WO1997042331A1 - Verfahren zur herstellung transgener, inulin erzeugender pflanzen - Google Patents

Verfahren zur herstellung transgener, inulin erzeugender pflanzen Download PDF

Info

Publication number
WO1997042331A1
WO1997042331A1 PCT/EP1997/002195 EP9702195W WO9742331A1 WO 1997042331 A1 WO1997042331 A1 WO 1997042331A1 EP 9702195 W EP9702195 W EP 9702195W WO 9742331 A1 WO9742331 A1 WO 9742331A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
modified
patatin
fructosyltransferase
amino
Prior art date
Application number
PCT/EP1997/002195
Other languages
English (en)
French (fr)
Inventor
Arnd G. Heyer
Regina Wendenburg
Original Assignee
Südzucker Aktiengesellschaft
Kws Kleinwanzlebener Saatzucht Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Südzucker Aktiengesellschaft, Kws Kleinwanzlebener Saatzucht Ag filed Critical Südzucker Aktiengesellschaft
Priority to JP53949797A priority Critical patent/JP2001517930A/ja
Priority to US09/180,143 priority patent/US6255562B1/en
Priority to EP97921819A priority patent/EP0944727A1/de
Priority to AU27741/97A priority patent/AU718897B2/en
Publication of WO1997042331A1 publication Critical patent/WO1997042331A1/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C12N9/1055—Levansucrase (2.4.1.10)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • C12N15/8246—Non-starch polysaccharides, e.g. cellulose, fructans, levans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a method for producing genetically modified, high-molecular inulin-producing plants, agents for carrying out this method and the plants obtainable with the aid of these agents and the method, and also the high-molecular inulin contained therein.
  • High molecular weight, water-soluble, linear polymers for example polyacrylates and polymethylacrylates. These are used, for example, to increase the viscosity of aqueous systems, as a suspending agent, to accelerate sedimentation and complexation, and in superabsorbers for binding water and lacquers which can be diluted in water. It proves to be disadvantageous that these products are not biodegradable. Derivatized, highly polymeric polysaccharides can be used instead. Such polysaccharides can hitherto be obtained biotechnologically by fermentation and transglycosylation. However, due to economic considerations, polymers produced by fermentation are not suitable for applications on a larger scale.
  • inulin a ⁇ -2-1 linked polyfructan
  • inulin a ⁇ -2-1 linked polyfructan
  • a number of gram-positive and gram-negative types of bacteria are also known among the bacteria, which synthesize a related fructan polymer, the ⁇ -2-6-linked levan, using so-called levan sucrases.
  • Bacterially formed polyfructans have considerably higher molecular weights of up to 2000 kD.
  • Streptococcus mutans which uses a ftf (fructosyltransferase) gene to form inulin on the basis of sucrose (Shiroza and Kuramitsu, J. Bacteriology (1988) 170, 810 to 816) .
  • PCT / EP93 / 02110 discloses a process for the production of transgenic plants which produce polyfructose and which contain the lsc gene for a levan sucrase from a gram-negative bacterium.
  • PCT / NL93 / 00279 discloses the transformation of plants with chimeric genes which contain the sacB gene from Bacillus subtilis or the ftf gene from Streptococus mutans. In the case of the sacB gene, a modification of the 5'-untranslated region of the bacterial gene is also recommended in order to increase the expression level in transformed plants. No sequence modifications to improve expression are described for the fructosyltransferase gene from Streptococcus mutans. The level of expression of fructosyltransferase is therefore comparatively low.
  • the present invention is therefore based on the technical problem of providing a method and means for the production of high molecular weight inulin in plants which enable simple and inexpensive production of the inulin in large quantities in plants.
  • the solution to this technical problem lies in the provision of a modified fructosyl transferase gene, in particular a gene in which one, preferably the amino terminal, region of a known fructosyl transferase gene is replaced by a region of a patatin gene and / or another gene .
  • the preferred modification of the sequence of the known fructosyltransferase gene according to the invention thus consists in an exchange of the coding region of the amino terminal region of a fructosyltransferase gene for the amino terminal region of a patatin gene and / or other gene.
  • the other gene can be, for example, the carboxypeptidase Y gene (cpy gene) or the lacZ gene.
  • fructosyltrans- ferasegens is only replaced by a region of the patatin gene.
  • a fructosyltransferase gene modified in this way can be efficiently expressed in higher plants, high-molecular inulin being obtained in large quantities.
  • no extensive sequence modification or new synthesis of the original fructosyl transferase gene is necessary.
  • a fructosyl transferase gene is understood to mean the coding DNA sequence of a gene whose gene product has a sucrose: ⁇ -D-fructosyl transferase activity.
  • a gene can be of vegetable, animal, microbial or synthetic origin.
  • modified fructosyltransferase genes are understood to mean the coding DNA sequences of modified genes whose gene products have a sucrose: ⁇ -D-fructosyltransferase activity and are capable of ⁇ -2-1 linked polyfructans, in particular inulins, to build.
  • the gene products of the modified genes therefore have the biological activity of an inulin sucrase defined above.
  • the term modification means all manipulations on a DNA sequence, for example nucleotide substitutions, deletions, inversions or additions.
  • the amino terminal region of a gene is understood to mean the region of the coding DNA sequence which codes the amino terminal region of the gene product, wherein the amino terminal region of a gene can comprise many or a few codons, but also only the start codon alone.
  • a patatin gene is understood to mean a gene belonging to the family of the patatin genes, which is for example a patatin gene can be class I or II (Rocha-Sosa et al., EMBO J (1989) 8, 23-29).
  • a patatin gene is also understood to mean patatin-analogous genes which have sequence homology and / or functionality similar to the patatin genes.
  • the patatin gene used according to the invention preferably originates from the potato, but can also be of synthetic or other origin.
  • high-molecular inulin is understood to mean an inulin with a molecular weight of more than 1.5 million daltons.
  • the invention relates to a modified fructosyltransferase gene in which the amino-terminal region of a fructosyltransferase gene is at least partially replaced by the region of a further gene, namely a patatin gene.
  • a further gene namely a patatin gene.
  • the fructosyltransferase gene can of course also have further modifications and / or be produced entirely synthetically.
  • the invention also relates to all other modifications of a fructosyl transferase gene if the gene product formed can produce high molecular weight inulin in plants.
  • the amino-terminal region of the fructosyltransferase gene by segregating from plant or bacterial genes or genes from yeast, in particular the patatin gene from preferably the potato and optionally another gene, for example the cpy Gene from yeast or the lacZ gene from Escherichia coli.
  • the vegetable gene is the patatin B33 gene from the potato.
  • the invention provides for the amino terminal region of the fructosyltransferase gene to be replaced by signal sequences of the patatin gene which encode signal peptides.
  • the invention thus relates to modified fructosyltransferase genes in which the modification of the fructosyltransferase gene can consist in that the amino-terminal region of the fructosyltransferase gene is replaced by signal sequences of plant genes, such as, for example, the patatin gene from potato.
  • the invention also includes modified fructosyltransferase genes in which the amino-terminal region of the fructosyltransferase gene is replaced by regions, in particular amino-terminal regions, of different genes, for example the amino-terminal area of the patatin gene and the lacZ gene.
  • the amino-terminal region of the lacZ gene encodes the amino-terminal amino acids 21 to 30 of the ⁇ -galactosidase.
  • the invention also includes modified fructosyltransferase genes, in which the amino-terminal region of the modified fructosyltransferase gene is provided by regions of various plant genes and genes from yeast, for example the cpy gene (carboxypeptidase Y) and the patatin gene from potato.
  • the signal sequence coding for the signal peptide from the patatin gene is preferably arranged upstream (5 ') from the sequence of the cpy gene or the lacZ gene.
  • the fructosyl transferase comes from Streptococcus mutans.
  • the invention also relates to the use of other fructosyltransferases, as long as they can produce inulins in the modified form specified according to the invention.
  • the amino-terminal region of the fructosyltransferase gene to be replaced represents a region coding for its signal peptide.
  • the region coding for a signal peptide is the region between the start of translation and the beginning of the mature, processed protein coding Understand DNA sequence. 31 PC17EP97 / 02195
  • the invention relates to a modified fructosyltransferase gene which has a signal sequence which codes a signal peptide for incorporating the modified gene into the endoplasmic reticulum of a eukaryotic cell.
  • the invention therefore provides that a modified gene of the invention can be provided with signal sequences which allow the gene product to be localized in certain compartments of the cell.
  • the signal sequence of a patatin gene in particular the patatin gene B33, preferably from potato, is particularly preferred.
  • the signal sequence can be fused to the modified fructosyltransferase gene, or the signal sequence is fused directly to the fructosyltransferase gene that is shortened in its amino-terminal region.
  • the amino-terminal region of the fructosyltransferase gene is replaced by at least part of the patatin gene and, if appropriate, additionally sequences from other genes, for example the lacZ gene or the cpy gene, in the amino-terminal region of the modified fructosyltransferase gene are present.
  • the signal sequence encoding the signal peptide for inclusion in the endoplasmic reticulum is used from the amino-terminal area of the patatin B33 gene, the gene product is translocated into the apoplastic space. Consequently, the synthesis of the high molecular weight inulin is carried out there, so that specific changes in the carbohydrate composition of the transgenic plant can be achieved.
  • other Si signal sequences can be used.
  • signal sequences come into consideration which code signal peptides which lead to the inclusion of a protein in the endoplasmic reticulum and which can be demonstrated by the fact that they can be detected in the precursor proteins, but not in processed, mature proteins. As is known, the signal peptides are proteolytically removed during the uptake into the endoplasmic reticulum.
  • the invention provides that the modified fructosyl transferase gene is fused or has a signal sequence which encodes a signal peptide for inclusion in the endoplasmic reticulum of a eukaryotic cell and for forwarding to the vacuole.
  • a signal peptide for the vacuolar localization of the gene product is advantageous insofar as it can also effect specific changes in the carbohydrate composition of the transgenic plants obtained.
  • signal peptides can, for example, be used for the vacuolar localization of lectin from barley (Raikhel and Lerner, Dev. Tague et al., Plant cell (1990) 2,533-546) and signal sequences from a patatin gene from potato.
  • a modification of the fructosyltransferase gene is preferred in which a signal sequence of the patatin B33 gene, in particular one which contains the 60 amino-terminal amino acids of the Propeptide encoded (Rosahl et al., Mol Gen Genet (1986) 203, 214-220), ie the nt 736 to 855, is used.
  • This signal sequence at least partially replaces the amino-terminal region of the fructosyltransferase gene, possibly together with other genes.
  • this sequence is referred to as an extended B33 signal sequence. This sequence can be obtained both as a fragment of genomic DNA of the potato and from cDNA for the transcript of the B33 gene.
  • the fusion of the extended B33 signal sequence to the modified gene of the invention or to the fructosyltransferase gene to be modified leads to the uptake of its gene product into the vacuole and thus to a specific change in the carbohydrate composition of the transgenic plant obtained.
  • the invention also relates to the use of this extended B33 signal sequence or the peptide encoded thereby for the transport of any other gene products into plant vacuoles.
  • the invention also relates to a vector, in particular a plasmid, containing a modified fructosyltransferase gene.
  • the invention relates to a vector or a plasmid containing a modified fructosyltransferase gene which is under the control of a promoter active in plants, in particular an organ-specific promoter.
  • sucrose is the substrate for fructosyltransferase, so that the production of high molecular weight inulin is particularly advantageous in those plant tissues or plant organs that store large amounts of sucrose.
  • the expression of the modified fructosyltransferase gene in such organs can be achieved by using tissue-specific promoters.
  • tissue-specific expression in potato tubers or beet from sugar beet is possible, for example, with the B33 promoter of the B33 gene from potato.
  • the invention also relates to a vector or a plasmid in which the 3 'terminus of the modified fructosyltransferase gene is fused to a transcription termination sequence, for example the polyadenylation site of the nos gene from Agrobacterium tumefaciens.
  • the invention relates to the plasmids pB33cftf, that is to say a plasmid containing the B33 promoter of the patatin gene, a lacZ-ftf gene fusion and a polyadenylation signal, pB33aftf, that is to say a B33 promoter of the patatin gene, a B33 signal sequence-lacZ-ftf gene fusion and a plasmid containing a polyadenylation signal, pB33vlftf, ie a B33 promoter of the patatin gene, an extended B33 signal sequence-lacZ-ftf gene fusion and a plasmid containing polyadenylation signal and pB33v2ftf, ie a patatin gene B33 promoter, an extended B33 signal sequence-lacZ-ftf gene fusion (without intron in signal sequence) and a plasmid containing polyadenylation signal (FI
  • the invention also relates to the gene fusions contained in the aforementioned plasmids without using the lacZ gene sequences located between the patatin sequences and the ftf sequences.
  • the invention also relates to prokaryotic and eukaryotic cells which contain a vector, a plasmid or a DNA sequence of the invention.
  • the invention relates to the vectors, plasmids or DNA sequences of cells according to the invention, for example bacterial cells or, preferably, plant cells. These can contain the modified fructosyltransferase gene of the invention either transiently or, particularly preferably, stably integrated into their genome.
  • the plant cells according to the invention are understood to be those which either originated directly from the transformation event and accordingly, depending on the chosen transformation method, can be undifferentiated or differentiated or differentiating or differentiated plant cells.
  • the invention also relates to plants which contain at least one, but preferably a multiplicity, of cells which contain the fructosyl transferase gene according to the invention or vectors or plasmids containing it and, as a result thereof, produce high-molecular inulin.
  • the invention thus makes it possible to provide plants of the most diverse types, genera, families, orders and classes which, owing to the modified fructosyltransferase gene which has been introduced, are able to produce high molecular weight inulin. Since the known plants are not able to produce high molecular weight inulin, the successful implementation of the method according to the invention is easy, for example by antibody tests.
  • the inulin according to the invention produced by the gene of bacterial origin according to the invention has a higher molecular weight than vegetable inulin.
  • the detection of successful transformation with the sequences according to the invention can be demonstrated, for example, by compartment-specific antibody tests, optionally with quantification.
  • the invention provides in particular that the plant to be transformed is a useful plant, in particular a maize, rice, wheat, barley, sugar beet, sugar cane or potato plant.
  • the invention also relates to a method for producing the abovementioned plants, comprising the transformation of one or more plant cells with a vector or a plasmid of the invention, the integration of the modified fructosyltransferase gene contained in this vector or plasmid into the genome of the plant cell (s) and the regeneration of the plant cell (s) to intact, transformed, high-molecular inulin-producing plants.
  • the invention relates to the high-molecular inulin produced by the plants according to the invention. Compared to inulin naturally occurring in some plants, this is particularly characterized by its high molecular weight of more than 1.5 million daltons.
  • the invention also relates to a method for obtaining inulin from the transformed plants, in particular from their vacuoles.
  • Figure 1 illustrates the construction of plasmid pB33cftf.
  • Figure 2 shows the construction of plasmid pB33aftf.
  • Figure 3 illustrates the construction of plasmid pB33vlftf.
  • Figure 4 illustrates the construction of plasmid pB33v2ftf.
  • FIG. 5 shows a Northern blot analysis of the gene expression, ie the ftf-mRNA content, in tubers of selected transformants with the constructs according to the invention.
  • FIG. 6 shows a thin layer chromatography analysis of the inulin contents of tubers in a series of plants transformed with the plasmid pB33vlftf.
  • Embodiment 1 Production of the plasmid pB33cftf and introduction of the corresponding construct into the genome of potato.
  • the plasmid pB33cftf contains the three fragments A, B and C in the binary vector pBinl9-Hyg (Bevan, Nucl Acids Res (1984) 12, 8711, modified according to Becker, Nucl Acids Res (1990) 18, 203) (cf. 1) .
  • Fragment A contains the B33 promoter of the potato gene B33 of the potato. It contains a Dral fragment (position: -1512 to position +14) of the patatin gene B33 (Rocha-Sosa et al., EMBO J (1989) 8, 23-29), which is located between the EcoRI and the SacI- Interface of the polylinker of pBin19-Hyg is inserted.
  • Fragment B is a fusion of nt 780-3191 of the ftf gene from Streptococcus mutans (Genbank EMBL Accession M18954) to a combination of nt 724-716 and nt 759-727 of the plasmid pBluescript KS, which contain the amino terminal amino acids 21-30 which represent ß-galactoside. Due to cloning, an ATG start codon arises before this sequence, which is used for the translation of the fusion product in plants. The sequence up to fusion at nt 780 of the ftf gene is shown below:
  • nt 780-3191 of the ftf gene were isolated as Earl (filled up with DNA polymerase) / BglII fragment from the plasmid pTS102 (Shiroza and Kuramitsu, J Bacteriol (1988) 170, 810-816).
  • fusing this fragment of the ftf gene to the DNA Sequence is the exchange of the original N-terminus for the amino-terminal region of the ⁇ -galactosidase.
  • Fragment C contains the polyadenylation signal of gene 3 (octopine synthase gene from Agrobacterium tumefaciens) of the T-DNA of the Ti plasmid pTiAch 5 (Gielen et al., EMBO J.
  • the plasmid pB33cftf has a size of approximately 14 kb.
  • the construct pB33cftf was introduced into potato plants. Intact plants were regenerated from transformed cells. Analysis of the tubers of a number of plants transformed with this gene clearly showed the presence of inulin, which is due to the expression of the gene according to the invention.
  • the plasmid pB33aftf contains the three fragments A, B and C in the binary vector pBinl9-Hyg (Bevan, Nucl Acids Res (1984) 12, 8711, modified according to Becker, Nucl Acids Res (1990) 18, 203) (cf. 2).
  • Fragment A contains the B33 promoter of the potato gene B33 of the potato. It contains a Dral fragment (position: -1512 to position +14) of the patatin gene B33 (Rocha-Sosa et al., EMBO J (1989) 8, 23-29), which is between the EcoRI and the SacI- Interface of the polylinker of pBin19-Hyg is inserted.
  • Fragment B is a fusion of the modified ftf gene from Streptococcus mutans (nt 780-3191, cf. Example 1) to nt 724 to 833 of the patatin gene B33 via a sequence of the nucleotides GTCGACGGTATCG.
  • This sequence (designated as "a” in FIG. 2) contains the coding region for the signal peptide for inclusion in the endoplasmic reticulum (ER) (Rosahl et al., Mol Gen Genet (1986) 203, 214-220; sequence comes from pcT58). Proteins that have such a signal sequence are first included in the ER and then exported to the apoplastic space.
  • Fragment C contains the polyadenylation signal of gene 3 (octopine synthase gene from Agrobacterium tumefaciens) of the T-DNA of the Ti plasmid pTiAch 5 (Gielen et al., EMBO J (1984) 3, 835-846), that is to say nucleotides 11749 -11939, which was isolated as a Pvu II-Hind III fragment from the plasmid pAGV 40 (Herrera-Estrella et al., Nature (1983) 303, 209-213) and after addition of Sph I linkers to the Pvu II site between the SphI and Hind HI sites of the polylinker from pBinl9-Hyg.
  • gene 3 octopine synthase gene from Agrobacterium tumefaciens
  • the plasmid pB33aftf has a size of approximately 14 kb.
  • the B33aftf construct was introduced into potato plants. Intact plants were regenerated from transformed cells. Analysis of the tubers of a number of plants transformed with this gene clearly showed the presence of inulin, which is due to the expression of the gene according to the invention.
  • the plasmid pB33vlftf contains the three fragments A, B and C in the binary vector pBinl9-Hyg (Bevan, Nucl Acids Res (1984) 12, 8711, modified according to Becker, Nucl Acids Res (1990) 18, 203) (cf. 3).
  • Fragment A contains the B33 promoter of the potato gene B33 of the potato. It contains a Dral fragment (position: -1512 to position +14) of the patatin gene B33 (Rocha-Sosa et al., EMBO J (1989) 8, 23-29), which is between the EcoRI and the SacI- Interface of the polylinker of pBin19-Hyg is inserted.
  • Fragment B is a fusion of the modified ftf gene from Streptococcus mutans (nt 780-3191, see Example 1) to nt 724 to 1399 of the patent gene B33 via a sequence of the nucleotides GTCGACGGTATCG.
  • This sequence (designated as "VI” in FIG. 3) contains the coding region for the signal peptide for inclusion in the ER and the subsequent information for a signal for forwarding into the vacuole (Rosahl et al., Mol Gen Genet (1986) 203, 214-220, sequence comes from pgT5).
  • An intron is inserted into the coding region of this expanded signal sequence.
  • the nucleotide sequence of the intron is removed from the transcript of the chimeric gene by 'splicing'. Proteins that have such a signal peptide are first taken up in the ER and then transported into the vacuole.
  • Fragment C contains the polyadenylation signal of gene 3 (octopine synthase gene from Agrobacterium tumefaciens) of the T-DNA of the Tl plasmid pTiAch 5 (Gielen et al., EMBO J (1984) 3, 835-846), that is to say nucleotides 11749 -11939, which was isolated as a Pvu II-Hind III fragment from the plasmid pAGV 40 (Herrera-Estrella et al., Nature (1983) 303, 209-213) and after addition of Sph I linkers to the Pvu II site between the SphI and Hind HI sites of the polylinker from pBinl9-Hyg.
  • gene 3 octopine synthase gene from Agrobacterium tumefaciens
  • the plasmid pB33vlftf has a size of approximately 14 kb.
  • the construct B33vlftf was introduced into potato plants. Intact plants were regenerated from transformed cells. Analysis of the tubers of a number of plants transformed with this gene clearly showed the presence of inulin, which can be attributed to the expression of the gene according to the invention (see FIG. 6).
  • the plasmid pB33v2ftf contains the three fragments A, B and C in the binary vector pBinl9-Hyg (Bevan, Nucl Acids Res (1984) 12, 8711, modified according to Becker, Nucl Acids Res (1990) 18, 203) (cf. 4).
  • Fragment A contains the B33 promoter of the potato gene B33 of the potato. It contains a Dral fragment (position: -1512 to position +14) of the patatin gene B33 (Rocha-Sosa et al., EMBO J (1989) 8, 23-29), which is located between the EcoRI and the SacI- Interface of the polylinker of pBin19-Hyg is inserted.
  • Fragment B is a fusion of the modified ftf gene from Streptococcus mutans (nt 780-3191, cf. Example 1) to a fragment (designated "V2" in FIG. 4) of the cDNA of the patatin gene B33.
  • the cDNA contains the signal sequence mentioned in embodiment 3 for inclusion in the ER and for forwarding to the vacuole; however, the coding region is not interrupted by an intron (Rosahl et al., Mol Gen Genet (1986) 203, 214-220; nt 724-903 / 1293-1399, sequence comes from pcT58, (payment according to pgT5)). Proteins which have such a signal peptide are first taken up in the ER and then transported into the vacuole.
  • Fragment C contains the polyadenylation signal of gene 3 (octopine synthase gene from Agrobacterium tumefaciens) of the T-DNA of the Ti plasmid pTiAch 5 (Gielen et al., EMBO J (1984) 3, 835-846), that is to say nucleotides 11749 11939, which has been isolated as a Pvu II-Hind III fragment from the plasmid pAGV 40 (Herrera-Estrella et al., Nature (1983) 303, 209-213) and after addition of Sph I linkers to the Pvu Il interface between the SphI and the Hind HI site of the polylinker from pBinl9-Hyg has been cloned.
  • gene 3 octopine synthase gene from Agrobacterium tumefaciens
  • the plasmid pB33v2ftf has a size of approximately 14 kb.
  • the construct B33v2ftf was introduced into potato plants. Intact plants were regenerated from transformed cells. Analysis of the tubers of a number of plants transformed with this gene clearly showed the presence of inulin, which is due to the expression of the gene according to the invention.
  • Tuber material was homogenized in 100 mM sodium acetate, pH 5.6 in the presence of insoluble polyvinylpyrrolidone (1 ml / 100 mg material), incubated for 30 min at 65 ° C. and then filtered at 65 ° C. 15 ml of homogenate were incubated with 15 ⁇ l RNAse A (1 mg / ml) and 15 ⁇ l DNAse (10 mg / ml) for 30 min at 37 ° C., then with 20 ⁇ l ProteinaseK (20 mg / ml) for 30 min at 60 ° C. . Inulin was precipitated from the homogenate by adjusting to 80% ethanol and centrifuged.
  • the sediment was dissolved in 50 ⁇ l of water at 75 ° C. and precipitated again with 80% ethanol. The sediment was then dissolved in 30 ⁇ l of water at 75 ° C., 4 ⁇ l of the solution were analyzed by thin-layer chromatography or treated with an excess of endoinulinase at 56 ° C. for 15 min.
  • Potato tubers are washed and then chopped with a grater (for example from Nivoba) to grater.
  • the friction eggs are then passed with a water stream over hydrocyclones and divided into pulp, solid and amniotic fluid fractions.
  • the solid fraction consisting essentially of inulin is cleaned by washing with water and dried.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Die vorliegende Erfindung betrifft ein Verfahren zur Herstellung gentechnisch veränderter, Inulin erzeugender Pflanzen, die dabei verwendeten DNA-Sequenzen sowie die erhaltenen transformierten Pflanzen.

Description

Verfahren zur Herstellung transqener, Inulin erzeugender Pflanzen
Beschreibung
Die vorliegende Erfindung betrifft ein Verfahren zur Herstellung gentechnisch veränderter, hochmole¬ kulares Inulin erzeugender Pflanzen, Mittel zur Durchführung dieses Verfahrens und die mit Hilfe dieser Mittel und des Verfahrens erhältlichen Pflanzen sowie das darin enthaltene hochmolekulare Inulin.
Hochmolekulare, wasserlösliche, lineare Polymere, beispielsweise Polyacrylate und Polymethylacrylate sind bekannt. Diese werden beispielsweise zur Vis¬ kositätserhöhung von wäßrigen Systemen, als suspen¬ dierendes Agens, zur Sedimentationsbeschleunigung und Komplexierung sowie in Superabsorbern zur Was¬ serbindung und in Wasser verdunnbaren Lacken einge¬ setzt. Als nachteilig erweist sich, daß diese Pro¬ dukte biologisch nicht abbaubar sind. Ersatzweise kommen derivatisierte hochpolymere Polysaccharide in Betracht. Solche Polysaccharide lassen sich bis¬ her biotechnologisch durch Fermentation und Trans- glycosylierung gewinnen. Fermentativ erzeugte Poly¬ mere sind jedoch aufgrund wirtschaftlicher Ge¬ sichtspunkte für Anwendungen im größeren Maßstab nicht geeignet. Seit einiger Zeit wird daher ver¬ sucht, lineare, wasserlösliche Polymere, wie zum Beispiel Inulin, in Pflanzen zu produzieren. Inulin, ein ß-2-1 verknüpftes Polyfructan, ist als Speicherkohlenhydrat in einigen zweikeimblattrigen, höheren Pflanzen nachweisbar, und liegt mit einem Molekulargewicht von 5-50 kD vor. Unter den Bakte¬ rien sind außerdem einige gram-positive und gram¬ negative Bakterienarten bekannt, die ein verwandtes Fructanpolymer, das ß-2-6 verknüpfte Levan, mittels sogenannter Levansucrasen synthetisieren. Bakteri¬ ell gebildete Polyfructane weisen erheblich höhere Molekulargewichte von bis zu 2000 kD auf. Derzeit ist lediglich ein gram-positives Bakterium be¬ schrieben, Streptococcus mutans, das mit Hilfe ei¬ nes ftf (Fructosyltransferase) Gens Inulin auf der Basis von Saccharose bildet (Shiroza und Kuramitsu, J. Bacteriology (1988) 170, 810 bis 816).
Verfahren zur Veränderung der Kohlenhydratkonzen- tration und/oder der Zusammensetzung der Kohlenhy¬ drate in transgenen Pflanzen mittels biotechnologi- scher Methoden sind bekannt. Die PCT/US89/02729 be¬ schreibt eine Möglichkeit zur Erzeugung von Kohlen- hydratpolymeren, insbesondere Dextran oder Poly- fructose, in transgenen Pflanzen, insbesondere de¬ ren Fruchten. Zur Erzeugung dieser Pflanzen wird die Verwendung von Levansucrase oder Dextransucrase aus verschiedenen Mikroorganismen vorgeschlagen. Weder die Bildung der aktiven Enzyme, noch die von Levan oder Dextran sowie die Herstellung transgener Pflanzen wird nachgewiesen.
Die PCT/EP93/02110 offenbart ein Verfahren zur Her¬ stellung Polyfructose erzeugender transgener Pflan¬ zen, die das lsc Gen für eine Levansucrase aus ei¬ nem gram-negativen Bakterium enthalten. Die PCT/NL93/00279 offenbart die Transformation von Pflanzen mit Chimären Genen, die das sacB Gen aus Bacillus subtilis oder das ftf Gen aus Streptococ- cus mutans enthalten. Im Falle des sacB Gens wird zur Erhöhung des Expressionsniveaus in transfor¬ mierten Pflanzen außerdem eine Modifikation des 5'- untranslatierten Bereichs des bakteriellen Gens empfohlen. Für das Fructosyltransferasegen aus Streptococcus mutans werden keine Seguenzmodifika- tionen zur Verbesserung der Expression beschrieben. Das Expressionsniveau der Fructosyltransferase ist daher vergleichsweise gering.
Der vorliegenden Erfindung liegt somit das techni¬ sche Problem zugrunde, ein Verfahren und Mittel zur Herstellung von hochmolekularem Inulin in Pflanzen bereitzustellen, die die einfache und kostengün¬ stige Erzeugung des Inulins in großer Menge in Planzen ermöglichen.
Die Losung dieses technischen Problems liegt in der Bereitstellung eines modifizierten Fructosyltrans- ferasegens, insbesondere eines Gens, in dem ein, vorzugsweise der aminoterminale, Bereich eines be¬ kannten Fructosyltransferasegens durch einen Be¬ reich eines Patatin-Gens und/oder eines anderen Gens ersetzt ist. Die bevorzugte erfindungsgemaß vorgesehene Modifikation der Seguenz des bekannten Fructosyltransferasegens besteht also in einem Aus¬ tausch der codierenden Region des aminoterminalen Bereiches eines Fructosyltransferasegens gegen den aminoterminalen Bereich eines Patatin-Gens und/oder anderen Gens. Das andere Gen kann beispielsweise das Carboxypeptidase-Y-Gen (cpy-Gen) oder das lacZ- Gen sein. Bevorzugt ist eine Ausfuhrungsform, in der der aminoterminale Bereich des Fructosyltrans- ferasegens nur durch einen Bereich des Patatin-Gens ersetzt ist. Überraschenderweise kann ein derart modifiziertes Fructosyltransferasegen effizient in höheren Pflanzen exprimiert werden, wobei hochmole¬ kulares Inulin in großer Menge erhalten wird. In besonders vorteilhafter Weise ist keine umfassende Sequenzmodifikation oder Neusynthese des ursprüng¬ lichen Fructosyltransferasegens notwendig.
Im Zusammenhang der vorliegenden Erfindung wird un¬ ter einem Fructosyltransferasegen die codierende DNA-Sequenz eines Gens verstanden, dessen Genpro¬ dukt eine Saccharose: ß-D-Fructosyltransferaseakti- vität aufweist. Ein derartiges Gen kann pflanzli¬ cher, tierischer, mikrobieller oder synthetischer Herkunft sein. Erfindungsgemäß werden unter modifi¬ zierten Fructosyltransferasegenen die codierenden DNA-Sequenzen von modifizierten Genen verstanden, deren Genprodukte eine Saccharose: ß-D-Fructosyl- transferaseaktivitat aufweisen und in der Lage sind, ß-2-1 verknüpfte Polyfructane, also insbeson¬ dere Inuline, zu bilden. Die Genprodukte der modi¬ fizierten Gene weisen also die vorstehend defi¬ nierte biologische Aktivität einer Inulinsucrase auf. Unter dem Begriff Modifikation werden samtli¬ che Manipulationen an einer DNA-Sequenz verstanden, beispielsweise Nucleotidsubstitutionen, -deletio- nen, -inversionen oder -additionen. Unter dem ami¬ noterminalen Bereich eines Gens wird der Bereich der codierenden DNA-Sequenz verstanden, der den aminoterminalen Bereich des Genproduktes codiert, wobei der aminoterminale Bereich eines Gens viele oder wenige Codons, aber auch nur das Startcodon allein umfassen kann. Unter einem Patatin-Gcn wird ein zu der Familie der Patatin-Gene zahlendes Gen verstanden, welches zum Beispiel ein Patatin-Gen der Klasse I oder II sein kann (Rocha-Sosa et al., EMBO J (1989) 8, 23-29). Unter einem Patatin-Gen werden auch Patatin-analoge Gene verstanden, die Sequenzhomologie und/oder Funktionsahnlichkeit zu den Patatin-Genen aufweisen. Das erfindungsgemaß verwendete Patatin-Gen stammt vorzugsweise aus der Kartoffel, kann aber auch synthetischen oder ande¬ ren Ursprungs sein.
Schließlich wird erfindungsgemaß unter hochmoleku¬ larem Inulin ein Inulin mit einem Molekulargewicht von mehr als 1,5 Mio. Dalton verstanden.
Die Losung des vorgenannten technischen Problemes wird insbesondere durch das im Hauptanspruch cha¬ rakterisierte Gen, dieses Gen aufweisende Vektoren, diese Vektoren verwendende Transformationsverfah¬ ren, die mit diesem Verfahren erhaltenen Pflanzen und Inuline sowie Verfahren zur Gewinnung des er- findungsgemaß gebildeten Inulins aus den erfin¬ dungsgemaßen Pflanzen bereitgestellt. Die Unteran¬ spruche betreffen vorteilhafte Ausgestaltungen der Erfindung.
Die Erfindung betrifft in einer ersten Ausfuhrungs- form ein modifiertes Fructosyltransferasegen, in dem der aminoterminale Bereich eines Fructosyl¬ transferasegens zumindest teilweise durch den Be¬ reich eines weiteren Gens, nämlich eines Patatin- Gens, ersetzt ist. Außer dem Austausch des ur¬ sprunglichen aminoterminalen Bereichs des Fructo¬ syltransferasegens gegen einen Bereich des Patatin- Gens, vorzugsweise des aminoterminalen Bereichs, kann das Fructosyltransferasegen selbstverständlich auch weitere Modifikationen aufweisen und/oder vollsynthetisch hergestellt sein. Die Erfindung betrifft aber auch alle anderen Modi¬ fikationen eines Fructosyltransferasegens, sofern das gebildete Genprodukt in Pflanzen hochmolekula¬ res Inulin erzeugen kann.
In einer besonders bevorzugten Ausführungsform der Erfindung ist vorgesehen, daß der aminoterminale Bereich des Fructosyltransferasegens durch Seguen- zen aus pflanzlichen oder bakteriellen Genen oder Genen aus Hefe, insbesondere dem Patatin-Gen aus vorzugsweise der Kartoffel und optional einem ande¬ ren Gen, beispielsweise dem cpy-Gen aus Hefe oder dem lacZ-Gen aus Escherichia coli, ersetzt ist.
Besonders bevorzugt ist vorgesehen, daß das pflanz¬ liche Gen das Patatin-B33-Gen aus der Kartoffel ist. Insbesondere sieht die Erfindung vor, den ami¬ noterminalen Bereich des Fructosyltransferasegens durch Signalpeptid codierende Signalsequenzen des Patatin-Gens zu ersetzen. Signalsequenzen des Pata¬ tin-Gens, insbesondere des Patatin-B33-Gens aus Kartoffel, die erfindungsgemaß eingesetzt werden können, codieren Signalpeptide zur Aufnahme ins en- doplasmatische Retikulum oder Signalpeptide, die eine Lokalisation des Genproduktes in der Vacuole erlauben. Die Erfindung betrifft also modifizierte Fructosyltransferasegene, bei denen die Modifika¬ tion des Fructosyltransferasegens darin bestehen kann, daß der aminoterminale Bereich des Fructo¬ syltransferasegens durch Signalsequenzen pflanzli¬ cher Gene, wie beispielsweise des Patatin-Gens aus Kartoffel ersetzt wird. Die Erfindung umfaßt auch modifizierte Fructosyltransferasegene, bei denen der aminoterminale Bereich des Fructosyltrans¬ ferasegens durch Bereiche, insbesondere aminotermi¬ nale Bereiche, verschiedener Gene ersetzt wird, beispielsweise den aminoterminalen Bereich des Pa¬ tatin-Gens und des lacZ-Gens. Insbesondere ist be¬ vorzugt, daß der genannte aminoterminale Bereich des lacZ-Gens die aminoterminalen Aminosäuren 21 bis 30 der ß-Galactosidase codiert. Selbstverständ¬ lich umfaßt die Erfindung auch modifizierte Fructo¬ syltransferasegene, bei denen der aminoterminale Bereich des modifizierten Fructosyltransferasegens durch Bereiche verschiedener pflanzlicher Gene und Gene aus Hefe, beispielsweise des cpy-Gens (Carboxypeptidase Y) und des Patatin-Gens aus Kartoffel, bereitgestellt wird. In den beiden letzten Fällen ist vorzugsweise die das Signalpeptid aus dem Patatin-Gen codierende Signalsequenz stromaufwärts (5') von der Sequenz des cpy-Gens oder des lacZ-Gens angeordnet.
In einer weiteren Ausfuhrungsform der Erfindung ist vorgesehen, daß die Fructosyltransferase aus Strep- tococcus mutans stammt. Selbstverständlich betrifft die Erfindung jedoch auch die Verwendung von ande¬ ren Fructosyltransferasen, solange sie in erfin¬ dungsgemäß vorgegebener modifizierter Form Inuline erzeugen können.
In einer besonders bevorzugten Ausfuhrungsform der Erfindung stellt der zu ersetzende aminoterminale Bereich des Fructosyltransferasegens einen dessen Signalpeptid codierenden Bereich dar. Im Zusammen¬ hang der vorliegenden Erfindung wird unter einem Signalpeptid codierenden Bereich der Bereich zwi¬ schen Translationsstart und Beginn der das reife, prozessierte Protein codierenden DNA-Sequenz ver¬ standen. 31 PC17EP97/02195
- 8 -
In einer Ausfuhrungsform betrifft die Erfindung ein modifiziertes Fructosyltransferasegen, das eine Si¬ gnalsequenz aufweist, welche eine Signalpeptid zur Aufnahme des modifizierten Gens in das endoplasma- tische Retikulum einer eukaryontischen Zelle co¬ diert. Die Erfindung sieht also vor, daß ein modi¬ fiziertes Gen der Erfindung mit Signalsequenzen versehen werden kann, die eine Lokalisation des Genproduktes in bestimmten Kompartimenten der Zelle erlauben. Erfindungsgemaß besonders bevorzugt ist die Signalsequenz eines Patatin-Gens, insbesondere des Patatin-Gens B33, vorzugsweise aus Kartoffel. Wie ausgeführt, kann die Signalsequenz zusatzlich zu einer bereits erfolgten Modifikation des Fructo¬ syltransferasegens an das modifizierte Fructosyl¬ transferasegen fusioniert werden oder die Signalse- quenz wird direkt an das in seinem aminoterminalen Bereich verkürzte Fructosyltransferasegen fusio¬ niert. Erfindungsgemaß ist in beiden bevorzugten Ausführungsformen also vorgesehen, daß der ami¬ noterminale Bereich des Fructosyltransferasegens durch zumindest einen Teil des Patatin-Gens ersetzt ist und gegebenenfalls auch zusätzlich Sequenzen aus anderen Genen, beispielweise dem lacZ-Gen oder dem cpy-Gen, im aminoterminalen Bereich des modifi¬ zierten Fructosyltransferasegens vorhanden sind. Bei der Verwendung der das Signalpeptid zur Auf¬ nahme ins endoplasmatische Retikulum codierenden Signalsequenz aus dem aminoterminalen Bereich des Patatin-B33-Genε wird eine Translokation des Gen¬ produktes in den apoplastischen Raum erreicht. Folglich wird dort die Synthese des hochmolekularen Inulins durchgeführt, so daß spezifische Verände¬ rungen in der Kohlenhydrat-Zusammensetzung der transgenen Pflanze erreicht werden können. Selbst¬ verständlich können erfindungsgemaß auch andere Si- gnalsequenzen verwendet werden. So kommen insbeson¬ dere Signalsequenzen in Betracht, die Signalpeptide codieren, welche zur Aufnahme eines Proteins in das endoplasmatische Retikulum fuhren und die dadurch nachgewiesen werden können, daß sie zwar in den Vorläuferproteinen, nicht aber in prozessierten, reifen Proteinen detektiert werden können. Bekann¬ termaßen werden nämlich die Signalpeptide wahrend der Aufnahme ins endoplasmatische Retikulum proteo- lytisch entfernt.
In einer weiteren bevorzugten Ausführungsform sieht die Erfindung vor, daß das modifizierte Fructosyl¬ transferasegen an eine Signalsequenz fusioniert ist oder diese aufweist, welche ein Signalpeptid zur Aufnahme ins endoplasmatische Retikulum einer euka- ryontischen Zelle und zur Weiterleitung in die Va- cuole codiert. Die Verwendung eines Signalpeptids zur vacuolären Lokalisation des Genproduktes ist vorteilhaft insofern, als das dadurch ebenfalls spezifische Veränderungen der Kohlenhydrat-Zusam¬ mensetzung der erhaltenen transgenen Pflanzen be¬ wirkt werden können. Erfindungsgemaß können bei¬ spielsweise Signalpeptide zur vacuolären Lokalisa¬ tion von Lektin aus Gerste verwendet werden (Raik- hel und Lerner, Dev.Genet (1991) 12,255-260), 43 Aminosäuren im aminoterminalen Bereich des reifen Phytohamaglutinins der Bohne codierende Signalse¬ quenzen (Tague et al., Plant cell (1990) 2,533-546) und Signalsequenzen aus einem Patatin-Gen aus Kar¬ toffel.
Erfindungsgemaß ist eine Modifikation des Fructo¬ syltransferasegens bevorzugt, bei der eine Si¬ gnalsequenz des Patatin-B33-Gens, insbesondere eine, die die 60 aminoterminalen Aminosäuren des Propeptids codiert (Rosahl et al. , Mol Gen Genet (1986) 203, 214-220), also die nt 736 bis 855, ver¬ wendet wird. Diese Signalsequenz ersetzt zumindest teilweise den aminoterminalen Bereich des Fructo¬ syltransferasegens, gegebenenfalls zusammen mit Be¬ reichen anderer Gene. Im Zusammenhang der vorlie¬ genden Erfindung wird diese Sequenz als erweiterte B33-Signalsequenz bezeichnet. Diese Sequenz kann sowohl als Fragment genomischer DNA der Kartoffel als auch aus cDNA zum Transcript des B33-Gens ge¬ wonnen werden. Die Fusion der erweiterten B33-Si- gnalsequenz zum modifizierten Gen der Erfindung oder zum zu modifizierenden Fructosyltransferasegen führt zur Aufnahme von dessen Genprodukt in die Va- cuole und damit zu einer spezifischen Änderung in der Kohlenhydrat-Zusammensetzung der erhaltenen transgenen Pflanze.
Die Erfindung betrifft auch die Verwendung dieser erweiterten B33-Signalsequenz beziehungsweise des davon codierten Peptids zum Transport beliebiger anderer Genprodukte in pflanzliche Vacuolen.
Die Erfindung betrifft auch einen Vektor, insbeson¬ dere ein Plasmid, enthaltend ein modifiziertes Fructosyltransferasegen. Insbesondere betrifft die Erfindung einen Vektor oder ein Plasmid, enthaltend ein modifiziertes Fructosyltransferasegen, das un¬ ter der Kontrolle eines in Pflanzen aktiven Promo¬ tors, insbesondere eines organspezifischen Promo¬ ters, steht. Bekanntermaßen ist Saccharose das Sub¬ strat für die Fructosyltransferase, so daß die Pro¬ duktion von hochmolekularem Inulin insbesondere in solchen Pflanzengeweben oder Pflanzenorganen von Vorteil ist, die große Mengen an Saccharose spei¬ chern. Dazu zahlen beispielsweise die Rübe der Zuk- 1 PC17EP97/02195
- 1 1 -
kerrube oder der Stamm vom Zuckerrohr. Erfindungs¬ gemaß kann die Expression des modifizierten Fructo¬ syltransferasegens in solchen Organen erreicht wer¬ den, indem gewebespezifische Promotoren verwendet werden. Eine organspezifische Expression in Kartof¬ felknollen oder Rüben von Zuckerrüben ist bei¬ spielsweise mit dem B33-Promotor des B33-Gens aus Kartoffel möglich.
Die Erfindung betrifft auch einen Vektor oder ein Plasmid, in dem der 3 '-Terminus des modifizierten Fructosyltransferasegens an eine Transcriptionster- minationssequenz, beispielsweise die Polyadenylie- rungsstelle des nos-Gens aus Agrobacterium tumefa- ciens, fusioniert ist.
In einer besonders bevorzugten Ausfuhrungsform be¬ trifft die Erfindung die Plasmide pB33cftf, also ein den B33-Promotor des Patatin-Gens, eine lacZ- ftf-Gen Fusion und ein Polyadenylierungssignal ent¬ haltendes Plasmid, pB33aftf, also ein den B33-Pro- motor des Patatin-Gens, eine B33-Signalsequenz- lacZ-ftf-Gen Fusion und ein Polyadenylierungssignal enthaltendes Plasmid, pB33vlftf, also ein den B33- Promotor des Patatin-Gens, eine erweiterte B33-Sig- nalsequenz-lacZ-ftf-Gen Fusion und ein Polyadeny¬ lierungssignal enthaltendes Plasmid und pB33v2ftf, also ein den B33-Promotor des Patatin-Gens, eine erweiterte B33-Signalsequenz-lacZ-ftf-Gen Fusion (ohne Intron in Signalsequenz) und ein Polyadeny¬ lierungssignal enthaltendes Plasmid (Fig. 1 bis 4) . Selbstverständlich betrifft die Erfindung auch die in den vorgenannten Plasmiden enthaltenden Genfusionen ohne Verwendung der zwischen den Patatin-Sequenzen und den ftf-Sequenzen gelegenen lacZ-Gensequenzen. Die Erfindung betrifft auch prokaryontische und eu¬ karyontische Zellen, die einen Vektor, ein Plasmid oder eine DNA-Sequenz der Erfindung enthalten. Ins¬ besondere betrifft die Erfindung die erfindungsge¬ mäßen Vektoren, Plasmide oder DNA-Sequenzen aufwei¬ senden Zellen, beispielsweise Bakterienzellen oder, bevorzugt, Pflanzenzellen. Diese können das modifi¬ zierte Fructosyltransferasegen der Erfindung entwe¬ der transient oder, besonders bevorzugt, stabil in¬ tegriert in ihr Genom enthalten. Im Zusammenhang der vorliegenden Erfindung werden unter den erfin¬ dungsgemäßen Pflanzenzellen solche verstanden, die entweder direkt unmittelbar aus dem Transformati¬ onsereignis hervorgegangen sind und demgemäß, je nach gewählter Transformationsmethode, undifferen- ziert oder differenziert vorliegen können oder sich differenzierende beziehungsweise ausdifferenzierte Pflanzenzellen.
Die Erfindung betrifft auch Pflanzen, die minde¬ stens eine, bevorzugt jedoch eine Vielzahl von Zel¬ len enthalten, die das erfindungsgemäße Fructosyl¬ transferasegen oder dieses enthaltende Vektoren oder Plasmide aufweisen und infolge dessen hochmo¬ lekulares Inulin erzeugen. Die Erfindung ermöglicht also die Bereitstellung von Pflanzen der verschie¬ densten Arten, Gattungen, Familien, Ordnungen und Klassen, die aufgrund des eingeführten modifizier¬ ten Fructosyltransferasegens in der Lage sind, hochmolekulares Inulin zu erzeugen. Da die bekann¬ ten Pflanzen nicht in der Lage sind, hochmolekula¬ res Inulin zu produzieren, ist die erfolgreiche Durchfuhrung des erfindungsgemaßen Verfahrens leicht, beispielsweise durch Antikorpertests, mög¬ lich. Gegenüber den wenigen bekannten Inulin erzeu¬ genden Pflanzen ergibt sich der Vorteil, daß eine gezielte Lokalisierung des gebildeten Inulins mög¬ lich ist und das zudem eine Erhöhung der Expressi- onsrate und damit der Menge an gebildeten Inulin erreicht wird. Zudem weist das durch das erfin¬ dungsgemäße Gen bakteriellen Ursprungs erzeugte er¬ findungsgemäße Inulin ein höheres Molekulargewicht als pflanzliches Inulin auf. Auch hier läßt sich der Nachweis erfolgreicher Transformation mit den erfindungsgemaßen Sequenzen beispielsweise durch Kompartiment-spezifische Antikörpertests, gegebe¬ nenfalls unter Quantifizierung, nachweisen.
Die Erfindung sieht insbesondere vor, daß die zu transformierende Pflanze eine Nutzpflanze, insbe¬ sondere eine Mais-, Reis-, Weizen-, Gersten-, Zuk- kerruben-, Zuckerrohr- oder Kartoffelpflanze ist.
Die Erfindung betrifft auch ein Verfahren zur Her¬ stellung der vorgenannten Pflanzen, umfassend die Transformation einer oder mehrerer Pflanzenzellen mit einem Vektor oder einem Plasmid der Erfindung, die Integration des in diesem Vektor oder Plasmid enthaltenden modifizierten Fructosyltransferasegens in das Genom der Pflanzenzelle(n) und die Re¬ generation der Pflanzenzelle(n) zu intakten, trans¬ formierten, hochmolekulares Inulin erzeugenden Pflanzen.
Schließlich betrifft die Erfindung das von den er¬ findungsgemaßen Pflanzen hergestellte hochmoleku¬ lare Inulin. Dieses zeichnet sich gegenüber natür¬ licherweise in einigen Pflanzen vorkommendem Inulin insbesondere auch durch sein hohes Molekulargewicht von mehr als 1,5 Mio. Dalton aus. Die Erfindung betrifft auch ein Verfahren zur Ge¬ winnung von Inulin aus den transformierten Pflan¬ zen, insbesondere aus deren Vacuolen.
Die Figuren zeigen:
Figur 1 stellt die Konstruktion des Plasmids pB33cftf dar.
Figur 2 stellt die Konstruktion des Plasmids pB33aftf dar.
Figur 3 stellt die Konstruktion des Plasmids pB33vlftf dar.
Figur 4 stellt die Konstruktion des Plasmids pB33v2ftf dar.
Figur 5 stellt eine Northern-Blot Analyse der Genexpression, das heißt der ftf-mRNA Ge¬ halte, in Knollen ausgewählter Transfor- manten mit den erfindungsgemaßen Kon- strukten dar.
Figur 6 stellt eine Dunnschichtchromatographie- Analyse der Inulingehalte von Knollen ei¬ ner Reihe von mit dem Plasmid pB33vlftf transformierter Pflanzen dar.
Die Ausführungsbeispiele beschreiben die Erfindung in Einzelheiten.
Ausführungsbeispiel 1 Herstellung des Plasmids pB33cftf und Einbringen des entsprechenden Konstrukts in das Genom von Kar¬ toffel.
Das Plasmid pB33cftf enthalt die drei Fragmente A, B und C im binären Vektor pBinl9-Hyg (Bevan, Nucl Acids Res (1984) 12, 8711, modifiziert nach Becker, Nucl Acids Res (1990) 18, 203) (vgl. Fig. 1) .
Das Fragment A beinhaltet den B33 Promotor des Pa- tatin Gens B33 der Kartoffel. Es enthält ein Dral Fragment (Position: -1512 bis Position +14) des Pa- tatin Gens B33 (Rocha-Sosa et al., EMBO J (1989) 8, 23-29) , das zwischen der EcoRI- und der Sacl- Schnittstelle des Polylinkers von pBinl9-Hyg inse¬ riert ist.
Das Fragment B ist eine Fusion der nt 780-3191 des ftf Gens aus Streptococcus mutans (Genbank EMBL Ac- cession M18954) an eine Kombination der nt 724-716 und nt 759-727 des Plasmids pBluescript KS, die die aminoterminalen Aminosäuren 21-30 der ß-Galactosi- dase repräsentieren. Clonierungsbedingt ensteht vor dieser Sequenz ein ATG-Startcodon, das für die Translation des Fusionsproduktes in Pflanzen ge¬ nutzt wird. Die Sequenz bis zur Fusion an nt 780 des ftf Gens ist im folgenden dargestellt:
AAGCTTGATGTACCGGGCCCCCCCTCGAGGTCGACGGTATCG
724 716 759 727
Die nt 780-3191 des ftf Gens wurden als Earl- (auf¬ gefüllt mit DNA Polymerase)/Bglll-Fragment aus dem Plasmid pTS102 (Shiroza and Kuramitsu, J Bacteriol (1988) 170, 810-816) isoliert. Durch die Fusion dieses Fragments des ftf Gens an die genannte DNA- Sequenz erfolgt der Austausch des ursprünglichen N- Terminus gegen den aminoterminalen Bereich der ß- Galactosidase.
Das Fragment C enthalt das Polyadenylierungssignal des Gens 3 (Octopin-Synthase-Gen aus Agrobacterium tumefaciens) der T-DNA des Ti-Plasmids pTiAch 5 (Gielen et al., EMBO J. (1984) 3, 835-846), also die Nucleotide 11749-11939, welches als Pvu II-Hind III Fragment aus dem Plasmid pAGV 40 (Herrera- Estrella et al., Nature (1983) 303, 209-213) iso¬ liert worden ist und nach Addition von Sph I Lin¬ kern an die Pvu Il-Schnittstelle zwischen die Sphl- und die Hind HI-Schnittstelle des Polylinkers von pBinl9-Hyg cloniert worden ist.
Das Plasmid pB33cftf hat eine Größe von ca. 14 kb.
Das Konstrukt pB33cftf wurde in Kartoffelpflanzen eingebracht. Aus transformierten Zellen wurden in¬ takte Pflanzen regeneriert. Die Analyse der Knollen einer Reihe von mit diesem Gen transformierten Pflanzen zeigte eindeutig das Vorkommen von Inulin, was auf die Expression des erfindungsgemäßen Gens zurückzuführen ist.
Ausführungsbeispiel 2
Herstellung des Plasmids pB33aftf und Einbringen des entsprechenden Konstrukts in das Genom von Kar¬ toffel.
Das Plasmid pB33aftf enthalt die drei Fragmente A, B und C im binaren Vektor pBinl9-Hyg (Bevan, Nucl Acids Res (1984) 12, 8711, modifiziert nach Becker, Nucl Acids Res (1990) 18, 203) (vgl. Fig. 2) . Das Fragment A beinhaltet den B33 Promotor des Pa- tatin Gens B33 der Kartoffel. Es enthalt ein Dral Fragment (Position:-1512 bis Position +14) des Pa- tatin Gens B33 (Rocha-Sosa et al . , EMBO J (1989) 8, 23-29) , das zwischen der EcoRI- und der Sacl- Schnittstelle des Polylinkerε von pBinl9-Hyg inse¬ riert ist.
Das Fragment B ist eine Fusion des modifizierten ftf Gens von Streptococcus mutans (nt 780-3191, vgl. Beispiel 1) an die nt 724 bis 833 des Patatin- Gens B33 über eine Sequenz der Nukleotide GTCGACGGTATCG. Diese Sequenz (in Figur 2 als "a" bezeichnet) beinhaltet die Codierregion für das Si¬ gnalpeptid zur Aufnahme in das endoplasmatische Re¬ tikulum (ER) (Rosahl et al., Mol Gen Genet (1986) 203, 214-220; Sequenz stammt aus pcT58) . Proteine, die eine derartige Signalsequenz besitzen, werden zunächst in das ER aufgenommen und dann in den apo- plastischen Raum exportiert.
Das Fragment C enthalt das Polyadenylierungssignal des Gens 3 (Octopin-Synthase Gen aus Agrobacterium tumefaciens) der T-DNA des Ti-Plasmids pTiAch 5 (Gielen et al., EMBO J (1984) 3, 835-846), also die Nucleotide 11749-11939, welches als Pvu II-Hind III Fragment aus dem Plasmid pAGV 40 (Herrera-Estrella et al., Nature (1983) 303, 209-213) isoliert worden ist und nach Addition von Sph I Linkern an die Pvu Il-Schnittstelle zwischen die SphI- und die Hind HI-Schnittstelle des Polylinkers von pBinl9-Hyg cloniert worden ist.
Das Plasmid pB33aftf hat eine Große von ca. 14 kb. Das Konstrukt B33aftf wurde in Kartoffelpflanzen eingebracht. Aus transformierten Zellen wurden in¬ takte Pflanzen regeneriert. Die Analyse der Knollen einer Reihe von mit diesem Gen transformierten Pflanzen zeigte eindeutig das Vorkommen von Inulin, was auf die Expression des erfindungsgemaßen Gens zurückzuführen ist.
Ausführungsbeispiel 3
Herstellung des Plasmids pB33vlftf und Einbringen des entsprechenden Konstrukts in das Genom von Kar¬ toffel.
Das Plasmid pB33vlftf enthalt die drei Fragmente A, B und C im binaren Vektor pBinl9-Hyg (Bevan, Nucl Acids Res (1984) 12, 8711, modifiziert nach Becker, Nucl Acids Res (1990) 18, 203) (vgl. Fig. 3) .
Das Fragment A beinhaltet den B33 Promotor des Pa- tatin Gens B33 der Kartoffel. Es enthalt ein Dral Fragment (Position: -1512 bis Position +14) des Pa- tatin Gens B33 (Rocha-Sosa et al., EMBO J (1989) 8, 23-29) , das zwischen der EcoRI- und der Sacl- Schnittstelle des Polylinkers von pBinl9-Hyg inse¬ riert ist.
Das Fragment B ist eine Fusion des modifizierten ftf Gens von Streptococcus mutans (nt 780-3191, vgl. Beispiel 1) an die nt 724 bis 1399 des Pata¬ tin-Gens B33 über eine Sequenz der Nukleotide GTCGACGGTATCG. Diese Sequenz (in Figur 3 als "VI" bezeichnet) beinhaltet die Codierregion für das Si¬ gnalpeptid zur Aufnahme in das ER, sowie die daran anschließende Information für ein Signal zur Wei¬ terleitung in die Vacuole (Rosahl et al . , Mol Gen Genet (1986) 203, 214-220, Sequenz stammt aus pgT5) . In die Codierregion dieser erweiterten Si¬ gnalsequenz ist ein Intron inseriert. Aus dem Tran¬ script des chimären Gens wird die Nucleotidsequenz des Introns durch 'splicing' entfernt. Proteine, die ein derartiges Signalpeptid besitzen, werden zunächst in das ER aufgenommen und dann in die Va- cuole transportiert.
Das Fragment C enthält das Polyadenylierungssignal des Gens 3 (Octopin-Synthase Gen aus Agrobacterium tumefaciens) der T-DNA des Tl-Plasmids pTiAch 5 (Gielen et al., EMBO J (1984) 3, 835-846) , also die Nucleotide 11749-11939, welches als Pvu II-Hind III Fragment aus dem Plasmid pAGV 40 (Herrera-Estrella et al., Nature (1983) 303, 209-213) isoliert worden ist und nach Addition von Sph I Linkern an die Pvu II-Schnittstelle zwischen die SphI- und die Hind HI-Schnittstelle des Polylinkers von pBinl9-Hyg cloniert worden ist.
Das Plasmid pB33vlftf hat eine Größe von ca. 14 kb.
Das Konstrukt B33vlftf wurde in Kartoffelplanzen eingebracht. Aus transformierten Zellen wurden in¬ takte Pflanzen regeneriert. Die Analyse der Knollen einer Reihe von mit diesem Gen transformierten Pflanzen zeigte eindeutig das Vorkommen von Inulin, was auf die Expression des erfindungsgemaßen Gens zurückzuführen ist (vgl. Abb. 6) .
Ausführungsbeispiel 4
Herstellung des Plasmids pB33v2ftf und Einbringen des entsprechenden Konstrukts in das Genom von Kar¬ toffel. Das Plasmid pB33v2ftf enthalt die drei Fragmente A, B und C im binären Vektor pBinl9-Hyg (Bevan, Nucl Acids Res (1984) 12, 8711, modifiziert nach Becker, Nucl Acids Res (1990) 18, 203) (vgl. Fig. 4) .
Das Fragment A beinhaltet den B33 Promotor des Pa- tatin Gens B33 der Kartoffel. Es enthält ein Dral Fragment (Position:-1512 bis Position +14) des Pa- tatin Gens B33 (Rocha-Sosa et al., EMBO J (1989) 8, 23-29) , das zwischen der EcoRI- und der Sacl- Schnittstelle des Polylinkers von pBinl9-Hyg inse¬ riert ist.
Das Fragment B ist eine Fusion des modifizierten ftf Gens von Streptococcus mutans (nt 780-3191, vgl. Beispiel 1) an ein Fragment (in Figur 4 als "V2" bezeichnet) der cDNA des Patatin-Gens B33. Die cDNA enthält die in Ausführungsbeispiel 3 erwähnte Signalsequenz zur Aufnahme in das ER und zur Wei¬ terleitung in die Vacuole; die Codierregion ist je¬ doch nicht durch ein Intron unterbrochen (Rosahl et al., Mol Gen Genet (1986) 203, 214-220; nt 724- 903/1293-1399, Sequenz stammt aus pcT58, (Zahlung nach pgT5)) . Proteine, die ein derartiges Signal¬ peptid besitzen, werden zunächst in das ER aufge¬ nommen und dann in die Vacuole transportiert.
Das Fragment C enthält das Polyadenylierungssignal des Gens 3 (Octopin-Synthase Gen aus Agrobacterium tumefaciens) der T-DNA des Ti-Plasmids pTiAch 5 (Gielen et al., EMBO J (1984) 3, 835-846) , also die Nucleotide 11749 - 11939, welches als Pvu II-Hind III Fragment aus dem Plasmid pAGV 40 (Herrera- Estrella et al., Nature (1983) 303, 209-213) iso¬ liert worden ist und nach Addition von Sph I Lin¬ kern an die Pvu Il-Schnittstelle zwischen die SphI- und die Hind HI-Schnittstelle des Polylinkers von pBinl9-Hyg cloniert worden ist.
Das Plasmid pB33v2ftf hat eine Größe von ca. 14 kb.
Das Konstrukt B33v2ftf wurde in Kartoffelpflanzen eingebracht. Aus transformierten Zellen wurden in¬ takte Pflanzen regeneriert. Die Analyse der Knollen einer Reihe von mit diesem Gen transformierten Pflanzen zeigte eindeutig das Vorkommen von Inulin, was auf die Expression des erfindungsgemaßen Gens zurückzuführen ist.
Ausführungsbeispiel 5
Nachweis des gebildeten Inulins
Knollenmaterial wurde in 100 mM Natriumacetat, pH 5,6 in Gegenwart von unlöslichem Polyvinylpyrro- lidon (1 ml/100 mg Material) homogenisiert, 30 min bei 65°C inkubiert und anschließend bei 65°C fil¬ triert. 15 ml Homogenat wurden mit 15 μl RNAse A (1 mg/ml) und 15 μl DNAse (10 mg/ml) 30 min bei 37°C, anschließend mit 20 μl ProteinaseK (20 mg/ml) 30 min bei 60°C inkubiert. Inulin wurde aus dem Ho¬ mogenat durch Einstellen auf 80% Ethanol gefällt und abzentrifugiert. Das Sediment wurde in 50 μl Wasser bei 75°C gelost und nochmals mit 80% Ethanol gefällt. Das Sediment wurde dann in 30 μl Wasser bei 75°C gelöst, 4 μl der Lösung wurden dunn- schichtchromatographisch analysiert beziehungsweise für 15 min mit einem Überschuß an Endoinulinase bei 56°C behandelt.
Transformations- und Regenerationsprotokoll für Kartoffel Die Kartoffel wurden gemäß (Potrykus I., Spangen¬ berg G. (Hrsg.), 1995, "Genetransfer to plants", Dietze J. , Blau A. , Willmitzer L. , "A Bacteria Me¬ diated Transformation of Potato", Springer Lab Ma¬ nual, Seite 24-39) transformiert und regeneriert.
Aufarbeitung und Gewinnung des gebildeten Inulins
Kartoffelknollen werden gewaschen und dann mit ei¬ ner Reibe (zum Beispiel von der Firma Nivoba) zu Reibsei zerkleinert. Die Reibsei werden dann mit einem Wasserstrom über Hydrozyklone geleitet und dabei in Pulpe-, Feststoff- und Fruchtwasser-Frak¬ tionen aufgeteilt. Die im wesentlichen aus Inulin bestehende Feststoff-Fraktion wird durch Waschen mit Wasser gereinigt und getrocknet.

Claims

Ansprüche
1. Modifiziertes Fructosyltransferasegen, in dem der aminoterminale Bereich eines Fructosyltrans¬ ferasegens durch zumindest einen Bereich eines Pa¬ tatin-Gens ersetzt ist und das ein Protein mit der biologischen Aktivität einer Inulinsucrase codiert.
2. Modifiziertes Fructosyltransferasegen nach An¬ spruch 1, wobei der Bereich eines Patatin-Gens des¬ sen aminoterminaler Bereich ist.
3. Modifiziertes Fructosyltransferasegen nach An¬ spruch 1 oder 2, wobei das Patatin-Gen aus der Kar¬ toffel stammt.
4. Modifiziertes Fructosyltransferasegen nach einem der Ansprüche 1 bis 3, wobei das Patatin-Gen das B-33-Gen ist.
5. Modifiziertes Fructosyltransferasegen nach einem der Ansprüche 1 bis 4, wobei der aminoterminale Be¬ reich des Patatin-Gens eine ein Signalpeptid codie¬ rende Signalsequenz ist.
6. Modifiziertes Fructosyltransferasegen nach einem der Ansprüche 1 bis 5, wobei die Signalsequenz ein Signalpeptid zur Aufnahme des Gens in das endoplas¬ matische Retikulum einer eukaryontischen Zelle co¬ diert.
7. Modifiziertes Fructosyltransferasegen nach einem der Ansprüche 1 bis 6, wobei die Signalsequenz ein Signalpeptid zur Aufnahme des Gens in das endoplas¬ matische Retikulum einer eukaryontischen Zelle und zur Weiterleitung an die Vacuole codiert.
8. Modifiziertes Fructosyltransferasegen nach einem der Ansprüche 1 bis 7, wobei die Signalsequenz die erweiterte Signalsequenz eines Patatingens aus Kar¬ toffel, insbesondere die 60 aminoterminalen Ami¬ nosäuren des vom Patatin-B33-Gen codierten Propep- tids, umfaßt.
9. Modifiziertes Fructosyltransferasegen nach einem der Ansprüche 1 bis 8, wobei stromabwärts (3') vom Bereich des Patatin-Gens und stromaufwärts (5') vom verkürzten Fructosyltransferasegen Sequenzen eines anderen Gens liegen.
10. Modifiziertes Fructosyltransferasegen nach ei¬ nem der Ansprüche 1 bis 9, wobei das andere Gen das lacZ-Gen aus Escherichia coli oder das Carboxypep- tidase-Y-Gen ist.
11. Modifiziertes Fructosyltransferasegen nach ei¬ nem der Ansprüche 1 bis 10, wobei der aminotermi¬ nale Bereich des lacZ-Gens die aminoterminalen Ami¬ nosäuren 21 bis 30 der ß-Galactosidase codiert.
12. Modifiziertes Fructosyltransferasegen nach ei¬ nem der Ansprüche 1 bis 11, wobei das Fructosyl¬ transferasegen aus Streptococcus mutans stammt.
13. Modifiziertes Fructosyltransferasegen nach ei¬ nem der Ansprüche 1 bis 12, wobei der zu ersetzende aminoterminale Bereich des Fructosyltransferasegens dessen Signalpeptid codierende Sequenz ist.
14. Vektor, enthaltend ein modifiziertes Fructo¬ syltransferasegen, nach einem der Ansprüche 1 bis 13.
15. Vektor nach Anspruch 14, enthaltend ein modi¬ fiziertes Fructosyltransferasegen, nach einem der Ansprüche 1 bis 13, das unter der Kontrolle eines in Pflanzen aktiven Promotors, insbesondere eine organspezifischen Promotors, steht.
16. Vektor nach einem der Ansprüche 14 oder 15, wo¬ bei der Promotor der B33-Promotor des Patatin-B33- Gens aus Kartoffel ist.
17. Vektor nach einem der Ansprüche 14 bis 16, wo¬ bei der 3 '-Terminus des modifizierten Fructosyl¬ transferasegens nach einem der Ansprüche 1 bis 13 an ein Transcriptionsterminationssignal, insbeson¬ dere eine Polyadenylierungsstelle des nos-Gens, fu¬ sioniert ist.
18. Plasmide pB33cftf, pB33aftf, pB33vlftf und pB33v2ftf.
19. Zelle, enthaltend einen Vektor, ein Plasmid oder ein modifiziertes Fructosyltransferasegen nach einem der Ansprüche 1 bis 18.
20. Zelle nach Anspruch 19, die eine Bakterien¬ oder Pflanzenzelle, insbesondere eine Mais-, Reis-, Weizen-, Gersten-, Zuckerrüben-, Zuckerrohr- oder Kartoffelpflanzenzelle ist.
21. Pflanze, enthaltend mindestens eine Zelle nach Anspruch 20, insbesondere eine Mais-, Reis-, Wei¬ zen-, Gersten-, Zuckerrüben-, Zuckerrohr- oder Kar¬ toffelpflanze.
22. Samen und Fruchte einer Pflanze nach Anspruch 21.
23. Verfahren zur Herstellung einer gentechnisch veränderten Inulin erzeugenden Pflanze, umfassend
a) die Transformation einer oder mehrerer Pflanzenzellen mit einem Vektor oder Plasmid nach einem der Ansprüche 14 bis 18,
b) die Integration des in den Vektoren oder Plasmiden enthaltenen modifizierten Fructosyl¬ transferasegens in das Genom der transformier¬ ten Zelle(n) , und
c) die Regeneration von intakten, hochmolekula¬ res Inulin erzeugenden Pflanzen.
24. Hochmolekulares Inulin mit einem Molekularge¬ wicht von mehr als 1,5 Mio. Dalton, erhaltlich aus einer Pflanze nach Anspruch 21.
25. Verfahren zur Gewinnung von hochmolekularem Inulin, wobei dieses aus Pflanzen gemäß Anspruch 21, insbesondere deren Vacuolen, isoliert und auf¬ gereinigt wird.
26. Verwendung des die 60 aminoterminalen Amino¬ säuren des Patatin-B33-Propeptids aufweisenden Pep- tids oder der dieses Peptid codierenden DNA-Sequen¬ zen zum Transport eines Genproduktes in eine pflanzliche Vacuole.
PCT/EP1997/002195 1996-05-03 1997-04-29 Verfahren zur herstellung transgener, inulin erzeugender pflanzen WO1997042331A1 (de)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP53949797A JP2001517930A (ja) 1996-05-03 1997-04-29 イヌリン産生性トランスジェニック植物の調製方法
US09/180,143 US6255562B1 (en) 1996-05-03 1997-04-29 Process for producing transgenic inulin-generating plants
EP97921819A EP0944727A1 (de) 1996-05-03 1997-04-29 Verfahren zur herstellung transgener, inulin erzeugender pflanzen
AU27741/97A AU718897B2 (en) 1996-05-03 1997-04-29 Process for preparing transgenic, inulin-producing plants

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE19617687.5 1996-05-03
DE19617687A DE19617687C2 (de) 1996-05-03 1996-05-03 Verfahren zur Herstellung transgener, Inulin erzeugender Pflanzen

Publications (1)

Publication Number Publication Date
WO1997042331A1 true WO1997042331A1 (de) 1997-11-13

Family

ID=7793167

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1997/002195 WO1997042331A1 (de) 1996-05-03 1997-04-29 Verfahren zur herstellung transgener, inulin erzeugender pflanzen

Country Status (6)

Country Link
US (1) US6255562B1 (de)
EP (1) EP0944727A1 (de)
JP (1) JP2001517930A (de)
AU (1) AU718897B2 (de)
DE (1) DE19617687C2 (de)
WO (1) WO1997042331A1 (de)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19749122A1 (de) * 1997-11-06 1999-06-10 Max Planck Gesellschaft Nucleinsäuremoleküle codierend Enzyme, die Fructosyltransferaseaktivität besitzen
EP0952222A1 (de) * 1998-04-17 1999-10-27 Centrum Voor Plantenveredelings- En Reproduktieonderzoek (Cpro-Dlo) Transgene Pflanzen mit einem modifizierten Inulin produzierendem Profil
DE19840028A1 (de) * 1998-09-02 2000-03-09 Max Planck Gesellschaft Nucleinsäuremoleküle codierend Enzyme, die Fructosyltransferaseaktivität besitzen, und deren Verwendung
WO2002050257A2 (de) * 2000-12-21 2002-06-27 Südzucker Aktiengesellschaft Verfahren zur herstellung von polyfructanen
DE10106163B4 (de) * 2000-12-21 2007-03-29 Südzucker AG Mannheim/Ochsenfurt Verfahren zur Herstellung von Kohlenhydraten
US7875763B2 (en) 2000-10-30 2011-01-25 E.I. Du Pont De Nemours And Company Fructan biosynthetic enzymes

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7485715B2 (en) * 1999-06-18 2009-02-03 Ceres, Inc. Sequence-determined DNA encoding AP2 domain polypeptides
US7479555B2 (en) * 1999-07-21 2009-01-20 Ceres, Inc. Polynucleotides having a nucleotide sequence that encodes a polypeptide having MOV34 family activity
US20050257293A1 (en) * 2002-09-17 2005-11-17 Mascia Peter N Biological containment system
US7476777B2 (en) * 2002-09-17 2009-01-13 Ceres, Inc. Biological containment system
AU2003902253A0 (en) * 2003-05-12 2003-05-29 The University Of Queensland Method for increasing product yield
US9758790B2 (en) 2004-12-08 2017-09-12 Ceres, Inc. Modulating the level of components within plants
WO2006091676A2 (en) * 2005-02-22 2006-08-31 Ceres Inc. Modulating plant alkaloids
WO2006115575A1 (en) * 2005-04-20 2006-11-02 Ceres Inc. Regulatory regions from papaveraceae
US8124839B2 (en) * 2005-06-08 2012-02-28 Ceres, Inc. Identification of terpenoid-biosynthesis related regulatory protein-regulatory region associations
WO2007041536A2 (en) * 2005-09-30 2007-04-12 Ceres, Inc. Modulating plant tocopherol levels
US20090178160A1 (en) * 2005-10-25 2009-07-09 Joon-Hyun Park Modulation of Triterpenoid Content in Plants
US20070199090A1 (en) * 2006-02-22 2007-08-23 Nestor Apuya Modulating alkaloid biosynthesis
US20090222957A1 (en) * 2006-04-07 2009-09-03 Ceres Inc. Regulatory protein-regulatory region associations related to alkaloid biosynthesis

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4227061A1 (de) * 1992-08-12 1994-02-17 Inst Genbiologische Forschung DNA-Sequenzen, die in der Pflanze die Bildung von Polyfructanen (Lävanen) hervorrufen, Plasmide enthaltend diese Sequenzen sowie Verfahren zur Herstellung transgener Pflanzen
WO1994014970A1 (en) * 1992-12-28 1994-07-07 Stichting Scheikundig Onderzoek In Nederland Method for obtaining transgenic plants showing a modified fructan pattern
WO1995013389A1 (en) * 1993-11-09 1995-05-18 E.I. Du Pont De Nemours And Company Transgenic fructan accumulating crops and methods for their production
WO1996001904A1 (en) * 1994-07-08 1996-01-25 Stichting Scheikundig Onderzoek In Nederland Production of oligosaccharides in transgenic plants

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU3852089A (en) * 1988-06-21 1990-01-12 Calgene, Inc. Methods and compositions for altering physical characteristics of fruit and fruit products

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4227061A1 (de) * 1992-08-12 1994-02-17 Inst Genbiologische Forschung DNA-Sequenzen, die in der Pflanze die Bildung von Polyfructanen (Lävanen) hervorrufen, Plasmide enthaltend diese Sequenzen sowie Verfahren zur Herstellung transgener Pflanzen
WO1994014970A1 (en) * 1992-12-28 1994-07-07 Stichting Scheikundig Onderzoek In Nederland Method for obtaining transgenic plants showing a modified fructan pattern
WO1995013389A1 (en) * 1993-11-09 1995-05-18 E.I. Du Pont De Nemours And Company Transgenic fructan accumulating crops and methods for their production
WO1996001904A1 (en) * 1994-07-08 1996-01-25 Stichting Scheikundig Onderzoek In Nederland Production of oligosaccharides in transgenic plants

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
NAKAMURA, K., ET AL .: "PROTEIN TARGETING TO THE VACUOLE IN PLANT CELLS", PLANT PHYSIOLOGY, vol. 101, 1993, pages 1 - 5, XP002038306 *
ROCHA-SOSA, M., ET AL .: "BOTH DEVELOPMENTAL AND METABOLIC SIGNALS ACTIVATE THE PROMOTER OF A CLASS I PATATIN GENE", THE EMBO JOURNAL, vol. 8, no. 1, 1989, pages 23 - 29, XP002038303 *
ROSAHL, S., ET AL .: "ISOLATION AND CHARACTERIZATION OF A GENE FROM SOLANUM TUBEROSUM ENCODING PATATIN, THE MAJOR STORAGE PROTEIN OF POTATO TUBERS", MOLECULAR AND GENERAL GENETICS, vol. 203, 1986, pages 214 - 220, XP002038304 *
SONNEWALD, U., ET AL .: "EXPRESSION OF MUTANT PATATIN PROTEIN IN TRANSGENIC TOBACCO PLANTS: ROLE OF GLYCANS AND INTRACELLULAR LOCATION", THE PLANT CELL, vol. 2, 1990, pages 345 - 355, XP002038305 *
SONNEWALD, U., ET AL .: "TRANSGENIC TOBACCO PLANTS EXPRESSING YEAST-DERIVED INVERTASE IN EITHER THE CYTOSOL, VACUOLE OR APOPLAST: A POWERFUL TOOL FOR STUDYING SUCROSE METABOLISM AND SINK/SOURCE INTERACTIONS", THE PLANT JOURNAL, vol. 1, no. 1, 1991, pages 95 - 106, XP002038302 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19749122A1 (de) * 1997-11-06 1999-06-10 Max Planck Gesellschaft Nucleinsäuremoleküle codierend Enzyme, die Fructosyltransferaseaktivität besitzen
US6664444B1 (en) 1998-04-17 2003-12-16 Tiense Suikerraffinaderij N.V. Transgenic plants presenting a modified inulin producing profile
EP0952222A1 (de) * 1998-04-17 1999-10-27 Centrum Voor Plantenveredelings- En Reproduktieonderzoek (Cpro-Dlo) Transgene Pflanzen mit einem modifizierten Inulin produzierendem Profil
WO1999054480A1 (en) * 1998-04-17 1999-10-28 De Stichting 'stichting Dienst Landbouwkundig Onderzoek' Transgenic plants presenting a modified inulin producing profile
DE19840028A1 (de) * 1998-09-02 2000-03-09 Max Planck Gesellschaft Nucleinsäuremoleküle codierend Enzyme, die Fructosyltransferaseaktivität besitzen, und deren Verwendung
US6872555B2 (en) 1998-09-02 2005-03-29 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Nucleic acid molecules encoding enzymes having fructosyltransferase activity, and their use
CZ300084B6 (cs) * 1998-09-02 2009-01-28 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e. V. Molekuly nukleové kyseliny kódující fruktosyltransferázu, vektor, hostitelská bunka, zpusob její prípravy a použití, rostlinná bunka, rostlina, zpusob prípravy rostliny, rozmnožovací materiál, skliditelné cásti rostliny, fruktosyltransferáza, zpusob
US7588922B2 (en) 1998-09-02 2009-09-15 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Nucleic acid molecules encoding enzymes having fructosyltransferase activity, and their use
US7906707B2 (en) 1998-09-02 2011-03-15 Max-Planck-Gesellschaft zur Forderund der Wissenschaften B.V. Nucleic acid molecules encoding enzymes having fructosyltransferase activity, and their use
US7875763B2 (en) 2000-10-30 2011-01-25 E.I. Du Pont De Nemours And Company Fructan biosynthetic enzymes
US8168862B2 (en) 2000-10-30 2012-05-01 E.I. Du Pont De Nemours And Company Fructan biosynthetic enzymes
US8399738B2 (en) 2000-10-30 2013-03-19 E I Du Pont De Nemours And Company Fructan biosynthetic enzymes
WO2002050257A3 (de) * 2000-12-21 2003-01-30 Suedzucker Ag Verfahren zur herstellung von polyfructanen
WO2002050257A2 (de) * 2000-12-21 2002-06-27 Südzucker Aktiengesellschaft Verfahren zur herstellung von polyfructanen
DE10106163B4 (de) * 2000-12-21 2007-03-29 Südzucker AG Mannheim/Ochsenfurt Verfahren zur Herstellung von Kohlenhydraten

Also Published As

Publication number Publication date
AU2774197A (en) 1997-11-26
JP2001517930A (ja) 2001-10-09
DE19617687A1 (de) 1997-11-06
EP0944727A1 (de) 1999-09-29
AU718897B2 (en) 2000-04-20
US6255562B1 (en) 2001-07-03
DE19617687C2 (de) 2000-11-16

Similar Documents

Publication Publication Date Title
WO1997042331A1 (de) Verfahren zur herstellung transgener, inulin erzeugender pflanzen
DE69333833T2 (de) Dna sequenzen, die zur bildung von polyfructanen (levanen) führen, plasmide mit entsprechenden sequenzen, sowie ein verfahren zur herstellung transgener pflanzen
DE4104782B4 (de) Neue Plasmide, enthaltend DNA-Sequenzen, die Veränderungen der Karbohydratkonzentration und Karbohydratzusammensetzung in Pflanzen hervorrufen, sowie Pflanzen und Pflanzenzellen enthaltend dieses Plasmide
DE19749122A1 (de) Nucleinsäuremoleküle codierend Enzyme, die Fructosyltransferaseaktivität besitzen
DE69836267T2 (de) Nukleinsäuren aus der artischocke (cynara scolymus), welche für ein enzym mit fruktosylpolymerase-aktivität kodieren
EP1078088B1 (de) Transgene pflanzen mit veränderter aktivität eines plastidären adp/atp - translokators
DE60037191T2 (de) Genetisch modifizierte pflanzenzellen und pflanzen mit einer erhöhten aktivität eines amylosucrase-proteins und eines verzweigungsenzyms
EP0791066B1 (de) Dna-moleküle codierend enzyme, die an der stärkesynthese beteiligt sind, vektoren, bakterien, transgene pflanzenzellen und pflanzen enthaltend diese moleküle
EP1038014B1 (de) PFLANZLICHE (GntI)-SEQUENZEN UND VERWENDUNG DERSELBEN ZUR GEWINNUNG VON PFLANZEN MIT VERMINDERTER ODER FEHLENDER N-ACETYLGLUCOSAMINYLTRANSFERASE I (GnTI)-AKTIVITÄT
WO2000008175A2 (de) NUKLEINSÄUREMOLEKÜLE KODIEREND FÜR EINE α-GLUKOSIDASE, PFLANZEN, DIE EINE MODIFIZIERTE STÄRKE SYNTHETISIEREN, VERFAHREN ZUR HERSTELLUNG DER PFLANZEN, IHRE VERWENDUNG SOWIE DIE MODIFIZIERTE STÄRKE
WO2000008185A1 (de) Nukleinsäuremoleküle kodierend für beta-amylase, pflanzen, die eine modifizierte stärke synthetisieren, herstellungsverfahren und verwendungen
WO1996027674A1 (de) Modifizierte stärke aus pflanzen, pflanzen, die diese synthetisieren, sowie verfahren zu ihrer herstellung
DE19926771A1 (de) Nukleinsäuremoleküle aus Weizen, transgene Pflanzenzellen und Pflanzen und deren Verwendung für die Herstellung modifizierter Stärke
WO2000008184A1 (de) Pflanzen, die eine modifizierte stärke synthetisieren, verfahren zur herstellung der pflanzen, ihre verwendung sowie die modifizierte stärke
EP1200615A2 (de) Nukleinsäuremoleküle aus pflanzen codierend enzyme, die an der stärkesynthese beteiligt sind
DE69432796T2 (de) Kombination von dna-sequenzen, die die bildung von modifizierter stärke in pflanzenzellen und pflanzen ermöglicht, verfahren zur herstellung dieser pflanzen
DE69738085T2 (de) Modifikation von polysacchariden
EP1108037B1 (de) Nucleinsäuremoleküle codierend enzyme, die fructosyltransferaseaktivität besitzen und deren verwendung
DE4439748A1 (de) Verfahren zur Veränderung des Blühverhaltens bei Pflanzen
WO2001059136A1 (de) Produktion nicht-kariogener zucker in transgenen pflanzen
DE10106163B4 (de) Verfahren zur Herstellung von Kohlenhydraten
EP1640457A1 (de) Verfahren und Mittel zur Herstellung von Hyaluronan
CA2431994A1 (en) Method for the production of polyfructans
WO2004096861A1 (en) Method for modifying the size and/or morphology of starch granules

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1997921819

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09180143

Country of ref document: US

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1997 539497

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1997921819

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1997921819

Country of ref document: EP