WO1997046704A1 - Sequencing by ligation of encoded adaptors - Google Patents
Sequencing by ligation of encoded adaptors Download PDFInfo
- Publication number
- WO1997046704A1 WO1997046704A1 PCT/US1997/009472 US9709472W WO9746704A1 WO 1997046704 A1 WO1997046704 A1 WO 1997046704A1 US 9709472 W US9709472 W US 9709472W WO 9746704 A1 WO9746704 A1 WO 9746704A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tag
- encoded
- polynucleotide
- oligonucleotide
- nucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
- C12Q1/6855—Ligating adaptors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6874—Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
Definitions
- the mvention relates generally to methods for determining the nucleotide sequence of a polynucleotide, and more particularly, to a method of identifying terminal nucleotides of a polynucleotide by specific hgation of encoded adaptors
- the chain termination method requires the generation of one or more sets of labeled DNA fragments, each having a common origin and each terminating with a known base
- the set or sets of fragments must then be separated by size to obtain sequence information
- the size separation is usually accomplished by high resolution gel electrophoresis.
- an object of our invention is to provide a DNA sequencing scheme which does not suffer the drawbacks of current base-by-base approaches
- Another object of our invention is to provide a method of DNA sequencing which is amenable to parallel, or simultaneous, application to thousands of DNA fragments present m a common reaction vessel
- a further object of our invention is to provide a method of DNA sequencing which permits the identification of a terminal portion of a target polynucleotide with minimal enzymatic steps
- Yet another object of our invention is to provide a set of encoded adaptors for identifying the sequence of a plurality of terminal nucleotides of one or more target polynucleotides
- Each encoded adaptor comprises a protruding strand and an oligonucleotide tag selected from a minimally cross-hybridizing set of oligonucleotides
- Encoded adaptors whose protruding strands form perfectly matched duplexes with the complementary protruding strands of the target polynucleotide are ligated After hgation, the identity and ordering of the nucleotides in the protruding strands are determined, or "decoded,” by specifically hybridizing a labeled tag complement to its corresponding tag on the ligated adaptor
- an encoded adaptor with a protruding strand of four nucleotides forms a perfectly matched duplex with the complementary protruding strand of a target polynucleotide and is ligated
- the four complementary nucleotides, 3'-TCCA, on the polynucleotide may be identified by a umque oligonucleotide tag selected from a set of 256 such tags, one for every possible four nucleotide sequence of the protruding strands
- Tag complements are applied to the ligated adaptors under conditions which allow specific hybridization of only those tag complements that form perfectly matched duplexes (or tnplexes) with the oligonucleotide tags of the ligated adaptors
- the tag complements may be applied individually or as one or more mixtures to determine the identity of the oligonucleotide tags, and therefore, the sequences of the protruding strands
- the encoded adaptors may be used in sequence analysis either (l) to identify one or more nucleotides as a step of a process that involves repeated cycles of hgation, identification, and cleavage, as desc ⁇ bed in Brenner U S patent 5,599,675 and PCT Publication No WO 95/27080, or (n) as a "stand alone" identification method, wherein sets of encoded adaptors are applied to target polynucleotides such that each set is capable of identifying the nucleotide sequence of a different portion of a target polynucleotide, that is, in the latter embodiment, sequence analysis is earned out with a s gle hgation for each set followed by identification
- oligonucleotide tags that are members of a minimally cross-hybndizing set of oligonucleotides, e g as described in International patent applications PCT/US95/12791 (WO 96/12041) and PCT/US96/09513 (WO 96/41011)
- the sequences of oligonucleotides of such a set differ from the sequences of every other member of the same set by at least two nucleotides
- each member of such a set cannot form a duplex (or triplex) with the complement of anv other member with less than two mismatches
- each member of a minimally cross-hybridizing set differs from every other member by as many nucleotides as possible consistent with the size of set required for a particular application
- longer oligonucleotide tags are used, such as 12- to 20-mers for delivering labels to encoded adaptors, then the difference between members of
- Oligonucleotide tags may be single stranded and be designed for specific hybridization to smgle stranded tag complements by duplex formation Oligonucleotide tags may also be double stranded and be designed for specific hybridization to single stranded tag complements by tnplex formation Preferably, the oligonucleotide tags of the encoded adaptors are double stranded and their tag complements are smgle stranded, such that specific hybridization of a tag with its complements occurs through the formation of a tnplex structure
- the method of the invention comprises the following steps (a) ligating an encoded adaptor to an end of a polynucleotide, the adaptor having an oligonucleotide tag selected from a minimally cross-hybndizing set of oligonucleotides and a protruding strand complementary to a protrudmg strand of the polynucleotide, and (b) identifying one
- Figures 1A-1E diagrammatically illustrate the use of encoded adaptors to determine the terminal nucleotides sequences of a plurality of tagged polynucleotides
- Figure 2 illustrates the phenomena of self-hgation of identical polynucleotides that are anchored to a solid phase support
- Figure 3 A illustrates steps in a preferred method of the invention in which a double stranded adaptor havmg a blocked 3' carbon is ligated to a target polynucleotide
- Figure 3B illustrates the use of the preferred embodiment in a method of DNA sequencing by stepwise cycles of hgation and cleavage
- Figure 4 illustrates data from the determination of the terminal nucleotides of a test polynucleotide usmg the method of the present invention
- Figure 5 is a schematic representation of a flow chamber and detection apparatus for observing a planar array of microparticles loaded with cDNA molecules for sequencmg
- the term "encoded adaptor” is used synonymously with the term “encoded probe” of pnonty document U S patent application Ser No 08/689,587
- the term “hgation” means the formation of a covalent bond between the ends of one or more (usually two) oligonucleotides The term usually refers to the formation of a phosphodiester bond resulting from the following reaction, which is usually catalyzed by a hgase
- o goi and o g ⁇ 2 are either two different oligonucleotides or different ends of the same oligonucleotide
- the term encompasses non-enzymatic formation of phosphodiester bonds, as well as the formation of non-phosphodiester covalent bonds between the ends of oligonucleotides, such as phosphorothioate bonds, disulfide bonds, and the like
- a hgation reaction is usually template d ⁇ ven, in that the ends of o goj and ohg ⁇ 2 are brought into juxtaposition by specific hybndization to a template strand
- a special case of template-driven hgation is the hgation of two double stranded oligonucleotides havmg complementary protruding strands
- oligonucleotide tags refers to an oligonucleotide to which a oligonucleotide tag specifically hybridizes to form a perfectly matched duplex or tnplex In embodiments where specific hybridization results in a tnplex, the oligonucleotide tag may be selected to be either double stranded or smgle stranded Thus, where triplexes are formed, the term “complement” is meant to encompass either a double stranded complement of a smgle stranded oligonucleotide tag or a smgle stranded complement of a double stranded oligonucleotide tag.
- oligonucleotide as used herem mcludes linear o gomers of natural or modified monomers or linkages, including deoxynbonucleosides, nbonucleosides, anomenc forms thereof,
- Perfectly matched in reference to a duplex means that the poly- or oligonucleotide strands making up the duplex form a double stranded structure with one other such that every nucleotide in each strand undergoes Watson-Crick basepairing with a nucleotide in the other strand
- the term also comprehends the pairmg of nucleoside analogs, such as deoxyinosine, nucleosides with 2-am ⁇ nopu ⁇ ne bases, and the like, that may be employed
- the term means that the tnplex consists of a perfectly matched duplex and a third strand in which every nucleotide undergoes Hoogsteen or reverse Hoogsteen association with a basepair of the perfectly matched duplex
- a "mismatch" in a duplex between a tag and an oligonucleotide means that a pair or triplet of nucleotides in the duplex or triplex
- nucleoside includes the natural nucleosides, including 2'-deoxy and 2'-hydroxyl forms, e g as desc ⁇ bed in Kornberg and Baker, DNA Replication, 2nd Ed (Freeman, San Francisco, 1992)
- "Analogs" in reference to nucleosides mcludes synthetic nucleosides havmg modified base moieties and or modified sugar moieties, e g described by Scheit, Nucleotide Analogs (John Wiley, New York, 1980), Uhlman and Peyman, Chemical Reviews, 90 543-584 (1990), or the like, with the only proviso that they are capable of specific hybridization
- Such analogs include synthetic nucleosides designed to enhance binding properties, reduce complexity, mcrease specificity, and the like
- sequence determination or "determining a nucleotide sequence” in reference to polynucleotides mcludes determination of partial as well as full sequence information of the polynucleotide That is, the term mcludes sequence compansons, fingerpnnting, and like levels of information about a target polynucleotide, as well as the express identification and ordering of nucleosides, usually each nucleoside, m a target polynucleotide The term also mcludes the determination of the identification, ordering, and locations of one, two, or three of the four types of nucleotides within a target polynucleotide For example, m some embodiments sequence determination may be effected by identifying the ordering and locations of a single type of nucleotide, e g cytosmes, within the target polynucleotide "CATCGC " so that its sequence is represented as a binary code, e g " 100101 " for "C-(not
- the term "complexity" in reference to a population of polynucleotides means the number of different species of molecule present in the population
- the invention involves the hgation of encoded adaptors specifically hybridized to the terminus or termini of one or more target polynucleotides Sequence information about the region where specific hybridization occurs is obtained by "decoding" the oligonucleotide tags of the encoded adaptors thus ligated
- multiple sets of encoded adaptors are ligated to a target polynucleotide at staggered cleavage points so that the encoded adaptors provide sequence information from each of a plurality of portions of the target polynucleotide
- Such portions may be disjoint, overlapping or contiguous, however, preferably, the portions are contiguous and together permit the identification of a sequence of nucleotides equal to the sum of the lengths of the individual portions
- encoded adaptors are only a smgle h
- the invention makes use of nucleases whose recognition sites are separate from their cleavage sites
- nucleases are type Ils restnction endonucleases
- the nucleases are used to generate protruding strands on target polynucleotides to which encoded adaptors are ligated
- the amount of sequence information obtained in a given embodiment of the mvention depends in part on how many such nucleases are employed and the length of the protruding strand produce upon cleavage
- the method of the invention comprises the following steps (a) attaching a first oligonucleotide tag from a repertoire of tags to each polynucleotide in a population of polynucleotides such that each first oligonucleotide tag from the repertoire is selected from a first minimally cross-hybndizing set, (b) sampling the population of polynucleotides such that substantially all different polynucleotides m the population have different first oligonucleotide tags attached, (c) gating one or more encoded adaptors to an end of each of the polynucleotides in the population, each encoded adaptor havmg a second oligonucleotide tag selected from a second minimally cross-hybndizmg set and a protrudmg strand complementary to a protruding strand of a polynucleo
- the method further mcludes repeated cycles of hgation, identification, and cleavage, such that one or more nucleotides are identified in each cycle Preferably, from 2 to 6 nucleotides are identified and their ordering determined m each cycle
- k target polynucleotides are prepared as described below, and also in Brenner, International patent applications PCT/US95/ 12791 (WO 96/12041) and PCT/US96/09513 (WO 96/41011) That is, a sample is taken from a population of polynucleotides conjugated with oligonucleotide tags designated by small "t's " These tags are sometimes referred to as oligonucleotide tags for sorting, or as "first" oligonucleotide tags
- the tag-polynuclcotide conjugates of the sample are amplified, e g by polymerase chain reaction (PCR) or by cloning, to give 1 through k populations of conjugates, indicated by (14)-(18) in Fig 1A
- PCR polymerase chain reaction
- an exemplary set of three cleavage adaptors may be constructed as follows
- cleavage adaptors (1), (2), and (3) are shown in capital letters with the respective recogmtion sites of nucleases Bbs I, Bbv I, and Bsm FI underlined and a 5' phosphate mdicated as "p "
- the double underlmed portions of the target polynucleotide indicate the positions of the protrudmg strands after hgation and cleavage In all cases, the target polynucleotide is left with a 5' protruding strand of four nucleotides
- many different embodiments can be constructed usmg different numbers and kinds of nucleases As discussed in Brenner, U.S.
- cleavage adaptors A], A2, and A3 are ligated (20) m a concentration ratio of 1 : 1 : 1 to the k target polynucleotides to give the conjugates shown in Fig. IB, such that within each population of tag-polynucleotide conjugates there are approximately equal numbers of conjugates having A ⁇ , A2, and A3 attached.
- the target polynucleotides are successively cleaved with each of the nucleases of the cleavage adaptors and ligated to a set of encoded adaptors.
- the target polynucleotides are cleaved (22) with the nuclease of cleavage adaptor A j after which a first set of encoded adaptors are ligated to the resulting protruding strands.
- the cleavage results in about a third of the target polynucleotides of each type, i.e. tj, t2, ... t j ., being available for ligation.
- the encoded adaptors are applied as one or more mixtures of adaptors which taken together contain every possible sequence of a protruding strand.
- Reaction conditions are selected so that only encoded adaptors whose protruding strands form perfectly matched duplexes with those of the target polynucleotide arc ligated to form encoded conjugates (28), (30), and (32) (Fig. IC).
- the capital "T's" with subscripts indicate that unique oligonucleotide tags are carried by the encoded adaptors for labeling.
- the oligonucleotide tags carried by encoded adaptors are sometimes referred to tags for delivering labels to the encoded adaptors, or as "second" oligonucleotide tags.
- single stranded oligonucleotide tags used for sorting preferably consist of only three of the four nucleotides, so that a T4 DNA polymerase "stripping" reaction, e.g. Kuijper et al (cited above), can be used to prepare target polynucleotides for loading onto solid phase supports.
- oligonucleotide tags employed for delivering labels may consist of all for nucleotides.
- encoded adaptors comprise a protruding strand (24) and an oligonucleotide tag (26).
- oligonucleotide tag T24 could have the following structure (SEQ ID NO: 1):
- the encoded adaptors in this example may be ligated to the target polynucleotides in one or more mixtures of a total of 768 (3 x 256) members
- an encoded adaptor may also comprise a spacer region, as shown m the above example where the 4 nucleotide sequence "ttct" serves as a spacer between the protrudmg strand and the oligonucleotide tag
- the tag- polynucleotide conjugates are cleaved (34) with the nuclease of cleavage adaptor A2, after which a second set of encoded adaptors is applied to form conjugates (36), (38), and (40) (Fig ID)
- the tag-polynucleotide conjugates are cleaved (42) with the nuclease of cleavage adaptor A3, after which a third set of encoded adaptors is applied to form conjugates (44), (46), and (48) (Fig IE)
- the mixture is loaded (50) onto one or more solid phase supports via oligonucleotide tags t ⁇ through t ⁇ .
- oligonucleotide tags t j , t2, t ⁇ , are not necessary
- biotin, or like moiety can be employed to anchor the polynucleotide-encoded adaptor conjugate, as no sorting is required
- the ordering of the steps of cleavage, hgation, and loading onto solid phase supports depends on the particular embodiment implemented For example, the tag-polynucleotide conjugates may be loaded onto solid phase support first, followed by hgation of cleavage adaptors, cleavage thereof, and hgation of encoded adaptors, or, the cleavage adaptors may be ligated first, followed bv loadmg, cleavage, and hgation of encoded adaptors, and
- sequence information is obtained by successively applymg labeled tag complements to the immobilized target polynucleotides, either individually or as mixtures under conditions that permit the formation of perfectly matched duplexes and/or triplexes between the oligonucleotide tags of the encoded adaptors and their respective tag complements
- the numbers and complexity of the mixtures depends on several factors, including the type of labelmg system used, the length of the portions whose sequences are to be identifed, whether complexity reducing analogs are used, and the like
- the tag complements are applied individually to identify the nucleotides of each of the four-nucleotide portions of the target polynucleotide (1 e , 4 tag complements for each of 12 positions for
- N is any one of the nucleotides, A, C, G, or T
- This embodiment incorporates a significant degree of redundancy (a total of 16 tag complements are used to identify 4 nucleotide) in exchange for increased reliability of nucleotide determination
- 12 mixtures of 4 tag complements each could applied in succession by usmg four spectrally distinguishable fluorescent dyes, such that there is a one-to-one correspondence between dyes and kinds of nucleotide
- a fourth adaptor is ligated to the ends of the target polynucleotides along with cleavage adaptors Aj, A2, and A3, for example, in a concentration ratio of 3 1 1 1
- the stepping adaptor includes a recognition site for a type Ils nuclease positioned such that its reach (defined below) will permit cleavage of the target polynucleotides at the end of the sequence determined via cleavage adaptors Aj, A2, and A3
- An example of a stepping adaptor that could be used with the above set of cleavage adaptors is as follows
- the recognition site of the nuclease in this case BpM I, is singly underlined and the nucleotides at the cleavage site are doubly underlined
- the target polynucleotides cleaved with the nuclease of the stepping adaptor may be ligated to a further set of cleavage adaptors A4, A5, and Ag, which may contain nuclease recognition sites that are the same or different than those contained in cleavage adaptors A ⁇ , A2, and A3 Whether or not an enlarged set of encoded adaptors is required depends on whether cleavage and hgation reactions can be tolerated in the signal measurement apparatus If, as above, it is desired to minimize enzyme reactions in connection with signal measurement, then additional sets of encoded adaptors must be employed That is, where above 768 oligonucleotide tags and tag complements were called for, with six cleavage reactions producmg protrudmg strands of four nucleot
- cleavage sites are mdicated by double underlining Cleavage adaptors A4, A5, and Ag are preferably applied as mixtures, such that every possible two-nucleotidc protruding strand is represented
- the target polynucleotides are prepared for loading onto solid phase supports, preferably microparticles, as disclosed in Brenner, International patent application PCT/US95/ 12791 (WO 96/ 12041 ) Briefly, the oligonucleotide tags for sorting are rendered single stranded using a "stripping" reaction with T4 DNA polymerase, c g Kuijper et al (cited above) The single stranded oligonucleotide tags are specifically hybridized and ligated to their tag complements on microparticles The loaded microparticles are then analyzed m an instrument, such as described in Brenner (cited above) which permits the sequential delivery, specific hybridization, and removal of labeled tag complements to encoded adaptors
- hgation methods include, but are not limited to, those disclosed in Shabarova, Biochimie 70 1323-
- non-enzymatic hgation is carried out by the method of Letsinger et al (cited above) In this method, an encoded adaptor having a 3'-bromoacetylated end is reacted with a polynucleotide havmg a complementary protrudmg strand and a thiophosphoryl group at its 5' end
- An exemplary encoded adaptor employing such chemistry has the following structure
- Encoded adaptors may be used in an adaptor-based method of DNA sequencing that mcludes repeated cycles of hgation, identification, and cleavage, such as the method described m Brenner, U S patent 5,599,675 and PCT Publication No WO 95/27080 Bncfly, such a method comprises the following steps (a) hgating an encoded adaptor to an end of a polynucleotide, the encoded adaptor having a nuclease recognition site of a nuclease whose cleavage site is separate from its recognition site, (b) identifying one or more nucleotides at the end of the polynucleotide by the identity of the encoded adaptor ligated thereto, (c) cleaving the polynucleotide with a nuclease recognizing the nuclease recognition' site of the encoded adaptor such that the polynucleotide is
- nucleotide sequences of oligonucleotides of a minimally cross-hybndizing set are conveniently enumerated by simple computer programs, such as those exemplified by the programs whose source codes are listed m Appendices I and II Similar computer programs arc readily written for listing oligonucleotides of minimally cross-hybndizing sets for any embodiment of the invention Table I below provides guidance as to the size of sets of minimally cross-hybndizing oligonucleotides for the indicated lengths and number of nucleotide differences The above computer programs were used to generate the numbers
- oligonucleotides may be synthesized directly by a vanety of parallel synthesis approaches, e g as disclosed in Frank et al, U S patent 4,689,405, Frank et al, Nucleic Acids Research, 1 1 4365-4377 (1983), Matson et al, Anal Biochem , 224 1 10-1 16 (1995), Fodor et al, International application PCT US93/04145 (WO 93/22684), Pease et al, Proc Natl Acad Sci , 91 5022-5026 (1994), Southern et al, J Biotechnology, 35 217-227 (1994), Brennan, International application PCT/US94/05896 (WO 94/27719), Lashkan et al, Proc Natl Acad Sci , 92 7912-7915 (1995), or the like
- tag complements in mixtures whether synthesized combinatonally or individually
- oligonucleotide tags used for sorting a preferred embodiment of minimally cross-hybndizing sets are those whose subumts are made up of three of the four natural nucleotides As will be discussed more fully below, the absence of one type of nucleotide in the oligonucleotide tags permits target polynucleotides to be loaded onto solid phase supports by use of the 5'— »3' exonuclease activity of a DNA polymerase.
- the following is an exemplary mmimally cross-hyb ⁇ dizmg set of subumts each comprising four nucleotides selected from the group consisting of A, G, and T
- each member would form a duplex having three mismatched bases with the complement of every other member
- oligonucleotide tags used for delivering labels to encoded adaptors, all four nucleotides are employed
- the oligonucleotide tags of the invention and their complements are conveniently synthesized on an automated DNA synthesizer, e g an Applied Biosystems, Inc (Foster City, California) model 392 or 394 DNA/RNA Synthesizer, using standard chemistnes, such as phosphoramiditc chemistry, c g disclosed in the following references Beaucage and Iyer, Tetrahedron, 48 2223-2311 (1992), Molko et al, U S patent 4,980,460, Koster et al, U S patent 4,725,677, Caruthers et al, U S patents 4,415,732, 4,458,066, and 4,973,679, and the like
- Alternative chemistnes e g resulting m non-natural backbone groups, such as peptide nucleic acids (PNAs), N3'— >
- Double stranded forms of tags may be made by separately synthesizing the complementary strands followed by mixing under conditions that permit duplex formation
- double stranded tags may be formed by first synthesizing a smgle stranded repertoire linked to a known oligonucleotide sequence that serves as a primer binding site The second strand is then synthesized by combining the single stranded repertoire with a primer and extending with a polymerase This latter approach is described in O phant et al, Gene, 44 177-183 (1986)
- duplex tags may then be inserted into cloning vectors along with target polynucleotides for sorting and manipulation of the target polynucleotide m accordance with the mvention
- tag complements are employed that are made up of nucleotides that have enhanced bmding charactenstics, such as PNAs or oligonucleotide N3'— »P5' phosphoramidates, sorting can
- Oligonucleotide tags for sorting may range in length from 12 to 60 nucleotides or basepairs Preferably, oligonucleotide tags range in length from 18 to 40 nucleotides or basepairs More preferably, oligonucleotide tags range in length from 25 to 40 nucleotides or basepairs In terms of preferred and more preferred numbers of subumts, these ranges may be expressed as follows Table III
- oligonucleotide tags for sorting are single stranded and specific hybndization occurs via Watson-Cnck pairing with a tag complement
- repertoires of smgle stranded oligonucleotide tags for sorting contain at least 100 members, more preferably, repertoires of such tags contain at least 1000 members, and most preferably, repertoires of such tags contain at least 10,000 members
- repertoires of tag complements for de ve ⁇ ng labels contain at least 16 members, more preferably, repertoires of such tags contain at least 64 members Still more preferably, such repertoires of tag complements contain from 16 to 1024 members, e g a number for identifying nucleotides in protruding strands of from 2 to 5 nucleotides in length Most preferably, such repertoires of tag complements contain from 64 to 256 members
- Repertoires of desired sizes are selected by directly generating sets of words, or subumts, of the desired size, e g with the help of the computer programs of Appendices I and II, or repertoires are formed generating a set of words which arc then used in a combinato ⁇ al synthesis scheme to give a repertoire of the desired size
- the length of smgle stranded tag complements for dehvermg labels is between 8 and 20 More preferably, the length is between 9 and 15
- Tnplex Tags In embodiments where specific hybndization occurs via triplex formation, coding of tag sequences follows the same principles as for duplex-forming tags, however, there are further constraints on the selection of subunit sequences Generally, third strand association via Hoogsteen type of binding is most stable along homopynmidine-homopunne tracks in a double stranded target Usually, base triplets form in T-A*T or C-G*C motifs (where "-" indicates Watson-Cnck pairmg and "*" indicates Hoogsteen type of binding), however, other motifs are also possible For example, Hoogsteen base pairing permits parallel and antiparallel onentations between the third strand (the Hoogsteen strand) and the punne-nch strand of the duplex to which the third strand binds, depending on conditions and the composition of the strands There is extensive guidance m the literature for selecting appropriate sequences, orientation, conditions, nucleoside type (e g whether nb
- Minimally cross-hybndizing sets of oligonucleotide tags that form triplexes may be generated by the computer program of Appendix II, or similar programs
- An exemplary set of double stranded 8-mer words are listed below in capital letters with the corresponding complements in small letters Each such word differs from each of the other words in the set by three base pairs Table IV
- the encoded adaptors and cleavage adaptors are conveniently synthesized on automated DNA synthesizers using standard chemistnes, such as phosphoramidite chemistry, e g disclosed in the following references Beaucage and Iyer, Tetrahedron, 48 2223-231 1 (1992), Molko et al, U S patent 4,980,460, Koster et al, U S patent 4,725,677, Caruthers et al, U S patents 4,415,732, 4,458,066, and 4,973,679, and the like
- Alternative chemistries e g resultmg in non-natural backbone groups, such as phosphorothioate, phosphoramidate, and the like, may also be employed provided that the resulting oligonucleotides are compatible with the hgation and/or cleavage reagents used in a particular embodiment
- the strands are combined to form a
- the 5' end of the adaptor may be phosphorylated in some embodiments
- a 5' monophosphate can be attached to a second oligonucleotide either chemically or enzymatically with a kinase, e g Sambrook et al, Molecular Cloning A Laboratory Manual, 2nd Edition (Cold Spring Harbor Laboratory, New York, 1989) Chemical phosphorylation is described by Horn and Urdea, Tetrahedron Lett , 27 4705 (1986), and reagents for carrying out the disclosed protocols are commercially available, e g 5' Phosphate-ON ⁇ M from Clontcch Laboratories (Palo Alto, California)
- Encoded adaptors of the invention can have several embodiments depending, for example, on whether single or double stranded tags are used, whether multiple tags are used, whether a 5' protruding strand or 3' protruding strand is employed, whether a 3' blocking group is used, and the like
- Formulas for several embodiments of encoded adaptors are shown below Preferred structures for encoded adaptors us g one single stranded tag are as follows-
- N is a nucleotide and N' is its complement
- p is a phosphate group
- z is a 3' hydroxyl or a 3' blocking group
- n is an mteger between 2 and 6, inclusive
- r is an integer greater than or equal to
- s is an mteger which is cither between four and six whenever the encoded adaptor has a nuclease recognition site or is 0 whenever there is no nuclease recognition site
- q is an integer greater than or equal to
- t is an integer between 8 and 20, inclusive More preferably, n is 4 or 5, and t is between 9 and 15, inclusive
- the region of "r" nucleotide pairs is selected so that a predetermined number of nucleotides are cleaved from a target polynucleotide whenever the nuclease recognizing the site is applied
- the size of "r" in a particular embodiment depends on the reach
- z is a 3' blocking group
- it is a phosphate group and the double stranded portion of the adaptors contain a nuclease recognition site of a nuclease whose recognition site is separate from its cleavage site.
- encoded tags of the invention preferably have the following form:
- N, N', p, q, r, s, z, and n are defined as above.
- t is an integer in the range of 12 to 24.
- encoded adaptors of the invention include embodiments with multiple tags, such as the following:
- the tag complements of the invention can be labeled in a vanety of ways for decodmg oligonucleotide tag, including the direct or indirect attachment of radioactive moieties, fluorescent moieties, colo ⁇ metnc moieties, chemiluminescent moieties, and the like
- Many comprehensive reviews of methodologies for labeling DNA and constructing DNA adaptors provide guidance applicable to constructing adaptors of the present invention Such reviews include Matthews et al, Anal Biochem .
- one or more fluorescent dyes are used as labels for tag complements, e g as disclosed by Menchen et al, U S patent 5, 188,934, Bergot et al PCT application
- fluorescent signal generating moiety means a signaling means which conveys information through the fluorescent absorption and/or emission properties of one or more molecules Such fluorescent properties mclude fluorescence intensity, fluorescence life time, emission spectrum characteristics, energy transfer, and the like
- cleavage adaptors are ligated to the ends of target polynucleotides to prepare such ends for eventual hgation of encoded adaptors
- hgation is carried out enzymatically using a hgase in a standard protocol
- gases are known and arc suitable for use in the invention, e g Lehman, Science, 186 790-797 (1974), Engler et al, DNA Ligases, pages 3-30 m Boyer, editor, The Enzymes, Vol 15B (Academic Press, New York, 1982), and the like
- Preferred gases include T4 DNA gase, T7 DNA hgase, E coli DNA hgase, Taq gase, Pfu gase, and Tth gase Protocols for their use are well known, e g Sambrook et al (cited above), Barany, PCR Methods and Applications, 1 5-16 (1991), Marsh
- a special problem may arise in dealmg with either polynucleotide ends or adaptors that are capable of self-hgation, such as illustrated in Figure 2, where the four-nucleotide protrudmg strands of the anchored polynucleotides are complementary to one another (114)
- This problem is especially severe m embodiments where the polynucleotides (112) to be analyzed are presented to the adaptors as umform populations of identical polynucleotides attached to a solid phase support (110) In these situations, the free ends of the anchored polynucleotides can twist around to form perfectly matched duplexes (1 16) with one another If the 5' strands of the ends are phosphorylated, the polynucleotides are readily ligated in the presence of a hgase
- An analogous problem also exists for double stranded adaptors Namely, whenever their 5' strands are phosphorylated, the 5' strand of one adaptor may be ligated
- adaptor or “encoded adaptor,” is used in the singular, it is meant to encompass mixtures of adaptors having different sequences of protruding strands as well as a single kind of adaptor having the same sequence of protruding strand, in a manner analogous to the usage of the term "probe " Besides removing by meltmg, a 3' deoxy may be removed from a second strand by a polymerase "exchange” reaction disclosed in Kuijper et al, Gene, 1 12 147-155 (1992), Aslarudis et al, Nucleic Acids Research, 18 6069-6074 (1990), and like references Briefly, the 5'— >3' exonuclease activity of T4 DNA polymerase, and like enzymes, may be used to exchange nucleotides in a priming strand with their t ⁇ phosphatc counterparts in solution, c g Kuijper et al (cited above) Thus, with such a reaction a 3' dideoxynu
- a preferred embodiment employing cycles of hgation and cleavage comprises the following steps (a) hgating (220) an encoded adaptor to an end of the polynucleotide (222), the end of the polynucleotide having a dephosphorylated 5' hydroxyl, the end of the double stranded adaptor to be ligated (224) having a first strand (226) and a second strand (228), the second strand of the double stranded adaptor having a 3' blocking group (230), and the double stranded adaptor havmg a nuclease recognition site (250) of a nuclease whose recognition site is separate from its cleavage site, (b) removing the 3' blocking group after hgation, e g by washing off the second strand (232), (c) phosphorylatmg (234) the 5' hydroxyl of the polynucleotide, (d) hgating (236) a second strand
- ends of polynucleotides to be analyzed are prepared by digesting them with one or more restnction endonucleases that produce predetermined cleavages, usually havmg 3' or 5' protruding strands, 1 c "sticky" ends
- Such digestions usually leave the 5' strands phosphorylated
- these 5' phosphorylated ends are dephosphorylated by treatment with a phosphatase, such as calf intestinal alkaline phosphatase, or like enzyme, using standard protocols, e g as descnbed in Sambrook et al, Molecular Cloning, Second Edition (Cold Spring Harbor Laboratory, New York, 1989)
- a phosphatase such as calf intestinal alkaline phosphatase, or like enzyme
- Nuclease as the term is used m accordance with the invention means any enzyme, combination of enzymes, or other chemical reagents, or combinations chemical reagents and enzymes that when applied to a ligated complex, discussed more fully below, cleaves the ligated complex to produce an augmented adaptor and a shortened target polynucleotide
- a nuclease of the invention need not be a single protein, or consist solely of a combmation of proteins
- a key feature of the nuclease, or of the combination of reagents employed as a nuclease, is that its (their) cleavage site be separate from its (their) recognition site The distance between the recognition site of a nuclease and its cleavage site will be referred to herein as its "reach " By convention, "reach” is defined by two integers which give the number of nucleotides between the recognition site and the hydrolyzed phosphodiester bonds of each strand For
- nuclease only cleave the target polynucleotide after it forms a complex with its recognition site, and preferably, the nuclease leaves a protruding strand on the target polynucleotide after cleavage
- nucleases employed in the invention are natural protein endonucleases (I) whose recognition site is separate from its cleavage site and (n) whose cleavage results in a protruding strand on the target polynucleotide
- class Ils restriction endonucleases are employed as nucleases in the invention, e g as described m Szybalski et al, Gene, 100 13-26 (1991), Roberts et al, Nucleic Acids Research, 21 3125-3137 (1993), and Livak and Brenner, U S patent 5,093,245
- Exemplary class Ils nucleases for use with the invention include Alw XI, Bsm Al, Bbv I, Bsm FI, Sts I, Hga I, Bsc Al, Bbv II, Bee fl, Bee 851, Bcc I, Beg I, Bsa I, Bsg I, Bsp MI, Bst 71 I, Ear I, Eco 571
- kits of the mvention mclude encoded adaptors, cleavage adaptors, and labeled tag complements Kits further include the nuclease reagents, the hgation reagents, and instructions for practicing the particular embodiment of the invention In embodiments employing natural protein endonucleases and hgases, hgase buffers and nuclease buffers may be included In some cases, these buffers may be identical Such kits may also include a methylase and its reaction buffer Preferably, kits also mclude one or more solid phase supports, e g microparticles carrying tag complements for sorting and anchoring target polynucleotides
- An important aspect of the invention is the sorting and attachment of a populations of polynucleotides, e g from a cDNA library, to microparticles or to separate regions on a solid phase support such that each microparticle or region has substantially only one kind of polynucleotide attached
- This objective is accomplished by insunng that substantially all different polynucleotides have different tags attached
- This condition is brought about by taking a sample of the full ensemble of tag-polynucleotide conjugates for analysis (It is acceptable that identical polynucleotides have different tags, as it merely results in the same polynucleotide being operated on or analyzed twice in two different locations )
- Such sampling can be carried out either overtly— for example, by taking a small volume from a larger mixture—after the tags have been attached to the polynucleotides, it can be carried out inherently as a secondary effect of the techniques used to process the polynucleotides and tags, or sampling can be
- the complexity of the tag repertoire is at least 10 times that of the polynucleotide population, and more preferably, the complexity of the tag repertoire is at least 100 times that of the polynucleotide population
- a protocol is disclosed for cDNA library construction using a primer mixture that contains a full repertoire of exemplary 9-word tags
- Tag-contaming primers has a complexity of 8 , or about 1 34 x 10
- mRNA for library construction can be extracted from as few as 10-100 mammalian cells Since a smgle
- 5 4 mammalian cell contains about 5 x 10 copies of mRNA molecules of about 3 4 x 10 different kinds, by standard techniques one can isolate the mRNA from about 100 cells, or
- a tag-polynucleotide conjugate mixture potentially contains every possible pairmg of tags and types of mRNA or polynucleotide.
- overt sampling may be implemented by removing a sample volume after a senal dilution of the starting mixture of tag-polynucleotide conjugates The amount of dilution required depends on the amount of starting material and the efficiencies of the processing steps, which are readily estimated
- the total number of tag- polynucleotide conjugates m a cDNA library would simply be equal to or less than the starting number of mRNAs, or about 5 x 10 vectors containing tag-polynucleotide conjugates (again this assumes that each step m cDNA construction — first strand synthesis, second strand synthesis, and hgation into a vector ⁇ occurs with perfect efficiency), which is a very conservative estimate The actual number is significantly less
- a repertoire of oligonucleotide tags can be conjugated to a population of polynucleotides in a number of ways, including direct enzymatic hgation, amplification, e g via PCR, using primers containing the tag sequences, and the like
- the initial hgating step produces a very large population of tag-polynucleotide conjugates such that a single tag is generally attached to many different polynucleotides
- the probability of obtaining "doubles” I e the same tag on two different polynucleotides, can be made negligible Generally, the larger the sample the greater the probability of obtaining a double
- a design trade-off exists between select g a large sample of tag-polynucleotide conjugates—which, for example, ensures adequate coverage of a target polynucleotide in a shotgun sequencing operation or adequate representation of a rapidly changing mRNA pool, and
- substantially all in reference to attaching tags to molecules, especially polynucleotides, is meant to reflect the statistical nature of the sampling procedure employed to obtain a population of tag-molecule conjugates essentially free of doubles
- substantially all means that at least eighty percent of the polynucleotides have unique tags attached More preferably, it means that at least ninety percent of the polynucleotides have unique tags attached Still more preferably, it means that at least ninety- five percent of the polynucleotides have unique tags attached And, most preferably, it means that at least ninety-nine percent of the polynucleotides have unique tags attached
- oligonucleotides tags may be attached by reverse transcribing the mRNA with a set of primers preferably containing complements of tag sequences
- a set of primers preferably containing complements of tag sequences
- the mRNA is removed, e g by RNase H digestion, and the second strand of the cDNA is synthesized using, for example, a pnmer of the following form (SEQ ID NO 3)
- N is any one of A, T, G, or C
- R is a punne-containing nucleotide
- Y is a py ⁇ midine-contaimng nucleotide
- This particular primer creates a Bst Y 1 restriction site in the resulting double stranded DNA which, together with the Sal I site, facilitates clomng to a vector with, for example, Bam HI and Xho I sites After Bst Yl and Sal I digestion, the exemplary conjugate would have the form
- the polynucleotide-tag conjugates may then be manipulated using standard molecular biology techniques
- the above conjugate— which is actually a mixture- may be inserted mto commercially available clomng vectors, e g Stratagene Cloning System (La Jolla, CA), transfected into a host, such as a commercially available host bacteria, which is then cultured to increase the number of conjugates
- the cloning vectors may then be isolated using standard techniques, e g Sambrook et al, Molecular Cloning, Second Edition (Cold Spring Harbor Laboratory, New York, 1989)
- appropnate adaptors and pnmers may be employed so that the conjugate population can be increased by PCR
- the Bst Yl and Sal I digested fragments are cloned into a Bam HI-/Xho I-digested vector having the following smgle-copy restriction sites
- Tags can be conjugated to cDNAs of existing hbranes by standard cloning methods cDNAs are excised from their existing vector, isolated, and then ligated into a vector contaimng a repertoire of tags
- the tag-containing vector is Imeanzed by cleavmg with two restriction enzymes so that the excised cDNAs can be ligated m a predetermined orientation
- the concentration of the Imeanzed tag-containing vector is m substantial excess over that of the cDNA inserts so that hgation provides an inherent sampling of tags
- a general method for exposing the single stranded tag after amplification involves digesting a target polynucleotide-contaimng conjugate with the 5'— >3' exonuclease activity of T4 DNA polymerase, or a like enzyme
- T4 DNA polymerase or a like enzyme
- a polymerase will cleave nucleotides from 3' recessed ends present on the non-template strand of a double stranded fragment until a complement of the single deoxynucleoside tnphosphate is reached on the template strand
- the 5'->3' digestion effectively ceases, as the polymerase's extension activity adds nucleotides at a higher rate than the excision activity removes nucleotides Consequently, single stranded tags constructed with three nucleotides are readily prepared for loading onto solid phase supports
- the technique may also be used to preferentially methylate interior Fok I sites of a target polynucleotide while leaving a single Fok I site at the terminus of the polynucleotide unmethylated
- the terminal Fok I site is rendered single stranded using a polymerase with deoxycytidine tnphosphate
- the double stranded portion of the fragment is then methylated, after which the single stranded terminus is filled in with a DNA polymerase the presence of all four nucleoside t ⁇ phosphates, thereby regenerating the Fok I site
- this procedure can be generalized to endonucleases other than Fok I
- the polynucleotides are mixed with microparticles containing the complementary sequences of the tags under conditions that favor the formation of perfectly matched duplexes between the tags and their complements
- the hybndization conditions are sufficiently stringent so that only perfectly matched sequences form stable duplexes Under such conditions the polynucleotides specifically hybridized through their tags may be ligated to the complementary sequences attached to the microparticles
- the microparticles are washed to remove polynucleotides with un gated and/or mismatched tags
- Specificity of the hybridizations may be increased by taking a sufficiently small sample so that both a high percentage of tags in the sample are unique and the nearest neighbors of substantially all the tags in a sample differ by at least two words
- This latter condition may be met by taking a sample that contains a number of tag-polynucleotide conjugates that is about 0 1 percent or less of the size of the repertoire being employed
- tags are constructed with eight words selected from Table II, a repertoire of 8 ⁇ , or about 1 67 x 10 , tags and tag complements are produced
- a 0 1 percent sample means that about 16,700 different tags are present If this were loaded directly onto a repertoire-equivalent of microparticles, or this example a sample of 1 67 x 10 microparticles, then only a sparse subset of the sampled microparticles would be loaded
- the density of loaded microparticles can be increase— for example, for more efficient sequencing— by undertaking a "panning" step which
- a panning step may be implemented by providing a sample of tag-cDNA conjugates each of which contams a capture moiety at an end opposite, or distal to, the oligonucleotide tag
- the capture moiety is of a type which can be released from the tag-cDNA conjugates, so that the tag-cDNA conjugates can be sequenced with a single-base sequencmg method
- moieties may compnse biotin, digoxigemn, or like ligands, a tnplex binding region, or the like
- such a capture moiety comprises a biotin component
- Biotin may be attached to tag-cDNA conjugates by a number of standard techniques If appropriate adapters contaimng PCR primer binding sites arc attached to tag-cDNA conjugates, biotm may be attached by using a biotinylated primer in an amplification after sampling Alternatively, if the tag-cDNA conjugates are inserts of clomng vectors, biotin may be attached after
- a tag-cDNA conjugate After a tag-cDNA conjugate is captured, it may be released from the biotin moiety in a number of ways, such as by a chemical linkage that is cleaved by reduction, e g Herman et al, Anal Biochem , 156 48-55 (1986), or that is cleaved photochemically, e g Olejnik et al, Nucleic Acids Research, 24 361-366 (1996), or that is cleaved enzymatically by introducing a restriction site in the PCR primer
- the latter embodiment can be exemplified by considering the library of tag-polynucleotide conjugates described above
- the following adapters may be ligated to the ends of these fragments to permit amplification by PCR 5'- xxxxxxxxxxxxxxxxxxxxxxxx
- the tags of the conjugates are rendered single stranded by the exonuclease activity of T4 DNA polymerase and conjugates are combined with a sample of microparticles, e g a repertoire equivalent, with tag complements attached
- the conjugates are preferably ligated to their tag complements and the loaded microparticles are separated from the unloaded microparticles by capture with avidinated magnetic beads, or like capture technique
- 40-50 tunes with new samples of microparticles and tag-cDNA conjugates
- 4-5 x 10 3 cDNAs can be accumulated by poolmg the released microparticles
- the pooled microparticles may then be simultaneously sequenced by a single-base sequencing technique
- An exemplary tag library is constructed as follows to form the chemically synthesized 9-word tags of nucleotides A, G, and T defined by the formula
- the right and left pnmcr bmdmg regions are ligated to the above tag mixture, after which the smgle stranded portion of the ligated structure is filled with DNA polymerase then mixed with the right and left primers indicated below and amplified to give a tag library Left Primer 5 '- AGTGGCTGGGCATCGGACCG
- the underlined portion of the left primer binding region indicates a Rsr II recogmtion site
- the left-most underlined region of the nght pnmer binding region indicates recognition sites for Bsp 1201, Apa I, and Eco O 1091, and a cleavage site for Hga I
- the right-most underlined region of the right primer binding region indicates the recognition site for Hga I
- the nght or left primers may be synthesized with a biotin attached (using conventional reagents, e g available from Clontech Laboratories, Palo Alto, CA) to facilitate purification after amplification and/or cleavage
- Encoded Adaptors cDNA is produced from an mRNA sample by conventional protocols using pGGCCCTi5(A or G or C) as a pnmer for first strand synthesis anchored at the boundary of the poly A region of the mRNAs and Ns(A or T)GATC as the primer for second strand synthesis That is, both are degenerate pnmers such that the second strand primer is present in two forms and the first strand pnmer is present in three forms
- the GATC sequence in the second strand pnmer corresponds to the recognition site of Mbo I, other four base recognition sites could be used as well, such as those for Bam HI, Sph I, Eco RI, or the like
- the presence of the A and T adjacent to the restriction site of the second strand pnmer ensures that a stripping and exchange reaction can be used in the next step to generate a five-base 5' overhang of "GGCCC"
- the first strand primer is annealed to the m
- the following cloning vector is constructed, e.g. starting from a commercially available plasmid, such as a Bluescript phagemid (Stratagene, La Jolla, CA)(SEQ ID NO 6)
- the plasmid is cleaved with Ppu MI and Pme I (to give a Rsr II-compat ⁇ ble end and a flush end so that the insert is oriented) and then methylated with DAM methylase
- the tag- containing construct is cleaved with Rsr II and then ligated to the open plasmid, after which the conjugate is cleaved with Mbo I and Bam HI to permit hgation and closing of the plasmid
- the plasmids are then amplified and isolated for use in accordance with the invention
- a segment of plasmid pGEM7Z (Promega, Madison, WI) is amplified and attached to glass beads via a double stranded DNA linker, one strand of which is synthesized directly onto (and therefore covalently linked to) the beads
- a mixture of encoded adaptors (1024 different adaptors in all) is applied to the target polynucleotides so that only those adaptors whose protrudmg strands form perfectly matched duplexes with the target polynucleotides are ligated
- Each of 16 fluorescently labelled tag complements are then applied to the polynucleotide-adaptor conjugates under conditions that permit
- a 47-mer oligonucleotide is synthesized directly on Ballotini beads ( 040- 075 mm, Jencons Scientific, Bndgeville, PA) using a standard automated DNA synthesizer protocol
- the complementary strand to the 47-mer is synthesized separately and purified by HPLC When hybridized the resulting duplex has a Bst XI restriction site at the end distal from the bead
- the complementary strand is hybndized to the attached 47-mer in the following mixture 25 ⁇ L complementary strand at 200 pmol/ ⁇ L, 20 mg Ballotini beads with the 47- mer, 6 ⁇ L New England Biolabs #3 restnction buffer (from lOx stock solution), and 25 ⁇ L distilled water
- the mixture is heated to 93°C and then slowly cooled to 55°C, after which 40 units of Bst XI (at 10 units/ ⁇ L) is added to bring the reaction volume to 60 ⁇ L
- the mixture is incubated at 55°C for 2
- PCR primers were prepared using standard protocols (SEQ ID NO 7 and SEQ ID NO 8)
- Primer 1 5 ' -CTAAACCATTGGTATGGGCCAGTGAATTGTAATA
- Primer 2 5 ' -CGCGCAGCCCGCATCGTTTATGCTACAGACTGTC-
- the PCR reaction mixture consists of the following 1 ⁇ l pGEM7Z at 1 ng/ ⁇ l, 10 ⁇ l pnmer 1 at 10 pmol/ ⁇ l, 10 ⁇ l primer 2 at 10 pmol/ ⁇ l, 10 ⁇ l deoxy ⁇ bonucleotide t ⁇ phosphates at 2 5 mM, 10 ⁇ l lOx PCR buffer (Perkin-Elmer), 0 5 ⁇ l Taq DNA polymerase at 5 units/ ⁇ l, and 58 ⁇ l distilled water to give a final volume of 100 ⁇ l
- the reaction mixture was subjected to 25 cycles of 93°C for 30 sec, 60°C for 15 sec, and 72°C for 60 sec, to give a 172 basepair product, which is successively digested w th Bbv I (100 ⁇ l PCR reaction mixture, 12 ⁇ l lOx # 1 New England Biolabs buffer, 8 ⁇ l Bbv I at 1 unit ⁇
- the 5' phosphate is removed by treating the bead mixture with an alkaline phosphatase, e g from calf intestine, available from New England Biolabs (Beverly MA), using manufacturer's protocol
- alkaline phosphatase e g from calf intestine, available from New England Biolabs (Beverly MA)
- the top strands of the following 16 sets of 64 encoded adaptors (SEQ ID NO 10 through SEQ ID NO 25) are each separately synthesized on an automated DNA synthesizer (model 392 Applied Biosystems, Foster City) using standard methods
- the bottom strand which is the same for all adaptors, is synthesized separately then hybridized to the respective top strands
- N and p are as defined above, and the nucleotides indicated in lower case letters are the 12-mer oligonucleotide tags. Each tag differs from every other by 6 nucleotides. Equal molar quantities of each adaptor are combined in NEB buffer No. 2 (New England Biosciences, Beverly, MA) to form a mixture at a concentration of 1000 pmol/ ⁇ l.
- Each of the 16 tag complements are separately synthesized as amino-derivatized oligonucleotides and are each labelled with a fluorescem molecule (e g FAM, an NHS-ester of fluorescein, available from Molecular Probes, Eugene, OR) which is attached to the 5' end of the tag complement through a polyethylene glycol linker (Clonetech Laboratories, Palo
- the encoded adaptors are cleaved from the polynucleotides with Bbv I usmg the manufacturer's protocol
- the cycle of hgation, identification, and cleavage is repeated three times to give the sequence of the 16 terminal nucleotides of the target polynucleotide
- Figure 4 illustrates the relative fluorescence from each of four tag complements applied to identify nucleotides at positions 5 through 16 (from the most distal from the bead to the most proximal to the bead)
- a cDNA library is constructed in which an oligonucleotide tag consisting of 8 four-nucleotide "words" is attached to each cDNA
- the repertoire of oligonucleotide tags of this size is sufficiently large (about 10 8 ) so that if the cDNAs are synthesized from a population of about 10 6 mRNAs, then there is a high probability that each cDNA will have a unique tag for sorting
- first strand synthesis is carried out in the presence of 5-Mc-dCTP (to block certain cDNA restriction sites) and a biotinylated pnmer mixture containing the oligonucleotide tags
- the tag-cDNA conjugates are cleaved with Dpn II (which is unaffected by the 5-Me-deoxycytos ⁇ nes), the biotiny
- V is G, C, or A
- IW,W,W,G] is a four-nucleotide word selected from Table II as described above
- the single underlined portion is a Bsm BI recognition site
- the double underlined portion is a Pac I recognition site
- the cDNAs are digested with Dpn II (New England Bioscience, Beverly, MA) using manufacturer's protocol and affinity purified with streptavidin-coated magnetic beads (M-280 beads, Dynal A S , Oslo, Norway)
- the DNA captured by the beads is digested with Bsm BI to release the tag-cDNA conjugates for cloning
- the tag- cDNA conjugates are amplified by PCR in the presence of 5-Me-dCTP using 20-mer primers complementary to vector sequences flanking the tag-cDNA insert
- the "upstream” pnmer, l e adjacent to the tag is biotinylated and the "downstream” primer, I e adjacent to the cDNA, is labelled with fluorescein
- the PCR product is affinity punfied then cleaved with Pac I to release fluorescently labelled tag-cDNA conjugates
- the tags of the conjugates are rendered smgle stranded by treating them with T4 DNA polymerase in the presence of dGTP After the reaction is quenched, the tag-cDNA conjugate is punfied by phenol-chloroform extraction and combined with 5 5 mm GMA beads carrying tag complements, each tag complement having a 5' phosphate Hybridization is conducted under stringent
- a flow chamber (500) diagrammatically represented in Figure 5 is prepared by etching a cavity having a fluid inlet (502) and outlet (504) in a glass plate (506) usmg standard micromachimng techniques, e g Ekstrom et al, International patent application PCT/SE91/00327 (WO 91/16966), Brown, U S patent 4,911,782, Har ⁇ son et al, Anal Chem 64 1926-1932 (1992), and the like
- the dimension of flow chamber (500) are such that loaded microparticles (508), e g GMA beads, may be disposed in cavity (510)
- Program tagN c c c Program tagN generates minimally cross-hybridizing c sets of subumts given I) N—subunit length, and ii) c an initial subunit sequence.
- tagN assumes that only c 3 of the four natural nucleotides are used in the tags.
- Program 3tagN c c c Program 3tagN generates minimally cross-hybridizmg c sets of triplex words given 1) N--subun ⁇ t length, (11) c an initial subunit sequence, and 111) the identity c of the nucleotides making up the subumts, i.e. c whether the subumts consist of all four c nucleotides, c or some subset of nucleotides.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Saccharide Compounds (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP50075598A JP4124377B2 (ja) | 1996-06-06 | 1997-06-02 | コードアダプターの連結による配列決定 |
| DE69737450T DE69737450T2 (de) | 1996-06-06 | 1997-06-02 | Sequenzierung durch ligation kodierter adapter |
| CA002256700A CA2256700A1 (en) | 1996-06-06 | 1997-06-02 | Sequencing by ligation of encoded adaptors |
| EP97929757A EP0923650B1 (en) | 1996-06-06 | 1997-06-02 | Sequencing by ligation of encoded adaptors |
| HU0003944A HUP0003944A3 (en) | 1996-06-06 | 1997-06-02 | Sequencing by ligation of encoded adaptors |
| AU33740/97A AU733782B2 (en) | 1996-06-06 | 1997-06-02 | Sequencing by ligation of encoded adaptors |
| HK99105687.9A HK1021206B (en) | 1996-06-06 | 1997-06-02 | Sequencing by ligation of encoded adaptors |
| NO985698A NO985698L (no) | 1996-06-06 | 1998-12-04 | Sekvensering ved ligering av kodede adaptorer |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/659,453 US5846719A (en) | 1994-10-13 | 1996-06-06 | Oligonucleotide tags for sorting and identification |
| US68958796A | 1996-08-12 | 1996-08-12 | |
| US08/689,587 | 1996-08-12 | ||
| US08/659,453 | 1996-08-12 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1997046704A1 true WO1997046704A1 (en) | 1997-12-11 |
Family
ID=27097828
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1997/009472 Ceased WO1997046704A1 (en) | 1996-06-06 | 1997-06-02 | Sequencing by ligation of encoded adaptors |
Country Status (12)
| Country | Link |
|---|---|
| EP (1) | EP0923650B1 (https=) |
| JP (1) | JP4124377B2 (https=) |
| CN (1) | CN1195872C (https=) |
| AT (1) | ATE356221T1 (https=) |
| AU (1) | AU733782B2 (https=) |
| CA (1) | CA2256700A1 (https=) |
| CZ (1) | CZ397998A3 (https=) |
| DE (1) | DE69737450T2 (https=) |
| HU (1) | HUP0003944A3 (https=) |
| NO (1) | NO985698L (https=) |
| PL (1) | PL331513A1 (https=) |
| WO (1) | WO1997046704A1 (https=) |
Cited By (81)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998015652A1 (en) * | 1996-10-04 | 1998-04-16 | Brax Genomics Limited | Nucleic acid sequencing by adaptator ligation |
| WO1999018240A3 (en) * | 1997-10-06 | 1999-09-30 | Stratagene Inc | Collections of uniquely tagged molecules |
| WO2000039333A1 (en) * | 1998-12-23 | 2000-07-06 | Jones Elizabeth Louise | Sequencing method using magnifying tags |
| WO2000024937A3 (en) * | 1998-10-28 | 2000-08-10 | Michael Strathmann | Parallel methods for genomic analysis |
| WO2000075373A3 (en) * | 1999-05-20 | 2002-01-24 | Illumina Inc | Combinatorial decoding of random nucleic acid arrays |
| WO2000060124A3 (en) * | 1999-04-06 | 2002-01-31 | Univ Yale | Fixed address analysis of sequence tags |
| WO2001012855A3 (en) * | 1999-08-13 | 2002-03-21 | Univ Yale | Binary encoded sequence tags |
| JP2003503007A (ja) * | 1998-12-23 | 2003-01-28 | プレバン ルクソウ | 拡大タグを使用したシークエンシング方法 |
| US6511802B1 (en) | 1998-01-09 | 2003-01-28 | Lynx Therapeutics, Inc. | Solid phase selection of differentially expressed genes |
| US6544732B1 (en) | 1999-05-20 | 2003-04-08 | Illumina, Inc. | Encoding and decoding of array sensors utilizing nanocrystals |
| EP0975655A4 (en) * | 1997-04-15 | 2004-03-31 | Lynx Therapeutics Inc | IMPROVEMENTS IN INTERMEDIATE SEQUENCE ANALYSIS |
| US6812005B2 (en) | 2000-02-07 | 2004-11-02 | The Regents Of The University Of California | Nucleic acid detection methods using universal priming |
| WO2004094663A3 (en) * | 2003-04-16 | 2004-12-23 | Lingvitae As | Method for identifying characteristics of molecules by converting said characteristics into a polynucleotide sequence |
| WO2003102216A3 (en) * | 2002-05-31 | 2005-01-27 | Diversa Corp | Multiplexed systems for nucleic acid sequencing |
| WO2005010184A1 (ja) * | 2003-07-25 | 2005-02-03 | Takara Bio Inc. | 変異の検出方法 |
| US6890741B2 (en) | 2000-02-07 | 2005-05-10 | Illumina, Inc. | Multiplexed detection of analytes |
| US7033754B2 (en) | 1998-06-24 | 2006-04-25 | Illumina, Inc. | Decoding of array sensors with microspheres |
| EP1594950A4 (en) * | 2003-01-29 | 2007-07-25 | 454 Corp | METHOD FOR PRODUCING SINGLE-STRIP DNA LIBRARIES |
| US7285384B2 (en) | 2000-02-16 | 2007-10-23 | Illuminia, Inc. | Parallel genotyping of multiple patient samples |
| US7361488B2 (en) | 2000-02-07 | 2008-04-22 | Illumina, Inc. | Nucleic acid detection methods using universal priming |
| US7364850B2 (en) | 1998-03-05 | 2008-04-29 | Hitachi, Ltd. | DNA probe array |
| EP1967592A1 (en) * | 1995-06-07 | 2008-09-10 | Solexa, Inc. | Method of improving the efficiency of polynucleotide sequencing |
| WO2007121489A3 (en) * | 2006-04-19 | 2008-09-12 | Applera Corp | Reagents, methods, and libraries for gel-free bead-based sequencing |
| US7582420B2 (en) | 2001-07-12 | 2009-09-01 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US7604996B1 (en) | 1999-08-18 | 2009-10-20 | Illumina, Inc. | Compositions and methods for preparing oligonucleotide solutions |
| US7611869B2 (en) | 2000-02-07 | 2009-11-03 | Illumina, Inc. | Multiplexed methylation detection methods |
| US7622281B2 (en) | 2004-05-20 | 2009-11-24 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for clonal amplification of nucleic acid |
| EP2270205A2 (en) | 2003-10-20 | 2011-01-05 | Isis Innovation Ltd | Nucleic acid sequencing methods |
| US7887752B2 (en) | 2003-01-21 | 2011-02-15 | Illumina, Inc. | Chemical reaction monitor |
| US8080380B2 (en) | 1999-05-21 | 2011-12-20 | Illumina, Inc. | Use of microfluidic systems in the detection of target analytes using microsphere arrays |
| USRE43097E1 (en) | 1994-10-13 | 2012-01-10 | Illumina, Inc. | Massively parallel signature sequencing by ligation of encoded adaptors |
| US8168388B2 (en) | 2005-11-25 | 2012-05-01 | Illumina Cambridge Ltd | Preparation of nucleic acid templates for solid phase amplification |
| US8481268B2 (en) | 1999-05-21 | 2013-07-09 | Illumina, Inc. | Use of microfluidic systems in the detection of target analytes using microsphere arrays |
| WO2013055995A3 (en) * | 2011-10-14 | 2013-08-15 | President And Fellows Of Harvard College | Sequencing by structure assembly |
| US8845880B2 (en) | 2010-12-22 | 2014-09-30 | Genia Technologies, Inc. | Nanopore-based single DNA molecule characterization, identification and isolation using speed bumps |
| US8889348B2 (en) | 2006-06-07 | 2014-11-18 | The Trustees Of Columbia University In The City Of New York | DNA sequencing by nanopore using modified nucleotides |
| US8962242B2 (en) | 2011-01-24 | 2015-02-24 | Genia Technologies, Inc. | System for detecting electrical properties of a molecular complex |
| US8986629B2 (en) | 2012-02-27 | 2015-03-24 | Genia Technologies, Inc. | Sensor circuit for controlling, detecting, and measuring a molecular complex |
| WO2015044412A1 (en) * | 2013-09-30 | 2015-04-02 | Qiagen Gmbh | Dna-adapter-molecules for the preparation of dna-libraries and method for producing them and use |
| CN104603287A (zh) * | 2012-05-10 | 2015-05-06 | 通用医疗公司 | 用于测定核苷酸序列的方法 |
| US9041420B2 (en) | 2010-02-08 | 2015-05-26 | Genia Technologies, Inc. | Systems and methods for characterizing a molecule |
| WO2015117040A1 (en) | 2014-01-31 | 2015-08-06 | Swift Biosciences, Inc. | Improved methods for processing dna substrates |
| US9110478B2 (en) | 2011-01-27 | 2015-08-18 | Genia Technologies, Inc. | Temperature regulation of measurement arrays |
| US9217177B2 (en) | 2005-02-01 | 2015-12-22 | Applied Biosystems, Llc | Methods for bead-based sequencing |
| US9273354B2 (en) | 1997-05-23 | 2016-03-01 | Illumina, Inc. | System and apparatus for sequential processing of analytes |
| US9279148B2 (en) | 1999-04-20 | 2016-03-08 | Illumina, Inc. | Detection of nucleic acid reactions on bead arrays |
| WO2016034433A1 (en) * | 2014-09-05 | 2016-03-10 | Qiagen Gmbh | Preparation of adapter-ligated amplicons |
| US9322062B2 (en) | 2013-10-23 | 2016-04-26 | Genia Technologies, Inc. | Process for biosensor well formation |
| KR20160111947A (ko) * | 2014-01-28 | 2016-09-27 | 란자테크 뉴질랜드 리미티드 | 재조합 미생물의 생산 방법 |
| US9494554B2 (en) | 2012-06-15 | 2016-11-15 | Genia Technologies, Inc. | Chip set-up and high-accuracy nucleic acid sequencing |
| US9551697B2 (en) | 2013-10-17 | 2017-01-24 | Genia Technologies, Inc. | Non-faradaic, capacitively coupled measurement in a nanopore cell array |
| US9605307B2 (en) | 2010-02-08 | 2017-03-28 | Genia Technologies, Inc. | Systems and methods for forming a nanopore in a lipid bilayer |
| US9605309B2 (en) | 2012-11-09 | 2017-03-28 | Genia Technologies, Inc. | Nucleic acid sequencing using tags |
| US9678055B2 (en) | 2010-02-08 | 2017-06-13 | Genia Technologies, Inc. | Methods for forming a nanopore in a lipid bilayer |
| US9759711B2 (en) | 2013-02-05 | 2017-09-12 | Genia Technologies, Inc. | Nanopore arrays |
| WO2018013837A1 (en) * | 2016-07-15 | 2018-01-18 | The Regents Of The University Of California | Methods of producing nucleic acid libraries |
| US9890375B2 (en) | 2014-09-12 | 2018-02-13 | Bgi Shenzhen Co., Limited | Isolated oligonucleotide and use thereof in nucleic acid sequencing |
| WO2018089996A3 (en) * | 2016-11-14 | 2018-07-26 | Agilent Technologies, Inc. | Composition and method for improving signal-to-noise in hybridization to oligonucleotide arrays |
| US10138509B2 (en) | 2013-03-12 | 2018-11-27 | President And Fellows Of Harvard College | Method for generating a three-dimensional nucleic acid containing matrix |
| US10179932B2 (en) | 2014-07-11 | 2019-01-15 | President And Fellows Of Harvard College | Methods for high-throughput labelling and detection of biological features in situ using microscopy |
| US10227639B2 (en) | 2011-12-22 | 2019-03-12 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US10266888B2 (en) | 2015-11-03 | 2019-04-23 | President And Fellows Of Harvard College | Method and apparatus for volumetric imaging of a three-dimensional nucleic acid containing matrix |
| US10421995B2 (en) | 2013-10-23 | 2019-09-24 | Genia Technologies, Inc. | High speed molecular sensing with nanopores |
| US10640826B2 (en) | 2012-06-05 | 2020-05-05 | President And Fellows Of Harvard College | Spatial sequencing of nucleic acids using DNA origami probes |
| US10648026B2 (en) | 2013-03-15 | 2020-05-12 | The Trustees Of Columbia University In The City Of New York | Raman cluster tagged molecules for biological imaging |
| CN111876409A (zh) * | 2012-04-24 | 2020-11-03 | Gen9股份有限公司 | 在体外克隆中分选核酸和多重制备物的方法 |
| US11021737B2 (en) | 2011-12-22 | 2021-06-01 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11085072B2 (en) | 2016-08-31 | 2021-08-10 | President And Fellows Of Harvard College | Methods of generating libraries of nucleic acid sequences for detection via fluorescent in situ sequencing |
| US11104945B2 (en) | 2015-03-06 | 2021-08-31 | Pillar Biosciences Inc. | Selective amplification of overlapping amplicons |
| US11185568B2 (en) | 2017-04-14 | 2021-11-30 | President And Fellows Of Harvard College | Methods for generation of cell-derived microfilament network |
| US11193163B2 (en) | 2018-07-30 | 2021-12-07 | Readcoor, Llc | Methods and systems for sample processing or analysis |
| US20220119874A1 (en) * | 2011-05-20 | 2022-04-21 | Fluidigm Corporation | Nucleic acid encoding reactions |
| US11447807B2 (en) | 2016-08-31 | 2022-09-20 | President And Fellows Of Harvard College | Methods of combining the detection of biomolecules into a single assay using fluorescent in situ sequencing |
| US11584929B2 (en) | 2018-01-12 | 2023-02-21 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| US11629345B2 (en) | 2018-06-06 | 2023-04-18 | The Regents Of The University Of California | Methods of producing nucleic acid libraries and compositions and kits for practicing same |
| US11713485B2 (en) | 2016-04-25 | 2023-08-01 | President And Fellows Of Harvard College | Hybridization chain reaction methods for in situ molecular detection |
| US11857940B2 (en) | 2015-12-16 | 2024-01-02 | Fluidigm Corporation | High-level multiplex amplification |
| US11981917B2 (en) | 2013-06-04 | 2024-05-14 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
| US12098425B2 (en) | 2018-10-10 | 2024-09-24 | Readcoor, Llc | Three-dimensional spatial molecular indexing |
| US12203136B2 (en) | 2020-08-17 | 2025-01-21 | Readcoor, Llc | Methods and systems for spatial mapping of genetic variants |
| US12559790B2 (en) | 2020-01-29 | 2026-02-24 | 10X Genomics, Inc. | Compositions and methods for analyte detection |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK1987159T4 (da) * | 2006-02-08 | 2020-11-16 | Illumina Cambridge Ltd | Fremgangsmåde til sekventering af en polynukleotidtemplate |
| WO2007097443A1 (ja) * | 2006-02-20 | 2007-08-30 | National University Corporation Hokkaido University | Dna塩基配列を決定する方法 |
| CN102766689B (zh) * | 2012-04-17 | 2015-07-22 | 盛司潼 | 一种增加测序读长的测序方法 |
| EP3207169B1 (en) * | 2014-10-14 | 2020-07-01 | MGI Tech Co., Ltd. | Mate pair library construction |
| AU2014409073B2 (en) * | 2014-10-14 | 2019-04-04 | Bgi Shenzhen Co., Limited | Linker element and method of using same to construct sequencing library |
| CN106435744B (zh) * | 2015-08-13 | 2022-02-01 | 生捷科技控股公司 | 使用y-接头和消失限制位点的文库构建 |
| EP3426774A4 (en) | 2016-03-10 | 2019-08-14 | The Board of Trustees of the Leland Stanford Junior University | TRANSPOSASE-MEDIATED ILLUSTRATION OF ACCESSIBLE GENOMS |
| WO2018102064A1 (en) | 2016-11-30 | 2018-06-07 | Microsoft Technology Licensing, Llc. | Dna random access storage system via ligation |
| CN107299151B (zh) * | 2017-08-28 | 2020-06-09 | 华中农业大学 | 用于鉴别稻米脂肪酸品质的dna分子标记及其应用 |
| CN112004920B (zh) | 2018-02-05 | 2024-08-02 | 斯坦福大学托管董事会 | 用于单细胞和集合细胞的多重测量的系统和方法 |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0309969A2 (en) * | 1987-09-28 | 1989-04-05 | E.I. Du Pont De Nemours And Company | Method of gene mapping |
| EP0392546A2 (en) * | 1989-04-14 | 1990-10-17 | Ro Institut Za Molekularnu Genetiku I Geneticko Inzenjerstvo | Process for determination of a complete or a partial contents of very short sequences in the samples of nucleic acids connected to the discrete particles of microscopic size by hybridization with oligonucleotide probes |
| WO1995020053A1 (en) * | 1994-01-21 | 1995-07-27 | Medical Research Council | Sequencing of nucleic acids |
| WO1995027080A2 (en) * | 1994-04-04 | 1995-10-12 | Lynx Therapeutics Inc | Dna sequencing by stepwise ligation and cleavage |
| WO1996012014A1 (en) * | 1994-10-13 | 1996-04-25 | Lynx Therapeutics, Inc. | Molecular tagging system |
| WO1996041011A1 (en) * | 1995-06-07 | 1996-12-19 | Lynx Therapeutics, Inc. | Oligonucleotide tags for sorting and identification |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5650274A (en) * | 1993-06-25 | 1997-07-22 | Hitachi, Ltd. | DNA analyzing method |
-
1997
- 1997-06-02 CA CA002256700A patent/CA2256700A1/en not_active Abandoned
- 1997-06-02 DE DE69737450T patent/DE69737450T2/de not_active Expired - Lifetime
- 1997-06-02 PL PL97331513A patent/PL331513A1/xx unknown
- 1997-06-02 WO PCT/US1997/009472 patent/WO1997046704A1/en not_active Ceased
- 1997-06-02 CZ CZ983979A patent/CZ397998A3/cs unknown
- 1997-06-02 JP JP50075598A patent/JP4124377B2/ja not_active Expired - Lifetime
- 1997-06-02 EP EP97929757A patent/EP0923650B1/en not_active Expired - Lifetime
- 1997-06-02 AT AT97929757T patent/ATE356221T1/de not_active IP Right Cessation
- 1997-06-02 AU AU33740/97A patent/AU733782B2/en not_active Ceased
- 1997-06-02 CN CNB971971013A patent/CN1195872C/zh not_active Expired - Lifetime
- 1997-06-02 HU HU0003944A patent/HUP0003944A3/hu not_active Application Discontinuation
-
1998
- 1998-12-04 NO NO985698A patent/NO985698L/no not_active Application Discontinuation
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0309969A2 (en) * | 1987-09-28 | 1989-04-05 | E.I. Du Pont De Nemours And Company | Method of gene mapping |
| EP0392546A2 (en) * | 1989-04-14 | 1990-10-17 | Ro Institut Za Molekularnu Genetiku I Geneticko Inzenjerstvo | Process for determination of a complete or a partial contents of very short sequences in the samples of nucleic acids connected to the discrete particles of microscopic size by hybridization with oligonucleotide probes |
| WO1995020053A1 (en) * | 1994-01-21 | 1995-07-27 | Medical Research Council | Sequencing of nucleic acids |
| WO1995027080A2 (en) * | 1994-04-04 | 1995-10-12 | Lynx Therapeutics Inc | Dna sequencing by stepwise ligation and cleavage |
| WO1996012014A1 (en) * | 1994-10-13 | 1996-04-25 | Lynx Therapeutics, Inc. | Molecular tagging system |
| WO1996041011A1 (en) * | 1995-06-07 | 1996-12-19 | Lynx Therapeutics, Inc. | Oligonucleotide tags for sorting and identification |
Cited By (182)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| USRE43097E1 (en) | 1994-10-13 | 2012-01-10 | Illumina, Inc. | Massively parallel signature sequencing by ligation of encoded adaptors |
| EP1967592A1 (en) * | 1995-06-07 | 2008-09-10 | Solexa, Inc. | Method of improving the efficiency of polynucleotide sequencing |
| WO1998015652A1 (en) * | 1996-10-04 | 1998-04-16 | Brax Genomics Limited | Nucleic acid sequencing by adaptator ligation |
| EP0975655A4 (en) * | 1997-04-15 | 2004-03-31 | Lynx Therapeutics Inc | IMPROVEMENTS IN INTERMEDIATE SEQUENCE ANALYSIS |
| US9273354B2 (en) | 1997-05-23 | 2016-03-01 | Illumina, Inc. | System and apparatus for sequential processing of analytes |
| US6607878B2 (en) | 1997-10-06 | 2003-08-19 | Stratagene | Collections of uniquely tagged molecules |
| WO1999018240A3 (en) * | 1997-10-06 | 1999-09-30 | Stratagene Inc | Collections of uniquely tagged molecules |
| US6511802B1 (en) | 1998-01-09 | 2003-01-28 | Lynx Therapeutics, Inc. | Solid phase selection of differentially expressed genes |
| US7364850B2 (en) | 1998-03-05 | 2008-04-29 | Hitachi, Ltd. | DNA probe array |
| US7368238B2 (en) | 1998-03-05 | 2008-05-06 | Hitachi, Ltd. | Method for manufacturing a DNA probe array |
| US7226734B2 (en) | 1998-06-24 | 2007-06-05 | Illumina, Inc. | Multiplex decoding of array sensors with microspheres |
| US7033754B2 (en) | 1998-06-24 | 2006-04-25 | Illumina, Inc. | Decoding of array sensors with microspheres |
| US9399795B2 (en) | 1998-06-24 | 2016-07-26 | Illumina, Inc. | Multiplex decoding of array sensors with microspheres |
| US7060431B2 (en) | 1998-06-24 | 2006-06-13 | Illumina, Inc. | Method of making and decoding of array sensors with microspheres |
| US7455971B2 (en) | 1998-06-24 | 2008-11-25 | Illumina, Inc. | Multiplex decoding of array sensors with microspheres |
| WO2000024937A3 (en) * | 1998-10-28 | 2000-08-10 | Michael Strathmann | Parallel methods for genomic analysis |
| WO2000039333A1 (en) * | 1998-12-23 | 2000-07-06 | Jones Elizabeth Louise | Sequencing method using magnifying tags |
| JP2011172573A (ja) * | 1998-12-23 | 2011-09-08 | Preben Lexow | 拡大タグを使用したシークエンシング方法 |
| US9458493B2 (en) | 1998-12-23 | 2016-10-04 | Empire Ip Llc | Sequencing method using magnifying tags |
| CN100351391C (zh) * | 1998-12-23 | 2007-11-28 | 普雷本·莱克索 | 使用放大标记的测序方法 |
| JP2003503007A (ja) * | 1998-12-23 | 2003-01-28 | プレバン ルクソウ | 拡大タグを使用したシークエンシング方法 |
| US6677121B2 (en) | 1999-04-06 | 2004-01-13 | Agilix Corporation | Fixed address analysis of sequence tags |
| WO2000060124A3 (en) * | 1999-04-06 | 2002-01-31 | Univ Yale | Fixed address analysis of sequence tags |
| US9279148B2 (en) | 1999-04-20 | 2016-03-08 | Illumina, Inc. | Detection of nucleic acid reactions on bead arrays |
| US9441267B2 (en) | 1999-04-20 | 2016-09-13 | Illumina, Inc. | Detection of nucleic acid reactions on bead arrays |
| US7166431B2 (en) | 1999-05-20 | 2007-01-23 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| US6890764B2 (en) | 1999-05-20 | 2005-05-10 | Illumina, Inc. | Encoding and decoding of array sensors utilizing nanocrystals |
| WO2000075373A3 (en) * | 1999-05-20 | 2002-01-24 | Illumina Inc | Combinatorial decoding of random nucleic acid arrays |
| EP2360270A1 (en) * | 1999-05-20 | 2011-08-24 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| US6544732B1 (en) | 1999-05-20 | 2003-04-08 | Illumina, Inc. | Encoding and decoding of array sensors utilizing nanocrystals |
| US6620584B1 (en) | 1999-05-20 | 2003-09-16 | Illumina | Combinatorial decoding of random nucleic acid arrays |
| US8206917B2 (en) | 1999-05-20 | 2012-06-26 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| US7960119B2 (en) | 1999-05-20 | 2011-06-14 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| US7563576B2 (en) | 1999-05-20 | 2009-07-21 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| US9163283B2 (en) | 1999-05-20 | 2015-10-20 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| US8563246B2 (en) | 1999-05-20 | 2013-10-22 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| US8883424B2 (en) | 1999-05-21 | 2014-11-11 | Illumina, Inc. | Use of microfluidic systems in the detection of target analytes using microsphere arrays |
| US8481268B2 (en) | 1999-05-21 | 2013-07-09 | Illumina, Inc. | Use of microfluidic systems in the detection of target analytes using microsphere arrays |
| US9289766B2 (en) | 1999-05-21 | 2016-03-22 | Illumina, Inc. | Use of microfluidic systems in the detection of target analytes using microsphere arrays |
| US8080380B2 (en) | 1999-05-21 | 2011-12-20 | Illumina, Inc. | Use of microfluidic systems in the detection of target analytes using microsphere arrays |
| WO2001012855A3 (en) * | 1999-08-13 | 2002-03-21 | Univ Yale | Binary encoded sequence tags |
| US9416411B2 (en) | 1999-08-18 | 2016-08-16 | Illumina, Inc. | Compositions and methods for preparing oligonucleotide solutions |
| US9745573B2 (en) | 1999-08-18 | 2017-08-29 | Illumina, Inc. | Compositions and methods for preparing oligonucleotide solutions |
| US7604996B1 (en) | 1999-08-18 | 2009-10-20 | Illumina, Inc. | Compositions and methods for preparing oligonucleotide solutions |
| US8669053B2 (en) | 1999-08-18 | 2014-03-11 | Illumina, Inc. | Compositions and methods for preparing oligonucleotide solutions |
| US7611869B2 (en) | 2000-02-07 | 2009-11-03 | Illumina, Inc. | Multiplexed methylation detection methods |
| US9850536B2 (en) | 2000-02-07 | 2017-12-26 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US10837059B2 (en) | 2000-02-07 | 2020-11-17 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US8906626B2 (en) | 2000-02-07 | 2014-12-09 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US7361488B2 (en) | 2000-02-07 | 2008-04-22 | Illumina, Inc. | Nucleic acid detection methods using universal priming |
| US6812005B2 (en) | 2000-02-07 | 2004-11-02 | The Regents Of The University Of California | Nucleic acid detection methods using universal priming |
| US6890741B2 (en) | 2000-02-07 | 2005-05-10 | Illumina, Inc. | Multiplexed detection of analytes |
| US7285384B2 (en) | 2000-02-16 | 2007-10-23 | Illuminia, Inc. | Parallel genotyping of multiple patient samples |
| US7803537B2 (en) | 2000-02-16 | 2010-09-28 | Illumina, Inc. | Parallel genotyping of multiple patient samples |
| US7582420B2 (en) | 2001-07-12 | 2009-09-01 | Illumina, Inc. | Multiplex nucleic acid reactions |
| WO2003102216A3 (en) * | 2002-05-31 | 2005-01-27 | Diversa Corp | Multiplexed systems for nucleic acid sequencing |
| US8592214B2 (en) | 2003-01-21 | 2013-11-26 | Illumina, Inc. | Chemical reaction monitor |
| US7887752B2 (en) | 2003-01-21 | 2011-02-15 | Illumina, Inc. | Chemical reaction monitor |
| EP1594950A4 (en) * | 2003-01-29 | 2007-07-25 | 454 Corp | METHOD FOR PRODUCING SINGLE-STRIP DNA LIBRARIES |
| WO2004094663A3 (en) * | 2003-04-16 | 2004-12-23 | Lingvitae As | Method for identifying characteristics of molecules by converting said characteristics into a polynucleotide sequence |
| WO2005010184A1 (ja) * | 2003-07-25 | 2005-02-03 | Takara Bio Inc. | 変異の検出方法 |
| EP2270206A2 (en) | 2003-10-20 | 2011-01-05 | Isis Innovation Ltd | Nucleic acid sequencing methods |
| EP2270205A2 (en) | 2003-10-20 | 2011-01-05 | Isis Innovation Ltd | Nucleic acid sequencing methods |
| EP2431481A1 (en) | 2003-10-20 | 2012-03-21 | Kalim Mir | Parallel polymer sequencing methods |
| US7622281B2 (en) | 2004-05-20 | 2009-11-24 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for clonal amplification of nucleic acid |
| US9217177B2 (en) | 2005-02-01 | 2015-12-22 | Applied Biosystems, Llc | Methods for bead-based sequencing |
| US10323277B2 (en) | 2005-02-01 | 2019-06-18 | Applied Biosystems, Llc | Reagents, methods, and libraries for bead-based sequencing |
| US9493830B2 (en) | 2005-02-01 | 2016-11-15 | Applied Biosystems, Llc | Reagents, methods, and libraries for bead-based sequencing |
| US8168388B2 (en) | 2005-11-25 | 2012-05-01 | Illumina Cambridge Ltd | Preparation of nucleic acid templates for solid phase amplification |
| WO2007121489A3 (en) * | 2006-04-19 | 2008-09-12 | Applera Corp | Reagents, methods, and libraries for gel-free bead-based sequencing |
| US8889348B2 (en) | 2006-06-07 | 2014-11-18 | The Trustees Of Columbia University In The City Of New York | DNA sequencing by nanopore using modified nucleotides |
| US10371692B2 (en) | 2010-02-08 | 2019-08-06 | Genia Technologies, Inc. | Systems for forming a nanopore in a lipid bilayer |
| US9041420B2 (en) | 2010-02-08 | 2015-05-26 | Genia Technologies, Inc. | Systems and methods for characterizing a molecule |
| US9678055B2 (en) | 2010-02-08 | 2017-06-13 | Genia Technologies, Inc. | Methods for forming a nanopore in a lipid bilayer |
| US9377437B2 (en) | 2010-02-08 | 2016-06-28 | Genia Technologies, Inc. | Systems and methods for characterizing a molecule |
| US10343350B2 (en) | 2010-02-08 | 2019-07-09 | Genia Technologies, Inc. | Systems and methods for forming a nanopore in a lipid bilayer |
| US9605307B2 (en) | 2010-02-08 | 2017-03-28 | Genia Technologies, Inc. | Systems and methods for forming a nanopore in a lipid bilayer |
| US11027502B2 (en) | 2010-02-08 | 2021-06-08 | Roche Sequencing Solutions, Inc. | Systems and methods for forming a nanopore in a lipid bilayer |
| US10926486B2 (en) | 2010-02-08 | 2021-02-23 | Roche Sequencing Solutions, Inc. | Systems and methods for forming a nanopore in a lipid bilayer |
| US8845880B2 (en) | 2010-12-22 | 2014-09-30 | Genia Technologies, Inc. | Nanopore-based single DNA molecule characterization, identification and isolation using speed bumps |
| US9121059B2 (en) | 2010-12-22 | 2015-09-01 | Genia Technologies, Inc. | Nanopore-based single molecule characterization |
| US10920271B2 (en) | 2010-12-22 | 2021-02-16 | Roche Sequencing Solutions, Inc. | Nanopore-based single DNA molecule characterization, identification and isolation using speed bumps |
| US10400278B2 (en) | 2010-12-22 | 2019-09-03 | Genia Technologies, Inc. | Nanopore-based single DNA molecule characterization, identification and isolation using speed bumps |
| US9617593B2 (en) | 2010-12-22 | 2017-04-11 | Genia Technologies, Inc. | Nanopore-based single DNA molecule characterization, identification and isolation using speed bumps |
| US10156541B2 (en) | 2011-01-24 | 2018-12-18 | Genia Technologies, Inc. | System for detecting electrical properties of a molecular complex |
| US8962242B2 (en) | 2011-01-24 | 2015-02-24 | Genia Technologies, Inc. | System for detecting electrical properties of a molecular complex |
| US9581563B2 (en) | 2011-01-24 | 2017-02-28 | Genia Technologies, Inc. | System for communicating information from an array of sensors |
| US10010852B2 (en) | 2011-01-27 | 2018-07-03 | Genia Technologies, Inc. | Temperature regulation of measurement arrays |
| US9110478B2 (en) | 2011-01-27 | 2015-08-18 | Genia Technologies, Inc. | Temperature regulation of measurement arrays |
| US20220119874A1 (en) * | 2011-05-20 | 2022-04-21 | Fluidigm Corporation | Nucleic acid encoding reactions |
| US12018323B2 (en) * | 2011-05-20 | 2024-06-25 | Fluidigm Corporation | Nucleic acid encoding reactions |
| US12467086B2 (en) | 2011-10-14 | 2025-11-11 | President And Fellows Of Harvard College | Sequencing by structure assembly |
| WO2013055995A3 (en) * | 2011-10-14 | 2013-08-15 | President And Fellows Of Harvard College | Sequencing by structure assembly |
| US10501791B2 (en) | 2011-10-14 | 2019-12-10 | President And Fellows Of Harvard College | Sequencing by structure assembly |
| US11312992B2 (en) | 2011-10-14 | 2022-04-26 | President And Fellows Of Harvard College | Sequencing by structure assembly |
| US11021737B2 (en) | 2011-12-22 | 2021-06-01 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11293052B2 (en) | 2011-12-22 | 2022-04-05 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11549136B2 (en) | 2011-12-22 | 2023-01-10 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11566276B2 (en) | 2011-12-22 | 2023-01-31 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11566277B2 (en) | 2011-12-22 | 2023-01-31 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11639518B2 (en) | 2011-12-22 | 2023-05-02 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US10227639B2 (en) | 2011-12-22 | 2019-03-12 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11111521B2 (en) | 2011-12-22 | 2021-09-07 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11976318B2 (en) | 2011-12-22 | 2024-05-07 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11293051B2 (en) | 2011-12-22 | 2022-04-05 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11293054B2 (en) | 2011-12-22 | 2022-04-05 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11275052B2 (en) | 2012-02-27 | 2022-03-15 | Roche Sequencing Solutions, Inc. | Sensor circuit for controlling, detecting, and measuring a molecular complex |
| US8986629B2 (en) | 2012-02-27 | 2015-03-24 | Genia Technologies, Inc. | Sensor circuit for controlling, detecting, and measuring a molecular complex |
| CN111876409A (zh) * | 2012-04-24 | 2020-11-03 | Gen9股份有限公司 | 在体外克隆中分选核酸和多重制备物的方法 |
| CN108018343A (zh) * | 2012-05-10 | 2018-05-11 | 通用医疗公司 | 用于测定核苷酸序列的方法 |
| CN104603287A (zh) * | 2012-05-10 | 2015-05-06 | 通用医疗公司 | 用于测定核苷酸序列的方法 |
| US10640826B2 (en) | 2012-06-05 | 2020-05-05 | President And Fellows Of Harvard College | Spatial sequencing of nucleic acids using DNA origami probes |
| US11473139B2 (en) | 2012-06-05 | 2022-10-18 | President And Fellows Of Harvard College | Spatial sequencing of nucleic acids using DNA origami probes |
| US9494554B2 (en) | 2012-06-15 | 2016-11-15 | Genia Technologies, Inc. | Chip set-up and high-accuracy nucleic acid sequencing |
| US10526647B2 (en) | 2012-11-09 | 2020-01-07 | The Trustees Of Columbia University In The City Of New York | Nucleic acid sequences using tags |
| US11674174B2 (en) | 2012-11-09 | 2023-06-13 | The Trustees Of Columbia University In The City Of New York | Nucleic acid sequences using tags |
| US10822650B2 (en) | 2012-11-09 | 2020-11-03 | Roche Sequencing Solutions, Inc. | Nucleic acid sequencing using tags |
| US9605309B2 (en) | 2012-11-09 | 2017-03-28 | Genia Technologies, Inc. | Nucleic acid sequencing using tags |
| US10809244B2 (en) | 2013-02-05 | 2020-10-20 | Roche Sequencing Solutions, Inc. | Nanopore arrays |
| US9759711B2 (en) | 2013-02-05 | 2017-09-12 | Genia Technologies, Inc. | Nanopore arrays |
| US10012637B2 (en) | 2013-02-05 | 2018-07-03 | Genia Technologies, Inc. | Nanopore arrays |
| US10494662B2 (en) | 2013-03-12 | 2019-12-03 | President And Fellows Of Harvard College | Method for generating a three-dimensional nucleic acid containing matrix |
| US10138509B2 (en) | 2013-03-12 | 2018-11-27 | President And Fellows Of Harvard College | Method for generating a three-dimensional nucleic acid containing matrix |
| US11078520B2 (en) | 2013-03-12 | 2021-08-03 | President And Fellows Of Harvard College | Method for generating a three-dimensional nucleic acid containing matrix |
| US11299767B2 (en) | 2013-03-12 | 2022-04-12 | President And Fellows Of Harvard College | Method for generating a three-dimensional nucleic acid containing matrix |
| US12264358B2 (en) | 2013-03-12 | 2025-04-01 | President And Fellows Of Harvard College | Method of selectively sequencing amplicons in a biological sample |
| US10648026B2 (en) | 2013-03-15 | 2020-05-12 | The Trustees Of Columbia University In The City Of New York | Raman cluster tagged molecules for biological imaging |
| US11981917B2 (en) | 2013-06-04 | 2024-05-14 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
| WO2015044412A1 (en) * | 2013-09-30 | 2015-04-02 | Qiagen Gmbh | Dna-adapter-molecules for the preparation of dna-libraries and method for producing them and use |
| US9551697B2 (en) | 2013-10-17 | 2017-01-24 | Genia Technologies, Inc. | Non-faradaic, capacitively coupled measurement in a nanopore cell array |
| US10393700B2 (en) | 2013-10-17 | 2019-08-27 | Roche Sequencing Solutions, Inc. | Non-faradaic, capacitively coupled measurement in a nanopore cell array |
| US10421995B2 (en) | 2013-10-23 | 2019-09-24 | Genia Technologies, Inc. | High speed molecular sensing with nanopores |
| US9322062B2 (en) | 2013-10-23 | 2016-04-26 | Genia Technologies, Inc. | Process for biosensor well formation |
| US11725236B2 (en) | 2013-10-23 | 2023-08-15 | Roche Sequencing Solutions, Inc. | Methods for forming lipid bilayers on biochips |
| US9567630B2 (en) | 2013-10-23 | 2017-02-14 | Genia Technologies, Inc. | Methods for forming lipid bilayers on biochips |
| KR102320074B1 (ko) | 2014-01-28 | 2021-11-03 | 란자테크 뉴질랜드 리미티드 | 재조합 미생물의 생산 방법 |
| KR20160111947A (ko) * | 2014-01-28 | 2016-09-27 | 란자테크 뉴질랜드 리미티드 | 재조합 미생물의 생산 방법 |
| EP3363904A3 (en) * | 2014-01-31 | 2018-09-12 | Swift Biosciences, Inc. | Improved methods for processing dna substrates |
| EP3604544A1 (en) * | 2014-01-31 | 2020-02-05 | Swift Biosciences, Inc. | Improved methods for processing dna substrates |
| US10316357B2 (en) | 2014-01-31 | 2019-06-11 | Swift Biosciences, Inc. | Compositions and methods for enhanced adapter ligation |
| CN106459968B (zh) * | 2014-01-31 | 2020-02-21 | 斯威夫特生物科学股份有限公司 | 用于加工dna底物的改进方法 |
| US10316359B2 (en) | 2014-01-31 | 2019-06-11 | Swift Biosciences, Inc. | Methods for multiplex PCR |
| US11162135B2 (en) | 2014-01-31 | 2021-11-02 | Swift Biosciences, Inc. | Methods for multiplex PCR |
| EP3099796A4 (en) * | 2014-01-31 | 2017-08-23 | Swift Biosciences, Inc. | Improved methods for processing dna substrates |
| EP4273264A3 (en) * | 2014-01-31 | 2024-01-17 | Integrated DNA Technologies, Inc. | Improved methods for processing dna substrates |
| AU2015210705B2 (en) * | 2014-01-31 | 2020-11-05 | Integrated Dna Technologies, Inc. | Improved methods for processing DNA substrates |
| US11203781B2 (en) | 2014-01-31 | 2021-12-21 | Swift Biosciences, Inc. | Methods for multiplex PCR |
| CN106459968A (zh) * | 2014-01-31 | 2017-02-22 | 斯威夫特生物科学股份有限公司 | 用于加工dna底物的改进方法 |
| WO2015117040A1 (en) | 2014-01-31 | 2015-08-06 | Swift Biosciences, Inc. | Improved methods for processing dna substrates |
| EP4039811A1 (en) * | 2014-01-31 | 2022-08-10 | Integrated DNA Technologies, Inc. | Improved methods for processing dna substrates |
| US10179932B2 (en) | 2014-07-11 | 2019-01-15 | President And Fellows Of Harvard College | Methods for high-throughput labelling and detection of biological features in situ using microscopy |
| US12331347B2 (en) | 2014-07-11 | 2025-06-17 | President And Fellows Of Harvard College | Methods for high-throughput labelling and detection of biological features in situ using microscopy |
| EP3330386A1 (en) * | 2014-09-05 | 2018-06-06 | QIAGEN GmbH | Preparation of adapter-ligated amplicons |
| CN106661636A (zh) * | 2014-09-05 | 2017-05-10 | 凯杰有限公司 | 衔接子连接的扩增子的制备 |
| EP3842544A1 (en) * | 2014-09-05 | 2021-06-30 | QIAGEN GmbH | Preparation of adapter-ligated amplicons |
| WO2016034433A1 (en) * | 2014-09-05 | 2016-03-10 | Qiagen Gmbh | Preparation of adapter-ligated amplicons |
| US10648031B2 (en) | 2014-09-05 | 2020-05-12 | Qiagen Gmbh | Preparation of adapter-ligated amplicons |
| EP3192869A4 (en) * | 2014-09-12 | 2018-03-21 | MGI Tech Co., Ltd. | Isolated oligonucleotide and use thereof in nucleic acid sequencing |
| US9890375B2 (en) | 2014-09-12 | 2018-02-13 | Bgi Shenzhen Co., Limited | Isolated oligonucleotide and use thereof in nucleic acid sequencing |
| US11104945B2 (en) | 2015-03-06 | 2021-08-31 | Pillar Biosciences Inc. | Selective amplification of overlapping amplicons |
| US11542554B2 (en) | 2015-11-03 | 2023-01-03 | President And Fellows Of Harvard College | Method and apparatus for volumetric imaging |
| US11118220B2 (en) | 2015-11-03 | 2021-09-14 | President And Fellows Of Harvard College | Method and apparatus for volumetric imaging of a three-dimensional nucleic acid containing matrix |
| US10266888B2 (en) | 2015-11-03 | 2019-04-23 | President And Fellows Of Harvard College | Method and apparatus for volumetric imaging of a three-dimensional nucleic acid containing matrix |
| US11857940B2 (en) | 2015-12-16 | 2024-01-02 | Fluidigm Corporation | High-level multiplex amplification |
| US11718874B2 (en) | 2016-04-25 | 2023-08-08 | President And Fellows Of Harvard College | Hybridization chain reaction methods for in situ molecular detection |
| US11713485B2 (en) | 2016-04-25 | 2023-08-01 | President And Fellows Of Harvard College | Hybridization chain reaction methods for in situ molecular detection |
| CN109563543B (zh) * | 2016-07-15 | 2022-08-30 | 加利福尼亚大学董事会 | 产生核酸库的方法 |
| CN109563543A (zh) * | 2016-07-15 | 2019-04-02 | 加利福尼亚大学董事会 | 产生核酸库的方法 |
| US11299780B2 (en) | 2016-07-15 | 2022-04-12 | The Regents Of The University Of California | Methods of producing nucleic acid libraries |
| WO2018013837A1 (en) * | 2016-07-15 | 2018-01-18 | The Regents Of The University Of California | Methods of producing nucleic acid libraries |
| US12565671B2 (en) | 2016-08-31 | 2026-03-03 | President And Fellows Of Harvard College | Methods of combining the detection of biomolecules into a single assay using fluorescent in situ sequencing |
| US11085072B2 (en) | 2016-08-31 | 2021-08-10 | President And Fellows Of Harvard College | Methods of generating libraries of nucleic acid sequences for detection via fluorescent in situ sequencing |
| US11447807B2 (en) | 2016-08-31 | 2022-09-20 | President And Fellows Of Harvard College | Methods of combining the detection of biomolecules into a single assay using fluorescent in situ sequencing |
| WO2018089996A3 (en) * | 2016-11-14 | 2018-07-26 | Agilent Technologies, Inc. | Composition and method for improving signal-to-noise in hybridization to oligonucleotide arrays |
| US10550425B2 (en) | 2016-11-14 | 2020-02-04 | Agilent Technologies, Inc. | Composition and method for improving signal-to-noise in hybridization to oligonucleotide arrays |
| US11185568B2 (en) | 2017-04-14 | 2021-11-30 | President And Fellows Of Harvard College | Methods for generation of cell-derived microfilament network |
| US11584929B2 (en) | 2018-01-12 | 2023-02-21 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| US11629345B2 (en) | 2018-06-06 | 2023-04-18 | The Regents Of The University Of California | Methods of producing nucleic acid libraries and compositions and kits for practicing same |
| US11193163B2 (en) | 2018-07-30 | 2021-12-07 | Readcoor, Llc | Methods and systems for sample processing or analysis |
| US12098425B2 (en) | 2018-10-10 | 2024-09-24 | Readcoor, Llc | Three-dimensional spatial molecular indexing |
| US12559790B2 (en) | 2020-01-29 | 2026-02-24 | 10X Genomics, Inc. | Compositions and methods for analyte detection |
| US12203136B2 (en) | 2020-08-17 | 2025-01-21 | Readcoor, Llc | Methods and systems for spatial mapping of genetic variants |
Also Published As
| Publication number | Publication date |
|---|---|
| HUP0003944A3 (en) | 2003-08-28 |
| HUP0003944A2 (en) | 2001-03-28 |
| CN1230226A (zh) | 1999-09-29 |
| NO985698D0 (no) | 1998-12-04 |
| CN1195872C (zh) | 2005-04-06 |
| AU733782B2 (en) | 2001-05-24 |
| HK1021206A1 (en) | 2000-06-02 |
| AU3374097A (en) | 1998-01-05 |
| ATE356221T1 (de) | 2007-03-15 |
| DE69737450D1 (de) | 2007-04-19 |
| JP4124377B2 (ja) | 2008-07-23 |
| CZ397998A3 (cs) | 1999-07-14 |
| DE69737450T2 (de) | 2007-11-29 |
| CA2256700A1 (en) | 1997-12-11 |
| JP2000515006A (ja) | 2000-11-14 |
| EP0923650B1 (en) | 2007-03-07 |
| PL331513A1 (en) | 1999-07-19 |
| EP0923650A1 (en) | 1999-06-23 |
| NO985698L (no) | 1999-02-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0923650B1 (en) | Sequencing by ligation of encoded adaptors | |
| US6013445A (en) | Massively parallel signature sequencing by ligation of encoded adaptors | |
| EP0975655B1 (en) | Improvements in adaptor-based sequence analysis | |
| US5763175A (en) | Simultaneous sequencing of tagged polynucleotides | |
| US5780231A (en) | DNA extension and analysis with rolling primers | |
| US5962228A (en) | DNA extension and analysis with rolling primers | |
| EP0994969B1 (en) | Categorising nucleic acid | |
| US6140489A (en) | Compositions for sorting polynucleotides | |
| EP0832287B1 (en) | Oligonucleotide tags for sorting and identification | |
| EP1967592B1 (en) | Method of improving the efficiency of polynucleotide sequencing | |
| US6172218B1 (en) | Oligonucleotide tags for sorting and identification | |
| USRE43097E1 (en) | Massively parallel signature sequencing by ligation of encoded adaptors | |
| AU739963B2 (en) | Method of mapping restriction sites in polynucleotides | |
| EP0840803B1 (en) | Simultaneous sequencing of tagged polynucleotides | |
| HK1021206B (en) | Sequencing by ligation of encoded adaptors | |
| JP4789294B2 (ja) | ローリングプライマーを用いたdna伸長および分析 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 97197101.3 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ VN YU AM AZ BY KG KZ MD RU TJ TM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 2256700 Country of ref document: CA Ref document number: 2256700 Country of ref document: CA Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PV1998-3979 Country of ref document: CZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1997929757 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: 1997929757 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: PV1998-3979 Country of ref document: CZ |
|
| WWR | Wipo information: refused in national office |
Ref document number: PV1998-3979 Country of ref document: CZ |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1997929757 Country of ref document: EP |