invention relates to methods of controlling the tumo ⁇ genicity and /or metastasis of neoplastic cells Specifically it relates to the use of anhsense sequences directed against the Rl and R2 components of ribonucleotide reductase B ACKC.ROUNP OF THF INVENTION
  • the first unique step leading to DNA synthesis is the conversion of ribonucleotides to their corresponding deoxy ⁇ bonucleotides, a reaction that is catalyzed in a cell cycle specific manner by the housekeeping gene ribonucleotide reductase [Lewis et al., 1978, Reichard, 1993, Wright, 1989a; Wright et al , 1990a; Stubbe, 1989]
  • the mammalian enzyme is composed of two dissimilar dime ⁇ c protein components often called Rl and R2, which are encoded by two different genes located on different chromosomes [Bjorklund et al , 1993, Tonin et al , 1987]
  • Mammalian protein Rl is a homodime ⁇ c structure, with a molecular weight of about 170 kDa, and has substrate sites and alloste ⁇ c effector sites that control enzyme activity and substrate specificity [Wright, 1989; Thelander et al , 1980; Caras et al
  • Rl and R2 are differentially regulated during the cell cycle. There is an S-phase correlated increase m the R2 protein resulting from its de novo synthesis [Lewis et al , 1978, Mann et al, 1988]. The activity of ribonucleotide reductase, and therefore DNA synthesis and cell proliferation, is controlled in proliferatmg cells during the cell cycle by the synthesis and degradation of the R2 component [Eriksson et al., 1984].
  • the rate-limiting R2 component is a phosphoprotein capable of being phosphorylated by the CDC2 and CDK2 protein kinase mediators of cell cycle progression [Chan et al., 1993], and contains non-heme iron that stabilizes an unique tyrosyl free radical required for enzyme activity [Reichard, 1993; McClarty et al., 1990].
  • the levels of the Rl protein do not appear to change substantially during the cell cycle of proliferating cells and can be detected throughout the cell cycle. Synthesis of Rl mRNA, like R2 mRNA appears to occur mainly during S phase [Eriksson et al , 1984, Choy et al., 1988; Mann et al., 1988].
  • the broader distribution of the Rl protein durmg the cell cycle is attributed to its longer half life as compared to the R2 protein [Choy et al, 1988; Mann et al , 1988].
  • ribonucleotide reductase and particularly the R2 component, is altered in malignant cells exposed to tumor promoters or to the growth factor TGF- ⁇ [Amara, et al., 1994; Chen et al., 1993; Amara et al., 1995b; Hurta and Wright, 1995; Hurta et al., 1991].
  • Antisense (AS) oligonucleotides designed to hybridize with specific sequences within a targeted mRNA are one example of such targeted intervention.
  • antisense oligonucleotides interact well with phospholipid membranes [Akhter et al, 1991].
  • the present inventors have shown that aberrant expression of the R2 gene can determine the malignant characteristics of cells. Altered R2 gene expression was found to cooperate with ras in mechanisms of malignant progression, and recombinant R2 expression resulted in increased membrane associated Raf-1 protein. These results suggest that R2 cooperates with Raf-1 and Rac-1 thereby affecting ras pathways and accordingly cell proliferation and in particular malignant progression.
  • the present inventors also showed that suppression of R2 gene expression reduced transformed properties of tumor cells.
  • novel R2 antisense decreased transformation.
  • Rl antisense also suppressed transformed properties of tumor cells. The Rl and R2 antisense are effective at low concentrations, and surprisingly normal cells were less sensitive to the antisense molecules.
  • Aberrant expression of R2 was also found to result in increased resistance of tumor cells to chemotherapeutic agents.
  • R2 antisense decreased resistance of tumor cells to chemotherapeutic agents at concentrations of antisense that alone did not kill the neoplastic cells.
  • the present invention relates to compounds and methods for modulating cell proliferation, preferably inhibiting the proliferation of tumor cells.
  • Compounds that may be used to modulate cell proliferation include inhibitors of ribonucleotide reductase expression i.e. inhibitors of transcription or translation of the gene encoding ribonucleotide reductase.
  • Antisense oligonucleotides complimentary to regions of the ribonucleotide reductase gene are particularly useful inhibitors.
  • the present invention provides an antisense oligonucleotide having a sequence which is complimentary to a nucleic acid sequence from a ribonucleotide reductase gene and comprises at least seven nucleotides or nucleotide analogues.
  • the oligonucleotide is complimentary to an mRNA region from a ribonucleotide reductase gene, more preferably the ribonucleotide reductase Rl or R2 gene.
  • the invention also relates to a method of evaluating if a compound inhibits transcription or translation of a ribonucleotide reductase gene and thereby effects cell proliferation comprising transfecting a cell with an expression vector comprising a recombinant molecule comprising a nucleic acid sequence encoding ribonucleotide reductase, and the necessary elements for the transcription or translation of the nucleic acid; administering a test compound; and comparing the level of expression of the ribonucleotide reductase with the level obtained with a control in the absence of the test compound.
  • a method for evaluating a compound for its ability to regulate a Ras signalling pathway by assaying for an agonist or antagonist of the interaction of R2 and Raf-1 and/or Rac-1 comprising providing a reaction mixture containing R2 and Raf-1 and/or Rac-1 under conditions which permit the interaction of R2 and Raf-1 and/or Rac-1, in the presence of a test compound; detecting the formation of complexes between R2 and Raf-1 and /or Rac-1 or activation of a Ras signalling pathway; and comparing to a control reaction in the absence of the test substance, wherein lower levels of complexes or activation in the reaction mixture indicate that the test compound interferes with the interaction of P_2 and Raf- 1 and /or Rac-1, and higher levels indicate that the test compound enhances the interaction of R2 and Raf-1 and /or Rac-1.
  • the present invention also provides a pharmaceutical composition for modulating cell proliferation, preferably tumor cell proliferation, comprising at least one inhibitor of expression of Rl or R2, preferably an antisense oligonucleotide according to the present invention, or a compound identified in accordance with a method of the invention, in admixture with a physiologically acceptable carrier or diluent.
  • the present invention also contemplates a method of modulating cell proliferation, preferably tumor cell proliferation by contacting a cell with an effective amount of at least one compound that inhibits the expression of R2 or Rl, preferably an antisense oligonucleotide according to the present invention, or a compound identified in accordance with a method of the invention.
  • the present invention also provides a method for reducing cell proliferation, preferably tumor cell proliferation, comprising contacting a cell with an effective amount of an inhibitor of the expression of Rl or R2 preferably, antisense oligonucleotide according to the present invention, or a compound identified in accordance with a method of the invention.
  • the present invention also provides a pharmaceutical composition for increasing the sensitivity of a tumor cell to a chemotherapeutic drug comprising at least one inhibitor of expression of Rl or R2, preferably an antisense oligonucleotide according to the present invention, or a compound identified in accordance with a method of the invention, in admixture with a physiologically acceptable carrier or diluent.
  • the present invention further provides a pharmaceutical composition for modulating the growth of a tumor cell that is resistant to a chemotherapeutic drug comprising at least one inhibitor of expression of Rl or R2, preferably an antisense oligonucleotide according to the present invention, or a compound identified in accordance with a method of the invention, in admixture with a physiologically acceptable carrier or diluent.
  • a chemotherapeutic drug comprising at least one inhibitor of expression of Rl or R2, preferably an antisense oligonucleotide according to the present invention, or a compound identified in accordance with a method of the invention, in admixture with a physiologically acceptable carrier or diluent.
  • the invention also contemplates the use of an antisense oligonucleotide according to the present invention, or a compound identified in accordance with a method of the invention, to prepare a medicament for modulating cell proliferation. DESCRIPTION OF THE DRAWINGS
  • FIGURE 1A-C are photographs of gels (A and B) and two scans (C) showing the analysis of Myc-tagged R2 expression from stable lnfectants by Western blot analysis using monoclonal anti-Myc epitope antibody 9E10 (A), polyclonal rabbit ant ⁇ -R2 serum (B), and during the cell cycle by flow cytometry [Blosmanis et al, 1987, Chadee et al, 1995], using antibody 9E10 (C)
  • FIGURE 2A-C are photographs (A and B) and a graph (C) of experiments measuring transformed foci wherein (A) shows infection of BALB/c 3T3 (a) and NIH 3T3 (b) cells with SH/mR2 did not lead to focus formation (B) There was an mcrease in focus formation with B3/mR2 (b) and N3/mR2 (d) compared to B3/SH (a) and N3/SH (c) after transfection with the T24 H-r ⁇ s plasmid (C) The number of foci formed in three independent ras transfection experiments was plotted
  • FIGURE 3A-C are photographs of soft agar growth (A) and graphs (B and C) wherein (A) shows expression of Myc-R2 in ras-transformed cells resulted in an increased growth efficiency in soft agar Examples shown are r-3/mR2 and uninfected r-3 cells (See Table 1)
  • FIGURE 4A-C are graphs wherein (A) shows an mcreased amount of Raf-1 protein associated with the membrane in R2 overexpressmg cells
  • the recombinant R2 expressmg cell lines B3/mR2, N3/mR2, Cl /mR2, r-2/mR2, r-3/mR2 and NR4/mR2 (R2) were compared to their respective control lmes, B3/SH, N3/SH, Cl/SH, r-2/SH, r-3, and NR4 (control)
  • cells expressmg recombinant R2 exhibited mcreased membrane associated Raf-1 protein, and when the two groups of cell lines were compared, they were found to be significantly different by t test analysis (p ⁇ 0 001)
  • B Also shows an mcrease in the activity of mitogen activating protein ktnase (MAPK-2) m R2 overexpressmg cells
  • the recombinant R2 expressmg lmes B3/mJ
  • FIGURE 5A-B are photographs of gells showmg examples of Southern blot analysis of CAD (A) and DHFR (B) DNA with mouse L cells
  • A H-4 cells not exposed to drug as a control (a), H-4 cells from a colony that developed in the presence of 50 ⁇ M PALA (b), or in the presence of 60 ⁇ M PALA (c). DNA was digested to completion with Xbal.
  • B SC2 cells not exposed to drug as a control (a), SC2 cells from colonies that developed in the presence of 80 nM methotrexate (MTX) (b) and (c). DNA was digested to completion with Pstl .
  • MTX methotrexate
  • FIGURE 6A-B are photographs of gells showing examples of Southern blot analysis of CAD (A) and DHFR (B) DNA with BALB/c 3T3 cells. DNA was digested to completion with Pstl.
  • A B3/mR2 cells not exposed to PALA (a), and B3/mR2 cells from colonies that developed in the presence of 40'M PALA (b), or in the presence of 50 ⁇ M PALA (c).
  • B B3/mR2 cells not exposed to MTX (a), and B3/mR2 cells from colonies that developed in the presence of 60 nM MTX (b), or in the presence of 80 nM MTX ( ).
  • Figure 7 is a photograph of a Western blot analysis of R2 protein levels in N/R2-4 (a) and N/R2+ASR2 (b) cells.
  • a human c-myc epitope coding for ten amino acids plus methionine was placed at the 5' end of the cDNA for R2.
  • Recombinant (upper band) and endogenous (lower band) R2 protein is observed in lane a and is markedly reduced in R2 antisense containing cells (lane b). Both cell lines grew with approximately the same doubling time of about 16 hours.
  • FIGURE 8 is a photograph of a gel showing p53-DNA binding activity in cells from colonies that developed in the presence of PALA, MTX or hydroxyurea.
  • control IB cells that are p53-null
  • B3/mR2 cells that grew in the presence of 20 ⁇ M PALA
  • B3/ R2c2 cells that grew in the presence of 40 ⁇ M PALA
  • B3/mR2 cells that grew in the presence of 40 nM MTX
  • e B3/R2c2 cells that grew in the presence of 60 nM MTX
  • B3/mR2 cells that grew in the presence of 0.20 mM hydroxyurea
  • B3/R2c2 cells that grew in the presence of 0.30 mM hydroxyurea.
  • FIGURE 9 is a graph showing the number of transformation foci in (a) NIH-3T3 mouse cells containing the H-r ⁇ s oncogene, (b) NIH-3T3 mouse cells containing the -ras oncogene and the R2 antisense sequence and (c) NTH-3T3 mouse cells containing the -ras oncogene and the coding region sequence for R2. Results are averages of three experiments.
  • Figure 10A-B are photographs of a Western blot analysis of AS-II-626-20 inhibition (A) and inhibition by a variety of R2 antisense oligonucleotides (B) of ribonucleotide reductase R2 protein level in L60 mouse tumor cells.
  • A AS-II-626-20 inhibition
  • B R2 antisense oligonucleotides
  • the present invention provides compounds that inhibit the expression of a ribonucleotide reductase protein and thereby modulate cell proliferation.
  • the compounds may rnhibit the expression of the ribonucleotide reductase by inhibiting the transcription of the gene, or the translation of the mRNA to protein
  • Such compounds may include antisense oligonucleotides and ⁇ bozymes
  • antisense oligonucleotide as used herein means a nucleotide sequence that is complimentary to its target
  • oligonucleotide refers to an ohgomer or polymer of nucleotide or nucleoside monomers consisting of naturally occurrmg bases, sugars, and mtersugar (backbone) linkages
  • the term also mcludes modified or substituted ohgomers comp ⁇ smg non-naturally occurrmg monomers or portions thereof, which function similarly Such modified or substituted oligonucleotides may be preferred over naturally occurrmg forms because of properties such as enhanced cellular uptake, or mcreased stability in the presence of nucleases
  • chime ⁇ c oligonucleotides which contam two or more chemically distmct regions
  • chime ⁇ c oligonucleotides may contain at least one region of modified nucleotides that confer beneficial properties (e g mcreased nuclease resistance, mcreased uptake into cells), or two or more oligonucleotides of the mvention
  • the antisense oligonucleotides of the present mvention may be ⁇ bonucleic or deoxy ⁇ bonucleic acids and may contam naturally occurrmg bases including adenine, guanine, cytosme, thymidine and uracil
  • the oligonucleotides may also contam modified bases such as xanthine, hypoxanthine, 2-am ⁇ noaden ⁇ ne, 6-methyl, 2-propyl and other alkyl adenines, 5- halo uracil, 5-halo cytosme, 6-aza uracil, 6-aza cytosme and 6-aza thymine, pseudo uracil, 4- thiouracil, 8-halo adenine, 8-ammoaden ⁇ ne, 8-th ⁇ ol adenine, 8-th ⁇ olalkyl adenines, 8- hydroxyl aden e and other 8-subst ⁇ ruted adenmes, 8-
  • antisense oligonucleotides of the mvention may contam modified phosphorous, oxygen heteroatoms in the phosphate backbone, short chain alkyl or cycloalkyl mtersugar linkages or short chain heteroatomic or heterocyclic mtersugar Imkages
  • the antisense oligonucleotides may contain phosphorothioates, phosphotnesters, methyl phosphonates, and phosphorodithioates
  • the antisense oligonucleotides of the mvention may also comprise nucleotide analogs that may be better suited as therapeutic or experimental reagents
  • An example of an oligonucleotide analogue is a peptide nucleic acid (PNA) wherem the deoxynbose (or ribose) phosphate backbone m the DNA (or RNA), is replaced with a polyamide backbone which is similar to that found m peptides (P E Nielsen, et al Science 1991, 254, 1497) PNA analogues have been shown to be resistant to degradation by enzymes and to have extended lives in vivo and in vitro.
  • PNA peptide nucleic acid
  • oligonucleotides may contain nucleotides containing polymer backbones, cyclic backbones, or acyclic backbones.
  • the nucleotides may have morpholino backbone structures (U.S. Pat. Nol 5,034, 506).
  • Oligonucleotides may also contain groups such as reporter groups, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an antisense oligonucleotide.
  • Antisense oligonucleotides may also have sugar mimetics.
  • the antisense oligonucleotides may be selected such that they exhibit the least likelihood of dimer formation, self-complementary interactions, and binding potential to the ribonucleotide reductase mRNA other than target sequence. These properties may be determined using the computer modeling program OLIGO Primer Analysis software Version 3.4 (National Biosciences). The program allows the determination of a qualitative estimation of these three parameters and indicates "no potential”; "some potential”; or “essentially complete potential”. Oligonucleotides are preferably selected that have estimates of "some potential” or “no potential”, most preferably "no potential", in all three parameters as described in Tables 7 and 11. The oligonucleotides are also selected so that their function is not substantially affected by any modifications or substitutions.
  • the antisense oligonucleotides of the present invention are preferably complimentary to the mRNA region from the ribonucleotide reductase gene. More preferably, the antisense oligonucleotide is complimentary to an mRNA region from the ribonucleotide reductase R2 gene.
  • the antisense oligonucleotides generally comprise at least seven nucleotides or nucleotides analogs, more preferably, at least 20 nucleotides or nucleotide analogs, most preferably 30-35 nucleotides or nucleotide analogs.
  • the sequences of preferred antisense oligonucleotides according to the present invention can be found in Tables 11 and 7 and are SEQ. ID. NOS. 1-102 and SEQ. ID. NOS. 103-161. More preferred oligonucleotides are shown in Table 12.
  • oligonucleotides have the SEQ.ID.NOS 1, 2, 12, 16, 18, 21, 25, 29, 34, 42, 44, 45, 46, 52, 53, 59, 60, 64, 65, 66, 68, 69, 70, 72, 73, 74, 76, 78, 79, 80. 90, 91, 92, 96, 99, 100 and 102 as shown in Table 7.
  • the antisense oligonucleotides of the invention may be prepared by conventional and well-known techniques.
  • the oligonucleotides may be prepared using solid-phase synthesis and in particular using commercially available equipment such as the equipment available from Applied Biosystems. It is also preferred to substantially purify the oligonucleotides so that they are free of any other factors which would interfere with their activity.
  • Oligonucleotides of the invention may also be identified using genetic complementation techniques, or using the probes described herein. It is also well within the skill in the art to prepare modified or substituted antisense oligonucleotides.
  • a ribozyme sequence may also be used to modulate cell proliferation.
  • the ribozyme has homologous or complementary sequences to an antisense oligonucleotide of the invention and the necessary catalytic centre for cleaving the oligonucleotide.
  • the ribozyme type utilized in the present invention may be selected from types known in the art. Several ribozyme structural families have been identified including Group I introns, RNase P, the hepatitis delta virus ribozyme, hammerhead ribozymes, and the hairpin ribozyme originally derived from the negative strand of the tobacco ringspot virus satellite RNA (sTRSV) (Sullivan, 1994, U.S. Patent No. 5,225,347, columns 4 to 5).
  • sTRSV tobacco ringspot virus satellite RNA
  • ribozyme is believed to separate monomers form oligomers created during rolling circle replication (Symons, 1989 and 1992).
  • Hammerhead and hairpin ribozyme motifs are most commonly adapted for trans-cleavage of mRNAs for gene therapy (Sullivan, 1994).
  • Hairpin ribozymes which are presently in clinical trials are preferably used in the present invention. In general the ribozyme is from 30 to 100 nucleotides in length.
  • the invention contemplates a method of evaluating if a compound inhibits transcription or translation of a ribonucleotide reductase gene and thereby modulates (i.e. reduces) cell proliferation comprising transfecring a cell with an expression vector comprising a nucleic acid sequence encoding ribonucleotide reductase, the necessary elements for the transcription or translation of the nucleic acid; administering a test compound; and comparing the level of expression of the ribonucleotide reductase with the level obtained with a control in the absence of the test compound.
  • An expression vector comprising a nucleic acid sequence encoding ribonucleotide reductase may be constructed having regard to the sequence of the gene using procedures known in the art.
  • Suitable transcription and translation elements may be derived from a variety of sources, including bacterial, fungal, viral, mammalian, or insect genes. Selection of appropriate elements is dependent on the host cell chosen, and may be readily accomplished by one of ordinary skill in the art.
  • reporter genes are genes encoding a protein such as ⁇ -galactosidase (e.g. lacZ), chloramphenicol, acetyl-transferase, firefly luciferase, or an immunoglobulin or portion thereof. Transcription of the reporter gene is monitored by changes in the concentration of the reporter proteins such as ⁇ -galactosidase etc. This makes it possible to visualize and assay for expression of recombinant molecules to determine the effect of a substance on expression of the ribonucleotide reductase gene.
  • Host cells suitable for carrying out the present invention include CHO, COS, BHK,
  • the invention also contemplates a method for evaluating a compound for its ability to regulate a Ras signalling pathway by assaying for an agonist or antagonist (i.e. stimulator or inhibitor) of the interaction of R2 and Raf-1 and /or Rac-1.
  • an agonist or antagonist i.e. stimulator or inhibitor
  • the basic method for evaluating if a compound is an agonist or antagonist of the interaction of R2 and Raf-1 and /or Rac-1 is to prepare a reaction mixture containing R2 and Raf-1 and/or Rac-1 under conditions which permit the interaction of R2 and Raf-1 and/or Rac-1, in the presence of a test compound.
  • the test compound may be initially added to the mixture, or may be added subsequent to the addition of the R2 and Raf-1 and/or Rac-1.
  • Control reaction mixtures without the test compound or with a placebo are also prepared.
  • the formation of complexes or activation of the pathway is detected and the formation of complexes or activation of the pathway in the control reaction but not in the reaction mixture indicates that the test compound interferes with the interaction of R2 and Raf-1 and/or Rac-1.
  • the reactions may be carried out in the liquid phase or R2 and Raf-1 and/or Rac-1, or test compound may be immobilized.
  • the invention also makes it possible to screen for antagonists that inhibit the effects of an agonist of the interaction of R2 and Raf-1 and/or Rac-1.
  • the invention may be used to assay for a compound that competes for the same binding site of R2.
  • the invention also contemplates methods for identifying compounds that bind to proteins that interact with R2 and thereby inhibit R2.
  • Protein-protein interactions may be identified using conventional methods such as co-immunoprecipitation, crosslinking and co- purification through gradients or chromatographic columns. Methods may also be employed that result in the simultaneous identification of genes which encode proteins interacting with R2. These methods include probing expression libraries with labeled R2. Two-hybrid systems may also be used to detect protein interactions in vivo.
  • plasmids are constructed that encode two hybrid proteins.
  • a first hybrid protein consists of the DNA-binding domain of a transcription activator protein fused to R2
  • the second hybrid protein consists of the transcription activator protein's activator domain fused to an unknown protein encoded by a cDNA which has been recombined into the plasmid as part of a cDNA library.
  • the plasmids are transformed into a strain of yeast (e.g. S. cerevisiae) that contains a reporter gene (e.g. lacZ, luciferase, alkaline phosphatase, horseradish peroxidase) whose regulatory region contains the transcription activator's binding site.
  • the hybrid proteins alone cannot activate the transcription of the reporter gene. However, interaction of the two hybrid proteins reconstitutes the functional activator protein and results in expression of the reporter gene, which is detected by an assay for the reporter gene product.
  • fusion proteins may be used in the above-described methods.
  • R2 fused to a glutathione-S-transferase may be used in the methods.
  • the compounds identified using the method of the invention include but are not limited to peptides such as soluble peptides including Ig-tailed fusion peptides, members of random peptide libraries and combinatorial chemistry-derived molecular libraries made of D- and/or L-configuration amino acids, phosphopeptides (including members of random or partially degenerate, directed phosphopeptide libraries), antibodies (e.g. polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, single chain antibodies, fragments, (e.g. Fab, F(ab) 2 , and Fab expression library fragments, and epitope-binding fragments thereof), and small organic or inorganic molecules.
  • the compound may be an endogenous physiological compound or it may be a natural or synthetic compound.
  • the reagents suitable for applying the methods of the invention to evaluate compounds that modulate R2 and Raf-1 and/or Rac-1 interactions may be packaged into convenient kits providing the necessary materials packaged into suitable containers.
  • the kits may also include suitable supports useful in performing the methods of the invention.
  • the compounds identified using the methods described herein, and other inhibitors of R2 expression described herein may be used for modulating a Ras pathway.
  • the compounds may be used to inhibit the signal-transduction properties of Raf-1 and /or Rac-1; inhibit cell proliferation, alter the cell cycle, and downregulate the immune response in patients with autoimmune diseases.
  • the compounds have anti-oncogene or tumor suppressor activity. 3. Methods and Compositions for Modulating Cell Growth/Metastasis
  • the antisense oligonucleotides, ribozymes, and compounds identified using the methods of the invention modulate cell proliferation and in particular tumor cell proliferation.
  • methods for interfering with cell proliferation comprising contacting tissues or cells with one or more of antisense oligonucleotides, ribozymes, and compounds identified using the methods of the invention.
  • an antisense oligonucleotide as shown in Table 7 or 11 or 12 is administered.
  • contact refers to the addition of an antisense oligonucleotide, ribozyme etc, in a liquid carrier to a cell suspension or tissue sample, or to administering the oligonucleotides etc. directly or indirectly to cells or tissues within an animal.
  • the methods may be used to treat proliferative disorders including various forms of cancer such as leukemias, lymphomas (Hodgkins and non-Hodgkins), sarcomas, melanomas, adenomas, carcinomas of solid tissue, hypoxic tumors, squamous cell carcinomas of the mouth, throat, larynx, and lung, genitourinary cancers such as cervical and bladder cancer, hematopoietic cancers, colon cancer, breast cancer, pancreatic cancer, head and neck cancers, and nervous system cancers, benign lesions such as papillomas, arthrosclerosis, psoriasis, primary and secondary polythemia, mastocytosis, autoimmune diseases, angiogenesis, bacterial infections, and viral infections, such as HIV infections, hepatitis or herpes infections.
  • cancer such as leukemias, lymphomas (Hodgkins and non-Hodgkins), sarcomas, melanomas, adenomas, carcinoma
  • the antisense oligonucleotides, ribozymes,and compounds identified using the methods of the invention may also be used to treat drug resistant tumors.
  • drug resistant tumors are tumors resistant to hydroxyurea; tumors expressing high levels of P-glycoprotein which is known to confer resistance to multiple anticancer drugs such as colchicine, vinblastine and doxorubicin; or, tumors expressing the multi-drug resistance protein as described in R. Deeley et al., Science, 258:1650-1654, 1992.
  • Antisense oligonucleotides of the invention have also been found to reduce metastasis.
  • a method for reducing metastasis in a subject comprising administering an amount of an antisense oligonucleotide of the invention effective to reduce metastasis.
  • the antisense oligonucleotide has the sequence shown in SEQ. ID. NOS. 1-102 or SEQ. ID. NOS. 103-161, most preferably a sequence shown in Table 12.
  • Selected antisense oligonucleotides, ribozymes, and compounds may be tested for their ability to modulate cell growth and in particular tumor cell growth, or to reduce metastasis in vitro and in vivo systems as described herein.
  • the antisense oligonucleotides, ribozymes, and compounds identified using the methods of the invention may be formulated into pharmaceutical compositions.
  • the pharmaceutical compositions may comprise one or more antisense oligonucleotides, ribozymes, and compounds identified using the methods of the invention for adminstration to subjects in a biologically compatible form suitable for administration to a subject.
  • the compositions of the invention can be intended for administration to humans and various other mammals, such as ovines, bovines, equines, swine, canines, and felines.
  • compositions of the invention may be administered in different ways depending upon whether local or systemic treatment is desired, and upon the area to be treated.
  • the compositions can be administered orally, subcutaneously or parenterally including intravenous, intraarterial, intramuscular, intraperitoneally, and intranasal administration as well as intrathecal and infusion techniques as required by the malignant cells being treated.
  • intrathecal delivery can be used with for example an Ommaya reservoir or other methods known in the art.
  • the pharmaceutically acceptable carriers, diluents, adjuvants and vehicles as well as implant carriers generally refer to inert, non-toxic solid or liquid fillers, diluents or encapsulating material not reacting with the active ingredients of the invention.
  • Cationic lipids may also be included in the composition to facilitate oligonucleotide uptake. Implants of the compounds are also useful. In general the pharmaceutical compositions are sterile.
  • the antisense oligonucleotides and ribozymes of the invention may be delivered using viral or non-viral vectors. Sequences may be incorporated into cassettes or constructs such that an antisense oligonucleotide or ribozyme of the invention is expressed in a cell. Generally the construct contains the proper transcriptional control region to allow the oligonucleotide or antisense oligonucleotide to be transcribed in the cell.
  • the invention provides vectors comprising a transcription control sequence operatively linked to a sequence which encodes an antisense oligonucleotide or ribozyme of the invention.
  • the present invention further provides host cells, selected from suitable eucaryotic and procaryotic cells, which are transformed with these vectors. Such transformed cells allow the study of the function and the regulation of malignancy and the treatments of the present invention.
  • Vectors are known or can be constructed by those skilled in the art and should contain all expression elements necessary to achieve the desired transcription of the sequences. Other beneficial characteristics can also be contained within the vectors such as mechanisms for recovery of the nucleic acids in a different form. Phagemids are a specific example of such beneficial vectors because they can be used either as plasmids or as bacteriophage vectors. Examples of other vectors include viruses such as bacteriophages, baculoviruses and retroviruses, DNA viruses, liposomes and other recombination vectors. The vectors can also contain elements for use in either procaryotic or eucaryotic host systems. One of ordinary skill in the art will know which host systems are compatible with a particular vector.
  • the vectors can be introduced into cells or tissues by any one of a variety of known methods within the art. Such methods can be found generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al, Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, MI (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor, MI (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston MA (1988) and Gilboa et al (1986) and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors.
  • nucleic acids by infection offers several advantages. Higher efficiency can be obtained due to their infectious nature. Moreover, viruses are very specialized and typically infect and propagate in specific cell types. Thus, their natural specificity can be used to target the vectors to specific cell types in vivo or within a tissue or mixed culture of cells. Viral vectors can also be modified with specific receptors or ligands to alter target specificity through receptor mediated events.
  • Additional features can be added to the vector to ensure its safety and /or enhance its therapeutic efficacy.
  • Such features include, for example, markers that can be used to negatively select against cells infected with the recombinant virus.
  • An example of such a negative selection marker is the TK gene that confers sensitivity to the anti-viral gancyclovir. Negative selection is therefore a means by which infection can be controlled because it provides inducible suicide through the addition of antibiotic. Such protection ensures that if, for example, mutations arise that produce altered forms of the viral vector or sequence, cellular transformation will not occur.
  • Features that limit expression to particular cell types can also be included. Such features include, for example, promoter and regulatory elements that are specific for the desired cell type.
  • Recombinant viral vectors are another example of vectors useful for in vivo introduction of a desired nucleic acid because they offer advantages such as lateral infection and targeting specificity.
  • Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny.
  • Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
  • a vector to be used in the methods of the invention may be selected depending on the desired cell type to be targeted. For example, if breast cancer is to be treated, then a vector specific for such epithelial cells should be used. Similarly, if cells of the hematopoietic system are to be treated, then a viral vector that is specific for blood cells and their precursors, preferably for the specific type of hematopoietic cell, should be used.
  • Retroviral vectors can be constructed to function either as infectious particles or to undergo only a single initial round of infection.
  • the genome of the virus is modified so that it maintains all the necessary genes, regulatory sequences and packaging signals to synthesize new viral proteins and RNA. Once these molecules are synthesized, the host cell packages the RNA into new viral particles which are capable of undergoing further rounds of infection.
  • the vector's genome is also engineered to encode and express the desired recombinant gene.
  • the vector genome is usually mutated to destroy the viral packaging signal that is required to encapsulate the RNA into viral particles. Without such a signal, any particles that are formed will not contain a genome and therefore cannot proceed through subsequent rounds of infection.
  • the specific type of vector will depend upon the intended application.
  • the actual vectors are also known and readily available within the art or can be constructed by one skilled in the art using well-known methodology.
  • the procedure can take advantage of their target specificity and consequently, do not have to be administered locally at the diseased site.
  • administration can also be performed by, for example, intravenous or subcutaneous injection into the subject.
  • Injection of the viral vectors into a spinal fluid can also be used as a mode of administration.
  • the viral vectors will circulate until they recognize host cells with the appropriate target specificity for infection.
  • Transfection vehicles such as liposomes can also be used to introduce the non-viral vectors described above into recipient cells within the inoculated area. Such transfection vehicles are known by one skilled within the art.
  • compositions and vectors of the invention may be administered in combination with other drugs or singly, consistent with good medical practice and treatment modalities that are known in the art.
  • other drugs which may be administered in combination with the compositions etc. of the invention are cytotoxic agents, immunotoxms, alkylating agents, anti-metabolites, antitumor antibiotics and other anti-cancer drugs
  • Dosing of the antisense oligonucleotides, ribozymes, and compounds will depend on the severity and responsiveness of the condition to be treated with a course of treatment lasting from several days to several months or until diminution of the disease is achieved. Optimal dosing schedules may be calculated using measurements of drug accumulation in the body. Persons of ordinary skill in the art can readily determine optimum dosages, dosing methodologies, and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be determined based on ED 50 s in in vttro and in vivo animal studies.
  • compositions or vectors of the invention, and combination drugs may each be administered at non-cytotoxic or cytotoxic doses, or one may be administered at a cytotoxic dose and the other at a non-cytotoxic dose.
  • the doses may be selected to provide a synergistic effect.
  • the examples provide an analysis of malignancy related characteristics of cells containing deregulated R2 expression achieved by gene transfer techniques.
  • Overexpression of R2 leads to an increased frequency of transformed foci formation by mouse fibroblasts following transfection with activated -ras.
  • expression of recobminant R2 in ras- transformed cells resulted in enhanced colony forming efficiency in soft agar, and markedly elevated tumorigenic and metastatic potential in vivo .
  • deregulated R2 expression can cooperate with other oncogenes like rac-1 in mechanisms of transformation.
  • the results herein demonstrate for the first time that the R2 component of mammalian ribonucleotide reductase is a malignancy determinant that can synergize with activated oncogenes to modify malignant potential, and supports a model in which these effects are mediated through alterations in major Ras pathways that are brought about by deregulated R2 gene expression.
  • the observations presented here indicated that R2 can also participate in other critical cellular functions, and can play a direct role in determining malignant potential through oncogene cooperativity.
  • the examples further demonstrate that ribonucleotide reductase R2 gene expression can play a significant role in determining drug sensitivity characteristics, and that this appeas to occur at least in part through a mechanism involving genomic instability.
  • the mechanism through which aberrant R2 expression modifies drug sensitivities does not appear to require the direct involvement of p53 mutation or loss of wild type p53 function, although it is possible that genetic events downstream of a p53 regulated pathway are involved.
  • Recombinant R2 gene expression in Balb/c 3T3 and NIH-3T3 cells significantly increases both Raf-2 protein activation and mitogen-activating protein kinase (MAPK) activity.
  • c-myc overexpression has also been directly linked to gene amplification mechanisms involving DHFR [Mai, 1994]. These obserations suggest that alterations in the MAPK pathway through aberrant R2 expression may be at least partly responsible for the observed changes in drug sensitivities and genomic integrity.
  • Example 3 demonstrates that short antisense sequences directed against the Rl and
  • R2 components have anti-tumor activity and are cytotoxic to the neoplastic cells. Further, the R2 antisense sequences can also act synergistically with well known chemotherapeutic agents. Very low concentrations (non-toxic) of short antisense sequences reduced the resistance of the neoplastic cells to chemotherapeutic agents such as N-(phosphonacetyl)-L-aspartate (PALA) and methotrexate (MTX) as well as hydroxyurea. As shown in the Example, cells were transfected with a vector containing the R2 sequence in an antisense oritentation. These cells were more sensitive to the chemotherapeutic agents.
  • chemotherapeutic agents such as N-(phosphonacetyl)-L-aspartate (PALA) and methotrexate (MTX)
  • mouse 10T 1 / 2 cells which are drug resistant, when transfected with R2 sequence in the antisense orientation, were found to have significantly reduced resistance (increased sensitivity) to the chemotherapeutic agents.
  • Short synthetic antisense sequence complementary to the R2 sequence also provided increases sensitivity.
  • Vectors can be constructed for the present invention by those skilled in the art and should contain all expression elements necessary to achieve the desired transcription of the sequences.
  • the expression elements can be selected to allow expression only in the cell being targeted. Other beneficial characteristics can also be contained within the vectors such as mechanisms for recovery of the nucleic acids in a different form.
  • One of ordinary skill in the art will know which expression elements are compatible with a particular cell type.
  • the vectors can be introduced into cells or tissues by any one of a variety of known methods within the art as described herein above.
  • C3H/HeN syngeneic mice (Charles River, Quebec) were used to evaluate tumorigenic and metastatic potential of the cells.
  • Cells were prepared from subconfluent, logarithmically growing cultures, collected by gentle treatment with trypsin/EDTA solution and adjusted to appropriate concentration in a balanced salt solution.
  • tumorigenicity tumor latency assay
  • 1 x IO 5 cells in a 0.1 ml volume were injected subcutaneously into the back of mice and the time required to form a tumor (2 X 2 mm) detectable by palpation was recorded.
  • the growth of tumors was also evaluated by measuring tumor diameters, and estimating tumor base area each day following tumor appearance [ Indianapolisn et al., 1989].
  • Tumor size was determined by multiplying the dimensions of the cross-section of the tumor. Tumors were removed from the mice and tumor weight was recorded 21 days later. In the case of no tumor formation, mice were kept for 2 months after injection and then sacrificed.
  • RIBONUCLEOTIDE REDUCTASE ASSAY Ribonucleotide reductase activity in crude extracts prepared from cells is assayed as previously described [Lewis et al., 1978; Hurta and Wright, 1992; Hurta et al., 1995]. Enzyme preparations are obtained from logarithmically growing cells lysed in phosphate buffered saline, pH 7.2, containing 1 mM dithiothreitol and 1 mM protease inhibitor, AEBSF (Calbiochem, San Francisco, CA), by three cycles of freeze-thawing.
  • AEBSF Calbiochem, San Francisco, CA
  • the infectivity of the viral stock was >1 x IO 4 colony-forming units/ml.
  • Plasmid pH06Ti which expresses T-24 H-r ⁇ s and a selective marker neo was used for malignant transformation [Egan et al., 1987a, 1987b; Taylor et al., 1992].
  • the activated Rac-1 plasmid (V12 Rac-1) was kindly provided by M. Symons [Stokoe, et al, 1994].
  • mice The mouse cell lines, BALB/c 3T3, NIH 3T3, four lines of T24 H-r ⁇ s transformed 10TV 2 cells, named Cl, NR4, r-2 and r-3 have been previously used as recipients of the R2 retroviral vector [Fan et al., 1996b].
  • Cells were routinely cultured in ⁇ -minimal essential medium ( ⁇ -MEM)(Gibco, Grand Island, NY) supplemented with 10% calf serum (Fetalclone III, Hyclone, Logan, UT).
  • ⁇ -MEM ⁇ -minimal essential medium
  • calf serum Fetalclone III, Hyclone, Logan, UT.
  • the transfection frequency in all the experiments were routinely determined by cotransfection of a mammalian expression plasmid for ⁇ -galactosidase from Esherichia coli, with the T-24 Ras or V-12 Rac-1 plasmids, followed by treatment of cells with the X-gal and counting the number of blue cells [Price et al, 1987], In some cases, T-24 Ras plasmid transfected plates were selected with geneticin, and drug resistant colonies were scored approximately 14 later after staining with methylene blue. Assays for Tumorigenicity and Metastasis: Malignant potential was determined as described herein above.
  • Protein R2 Analysis The procedures for Western blot analysis have been described previously, for example, using either the anti- yc mouse monoclonal 9E10 antibody (ATCC, Rockville, MD)[Fan et al., 1996b] or the anti-R2 rabbit polyclonal antibody [Chan et al., 1993]. To determine recombinant R2 protein expression during the cell cycle, flow cytometry analysis was performed following 9E10/fluorescein isothiocyanate antibody labelling as previously described [Blosmanis et al, 1987; Chadee et al, 1995].
  • Membrane-associated Raf-1 Protein The membrane fraction was prepared as described by Qui et al. [1995], and used for Western analysis with a polyclonal antibody specific for Raf-1 protein (Santa Cruz Biotechnology Inc., Santa Cruz, CA), after the protein content was determined by the standard Bio-Rad assay. Densitometry analysis of the Raf-1 band was performed, and the amount of Raf-1 protein from each sample was corrected by densitometry analysis of a well separated band on a parallel gel stained with Coomassie blue. Ribonucleotide Reductase Assay: The Assay was performed as described herein above.
  • enzyme assays were performed by combining purified recombinant Rl protein [Salem et al, 1993] with 9E10 antibody-precipitated R2 protein [Hurta and Wright, 1992].
  • 20 ⁇ g of the 9E10 antibody and 50 ⁇ l of Staphylococcal protein A-agarose (Sigma Chem. Co., St. Louis, MO) were added to 1 ml of the supernatant of centrifuged lysed cells, and placed on a rocker at 4°C for 2 hours.
  • the Staphylococcal protein A agarose-immunocomplex was washed three times with 1 ml of cold phosphate buffer containing 1 mg/ml bovine serum albumin.
  • the immunocomplex was then assayed for ribonucleotide reductase activity [Lewis et al, 1978; Hurta and Wright, 1992; Fan et al., 1996b; Choy et al, 1988].
  • Figure 1A shows that Western blots with the 9E10 antibody that specifically recognizes the Myc-epitope sequence detects the R2 protein of approximately 45 kDa in SH/mR2 stably infected BALB/c 3T3 and NIH 3T3 cells (named B3/mR2 and N3/mR2, respectively), but not in control vector (LXSH) infected B3/SH or N3/SH cells.
  • R2 specific antibodies detected the endogenous as well as the recombinant R2 protein in expression vector infected cells, and as expected only the endogenous protein was observed in control vector infected cells (Fig. IB).
  • ribonucleotide reductase activity was assayed and found that the CDP reductase activities in B3/mR2 and N3/mR2 cells in three independent experiments were 1.96 ⁇ 0.32 and 1.71 ⁇ 0.11 nmoles/mg protein/hour, respectively, which was 2.6 and 2.1 times higher than observed with B3/SH and N3/SH cells (0.74 ⁇ 0.14 and 0.83 ⁇ 0.08 nmoles/mg/hour, respectively).
  • enzyme assays were carried out by combining purified recombinant Rl protein [Salem et al, 1993], with 9E10 antibody precipitated R2 protein.
  • Ras Malignancy Potential Determined by Aberrant R2 Gene Expression Since combinations of altered R2 gene expression and activated H-r ⁇ s were synergistic in focus forming experiments in which ras was transfected into altered R2 expressing cells, this gene combination was tested further by infecting four independent H-r ⁇ s transformed 10TV 2 cell lines, Cl, NR4, r-2 and r-3 that were previously characterized [Egan et al., 1987a, 1987b; Taylor et al., 1992; Stokoe et al, 1994], with the retroviral vector SH/mR2. Stable infectants were selected with hygromycin, and Western blot analyses and enzyme activity assays confirmed that these infectants expressed biologically active Myc-tagged R2 protein.
  • the hydroxyurea resistant mouse cell lmes, H-2, H-4, LHF and SC2 were derived from mouse L cells and have been characterized m Choy et al [1988] and McClarty et al [1986]
  • BALB/c 3T3 cells were used as recipients of an R2 retroviral expression vector (B3/mR2 and B3/R2c2 cell lmes), or of the same retroviral vector lacking the R2 sequence (B3/SH cells)[Fan et al , 1996a; 1996b]
  • NIH-3T3 cells were also used as recipients of the R2 retroviral expression vector (N/R2-4 cell lme) or of this retroviral vector lacking the R2 sequence (N/SH cells), as described previously [Fan et al , 1996a; 1996b]
  • the N/R2+ASR2 cell lme was the recipient through co-transfection using LipofectAmine (Life Technologies, N Y) [Damen et al , 1991] of retro
  • the pCAD142 plasmid containing CAD cDNA, which encodes the CAD protein complex [Shigesada et al., 1985], was used to obtain the 6.3 Kb Hind III fragment as a probe.
  • the 1487 bp Sal I/Pst I probe for ribonucleotide reductase R2 was prepared from cDNA clone 10 [Huang et al., 1995a; Choy et al., 1988].
  • Electrophoretic Gel Mobility Shift Assay (EMSA) was used to determine the presence of wild type p53. Assays were performed essentially as described [Price and Calderwood, 1993], with the following modifications. Cells on 150 mm plates were washed once with ice cold phosphate buffered saline (PBS) and scraped into 1 ml PBS. Cells were pelleted by centrifugation at 1300 g at 4°C for 10 minutes and stored at -80°C.
  • PBS ice cold phosphate buffered saline
  • Nuclei were prepared by lysing the pellets in 300 ⁇ l buffer A (20 mM HEPES (pH 7.6], 20% glycerol, 10 mM NaCl, 1.5 mM MgCl 2 , 0.2 mM EDTA and 0.1% Triton X-100) for 20 minutes on ice. Buffer A also contained
  • the nuclear lysate was incubated with an excess of double stranded p53 consensus binding sequence (GGACATGCCCGGGCATGTCC)(SEQ ID No:162) end labeled with [ ⁇ - 32 P]-ATP using T4 polynucleotide kinase (Boehringer).
  • DNA binding was carried out in buffer containing 20 mM HEPES (pH 7.6), 20% glycerol, 1.5 mM MgCl 2 , 0.2 mM EDTA, 1 mM
  • Each binding reaction contained 5 ⁇ g cell lysate, 10 ⁇ g double stranded poly (dI-dC)(Pharmacia), 1.4 ng labeled consensus probe and 100 ng of monoclonal antibody 421 (Santa Cruz) in a total volume of 20 ⁇ l.
  • DNA binding was allowed to proceed for 30 minutes at room temperature and the mixture was separated by electrophoresis on 5% nondenaturing polyacrylamide gels. Electrophoresis was carried out at room temperature until the xylene cyanol tracking dye had run to the bottom of the gel and the free probe had run off the gel.
  • H-2, H-4, LHF and SC2 are mouse L cell lines selected for resistance to the cytotoxic effects of the antitumor agent, hydroxyurea. These four cell lines exhibited resistance to hydroxyurea in colony forming efficiency experiments, that ranged between approximately 18 (H-2) to 30 (SC2) fold higher than the wild type mouse L cell line from which they were derived [Choy et al., 1998; McClarty et al., 1988].
  • ribonucleotide reductase activity that ranged between 2.2 fold (H-2) to 17 fold (LHF and SC2), which was primarily due to increases in the R2 component of ribonucleotide reductase that is limiting for enzyme activity and cell division in proliferating mouse cells.
  • Table 2 shows that the four hydroxyurea resistant cell lines were also less sensitive to the cytotoxic effects of N-(phosphonacetyl)-L-aspartate (PALA) and methotrexate (MTX) in colony forming experiments, when compared to parental wild type mouse L cells. These differences in drug sensitivity are highly significant, with p values of ⁇ 0.0001 for each of the cell lines when compared to the parental wild type mouse cells.
  • DHFR dihydrofolate reductase
  • CAD a multifunctional polypeptide containing carbamyl phosphate synthetase, aspartate transcarbamylase and dihydrooratase
  • Figure 5 shows that cells that proliferated in the presence of PALA or MTX exhibited increased CAD or DHFR gene copy numbers.
  • PALA or MTX exhibited increased CAD or DHFR gene copy numbers.
  • all colonies that developed in PALA and tested (10/10) showed CAD gene amplification.
  • some but not all colonies that developed in the presence of MTX (3/6) showed DHFR gene amplification.
  • B3/mR2 is a population of BALB/c 3T3 cells containing elevated R2 protein due to the presence of a retroviral expression vector encoding R2
  • B3/SH is a cell population that has wildtype levels of R2 protein and contains the empty vector as a control.
  • B3/R2c2 is a cloned line with elevated R2 protein selected from the B3/mR2 population.
  • Table 3 shows that B3/mR2 and B3/R2c2 cells are significantly more resistant to the cytotoxic effects of hydroxyurea, at a range of concentrations, when compared to B3/SH cells.
  • N/R2-4 were resistant to hydroxyurea when compared to cells containing the retroviral vector lacking the R2 coding sequence (N/SH).
  • the N/R2-4 cells were also significantly more resistant to MTX.
  • the N/R2-4 cells showed a trend towards resistance to PALA when compared to N/SH cells, this trend was not statistically significant. This latter observation indicates that other factors inherent in the genetic differences between the cell lines used in this study, in addition to the increased R2 levels, can influence drug sensitivity responses.
  • ANTISENSE DEOXYRIBONUCLEOTIDE SEQUENCES THAT TARGET RIBONUCLEO ⁇ DE REDUCTASE AND ARE CYTOTOXIC FOR HUMAN TUMOR CELLS.
  • oligonucleotides being tested were added to cell cultures in the presence of 2.5 ⁇ g of DOTMA/DOPE (Lipofectin; Life Technologies, Inc.) for four hours. The oligonucleotide was tested at 0.2 ⁇ M unless otherwise indicated. Controls were the cultures treated with lipofectin but without the oligonucleotide. After 4 hours the medium containing the oligonucleotide was removed and washed with 5 ml of growth medium. The cells were then cultured in growth medium containing 10% fetal bovine serum for seven to ten days. Surviving cells were visualized by methylene blue staining, and colonies were scored. In some experiments cell aliquotes were removed from the culture and viability was determined using the trypan blue exclusion test [Phillips, 1973]. Results were analyzed as percent of surviving cells compared to control cells. RESULTS
  • Antisense molecules were identified that target ribonucleotide reductase As shown below they were cytotoxic for a variety of human tumor cells. Sequences were found that facilitated drug-cytotoxicity for drug resistant tumor cells. That is, at very low non-cytotoxic concentrations, antisense sequences targeting ribonucleotide reductase can sensitize tumor cells to the cytotoxic activity of clinically important chemotherapeutic compounds.
  • AS-II-336-20 has the sequence 5 -TCC TGG AAG ATC CTC CTC GC-3'(SEQ ID No:l), and targets the R2 message of human ribonucleotide reductase at nucleotides 336-355, based on the numbering of R2 nucleotides [Pavloff et al., 1992].
  • the AS-II-2229B-20 sequence is: 5'-TCC CAC ATA TGA GAA AAC TC-3' (SEQ ID No:2), and targets the R2 message at nucleotides 2229-2248.
  • Both AS-II-336-20 and AS-II-2229B-20 were constructed as phosphorothioate sequences to protect against nuclease activity [Anazodo et al., 1995].
  • Antisense construct AS-II-336-20 was tested for the ability to inhibit the proliferation of human tumor cells (Hela) in relative colony forming efficiency experiments as described herein above.
  • Hela S3 cells American Type Culture Collection, Rockville, Maryland, ATCC
  • Hela ImM Hela cell line
  • Two experiments were undertaken with Hela S3 cells. With a 4 hour treatment of 0.2 ⁇ M antisense construct AS-II-336-20, inhibition of 92% and 82% was seen in colony forming efficiency in two experiments, respectively.
  • AS-II-336-20 is a very effective inhibitor of human tumor cell colony forming ability, and it is effective both m inhibiting the proliferation of human tumor cell colony forming ability and in inhibiting the proliferation of human tumor cells that exhibit resistance to another chemotherapeutic compound
  • antisense construct AS-II-336-20 is an effective antitumor compound m experiments performed with the mouse tumor cell lme, SC2, which is a highly hydroxyurea resistant mouse L cell lme [McClarty et al , 1988]
  • the antisense sequence AS-II-2229B-20 was also tested for the ability to inhibit the proliferation of human Hela tumor cells m relative colony forming efficiency experiments with results similar to that of AS-II-336-20 as shown in Table 6 These data show that AS-II-2229B-20 is a potent antitumor agent when tested with Hela S3 cells and with the drug resistant Hela ImM cell lme
  • the antisense construct AS-II-2229B-20 was also tested for the ability to inhibit the proliferation of the human breast cancer cell lme MDA435 and found to be very effective (Table 8)
  • the ribonucleotide reductase R2 antisense construct designated AS-II-2229B-20 was tested for tumor cell cytotoxicity by comparing the results obtamed with human tumor and non- tumor cell populations Hela S3 tumor cells and WI 38 normal non-tumo ⁇ genic human cells were used Tumor cells were found to be much more sensitive to the cytotoxic effects of AS-II-2229B-20 than normal
  • Example 2 Treatment of human tumor cells with very low concentrations of short antisense sequences was tested to determine if these constructs could sensitize the tumor cells to inhibitory effects of other chemotherapeutic drugs.
  • concentration used was not cytotoxic in itself as shown in Table 6.
  • the treatment of Hela S3 and Hela ImM cells with 0.02 ⁇ M of the AS-II-2229B-20 antisense construct increases the sensitivity of these cells to N-(phosphonacetyl)-L-aspartate (PALA) and to methotrexate (MTX) as shown in Table 9.
  • Ribonucleotide reductase is composed of two dissimilar protein components coded by two distinct genes, Rl and R2. Therefore, the results described hereinabove suggest that the Rl message may also be an appropriate target for designing short antisense molecules that have potent antitumor activity.
  • Rl 20-mer deoxyribonucleotide phosphorothioate sequence in antisense orientation, designated AS-I-1395-20, was constructed and its antitumor abilities were tested.
  • the antisense construct AS-I-1395-20 has the sequence 5'-ACA GGA ATC TTT GTA GAG CA-3' (SEQ ID No:103), and targets the Rl message at nucleotides 1395-1414.
  • colony efficiency assays performed in soft agar as described herein demonstrated similar results. Colony forming efficiencies of 15.6 ⁇ 6.73 for NIH-3T3 mouse cells containing the H-ras oncogene, 4.4 ⁇ 2.62 for NIH-3T3 mouse cells containing the H-r ⁇ s oncogene and the R2 antisense sequence, and 51 ⁇ 12.29 for NIH-3T3 mouse cells containing the H-r ⁇ s oncogene and the coding region sequence for R2 were seen.
  • EXAMPLE 5 Western blot analysis of AS-II-626-20 inhibition of ribonucleotide reductase R2 protein level in L60 mouse tumor cells.
  • Cells were treated for 4 hours with growth medium supplemented with lipofectin but without antisense oligonucleotides (a) or with lipofectin medium containing 0.2 ⁇ M AS-II-626-20 (b).
  • As added controls the tumor cells were also treated for 4 hours with growth medium supplemented with lipofectin and 0.2 ⁇ M oligonucleotide scrambled control, which contains the same proportion of nucleotides found in AS-II-626-20 but in a different order (ACGCACTCAGCTAGTGACAC, SEQ. ID. NO.
  • Cells were treated for 4 hours with 0.2 ⁇ M oligonucleotide in the presence of lipofectin (b to f), or with lipofectin without oligonucleotide as a control (a), (b) Cells treated as AS-II-667-20; (c) cells treated with AS-II-816-20; (d) cells treated with AS-H-1288-20; (e) cells treated with AS-II- 1335-20 and, (f) cells treated with AS-II-1338-20. Note the decrease in R2 protein levels in cells treated with antisense oligonucleotides that target the R2 mRNA, in keeping with their abilities to inhibit human tumor cell proliferation (Table 12).
  • the first number m dicates the first nucleotide position in the R2 mRNA sequence
  • the second number m dicates the length of the sequence segment
  • sequence AS-II-2229A shown in the Table and the sequence AS-II-2229B described in the text are alternate sequences, with 2229A chosen from the version of R2 m GENBANK (submitted by Pavloff) and 2229B chosen from the version published by Pavloff et al , J DNA Sequencmg and Mappmg, 2227-234, 1992
  • TM°C Melting temperature of oligonucleotide duplex formed
  • Name includes the following:
  • the first number indicates the first nucleotide position in the Rl mRNA sequence.
  • the second number indicates the length of the sequence segment.
  • iTm°C Melting temperature of oligonucleotide duplex formed.
  • 2 dG Free energy value for oligonucleotide-complement dimer formation.
  • Tumors (mean ⁇ SE)
  • the r-3 cell line is highly malignant and has been described previously (Taylor, W.R., Egan, S.E., Mowat, M., Greenberg, A.H. and Wright, J.A.
  • Wild-type p53 restores cell cycle control and inhibits gene amplification in cells with mutant p53 alleles.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/CA1997/000540 1996-08-02 1997-08-01 Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase Ceased WO1998005769A2 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
DE69734589T DE69734589T2 (de) 1996-08-02 1997-08-01 Antitumor antisense sequenzen gegen h1 und r2 verbindungen von ribonukleotide reductase
CA002262776A CA2262776C (en) 1996-08-02 1997-08-01 Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase
NZ333802A NZ333802A (en) 1996-08-02 1997-08-01 Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase
AU36175/97A AU738592C (en) 1996-08-02 1997-08-01 Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase
IL12812497A IL128124A0 (en) 1996-08-02 1997-08-01 Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase
AT97932690T ATE309345T1 (de) 1996-08-02 1997-08-01 Antitumor antisense sequenzen gegen h1 und r2 verbindungen von ribonukleotide reductase
JP50741098A JP4301576B2 (ja) 1996-08-02 1997-08-01 リボヌクレオチドレダクターゼのr1およびr2成分に対して指向される抗腫瘍アンチセンス配列
EP97932690A EP0917569B1 (en) 1996-08-02 1997-08-01 Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase
IL128124A IL128124A (en) 1996-08-02 1999-01-19 Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US2304096P 1996-08-02 1996-08-02
US60/023,040 1996-08-02
US3995997P 1997-03-07 1997-03-07
US60/039,959 1997-03-07

Publications (2)

Publication Number Publication Date
WO1998005769A2 true WO1998005769A2 (en) 1998-02-12
WO1998005769A3 WO1998005769A3 (en) 1998-06-25

Family

ID=26696655

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA1997/000540 Ceased WO1998005769A2 (en) 1996-08-02 1997-08-01 Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase

Country Status (12)

Country Link
US (1) US5998383A (cg-RX-API-DMAC7.html)
EP (1) EP0917569B1 (cg-RX-API-DMAC7.html)
JP (1) JP4301576B2 (cg-RX-API-DMAC7.html)
CN (1) CN1189562C (cg-RX-API-DMAC7.html)
AT (1) ATE309345T1 (cg-RX-API-DMAC7.html)
AU (1) AU738592C (cg-RX-API-DMAC7.html)
CA (1) CA2262776C (cg-RX-API-DMAC7.html)
DE (1) DE69734589T2 (cg-RX-API-DMAC7.html)
ES (1) ES2256893T3 (cg-RX-API-DMAC7.html)
IL (2) IL128124A0 (cg-RX-API-DMAC7.html)
NZ (1) NZ333802A (cg-RX-API-DMAC7.html)
WO (1) WO1998005769A2 (cg-RX-API-DMAC7.html)

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999002673A3 (en) * 1997-07-10 1999-04-01 Genesense Technologies Inc Antisense oligonucleotide sequences as inhibitors of microorganisms
WO2000047733A1 (en) * 1999-02-11 2000-08-17 Genesense Technologies Inc. Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase
WO2001048166A1 (en) * 1999-12-27 2001-07-05 Shanghai Biowindow Gene Development Inc. A new polypeptide- ribonucleotide reductase 10 and the polynucleotide encoding it
WO2001006019A3 (en) * 1999-07-20 2001-08-16 Vi Technologies Inc Nucleic acids for detecting parvovirus and methods of using same
WO2003004037A1 (de) * 2001-06-28 2003-01-16 I.P.L. International Pharmaceutics Ltd. Xenogene oligo- oder/und polyribonukleotide als mittel zur behandlung von malignen tumoren
US6593305B1 (en) 1996-08-02 2003-07-15 Genesense Technologies Inc. Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase
WO2004070033A1 (en) 2003-02-10 2004-08-19 Genesense Technologies Inc. Antisense oligonucleotides directed to ribonucleotide reductase r2 and uses thereof in the treatment of cancer
WO2004106518A1 (en) * 2003-05-31 2004-12-09 Genesense Technologies Inc. Antisense oligonucleotides directed to ribonucleotide reductase r2 and uses thereof in the treatment of cancer
EP1584681A3 (en) * 1997-07-10 2005-11-09 GeneSense Technologies Inc. Antisense oligonucleotide sequences as inhibitors of microorganisms
WO2006017932A1 (en) * 2004-08-18 2006-02-23 Genesense Technologies Inc. Small interfering rna molecules against ribonucleotide reductase and uses thereof
WO2009080694A1 (en) 2007-12-20 2009-07-02 Novartis Ag Thiazole derivatives used as pi 3 kinase inhibitors
WO2010027279A3 (en) * 2008-09-04 2010-04-29 Genesis Research And Development Corporation Limited Compositions and methods for the treatment and prevention of neoplastic disorders
EP2261223A1 (en) 2006-01-20 2010-12-15 Novartis AG Pyrimidine derivatives used as pi-3 kinase inhibitors
WO2011000905A1 (en) 2009-07-02 2011-01-06 Novartis Ag Substituted 2-carboxamide cycloamino ureas
US7932262B2 (en) 2006-04-06 2011-04-26 Novartis Ag Quinazolines for PDK1 inhibition
WO2012016970A1 (en) 2010-08-02 2012-02-09 Novartis Ag A crystalline form of (s)-pyrrolidine-1,2-dicarboxylic acid 2-amide 1-(4 -methyl-5-[2-(2,2,2-trifluoro-1,1-dimethyl-ethyl)-pyridin-4-yl]-thiazol-2-yl)-amide and its use as pi3k inhibitor
WO2012104776A1 (en) 2011-01-31 2012-08-09 Novartis Ag Novel heterocyclic derivatives
WO2013061305A1 (en) 2011-10-28 2013-05-02 Novartis Ag Novel purine derivatives and their use in the treatment of disease
WO2013173283A1 (en) 2012-05-16 2013-11-21 Novartis Ag Dosage regimen for a pi-3 kinase inhibitor
WO2017077445A1 (en) 2015-11-02 2017-05-11 Novartis Ag Dosage regimen for a phosphatidylinositol 3-kinase inhibitor
WO2018060833A1 (en) 2016-09-27 2018-04-05 Novartis Ag Dosage regimen for alpha-isoform selective phosphatidylinositol 3-kinase inhibitor alpelisib
EP4000619A1 (en) 2013-12-06 2022-05-25 Novartis AG Dosage regimen for an alpha-isoform selective phosphatidylinositol 3-kinase inhibitor

Families Citing this family (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA1223831A (en) 1982-06-23 1987-07-07 Dean Engelhardt Modified nucleotides, methods of preparing and utilizing and compositions containing the same
CA2259123C (en) * 1996-07-01 2003-10-21 Lorus Therapeutics Inc. Oligonucleotides from the untranslated regions of ribonucleotide reductase and their use to modulate cell growth
EP0971731B1 (en) * 1997-03-19 2004-05-12 GeneSense Technologies Inc. Suppression of malignancy utilizing ribonucleotide reductase r1
US6835395B1 (en) 1997-05-14 2004-12-28 The University Of British Columbia Composition containing small multilamellar oligodeoxynucleotide-containing lipid vesicles
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
AUPP249298A0 (en) 1998-03-20 1998-04-23 Ag-Gene Australia Limited Synthetic genes and genetic constructs comprising same I
CN101818145A (zh) * 1998-03-20 2010-09-01 联邦科学和工业研究组织 控制基因表达
CA2361201A1 (en) * 1999-01-28 2000-08-03 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna
US20040138168A1 (en) * 1999-04-21 2004-07-15 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
US6423885B1 (en) 1999-08-13 2002-07-23 Commonwealth Scientific And Industrial Research Organization (Csiro) Methods for obtaining modified phenotypes in plant cells
KR20020097198A (ko) * 2000-03-17 2002-12-31 베니텍 오스트레일리아 리미티드 유전자 사일런싱
CA2369944A1 (en) * 2001-01-31 2002-07-31 Nucleonics Inc. Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell
AU2003225410A1 (en) * 2003-03-21 2004-10-11 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
CA2526393A1 (en) * 2003-05-21 2004-12-02 Genesense Technologies Inc. Antisense oligonucleotides directed to ribonucleotide reductase r1 and uses thereof in the treatment of cancer
CN1910293B (zh) 2003-10-23 2011-04-13 伊洛默格生物科学公司 检测与抗病毒感染性有关的基因oas1中的突变的方法
EP1715896A4 (en) * 2004-01-12 2009-01-07 Lorus Therapeutics Inc ANTISENSE OLIGONUCLEOTIDES DIRECTED AGAINST RIBONUCLEOTIDE REDUCTASE R2 AND USE THEREOF IN POLYTHERAPIES FOR THE TREATMENT OF CANCER
US8029815B2 (en) * 2004-04-28 2011-10-04 Elford Howard L Methods for treating or preventing restenosis and other vascular proliferative disorders
JP5697297B2 (ja) * 2004-05-14 2015-04-08 ロゼッタ ジノミクス リミテッド マイクロnasおよびその使用
US7968762B2 (en) * 2004-07-13 2011-06-28 Van Andel Research Institute Immune-compromised transgenic mice expressing human hepatocyte growth factor (hHGF)
US20060185027A1 (en) * 2004-12-23 2006-08-17 David Bartel Systems and methods for identifying miRNA targets and for altering miRNA and target expression
JP2008537551A (ja) * 2005-03-31 2008-09-18 カランド ファーマシューティカルズ, インコーポレイテッド リボヌクレオチドレダクターゼサブユニット2の阻害剤およびその使用
EP2030615A3 (en) * 2007-08-13 2009-12-02 ELFORD, Howard L. Ribonucleotide reductase inhibitors for use in the treatment or prevention of neuroinflammatory or autoimmune diseases
US20100204305A1 (en) * 2007-12-11 2010-08-12 Lorus Therapeutics Inc. Small interfering rna molecules against ribonucleotide reductase and uses thereof
EP2727996A1 (en) 2008-11-06 2014-05-07 The Johns-Hopkins University Treatment of chronic inflammatory respiratory disorders with NP1 inhibitors
EP3434772A3 (en) * 2010-10-18 2019-03-20 Arrowhead Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of rrm2 genes

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5681747A (en) * 1992-03-16 1997-10-28 Isis Pharmaceuticals, Inc. Nucleic acid sequences encoding protein kinase C and antisense inhibition of expression thereof
WO1994021661A1 (en) * 1993-03-23 1994-09-29 The Board Of Trustees Of The Leland Stanford Junior University Cellular regulation with riboregulators

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
BARKER R H JR ET AL: "Inhibition of Plasmodium falciparum malaria using antisense oligodeoxynucleotides." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA 93 (1). 1996. 514-518. ISSN: 0027-8424, XP002053162 *
BJ\RKLUND S ET AL: "S-PHASE-SPECIFIC EXPRESSION OF MAMMALIAN RIBONUCLEOTIDE REDUCTASE R1 AND R2 SUBUNIT MESSENGER RNAS." BIOCHEMISTRY 29 (23). 1990. 5452-5458. CODEN: BICHAW ISSN: 0006-2960, XP002053156 *
CHAKRABARTI, DEBOPAM ET AL: "Cloning and characterization of subunit genes of ribonucleotide reductase, a cell-cycle-regulated enzyme, from Plasmodium falciparum" PROC. NATL. ACAD. SCI. U. S. A. (1993), 90(24), 12020-4 CODEN: PNASA6;ISSN: 0027-8424, 1993, XP002053163 *
HUANG A ET AL: "Ribonucleotide reductase R2 gene expression and changes in drug sensitivity and genome stability." CANCER RESEARCH 57 (21). 1997. 4876-4881. ISSN: 0008-5472, XP002053166 *
L. THELANDER ET AL.: "Isolation and characterization of expressible cDNA clones encoding the M1 and M2 subunits of mouse ribonucleotide reductase." MOLECULAR AND CELLULAR BIOLOGY, vol. 6, no. 10, October 1986, pages 3433-3442, XP002053157 *
M. THELANDER ET AL.: "Molecular cloning and expression of the functional gene encoding the M2 subunit of mouse ribonucleotide reductase: a new dominant marker gene." THE EMBO JOURNAL, vol. 8, no. 9, 1989, pages 2475-2479, XP002053158 *
M.M. CHAUDHURI ET AL.: "cDNA sequence of the small subunit of the hamster ribonucleotide reductase." BIOCHEMICA ET BIOPHYSICA ACTA, vol. 1171, 1992, pages 117-121, XP002053159 *
MADER R M ET AL: "Transcription and activity of 5-fluorouracil converting enzymes in fluoropyrimidine resistance in colon cancer in vitro." BIOCHEMICAL PHARMACOLOGY 54 (11). 1997. 1233-1242. ISSN: 0006-2952, XP002053167 *
N. PAVLOFF ET AL.: "Sequence analysis of the large and small subunits of human ribonucleotide reductase." DNA SEQUENCE, vol. 2, 1992, pages 227-234, XP002048232 *
R.A.R. HURTA ET AL.: "Early induction of ribonucleotide reductase gene expression by transforming growth factor beta1 in malignant H-ras transformed cell lines." THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 266, no. 35, 15 December 1991, pages 24097-24100, XP002053309 cited in the application *
See also references of EP0917569A2 *
STANDARD N ET AL: "MATERNAL MESSENGER RNA FROM CLAM OOCYTES CAN BE SPECIFICALLY UNMASKED IN-VITRO BY ANTISENSE RNA COMPLEMENTARY TO THE 3'-UNTRANSLATED REGION." GENES DEV 4 (12A). 1990. 2157-2168. CODEN: GEDEEP ISSN: 0890-9369, XP002053164 *
STANDART N ET AL: "CONTROL OF TRANSLATION OF MASKED MRNAS IN CLAM OOCYTES." ENZYME (BASEL) 44 (1-4). 1990 (1991). 106-119. CODEN: ENZYBT ISSN: 0013-9432, XP002053165 *

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7405205B2 (en) 1996-08-02 2008-07-29 Lorus Therapeutics Inc. Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase
US6593305B1 (en) 1996-08-02 2003-07-15 Genesense Technologies Inc. Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase
WO1999002673A3 (en) * 1997-07-10 1999-04-01 Genesense Technologies Inc Antisense oligonucleotide sequences as inhibitors of microorganisms
EP1584681A3 (en) * 1997-07-10 2005-11-09 GeneSense Technologies Inc. Antisense oligonucleotide sequences as inhibitors of microorganisms
WO2000047733A1 (en) * 1999-02-11 2000-08-17 Genesense Technologies Inc. Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase
US6121000A (en) * 1999-02-11 2000-09-19 Genesense Technologies, Inc. Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase
AU780455B2 (en) * 1999-02-11 2005-03-24 Lorus Therapeutics Inc. Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase
US6642033B1 (en) 1999-07-20 2003-11-04 V.I. Technologies, Inc. Nucleic acids for detecting parvovirus and methods of using same
WO2001006019A3 (en) * 1999-07-20 2001-08-16 Vi Technologies Inc Nucleic acids for detecting parvovirus and methods of using same
WO2001048166A1 (en) * 1999-12-27 2001-07-05 Shanghai Biowindow Gene Development Inc. A new polypeptide- ribonucleotide reductase 10 and the polynucleotide encoding it
WO2003004037A1 (de) * 2001-06-28 2003-01-16 I.P.L. International Pharmaceutics Ltd. Xenogene oligo- oder/und polyribonukleotide als mittel zur behandlung von malignen tumoren
AU2002354738B2 (en) * 2001-06-28 2007-11-29 I.P.L. International Pharmaceutics Ltd. Xenogenic oligoor/and polyribonucleotides as agents for the treatment of malignant tumours
WO2004070033A1 (en) 2003-02-10 2004-08-19 Genesense Technologies Inc. Antisense oligonucleotides directed to ribonucleotide reductase r2 and uses thereof in the treatment of cancer
US7968526B2 (en) 2003-02-10 2011-06-28 Lorus Therapeutics Inc. Antisense oligonucleotides directed to ribonucleotide reductase R2 and uses thereof in the treatment of cancer
AU2004209579B2 (en) * 2003-02-10 2010-03-04 Lorus Therapeutics Inc. Antisense oligonucleotides directed to ribonucleotide reductase R2 and uses thereof in the treatment of cancer
WO2004106518A1 (en) * 2003-05-31 2004-12-09 Genesense Technologies Inc. Antisense oligonucleotides directed to ribonucleotide reductase r2 and uses thereof in the treatment of cancer
WO2006017932A1 (en) * 2004-08-18 2006-02-23 Genesense Technologies Inc. Small interfering rna molecules against ribonucleotide reductase and uses thereof
EP2261223A1 (en) 2006-01-20 2010-12-15 Novartis AG Pyrimidine derivatives used as pi-3 kinase inhibitors
US7932262B2 (en) 2006-04-06 2011-04-26 Novartis Ag Quinazolines for PDK1 inhibition
WO2009080694A1 (en) 2007-12-20 2009-07-02 Novartis Ag Thiazole derivatives used as pi 3 kinase inhibitors
WO2010027279A3 (en) * 2008-09-04 2010-04-29 Genesis Research And Development Corporation Limited Compositions and methods for the treatment and prevention of neoplastic disorders
WO2011000905A1 (en) 2009-07-02 2011-01-06 Novartis Ag Substituted 2-carboxamide cycloamino ureas
WO2012016970A1 (en) 2010-08-02 2012-02-09 Novartis Ag A crystalline form of (s)-pyrrolidine-1,2-dicarboxylic acid 2-amide 1-(4 -methyl-5-[2-(2,2,2-trifluoro-1,1-dimethyl-ethyl)-pyridin-4-yl]-thiazol-2-yl)-amide and its use as pi3k inhibitor
WO2012104776A1 (en) 2011-01-31 2012-08-09 Novartis Ag Novel heterocyclic derivatives
WO2013061305A1 (en) 2011-10-28 2013-05-02 Novartis Ag Novel purine derivatives and their use in the treatment of disease
WO2013173283A1 (en) 2012-05-16 2013-11-21 Novartis Ag Dosage regimen for a pi-3 kinase inhibitor
EP4000619A1 (en) 2013-12-06 2022-05-25 Novartis AG Dosage regimen for an alpha-isoform selective phosphatidylinositol 3-kinase inhibitor
WO2017077445A1 (en) 2015-11-02 2017-05-11 Novartis Ag Dosage regimen for a phosphatidylinositol 3-kinase inhibitor
WO2018060833A1 (en) 2016-09-27 2018-04-05 Novartis Ag Dosage regimen for alpha-isoform selective phosphatidylinositol 3-kinase inhibitor alpelisib

Also Published As

Publication number Publication date
DE69734589T2 (de) 2006-08-10
IL128124A (en) 2006-12-31
EP0917569A2 (en) 1999-05-26
CA2262776C (en) 2005-03-08
CA2262776A1 (en) 1998-02-12
AU738592C (en) 2002-07-25
NZ333802A (en) 2001-09-28
IL128124A0 (en) 1999-11-30
ATE309345T1 (de) 2005-11-15
ES2256893T3 (es) 2006-07-16
CN1189562C (zh) 2005-02-16
JP2000517167A (ja) 2000-12-26
WO1998005769A3 (en) 1998-06-25
DE69734589D1 (de) 2005-12-15
AU738592B2 (en) 2001-09-20
EP0917569B1 (en) 2005-11-09
US5998383A (en) 1999-12-07
CN1231694A (zh) 1999-10-13
AU3617597A (en) 1998-02-25
JP4301576B2 (ja) 2009-07-22

Similar Documents

Publication Publication Date Title
AU738592C (en) Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase
US7223849B1 (en) Oligonucleotides from the untranslated regions of housekeeping genes and methods of using same to modulate cell growth
EP1153128B1 (en) Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase
US5869248A (en) Targeted cleavage of RNA using ribonuclease P targeting and cleavage sequences
KR20010040448A (ko) 티오레독신 또는 티오레독신 환원효소의 유전자와상보적인 올리고뉴클레오 타이드 서열 및 이들을 사용하는세포성장 조절 방법
US7405205B2 (en) Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase
Kyo et al. How to inhibit telomerase activity for cancer therapy
AU9732101A (en) Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase
EP0971731B1 (en) Suppression of malignancy utilizing ribonucleotide reductase r1
TW200823287A (en) Composition and method for treatment of tumors
HK1024640B (en) Suppression of malignancy utilizing ribonucleotide reductase r1

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 97198163.9

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD GH

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL

WWE Wipo information: entry into national phase

Ref document number: 333802

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 09230521

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2262776

Country of ref document: CA

Ref document number: 2262776

Country of ref document: CA

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1997932690

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1997932690

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 1997932690

Country of ref document: EP