Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
  • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
  • C07K16/2827—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/02—Immunomodulators
  • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
  • C07K14/70503—Immunoglobulin superfamily
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
  • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
  • C07K16/2836—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD106
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
  • C07K16/2851—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the lectin superfamily, e.g. CD23, CD72
  • C07K16/2854—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the lectin superfamily, e.g. CD23, CD72 against selectins, e.g. CD62
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides

Definitions

• This invention relates to xenotransplantation, and to the monitoring and modulation of the immune response to the xenotransplant. More specifically, the invention relates to the development of reagents and methods that will improve the ability to rapidly and specifically diagnose rejection of porcine xenotransplants by human patients. The invention also relates to compositions, including nucleic acid molecules, proteins
• porcine cells including antibodies
• porcine tissues including antibodies
• porcine organs that will improve the outcome of the xenotransplantation of porcine cells, tissues, and organs into human recipients.
• the invention provides a porcine P-selectin protein, a porcine VCAM protein, and a porcine CD86 protein, as well as the amino acid sequences of these proteins, the sequences of the cDNAs encoding these proteins, antibodies reactive with these proteins (but not with their human homologues), and methods for the use of these molecules.
• Xenotransplant Rejection There is an ongoing shortage of human organs for transplant. This shortage has resulted in a long felt need for organs, and has resulted in attempts to develop xenotransplantation technology.
• the primary non-primate candidate donor species for clinical xenotransplantation e.g., the transplantation of non-human organs into human recipients
• Swine provide an abundant supply of organs that are similar in size, anatomy, and physiology to their human counterparts (Auchincloss, 1988; Najarian, 1992; and So ervile and d'Apice, 1993) .
• HAR hyperacute rejection
• HAR of discordant (i.e., non-primate) xenotransplants is initiated by preformed "natural" antibodies that bind to donor organ endothelium and activate complement attack by the recipient immune system (Dalmasso et al . , 1992; and Tuso et al. , 1993) .
• C3a, C5a fluid phase
• C3b and C5b-9 membrane bound proteins with chemotactic, procoagulant, proinflammatory, adhesive, and cytolytic properties
• Immunohistological analysis of hyperacutely rejected xenotransplants reveals antibody deposition, complement fixation, and vascular thrombosis as well as neutrophil infiltration (Auchincloss, 1988; Mejia-Laguna et al. , 1972; Najarian, 1992; Somervile and d'Apice, 1993; and Zehr et al .
• HAR is a major impediment to the xenotransplantation of vascularized organs
• some discordantly xenotransplanted tissues e.g., porcine pancreatic islets
• Methods for the control of the HAR are also available. These include interference with the antibody antigen reactions responsible for initiating the HAR response, either by removing the antibodies from the circulation or by interfering with the expression of the antigens (see copending U.S. patent application Serial No. 08/214,580, entitled “Xenotransplantation Therapies” and filed by Mauro ⁇ . Sandrin and Ian F.C. McKenzie on March 15, 1994) .
• Inhibition of complement attack on the xenotransplant may be accomplished by several means, including the use of complement inhibitors such as the 18kDa C5b-9 inhibitory protein and monoclonal antibodies against human C5b-9 proteins as taught in U.S. Patent No. 5,135,916, issued August 4, 1992.
• porcine xenograft rejection phenomenon studies have been undertaken to investigate interactions between human white blood cells and porcine cells, particularly porcine aortic endothelial cells (PAEC) .
• PAEC porcine aortic endothelial cells
• the role of neutrophils in the actual destruction of xenografts has not been well characterized, and the precise mechanism of complement independent neutrophil activation and adherence to xenograft endothelium are beginning to be understood.
• Previous studies have shown that human complement component C3b (C3bi) deposited on PAEC mediates the binding of human neutrophils to the PAEC through interactions with the heterodimeric neutrophil cell surface receptor CDllb/CD18 (Vercellotti et al. , 1991) .
• Cell interaction molecules Numerous cell surface molecules serve to mediated cell-cell interactions such as cell adhesion and cell activation. These molecules include cell adhesion molecules such as P-selectin and VCAM, as well as "costimulatory” molecules, such as CD86 (B7-2) that are involved in the activation of certain cells of the immune system, e.g., T cells.
• cell adhesion molecules such as P-selectin and VCAM
• costimulatory molecules such as CD86 (B7-2) that are involved in the activation of certain cells of the immune system, e.g., T cells.
• P-selectin (also known as CD62P, platelet activation-dependent granule external membrane protein - PADGEM, and granule membrane protein of molecular weight 140kDa - GMP- 140) is a cytokine inducible cell adhesion molecule that is a glycoprotein found on alpha-granules of platelets and storage granules of endothelial cells, known as Weibel-Palade bodies (Bevilacqua and Nelson, 1993; Bonfanti et al. , 1989; Collins et al. , 1993) from whence it is released to the cell surface upon cell activation.
• P-selectin belongs to a family of adhesion molecules termed "selectins” that also includes E-selectin and L- selectin (see reviews in Lasky, 1992 and Bevilacqua and Nelson, 1993) . These molecules are characterized by common structural features such as an amino-terminal lectin-like domain, an epidermal growth factor (EGF) domain, a discrete number of complement repeat modules (approximately 60 amino acids each) similar to those found in certain complement binding proteins, a transmembrane domain, and a cytoplasmic tail (Dunlop et al . , 1992) .
• EGF epidermal growth factor
• P-selectin mediates the adhesion of various leukocytes (including neutrophils, monocytes, eosinophils, natural killer cells, and a subset of T cells) to activated platelets bound in the region of tissue injury, and to activated endothelium (Bevilacqua, et al. , 1989; Carlos, et al . , 1991; Graber, et al . , 1990; Hakkert, et al . , 1991; and Picker, et al. , 1991; Shimuzu, et al . , 1991) .
• leukocytes including neutrophils, monocytes, eosinophils, natural killer cells, and a subset of T cells
• P-selectin is induced on human platelets and endothelial cells in response to thrombin generation, histamine generation, and the cytokines IL-1 and TNFa through transcriptional upregulation similar to that of E-selectin (Bevilacqua and Nelson, 1993; Carlos and Harlan, 1994) .
• Phorbol esters, calcium ionophores, and complement proteins also activate P-selectin expression on endothelial cells (Collins et al. , 1993; Hattori et al . , 1989; Ishiwata et al . , 1994) .
• P-selectin ligands contain sialic acid (sialyl Lewis x, or SLe x ) or other fucose-containing carbohydrate structures as a component mediating interaction with the P-selectin protein.
• sialic acid sialyl Lewis x, or SLe x
• SLe x containing molecules seem to be higher affinity ligands, the number of these ligands and their precise specificity remains uncertain (Bevilacqua and Nelson, 1993; Carlos and Harlan, 1994) .
• leukocyte-mediated inflammatory reactions associated with increased P-selectin expression on endothelium include delayed type hypersensitivity, immune complex-mediated lung injury, ischemic reperfusion injury, psoriasis, contact dermatitis, and arthritis, in addition to microcirculatory disorders such as thrombotic thrombocytopenic purpura (TTP) and hemolytic uremic syndrome (HUS) (Bevilacqua and Nelson, 1993; Carlos and Harlan, 1994; Ishiwata et al. , 1994; Kataya a et al. , 1993; Mulligan et al. , 1992).
• TTP thrombotic thrombocytopenic purpura
• HUS hemolytic uremic syndrome
• P-selectin has been characterized as an adhesion molecule to mediate leukocyte "rolling" on the vessel wall where neutrophils emigrate from circulation to sites of injured tissue or graft tissue (Hattori et al., 1989) .
• increased C5b-9 complement protein stimulates platelets to secrete adhesion proteins for deposition of platelets at sites of inflammation (Collins et al. , 1993; Hattori et al. , 1989).
• membrane deposition of C5b-9 proteins causes the release of very high molecular weight von Willebrand Factor multimers, which are accompanied by endothelial surface expression of an intracellular granule membrane protein, P-selectin.
• platelet activation regulates human responses to recognition of foreign tissue such that cytokine-induced expression of P-selectin by donor organ endothelium contributes to the binding and subsequent transmigration of inflammatory cells into the graft tissue and thereby plays an important role in acute cellular allograft rejection.
• soluble P-selectin In normal humans, soluble P-selectin (sP-selectin) is known to exist in plasma at a concentration level of from 0.10 to 0.30 mg/ml (Carlos and Harlan, 1994; Dunlop et al. , 1992; Ishiwata et al., 1994) .
• the demonstration of sP-selectin in the blood would therefore be taken as evidence of either endothelial activation or platelet activation in diseases such as thrombotic and inflammatory diseases (Gearing and Newman, 1993; Dunlop et al. , 1992). Gearing and Newman, 1993, review the levels of sP- selectin found in healthy and sick patients in various previous studies.
• sP-selectin Elevated levels of sP-selectin have been found in patients with thrombotic thrombocytopenic purpura by a three-fold increase and hemolytic uremic syndrome by a two-fold increase (Gearing and Newman, 1993; Ushiyama et al. , 1993) . Similarly, sP-selectin was detected in patients with circulatory disorders and adult respiratory distress syndrome (ARDS) with an increase of about 1 mg/ml .
• ARDS adult respiratory distress syndrome
• VCAM and CD86 are also cell adhesion molecules that are involved in the aggregation of various leukocytes at sites of inflammation. These molecules are also important mediators of inflammation, and are believed to be involved in xenograft rejection, albeit not necessarily in hyperacute xenograft rejection.
• VCAM Vascular cell adhesion molecule (VCAM) is an inducible transmembrane glycoprotein member of the immunoglobulin gene superfamiiy, expressed predominantly on endothelial cells (9-11) .
• VLA-4, a4bl very late antigen-4
• bl integrin molecule found on all leukocytes except neutrophils (12) .
• VCAM expression is low or absent on resting endothelial cells in culture but can be induced by cytokines such as TNFa or I -1 (9, 13-15) .
• cytokines such as TNFa or I -1 (9, 13-15) .
• VCAM expression promotes a4 integrin-bearing leukocyte adhesion primarily to inflamed vascular endothelial cells (9, 15) .
• VCAM participates with intercellular adhesion molecule (ICAM) and endothelial-leukocyte adhesion molecule (ELAM) in the cellular recruitment, migration, and localization of inflammatory lymphocytes, monocytes, eosinophils and basophils to sites of tissue inflammation (8, 12, 14, 16) .
• IAM intercellular adhesion molecule
• ELAM endothelial-leukocyte adhesion molecule
• VLA-4/VCAM interactions during the immune response to organ transfer has been shown by experiments in which treatment of experimental animals with mAbs to VCAM has delayed murine cardiac allograft rejection (20, 23) .
• Anti-VLA-4 and anti- VCAM mAbs also have been shown to block migration of lymphocytes, monocytes and eosinophils into tissue, and to exhibit anti ⁇ inflammatory effects in animal models of experimental allergic encephalomyelitis (19-24) .
• the invention provides:
• Porcine P-selectin, VCAM, and CD86 genes in the form of, for example, cDNA and genomic DNA molecules comprising porcine coding sequences .
• a method for producing porcine P-selectin, VCAM, and CD86 by growing a recombinant host cell containing the gene of the invention (i.e. , a nucleic acid molecule coding for porcine P- selectin, VCAM, and/or CD86) .
• the host cell is grown so that it expresses the porcine protein encoded by the gene of the invention and the expressed porcine protein is then isolated.
• These agents contain the porcine proteins of paragraph 1, immediately above, and/or the anti-poreine antibodies of paragraph 4, immediately above.
• Recombinant (chimeric and/or humanized) antibody molecules comprising the Cl and hinge regions of human IgG2 and the C2 and C3 regions of human IgG4 , such antibodies being referred to hereinafter as "HuG2/G4 mAb”.
• FIGURE 1 Adhesion of Ramos cells to TNFa-activated PAEC or COS-7 cells expressing pVCAM. Labeled Ramos cells were incubated for 30 min at 37°C with PAEC monolayers treated with 25 ng/ml recombinant human TNFa or with COS-7 monolayers transfected with APEX-1 (mock transfected) or pAPEX-1/pVCAM 72 h previously (no mAb) . Specific adhesion of Ramos was analyzed by measuring dye release of SDS cell lysates in a fluoremeter. Binding is expressed as the average Fluorescence units from three replicate wells with bars representing the standard error of the mean.
• FIGURE 2 spVCAM-His ⁇ fusion gene and protein.
• A Schematic of the putative structures of the full length pVCAM and truncated pVCAM. Six histidine residues and a stop codon and were inserted at the putative domain 7/transmembrane boundary.
• B Purification of spVCAM. spVCAM-His ⁇ protein was purified by adsorption and elution from Ni ++ charged NTA resin as described in Materials and Methods, separated by SDS-PAGE under nonreducing conditions and stained with Coomassie Blue. The electrophoretic mobility of molecular mass standards is shown in kDa. Apparent differences in kDa are consistent with differential glycosylation of pVCAM- derived fragments, since potential N-glycosylation sites occur in domains 1, 2 and 3 (one site in each) and domain 6 (two sites) of pVCAM.
• FIGURE 3 Adhesion of calcein-labeled Ramos cells to immobilized spVCAM. spVCAM was immobilized to plastic and assessed for the ability to support Ramos cell adhesion.
• A Concentration dependence of binding of Ramos cells to immobilized spVCAM. Adhesion of Ramos cells to the indicated concentrations of spVCAM is shown. spVCAM was immobilized to microtiter wells and 3 x 10 ⁇ labeled Ramos cells in 0.1 ml RPMI/1640 medium containing 10% FBS were added to each well. Binding was quantitated after 30 min at 37°C. Background binding of Ramos cells to a negative control protein (BSA) was subtracted from the data.
• BSA negative control protein
• FIGURE 4 Binding of Ramos cells to spVCAM in the continuous presence of mAbs to pVCAM.
• the indicated concentrations of anti- pVCAM mAb were added to microtiter wells precoated with spVCAM
• FIGURE 5 Cell surface expression of VCAM on TNFa-activated HUVECs and PAEC.
• Cells were stained with anti-hVCAM (51-10C9) or anti pVCAM mAbs (2A2, 3F4, 5D11) followed by FITC goat-anti-mouse immunoglobulin and analyzed for VCAM expression by immunofluorecence and flow cytometry using a FACScan (Becton Dickinson Immunocytometry Systems) . Data are displayed as histograms. The x-axis represents fluorescence and the y-axis represents the relative cell number. Background staining by secondary FITC-labeled antibody (SECONDARY) is indicated.
• SECONDARY secondary FITC-labeled antibody
• FIGURE 6 Epitope mapping of 2A2 , 3F4 and 5D11 mAbs.
• Each anti- pVCAM mAb was assayed for the ability to bind to spVCAM captured on microtiter plates coated with either 2A2 or 3F4 F(ab')2 fragments. Detection of bound mAb was performed using peroxidase- conjugated goat anti-mouse IgG Fc. The background absorbance obtained in the absence of anti-pVCAM mAb was subtracted from all values. Results shown are the average of duplicate determinations.
• FIGURE 7 Monoclonal antibody inhibition of Ramos and human peripheral T cell adhesion to TNFa-stimulated PAEC. Labeled Ramos or T cells were added to TNFa-stimulated PAEC monolayers in the presence or absence of the indicated mAb. Cell binding was quantitated in a 30 min adhesion assay. Each value is a mean of triplicate wells with bars representing the standard error of the mean. Representative data are shown from three experiments using different blood donors. Each antibody was added at a final concentration of 10 ug/ml at the initiation of the assay.
• FIGURE 8 Inhibition of Ramos cell binding to porcine aortic endothelial cells (PAEC) .
• Cell adhesion assays were performed as described except the paec were stimulated with 1 ⁇ g/ml LPS for 16 hours prior to the assay.
• the binding reactions contained the indicated concentrations of either (A) 2A2 mAb, 2A2 F(ab')2- or 2A2 Fab, or (B) 3F4 mAb, 3F4 F(ab')2» or 3F4 Fab. Binding in the presence of inhibitor is defined as percent of binding found in the absence of inhibitor.
• FIGURE 9 Sequences of the murine 2A2 and 3F4 variable regions.
• FIGURE 10 Flow cytometry analysis of chimeric antibodies.
• Murine antibodies 2A2 and 3F4 or purified chimeric antibodies (ch2A2 HuG4 and ch3F4 HuG4) were assayed for binding to 293-EBNA cells (293) or 293-EBNA cells expressing pVCAM (293/pVCAM) . Cells were incubated with either no primary antibody (2°) or 10 ⁇ g/ml of the murine or chimeric antibodies. Bound antibody was detected using either FITC-conjugated goat anti-mouse IgG antibody or FITC-conjugated goat anti-human IgG antibody.
• FIGURE 11 Inhibition of Ramos binding to PAEC. Binding experiments containing the indicated concentrations of antibody were performed as described in Figure 1. Results demonstrate the recombinant the 2A2 HuG4 and ch3F4 HuG4 inhibit binding as potently as the murine 3F4 mAb. Neither a humanized antibody directed against human C5 (h5Gl.l C012 HuG4 mAb) nor a murine antibody specific for human VCAM (anti-hVCAM) blocked binding of Ramos to PAEC.
• FIGURE 12 Inhibition of Jurkat binding to PAEC. Binding experiments containing the indicated concentrations of antibody were performed as described in Figure 1 using calcein labeled Jurkat cells. Results demonstrate the recombinant the ch2A2 HuG4 and ch3F4 HuG4 inhibit binding as potently as the murine 3F4 mAb.
• FIGURE 13 Inhibition of T-cell binding to PAEC. Binding experiments containing the indicated concentrations of inhibitor were performed as described in Figure 1 using calcein labeled purified human T-cells. Results demonstrate the recombinant the 2A2 HuG4 and ch3F4 HuG4 inhibit binding as potently as the murine 3F4 mAb.
• FIGURE 14 Inhibition of U937 binding to PAEC. Binding experiments containing the indicated concentrations of antibody were performed as described in Figure 1 using calcein labeled
• PAEC through interaction of the U937 cell FcRI receptor with the bound ch3F4 HuG4 mAb.
• chimeric antibodies containing the Cl and hinge region of human IgG2 and the C2 and C3 regions of human IgG4 were constructed (HuG2/G4 mAb) .
• Flow cytometry demonstrated the resulting antibody does not bind to U937 cells.
• the ch3F4 HuG2/G4 mAb inhibited U937 binding to PAEC as potent as the ch3F4 HuG4 F(ab')2*
• FIGURE 15 Flow cytometry of HuG4 mAb and HuG2/G4 mAb binding to U937 cells.
• U937 cells were incubated with 10 ⁇ g/ml ch3F4 HuG4 mAb, ch3F4 HuG2/G4 mAb, ch2A2 HuG4 mAb, ch2A2 HuG2/G4 mAb, h5Gl .1 C012 HuG4 mAb, h5Gl.1 C012 HuG2/G4 mAb, or buffer.
• Bound antibody was detected using FITC-labeled goat anti-human IgG. Results demonstrate that the HuG4 mAb bound to U937 cells whereas the HuG2/G4 mAb did not.
• FIGURE 16 Assays of human neutrophil binding to PAEC.
• FIGURE 17 Amino acid sequence of porcine P-selectin.
• FIGURE 18 Soluble porcine P-selectin cell ELISAs.
• FIGURE 19 FACS profiles of COS expression of porcine P- selectin.
• FIGURE 20 Neutrophil binding to porcine P-selectin.
• FIGURE 21 FACS analysis of porcine P-selectin expression by PAEC. DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
• the isolated nucleic acid molecules of the invention comprise sequences that are unique to the porcine genome.
• unique to the porcine genome refers to sequences found in porcine-derived nucleic acid molecules that do not appear in published form as of the filing date of this application, e.g., they are not found in the cDNAs encoding the VCAM, P-selectin, or CD86 proteins of humans, cows, mice, or dogs.
• the isolated nucleic acid molecules of the invention comprise sense sequences of contiguous nucleotides of the porcine sequences disclosed herein, for example in the figures. These sense sequences are unique to the porcine genome, and can be used as PCR primers or hybridization probes for the identification and/or isolation of the homologous porcine genes from genomic DNA. Antisense sequences of contiguous nucleotides complementary to such sense sequences are also required in order to practice PCR, and may also be used as hybridization probes. In order to be used for such purposes, the sequences of contiguous nucleotides must span a sufficient length.
• oligonucleotide length required for specific hybridization i.e., hybridization under conditions requiring an essentially perfect match of complementary nucleotides wherein the sequence of the probe can be expected to occur only once in the genome of the organism being probed
• this span is at least 14 nucleotides, and, preferably, at least 18 nucleotides. Because at least 2 PCR primers are generally required to carry out a PCR reaction, the specificity of the PCR reaction is greater than that of each of the oligonucleotide primers used to drive the reaction.
• Another isolated nucleic acid molecule of the invention is a cloned porcine genomic DNA molecule comprising a sequence of nucleotides unique to the porcine genome.
• This cloned molecule is characterized by hybridizing specifically to an isolated nucleic acid molecule as described in the preceding paragraph. Specific hybridization is used to clone this genomic DNA molecule.
• This cloning can be accomplished by several methods well known in the art such as by PCR using porcine genomic DNA templates, or by conventional screening of phage libraries of porcine genomic DNA, e.g. , by plaque lift filter hybridization.
• Certain of the isolated nucleic acid molecules of the invention are also useful as means to direct and/or modulate the expression of porcine cell interaction molecules in porcine cells, e.g., by altering the expression of any of the porcine P- selectin, VCAM, or CD86 genes. Such modulation may be accomplished by several means well known in the art. Modulation, specifically inhibition, of the expression of any particular gene may be accomplished by the use of antisense nucleic acid molecules or DNA constructions specially engineered to allow gene inactivation as described below for antisense RNAs, antisense oligonucleotides, and gene knockout constructions.
• the antisense nucleic acid molecules or DNA constructions will comprise nucleic acid sequences of the VCAM nucleic acid molecules of the invention.
• Antisense RNAs can be used to specifically inhibit gene expression (see, for example, Eguchi, et al., 1991) .
• Such nucleic acid molecules can be expressed by recombinant transcription units engineered for expression in porcine cells. Such transcription units can be introduced as transgenes into porcine cells, and, when introduced into porcine embryos or embryonic stem cells can be used to generate transgenic pigs.
• Antisense nucleic acid molecules in the form of oligonucleotides can also be used to specifically inhibit gene expression, as described, for example, in Cohen, 1989.
• antisense oligonucleotides can be designed and used to inhibit expression of specific genes (Cohen, 1989, pp. 1- 6, 53-77) .
• Such antisense oligonucleotides can be in the form of oligonucleotide analogs, for example, phosphorothioate analogs (Cohen, 1989, pp. 97-117), non-ionic analogs (Cohen, 1989, pp.
• oligonucleotides that can be used to inhibit gene expression include oligonucleotides covalently linked to intercalating agents or to nucleic acid-cleaving agents (Cohen, 1989, pp. 137-172), and oligonucleotides linked to reactive groups (Cohen, 1989, pp. 173-196). Oligonucleotides and derivatives designed to recognize double-helical DNA by triple- helix formation (Cohen, 1989, pp. 197-210) may also be used to specifically inhibit gene expression.
• oligonucleotides and derivatives described above are used by adding them to the fluids bathing the cells in which specific inhibition of gene expression in accordance with the present invention is desired.
• Gene knockout is a method of genetic manipulation via homologous recombination that has long been carried out in microorganisms, but has only been practiced in mammalian cells within the past decade. These techniques allow for the use of specially designed DNA molecules (gene knockout constructions) to achieve targeted inactivation (knockout) of a particular gene upon introduction of the construction into a cell.
• the practice of mammalian gene knockout, including the design of gene knockout constructions and the detection and selection of successfully altered mammalian cells, is discussed in numerous publications, including Thomas, et al., 1986; Thomas, et al.
• Gene knockouts and gene replacements can be achieved in mammalian zygotes through microinjection techniques well known in the art (Brinster, et al. , 1989) .
• the introduction of the DNA constructions used to effect gene knockouts into cultured cells is a more common route to the production of knockout cells, tissues, and organs.
• cultured embryonic stem cells provide a means to introduce the DNA constructions into cells in culture and to generate transgenic animals derived from such engineered cells. Such animals can also be obtained from knockout transgenic zygotes obtained by microinjection as described above.
• the nucleic acid molecules of the present invention are used to generate engineered transgenic animals using techniques known in the art. These techniques include, but are not limited to, microinjection, e.g., of nuclei or pronuclei, electroporation of ova or zygotes, nuclear transplantation, and/or the stable transfection or transduction of embryonic stem cells.
• transgenic animals The most well known method for making transgenic animals is that used to produce transgenic mice by superovulation of a donor female, surgical removal of the egg, injection of the transgene transcription unit into the pronuclei of the embryo, and introduction of the transgenic embryo into the reproductive tract of a pseudopregnant host mother, usually of the same species. See Brinster, et al. , 1985, Hogan, et al . , 1986, Robertson 1987, Pedersen, et al . , 1990. The use of this method to make transgenic livestock is also widely practiced by those of skill in the art. As an example, transgenic swine are routinely produced by the microinjection of nucleic acid molecules into pig embryos.
• this procedure may, for example, be performed as follows. First, the nucleic acid molecules are gel isolated and extensively purified, for example, through an ELUTIP column (Schleicher & Schuell, Keene, NH) , dialyzed against pyrogen free injection buffer (lOmM Tris, pH7.4 + O.lmM EDTA in pyrogen free water), and used for embryo injection.
• Embryos are recovered from the oviduct of a hormonally synchronized, ovulation induced sow, preferably at the pronuclear stage. They are placed into a 1.5 ml microfuge tube containing approximately 0.5 ml of embryo transfer media (phosphate buffered saline with 10% fetal calf serum) . These are centrifuged for 12 minutes at 16,000 x g in a microcentrifuge. Embryos are removed from the microfuge tube with a drawn and polished Pasteur pipette and placed into a 35 mm petri dish for examination. If the cytoplasm is still opaque with lipid such that the pronuclei are not clearly visible, the embryos are centrifuged again for an additional 15 minutes.
• embryo transfer media phosphate buffered saline with 10% fetal calf serum
• Embryos to be microinjected are placed into a drop of media (approximately 100 ⁇ l) in the center of the lid of a 100 mm petri dish. Silicone oil is used to cover this drop and to fill the lid to prevent the medium from evaporating.
• the petri dish lid containing the embryos is set onto an inverted microscope equipped with both a heated stage (37.5-38"C) and Hoffman modulation contrast optics (200X final magnification) .
• a finely drawn and polished micropipette is used to stabilize the embryos while about 1-2 picoliters of injection buffer containing approximately 200-500 copies of the purified transgene transcription unit is delivered into the nucleus, preferably the male pronucleus, with another finely drawn and polished micropipette.
• Embryos surviving the microinjection process as judged by morphological observation are loaded into a polypropylene tube (2 mm ID) for transfer into the recipient pseudopregnant sow.
• Offspring are tested for the presence of the transgene by isolating genomic DNA, e.g., from tissue removed from the tail of each piglet, and subjecting about 5 micrograms of this genomic DNA to nucleic acid hybridization analysis with a transgene specific probe.
• Another commonly used technique for generating transgenic animals involves the genetic manipulation of embryonic stem cells (ES cells) as described in PCT Patent Publication No. WO 93/02188 and Robertson, 1987. In accordance with this technique, ES cells are grown as described in, for example, Robertson, 1987, and in U.S.
• Patent No. 5,166,065 to Williams et al Genetic material is introduced into the embryonic stem cells by, for example, electroporation according, for example, to the method of McMahon, et al. , 1990, or by transduction with a retroviral vector according, for example, to the method of Robertson, et al. , 1986, or by any of the various techniques described by Lovell-Badge, 1987.
• Chimeric animals are generated as described, for example, in Bradley, 1987. Briefly, genetically modified ES cells are introduced into blastocysts and the modified blastocysts are then implanted in pseudo-pregnant female animals. Chimeras are selected from the offspring, for example by the observation of mosaic coat coloration resulting from differences in the strain used to prepare the ES cells and the strain used to prepare the blastocysts, and are bred to produce non-chimeric transgenic animals .
• transgenic pigs prepared in accordance with the invention are useful as model systems for testing the xenotransplantation of their engineered cells, tissues, or organs and as sources of engineered cells, tissues, or organs for xenotransplantation.
• the lack of expression of porcine porcine cell interaction proteins on the endothelial cells of the transgenic pigs will provide enhanced protection from rejection following xenotransplantation of those cells, or of tissues and organs containing those cells, into recipient animals, e.g., humans.
• the nucleic acid molecules of the invention can also be used to directly engineer cultured porcine endothelial cells for subsequent use in transplantation.
• the nucleic acid molecules of the invention can also be used to express porcine cell interaction proteins for subsequent purification and use.
• Recombinant DNA methods for the production of recombinant proteins are well known in the art, as are methods for the purification of such proteins (see, for example, Ausubel, et al., 1992; Goeddel, 1990; Harris and Angal, 1989; and Deutscher, 1990) .
• Preferred uses of such proteins include the use of porcine cell interaction proteins as immunogens for the purpose of raising anti porcine cell interaction protein antibodies, or as an antigen for use in immunoassays to detect soluble porcine cell interaction proteins as markers of inflammation in primate recipients of porcine xenografts. See, for example, below under "ELISA screen for anti-porcine VCAM antibodies”.
• the present invention provides recombinant expression vectors which include synthetic or cDNA-derived DNA fragments encoding porcine cell interaction proteins.
• the nucleotide sequences coding for porcine cell interaction proteins can be inserted into an appropriate expression vector, i.e., a vector that contains the necessary elements for the transcription and translation of the inserted protein-coding sequence.
• the necessary transcriptional and translational signals can also be supplied by the native gene and/or its flanking regions.
• a variety of host vector systems may be utilized to express the protein-coding sequence.
• mammalian cell systems infected with virus e.g., vaccinia virus, adenovirus, retroviruses, etc.
• mammalian cell systems transfected with plasmids e.g., vaccinia virus, adenovirus, retroviruses, etc.
• mammalian cell systems transfected with plasmids e.g., vaccinia virus, adenovirus, retroviruses, etc.
• insect cell systems infected with virus e.g., baculovirus
• microorganisms such as yeast containing yeast expression vectors, or bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA (see, for example, Goeddel, 1990) .
• Useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well-known cloning vector pBR322 (American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852, United States of America; ATCC Accession No. 37017) . These pBR322 "backbone sections," or functionally equivalent sequences, are combined with an appropriate promoter and the structural gene to be expressed. Promoters commonly used in recombinant microbial expression vectors include, but are not limited to, the lactose promoter system (Chang, et al .
• bacterial expression vectors include, but are not limited to, vector pSE420 (Invitrogen Corporation, San Diego, California) . This vector harbors the trc promoter, the lacO operon, an anti-terminator sequence, the glO ribosome binding sequence, a translation terminator sequence, the laclq repressor, the ColEl origin of replication, and the ampicillin resistance gene.
• Recombinant porcine cell interaction proteins may also be expressed in fungal hosts, preferably yeast of the Saccharomyces genus such as S. cerevisiae. Fungi of other genera such as Aspergillus. Pichia or Kluweromvces may also be employed.
• Fungal vectors will generally contain an origin of replication from the 2 ⁇ m yeast plasmid or another autonomously replicating sequence (ARS) , a promoter, DNA encoding a porcine cell interaction molecule, sequences directing polyadenylation and transcription termination, and a selectable marker gene.
• fungal vectors will include an origin of replication and selectable markers permitting transformation of both E. coli and fungi.
• Suitable promoter systems in fungi include the promoters for metallothionein, 3-phosphoglycerate kinase, or other glycolytic enzymes such as enolase, hexokinase, pyruvate kinase, glucokinase, the glucose-repressible alcohol dehydrogenase promoter (ADH2) , the constitutive promoter from the alcohol dehydrogenase gene, ADH1, and others. See, for example, Schena, et al. 1991.
• Secretion signals such as those directing the secretion of yeast a-factor or yeast invertase, can be incorporated into the fungal vector to promote secretion of a soluble porcine cell interaction proteins into the fungal growth medium.
• Preferred fungal expression vectors can be assembled using DNA sequences from pBR322 for selection and replication in bacteria, and fungal DNA sequences, including the ADH1 promoter and the alcohol dehydrogenase ADH1 termination sequence, as found in vector pAAH5 (Ammerer, 1983).
• the ADH1 promoter is effective in yeast in that ADH1 mRNA is estimated to be 1 - 2% of total poly(A) RNA.
• Suitable mammalian or insect cell culture systems can be employed to express recombinant porcine cell interaction proteins.
• Suitable baculovirus systems for production of heterologous proteins in insect cells are reviewed by Luckow, et al., 1988.
• suitable mammalian host cell lines include the COS cell of monkey kidney origin, mouse L cells, murine C127 mammary epithelial cells, mouse Balb/3T3 cells, Chinese hamster ovary cells (CHO) , human 293 EBNA and HeLa cells, myeloma, and baby hamster kidney (BHK) cells.
• Mammalian expression vectors may comprise non-transcribed elements such as origin of replication, a suitable promoter and enhancer linked to the porcine cell interaction protein gene to be expressed, and other 5' or 3 ' flanking sequences such as ribosome binding sites, a polyadenylation sequence, splice donor and acceptor sites, and transcriptional termination sequences.
• the transcriptional and translational control sequences in mammalian expression vector systems to be used in transforming vertebrate cells may be provided by viral sources.
• promoters and enhancers are derived from Polyoma virus, Adenovirus, Simian Virus 40 (SV40), and human cytomegalovirus, including the cytomegalovirus immediate-early gene 1 promoter and enhancer (CMV) .
• SV40 Simian Virus 40
• CMV cytomegalovirus immediate-early gene 1 promoter and enhancer
• Particularly preferred eukaryotic vectors for the expression of porcine cell interaction proteins are pAPEX-1 and pAPEX-3, as described below.
• a particularly preferred host cell for the expression of inserts in the pAPEX-3 vector is the human 293 EBNA cell line (Invitrogen, San Diego, CA) .
• the pcDNAI/Amp expression vector contains the human cytomegalovirus immediate-early gene I promoter and enhancer elements, the Simian Virus 40 (SV40) consensus intron donor and acceptor splice sequences, and the SV40 consensus polyadenylation signal.
• This vector also contains an SV40 origin of replication that allows for episomal amplification in cells (e.g., COS cells, M0P8 cells, etc.) transformed with SV40 large T antigen, and an ampicillin resistance gene for propagation and selection in bacterial hosts.
• Purified porcine cell interaction proteins are prepared by culturing suitable host/vector systems to express the recombinant translation products of the nucleic acid molecules of the present invention, which are then purified from the culture media or cell extracts of the host system, e.g., the bacteria, insect cells, fungal, or mammalian cells. Fermentation of fungi or mammalian cells that express soluble porcine cell interaction proteins containing a histidine tag sequence (comprising a string of at least 5 histidine residues in a row) as a secreted product greatly simplifies purification. Such a histidine tag sequence enables binding under specific conditions to metals such as nickel, and thereby to nickel columns for purification.
• a histidine tag sequence enables binding under specific conditions to metals such as nickel, and thereby to nickel columns for purification.
• the purification of recombinant porcine cell interaction proteins is performed using a suitable set of concentration, fractionation, and chromatography steps well known in the art (see, for example, Deutscher, 1990; and Harris and Angal, 1989) .
• concentration, fractionation, and chromatography steps well known in the art (see, for example, Deutscher, 1990; and Harris and Angal, 1989) .
• denaturation of the purified protein followed by chemical-mediated refolding under reducing conditions can be done to promote proper disulfide interactions.
• Porcine cell interaction proteins purified from bodily fluids of transgenic animals engineered to produce the porcine cell interaction proteins of the invention are also within the scope of the invention, as are porcine cell interaction proteins that are produced in part or entirely by chemical synthesis.
• Porcine cell interaction proteins synthesized in recombinant culture and subsequently purified may be characterized by the presence of contaminating components. These components may include proteins or other molecules in amounts and of a character which depend on the production and purification processes. These components will ordinarily be of viral, prokaryotic, eukaryotic, or synthetic origin, and preferably are present in innocuous contaminant quantities, on the order of less than about 1% by weight. Recombinant cell culture, however, enables the production of porcine cell interaction proteins relatively free of other proteins that may normally be associated with the proteins as found in nature.
• certain aspects of the present invention relates to the use of anti porcine cell interaction protein antibodies or soluble cell interaction proteins (collectively referred to hereinafter as "therapeutic porcine cell interaction agents") in treating patients suffering from xenotransplant rejection.
• the therapeutic porcine cell interaction agents are used in an amount effective to achieve blood concentrations equivalent to in vitro concentrations that substantially reduce (e.g., reduce by at least about 50%) the binding of human test cells expressing the human cell interaction protein binding ligand, such as PBLs, neutrophils, and HL-60 cells, to cells expressing porcine cell interaction proteins, such as TNFa treated porcine endothelial cells.
• Reduction of the binding of human test cells to cells expressing porcine cell interaction proteins can be measured by methods well known in the art such as, for example, by the assay described below under the heading "assays for neutrophil / HL-60 binding to PAEC”.
• the therapeutic porcine cell interaction agents can be administered in a variety of unit dosage forms.
• the dose will vary according to the particular agent.
• different antibodies may have different masses and/or affinities, and thus require different dosage levels.
• Antibodies prepared as Fab' or F(ab'>2 fragments will also require differing dosages than the equivalent intact immunoglobulins, as they are of considerably smaller mass than intact immunoglobulins, and thus require lower dosages to reach the same molar levels in the patient's blood.
• Dosage levels of the therapeutic porcine cell interaction agents for human subjects are generally between about 1 mg per kg and about 100 mg per kg per patient per treatment, and preferably between about 5 mg per kg and about 50 mg per kg per patient per treatment.
• the therapeutic porcine cell interaction agent concentrations are preferably in the range from about 25 ⁇ g/ml to about 500 ⁇ g/ml. See, also, Kung et al . , 1993.
• a typical therapeutic treatment includes a series of doses, which will usually be administered concurrently with the monitoring of clinical endpoints such as xenotransplant biopsies, or measures of organ function, such as, for example, for xenotransplanted kidneys, BUN levels, proteinuria levels, etc., with the dosage levels adjusted as needed to achieve the desired clinical outcome.
• clinical endpoints such as xenotransplant biopsies, or measures of organ function, such as, for example, for xenotransplanted kidneys, BUN levels, proteinuria levels, etc.
• the therapeutic porcine cell interaction agents of the present invention can be used in therapeutic compositions to treat episodes of xenograft rejection. Such treatment will result in the reduction of the severity of the rejection episode.
• purified therapeutic porcine cell interaction agents can be administered to a patient, e.g., a human, in a variety of ways.
• therapeutic porcine cell interaction agents can be given by bolus injection, continuous infusion, sustained release from implants, or other suitable techniques.
• Formulations suitable for injection are found in Remington' s Pharmaceutical Sciences. Mack Publishing Company, Philadelphia, PA, 17th ed. (1985) . Such formulations must be sterile and non- pyrogenic, and generally will include purified therapeutic porcine cell interaction agents in conjunction with a pharmaceutically effective carrier, such as saline, buffered (e.g., phosphate buffered) saline, Hank's solution. Ringer's solution, dextrose/saline, glucose solutions, and the like.
• the formulations may contain pharmaceutically acceptable auxiliary substances as required, such as, tonicity adjusting agents, wetting agents, bactericidal agents, preservatives, stabilizers, and the like.
• the therapeutic porcine cell interaction agent is formulated as a lyophilizate using appropriate excipient solutions (e.g., sucrose, albumin) as diluents.
• excipient solutions e.g., sucrose, albumin
• the amount and frequency of administration will depend, of course, on such factors as the nature and severity of the rejection episode being treated, the desired response, the condition of the patient, and so forth.
• the formulations of the invention can be distributed as articles of manufacture comprising packaging material and the therapeutic porcine cell interaction agents.
• the packaging material will include a label which indicates that the formulation is for use in the treatment of porcine xenotransplant rejection.
• Hybridomas producing the monoclonal antibodies of the invention i.e., monoclonal antibodies reactive with porcine cell interaction proteins, but not with human cell interaction proteins, can be obtained using purified porcine cell interaction proteins as immunogens followed by screening. Such screening is carried out to identify hybridomas producing antibodies with the desired properties, and can be carried out using appropriate immunoassays. Examples of appropriate immunoassays are the ELISA described below and in copending U.S. patent application serial No.
• the present invention also includes porcine cell interaction proteins and anti porcine cell interaction protein antibodies with or without associated native patterns of glycosylation. For example, expressing proteins recombinantly in bacteria such as E. coli provides non-glycosylated molecules, while expressing porcine cell interaction proteins or anti porcine cell interaction protein antibodies in mammalian cells can provide glycosylated molecules.
• antibodies refers to immunoglobulins produced in vivo, as well as those produced in. vitro by a hybridoma, and antigen binding fragments (e.g., Fab' preparations) of such immunoglobulins, as well as to recombinantly expressed antigen binding proteins, including immunoglobulins, chimeric immunoglobulins, "humanized” immunoglobulins, antigen binding fragments of such immunoglobulins, single chain antibodies, and other recombinant proteins containing antigen binding domains derived from immunoglobulins.
• Publications describing methods for the preparation of such antibodies include: Reichmann, et al. , 1988; Winter and Milstein, 1991; Clackson, et al . , 1991; Morrison, 1992; Haber, 1992; and Rodrigues, et al . , 1993.
• Diagnostic use of the anti porcine cell interaction protein antibodies of the invention can be carried out by assaying the patient's blood for levels of one or more porcine cell interaction proteins.
• Assays for porcine cell interaction protein levels may be by RIA, ELISA, or other suitable immunoassay using the anti porcine cell interaction protein antibodies of the invention.
• General methods for performing such assays are set forth in Coligan, et al . , 1992.
• Blood porcine cell interaction protein levels must be monitored at regular intervals, e.g., daily or weekly, and changes in such levels recorded. Any distinct increase in porcine cell interaction protein levels in the patient's blood is an indication that the porcine tissue is becoming inflamed, and may indicate the onset of a rejection episode.
• An alternative test for rejection may be obtained by monitoring porcine organ function or by biopsy and histopathological examination of the porcine organ. Such examination will be carried out in order to detect the typical manifestations of transplant rejection, e.g., cellular infiltrates, inflammation, and necrosis.
• the histopathological examination of xenotransplanted organ biopsy tissues will also include the use of certain of the antibodies of the invention to detect the levels of expression of one or more porcine cell interaction proteins on the surfaces of the cells of the biopsied tissues of the xenotransplanted organ. High levels of such expression (compared to levels on non- transplanted control tissue samples) are indicative of xenotransplant rejection.
• nucleotide sequences of the porcine cell interaction protein-encoding nucleic acid molecules of the invention may be modified by creating nucleic acid mutations which do not significantly change the encoded amino acid sequences.
• Such mutations include third nucleotide changes in degenerate codons (and other "silent" mutations that do not change the encoded amino acid sequence) .
• Other such mutations within the scope of the invention and considered as equivalents of the specific embodiments set forth herein include those which result in a highly conservative amino acid substitution for an encoded amino acid while leaving the leucocyte binding (or other cell binding) characteristics of the porcine cell interaction proteins essentially unchanged.
• Such silent or highly conservative mutations are included within the scope of the invention.
• Nucleotide and amino acid sequences comprising changes that are found as naturally occurring allelic variants of the porcine cell interaction protein genes;
• tags include the FLAG epitope (which enables specific binding to anti-FLAG antibodies) and a histidine tag sequence, as described above;
• a monoclonal antibody to human LFA-1 (clone 25.3) was obtained from AMAC Inc, Westbrook ME. Human TNFa and IL-1 were obtained from Collaborative Biomedical Products, Bedford MA.
• Dulbecco's modified Eagles medium (DMEM) and RPMI-1640 medium were purchased from JRH Biosciences, Lenexa KS.
• Fetal bovine serum (FBS) was purchased from Harlan, Indianapolis IN.
• Sterile Hank's balanced salt solution (HBSS) and phosphate buffered saline (PBS) were purchased from Bio Whittaker, Walkersville MD.
• Calcein AM was obtained from Molecular Probes, Eugene OR.
• Neuraminidase was purchased from Boehringer Mannheim,
• Ramos, Jurkat, and U-937 cells were obtained from the American Type Culture Collection. Ramos and Jurkat were maintained in RPMI 1640 supplemented with 10% heat-inactivated FCS and 2 mM glutamine. U937 cells were maintained in RPMI 1640 supplemented with 15% FCS.
• Porcine aortic endothelial cells were obtained at passage 1 (Cell Systems, Kirkland WA) and maintained in DMEM containing 10% FBS, penicillin 100 U/ml, and streptomycin 100 ⁇ g/ml (pen/strep, JRH Biosciences, Lenexa KS) , hereinafter referred to as D10 medium.
• PAEC were at passage 2-4 in all assays.
• the human promyelocytic leukemia cell line HL-60 was obtained from the
• the isolated neutrophils or HL-60 cells were washed 2x with HBSS, resuspended in HBSS containing 1% BSA (HBSS/BSA) at a final concentration of 3 x 10 ⁇ cells/ml, incubated (30 min, 37°C) in the cytoplasmic indicator dye calcein AM (10 ⁇ M) , washed 2x with
• HBSS HBSS and resuspended to 3 x IO 6 cells/ml in HBSS/BSA.
• HL-60 cells were incubated (30 min, 37°C) in either, HBSS/BSA, HBSS/BSA containing 0.25 U/ml neuraminidase, or HBSS/BSA containing 10 ⁇ g/ml anti-LFA-1 mAb.
• the neutrophils or HL-60 cells were washed 2x with HBSS/BSA and resuspended to 3 x 10 ⁇ cells/ml. PAEC monolayers were then washed 3x with HBSS/BSA and calcein- loaded human neutrophils or HL-60 cells were added at 3 x IO 5 cells/well. The plates were centrifuged briefly (250 x g, 1 minute) , incubated in the dark for 5 min at 37°C and then centrifuged upside down at 250 x g for 3 minutes. The media and unbound neutrophils or HL-60 cells were removed from the plate and the bound cells were lysed by the addition of 1% SDS (100 ⁇ l/well) in HBSS.
• SDS 100 ⁇ l/well
• ELISA screen for anti-porcine ⁇ __ ⁇ intera tion. protein antibodies To test antibodies for reactivity with porcine cell interaction proteins, an ELISA is carried out using the following protocol:
• a 50 ⁇ L aliquot of a solution of a solublized (or soluble form of) a porcine cell interaction molecule is suspended in sodium carbonate/bicarbonate buffer, pH 9.5 and incubated overnight at 4"C in each test well of a 96 well plate (Nunc- Immuno F96 Polysorp, A/S Nunc, Roskilde, Denmark) in order to bind the protein to the plastic plate.
• the wells are then subjected to a wash step.
• test wells were blocked with 200 ⁇ L of blocking solution, 1% BSA in TBS (BSA/TBS) , for 1 hour at 37'C (or, in some cases, 4 * C overnight) .
• blocking solution 1% BSA in TBS (BSA/TBS)
• 37'C or, in some cases, 4 * C overnight
• test antibody solution e.g., hybridoma supernatant
• HRP horseradish peroxidase
• BSA/TBS horseradish peroxidase conjugated goat anti- mouse IgG
• HRP horseradish peroxidase
• P-8287 10 mg of O-phenylenediamine
• 25 mLs of phosphate-citrate buffer 20 mLs of phosphate-citrate buffer
• 50 ⁇ L of this substrate solution is added to each well to allow detection of peroxidase activity.
• porcine cell interaction protein in sodium carbonate/bicarbonate buffer that serves as a source of the protein bound to the plastic plate is used at 2-fold serial dilutions across the plate starting at 50 ⁇ g of protein per mL, i.e., at 50, 25, 12.5, 6.25, 3.125, 1.5625, and 0.78125 ⁇ g/mL. These dilutions are used to determine the minimum amount of porcine cell interaction protein that will give maximum sensitivity in this assay.
• the primer selection was based on sequence similarity between human, murine and rat VCAM.
• the resulting 299 bp PCR product was subcloned by TA-cloning into plasmid pCRII creating plasmid pCRIIpVCAM48 (Invitrogen, San Diego, CA) .
• Plasmid pCRIIpVCAM48 was random primed and used to screen a TNFa-stimulated PAEC cDNA Uni-ZAP XR 1 library (25) . A full-length, five Ig domain pVCAM cDNA was identified and entirely sequenced on both strands using a series of internal primers. The sequence for our porcine VCAM was identical to that reported by Tsang et al .
• COS-7-7 and human 293-EBNA cells were grown as previously described (27) .
• PAEC AND HUVECs were obtained (Cell Systems, Kirkland WA) at passage 1 and maintained as described (6) and used for adhesion assays or RNA isolation at passages 2-4.
• Human resting T cells were purified as previously described (6) .
• Plasmid pAPEX-1- pVCAM was transfected into COS-7 cells as described previously (27) .
• a truncated version of pVCAM was constructed by deleting the transmembrane and cytoplasmic domains as follows.
• the mammalian expression vector pAPEX-3/pVCAM was cleaved with Nhel and SphI and ligated to a 181 bp PCR fragment which supplied a six histidine tag and a stop codon using the following primers: 5'-CCCGAATTCGCATATACCATCCACAGG-3 ' and 5 ' -CGCGGA TCCTGCATGCATTAATGGTGATGGTGATGGTGTTCAGAAGAAAAATAGTCC-3 ' .
• This plasmid, pAPEX-3/spVCAM encodes the signal sequence and extracellular domains of pVCAM.
• spVCAM Purification of spVCAM.
• the APEX-3/spVCAM expression vector was transfected into human 293-EB ⁇ A embryonic kidney cells (Invitrogen, San Diego, CA) as previously described (27) .
• spVCAM was purified from concentrated serum-free conditioned medium from 293-EBNA cells expressing spVCAM by metal affinity chromatography using a nickel charged nitrilotriacetic acid (NTA) resin (Qiagen, Chatsworth, CA) .
• NTA nickel charged nitrilotriacetic acid
• spVCAM was eluted with 9 ml elution buffer (20 mM Tris-Cl, pH 7.9, 500 mM NaCl, 1 M imidazole) , concentrated with a Centriprep-30 (Amicon, Beverly MA) , dialyzed extensively against PBS, sterile filtered and stored at 4°C. Protein concentration was determined by the Lowry method. Affinity purified spVCAM was subjected to SDS-PAGE, transferred to polyvinylidene difluoride membranes (Problot, Applied Biosystems) and sequenced directly using an Applied Biosystems 470A gas phase protein sequencer. spVCAM Adhesion Assay.
• telomere binding buffer 15 mM sodium bicarbonate/35 mM sodium carbonate, pH 9.2
• Ramos cells were preincubated with anti-human VLA-4 mAb (HP2/1) at 10 mg/ml for 15 min at 37°C or spVCAM coated wells were treated with varying concentrations of anti-pVCAM mAbs for 1 h at 37°C prior to the adhesion assays.
• Blocking anti-a4-integrin (CD49d) mAb HP2/1 was purchased from Amac, Inc. (Westbrook, ME) .
• Mouse anti-porcine VCAM (anti-pVCAM) mAbs were prepared by intraperitoneal immunization of Balb/c mice with 100 mg of recombinant spVCAM in complete Freund's adjuvant. Following two boost injections with 100 mg of spVCAM in incomplete Freund's adjuvant, SP2/0 myeloma cells were fused using polyethylene glycol with spleen cells from the immunized animals. Hybridoma supernatants were screened 10-14 days later by ELISA for binding to spVCAM.
• Blocking anti-pVCAM mAbs were screened in a 30 min adhesion assay for the ability to inhibit the binding of Ramos cells to immobilized spVCAM and in a second adhesion assay for the ability to inhibit the binding of labeled Ramos cells to TNFa-stimulated PAEC (see below) .
• Three anti-pVCAM mAbs (2A2, 3F4, 5D11) were selected for characterization. The mAbs were purified from ascites fluid on protein G-SEPHAROSE columns (Pharmacia, Piscataway, NJ) and are of the IgGl isotype.
• Activated PAEC and HUVECs were analyzed for cell surface expression of VCAM using mouse anti-pVCAM mAb 2A2 , 3F4, 5D11, or a commercially available mouse anti-hVCAM mAb (51-10C9; Pharmingen, San Diego, CA) .
• Cells were treated with human TNFa (25 ng/ml) for approximately 24 h, harvested from culture flasks using mild trypsination and washed twice with PBS containing 2% FBS (PBS/2) . Five hundred thousand cells were incubated with 5.0 mg/ml 3F4, 2A2, 5D11 or 51-10C9 for 1 h on ice.
• the cells were washed twice with PBS/2 and incubated for 30 min on ice with FITC-conjugated goat anti-mouse IgG (Zymed Laboratories, San Francisco, CA) .
• the cells were washed in PBS/2 and analyzed by FACS using a Becton Dickerson FACSort (Becton Dickenson Immunocytometry Systems, San Jose, CA) .
• F(ab')2 fragments were prepared by digestion of purified 2A2 and 3F4 mAb with ficin in the presence of 1 mM cysteine as described by the manufacturer (Pierce, Rockford, IL) . Undigested mAb and Fc fragments were removed by subsequent protein A-sepharose chromatography. PolySorp microtiter plates (Nunc, Naperville, IL) were coated overnight at 4°C with 50 ml/well of 2 mg/ml 2A2 or 3F4 F(ab')2 in 0.1 M Na2C ⁇ 3 pH 9.6.
• the plates were then washed three times with PBS containing 0.5% (v/v) Tween 20 and blocked with blocking buffer (PBS supplemented with 1% (w/v) BSA and 0.5% Tween 20) at 37°C for 1 h.
• the plates were washed and incubated with 50 ml/well blocking buffer containing 2 mg/ml spVCAM at 37°C for 1 h. After additional washing, the plates were incubated at 37°C for 1 h with 50 ml/well blocking buffer or blocking buffer containing 1 mg/ml 2A2, 3F4, or 5D11 mAb.
• the plates were incubated with 50 ml/well blocking buffer containing peroxidase-conjugated goat anti-mouse IgG Fc (Sigma, St. Louis, MO) at a 1:2000 dilution. After three final washes, the plate was developed with 50 ml/well substrate buffer (0.05 M phosphate- citrate buffer, pH 5.0/0.3 mg/ml sodium perborate/0.4 mg/ml o- phenylenediamine dihydrochloride) . Reactions were stopped by the addition of 50 ml/well 1 M sulfuric acid. Quantitation was performed using a Bio-Rad model 3550 plate reader set at 490 nm.
• VLA-4 human a4bl integrins
• the spVCAM- (His) 6 used in this study was created by fusing a cDNA fragment encoding the extracellular domain of pVCAM (residues 1- 497) to a sequence encoding a C terminal hexahistidine tag and a stop codon at the leucine which is the first amino acid of the putative transmembrane domain (Fig. 2A) .
• the resulting spVCAM was secreted into the culture medium of stably transfected 293-EBNA cells and purified by metal affinity chromatography to >90 % purity (Fig. 2B) .
• spVCAM was subjected to 6 cycles of N-terminal sequencing.
• the sequence (VSQNVK) included four additional amino acids from that determined for the amino terminus of human VCAM (28) , the putative termini for rat and mouse VCAM (29) and the pVCAM sequence recently reported by Tsang et al . (26) .
• Anti-pVCAM mAbs Having established the interaction of human VLA-4 with pVCAM, we investigated the potential of inhibiting this interaction with blocking mAbs to pVCAM. Hybridomas were derived from the spleen cells of Balb/c mice immunized with spVCAM and used to make hybridomas . Numerous mAbs were produced that recognized pVCAM by ELISA and FACS analysis (data not shown) . Several mAbs were tested in a rapid screening assay involving the adherence of Ramos cells to immobilized spVCAM. Two mAbs, 2A2 and 3F4, significantly inhibited Ramos cell binding in a dose-dependent manner (Fig. 4) .
• Anti-pVCAM mAb 3F4 completely blocked Ramos cell binding to spVCAM at a concentration of 3 mg/ml, where as mAb 2A2 maximally inhibited binding to pVCAM at a higher concentration (30 mg/ml) (Fig. 4) .
• the weaker inhibition observed with the anti-pVCAM mAb 2A2 may reflect its reactivity with a distinct epitope on the pVCAM molecule (see below) .
• a third anti-pVCAM mAb, 5D11 showed virtually no inhibitory effect, even at high concentrations (Fig. 4) .
• the anti-human VCAM-1 mAb, 51-10C9 reacted with stimulated HUVEC but did not cross react with cell surface pVCAM present on stimulated PAEC, indicating that mAbs 2A2, 3F4 and 5D11 recognize porcine-specific epitopes.
• Flow cytometric analysis also revealed that pVCAM was highly expressed on LPS activated PAEC, whereas recombinant human IL-1 did not induce VCAM expression on PAEC (data not shown) .
• Epitope mapping of the anti-pVCAM mAbs was performed by pairwise interaction analysis. This approach tested the ability of mAb pairs to bind simultaneously to spVCAM. As shown in Fig. 6, mAbs 2A2 and 3F4 did not interfere with the binding of the remaining mAbs to spVCAM. Therefore, the mAb epitopes are nonoverlapping and represent distinct antigenic regions on the pVCAM molecule.
• the anti-pVCAM mAbs 2A2 and 3F4 inhibited binding of human T cells to TNFa-stimulated PAEC to the same degree as the anti-VLA-4 mAb (Fig. 7) .
• the degree of anti-pVCAM mAb-mediated inhibition of T cell interaction with PAEC was less than for Ramos binding to PAEC, suggesting that adhesion interactions other than VLA-4/VCAM are likely to play a role in human T cell/PAEC adhesion. Nevertheless, the data demonstrate a major role for pVCAM in mediating PAEC adhesion to human lymphocytes.
• the resulting expression plasmids were transfected into 293-EBNA cells and selected for puromycin resistance as described previously (Evans et al . , 1995) .
• cells were refed serum-free HB PRO (Irvine Scientific, Santa Ana, CA) every 3 to 4 days.
• the conditioned medium was centrifuged at 4500 x g to remove cell debris, concentrated 10-fold, and dialyzed into 20 mM sodium phosphate, pH 7.0.
• Antibody was subsequently purified using a 1 ml HiTrap Protein A column (Pharmacia, Piscataway, NJ) , dialyzed into PBS, passed through a 0.2 micron filter, and stored at 4°C.
• F(ab')2 and Fab were produced by digestion of murine monoclonal antibody or chimeric antibody with Ficin (Pierce, Rockford, IL) or papain
• the antibodies were tested for function as described above.
• GGC CCA TCC GTC TTC CCC CTG GCG CCC TGC TCC AGG AGC ACC TCC GAG AGC ACA GCC GCC
• CCA AAA CCC AAG GAC ACT CTC ATG ATC TCC CGG ACC CCT GAG GTC ACG TGC GTG GTG GTG
• GGC CCA TCC GTC TTC CCC CTG GCG CCC TGC TCC AGG AGC ACC TCC GAG AGC ACA GCC GCC
• AAA CCC AAG GAC ACC CTC ATG ATC TCC CGG ACC CCT GAG GTC ACG TGC GTG GTG GTG GAC
• CCC CCA AAA CCC AAG GAC ACT CTC ATG ATC TCC CGG ACC CCT GAG GTC ACG TGC GTG GTG
• CCA AAA CCC AAG GAC ACC CTC ATG ATC TCC CGG ACC CCT GAG GTC ACG TGC GTG GTG GTG
• Porcine CD86 (B7-2) RT-PCR was used to amplify an internal segment of the porcine CD86 gene from RNA isolated from LPS stimulated porcine PBLs.
• a second PCR fragment encoding a truncated N-terminus was prepared using the same cDNA template and an anchor dependent 5' RACE PCR cloning kit (CLONTECH, San Diego, CA) . These porcine PCR products were fused by overlapping PCR and ligated into a plasmid vector for sequencing.
• the cloned portion of porcine CD86 comprises 577 nucleotides.
• the encoded polypeptide is 192 amino acids long.
• the partial gene fragment was subsequently fused to the carboxy terminal 49 amino acids of the human CD86 IgC domain by overlapping PCR in which the 5 ' primer was constructed so as to encode the first 4 N-terminal amino acid residues of human CD86. to facilitate efficient secretion from mammalian cells.
• the 3 1 primer included fifteen nucleotides encoding a 5 histidine tag sequence.
• the sequence of the chimeric human/porcine CD86 is shown below. Amino acid residues 1-4 and 197-245 are from human CD86. Residues 1-25 are believed to encode a signal sequence. Primers used for cloning had sequences corresponding to (separately) nucleotides 166-184, nucleotides 574-595, nucleotides 1-33, nucleotides 585-764, and nucleotides 728-764. The porcine CD86 sequence of the invention spans nucleotides 19-597.
• GAC AAG ACG CGG CTT TTA TCT TCA CCT TTC TCT ATA GAG CTT GAG GAC 720 Asp Lys Thr Arg Leu Leu Ser Ser Pro Phe Ser Ile Glu Leu Glu Asp 225 230 235
• Robertson in Robertson (ed) , 1987. Teratocarcinomas and
• VCAM-1 Full length vascular cell adhesion molecule 1
• VCAM-1 on activated endothelium interacts with the leukocyte integrin VLA-4 at a site distinct from the VLA- 4/fibronectin binding site. Cell 1990; 60: 577.
• IL-4 regulates endothelial cell activation by IL-1, tumor necrosis factor, or IFN-gamma.

Landscapes

• Health & Medical Sciences (AREA)
• Immunology (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• Medicinal Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Molecular Biology (AREA)
• Genetics & Genomics (AREA)
• Biophysics (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Engineering & Computer Science (AREA)
• Animal Behavior & Ethology (AREA)
• General Chemical & Material Sciences (AREA)
• Veterinary Medicine (AREA)
• Cell Biology (AREA)
• Toxicology (AREA)
• Zoology (AREA)
• Gastroenterology & Hepatology (AREA)
• Public Health (AREA)
• Transplantation (AREA)
• Pharmacology & Pharmacy (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Peptides Or Proteins (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Priority Applications (3)

Applications Claiming Priority (2)

Publications (1)

Family

ID=21711053

Family Applications (1)

Country Status (3)

Cited By (65)

Families Citing this family (2)

• 1996
  • 1996-09-27 AU AU73780/96A patent/AU7378096A/en not_active Abandoned
  • 1996-09-27 WO PCT/US1996/015575 patent/WO1997011971A1/en not_active Application Discontinuation
  • 1996-09-27 JP JP51370997A patent/JP2002514895A/ja not_active Withdrawn

Non-Patent Citations (3)

Also Published As

Similar Documents

Legal Events