WO1996039418A1 - Cystatine e humaine - Google Patents

Cystatine e humaine Download PDF

Info

Publication number
WO1996039418A1
WO1996039418A1 PCT/US1995/007135 US9507135W WO9639418A1 WO 1996039418 A1 WO1996039418 A1 WO 1996039418A1 US 9507135 W US9507135 W US 9507135W WO 9639418 A1 WO9639418 A1 WO 9639418A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
dna
sequence
receptor
cyse
Prior art date
Application number
PCT/US1995/007135
Other languages
English (en)
Inventor
Jian Ni
Guo-Liang Yu
Reiner Gentz
Craig A. Rosen
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority to KR1019970708867A priority Critical patent/KR19990022387A/ko
Priority to AU27670/95A priority patent/AU717477B2/en
Priority to JP9500362A priority patent/JPH11507811A/ja
Priority to PCT/US1995/007135 priority patent/WO1996039418A1/fr
Priority to CA002223888A priority patent/CA2223888A1/fr
Priority to EP95922973A priority patent/EP0842187A4/fr
Publication of WO1996039418A1 publication Critical patent/WO1996039418A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/8139—Cysteine protease (E.C. 3.4.22) inhibitors, e.g. cystatin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention has been putatively identified as human cystatin E, sometimes hereinafter referred to as "CysE". The invention also relates to inhibiting the action of such polypeptides.
  • the cystatin superfamily comprises a group of cysteine proteinase inhibitors which are widely distributed in human tissues and body fluids, and which form tight and reversible complexes with cysteine proteinases such as cathepsins B, H,
  • cystatins are most likely involved in the regulation of normal or pathological processes in which these proteinases participate. Thus, cystatins may influence the intra- and extracellular catabolism of proteins and peptides
  • the cystatin superfamily has been sub-divided into families I, II and III (also called the stefin, cystatin and kininogen families, respectively) , each with members differing from those of the other families in structural organization and biological distribution (Barret, A.J., et al., Biochem. J.. 236:312 (1986)).
  • the family I cystatins A and B are small proteins consisting of single polypeptide chains of about 100 amino acid residues without disulfide bridges.
  • the family II cystatins consist of polypeptide chains of approximately 120 amino acid residues with two intra-chain disulfide bonds.
  • family III cystatins the kininogens
  • Family I and II cystatins are mainly present intracellularly and in secretory fluids (Abrahamson, M., et al., J. Biol. Chem.. 261:11282-11289 (1986)), whereas kinigogens are highly concentrated in blood plasma (Adam, A. , et al., Clin. Chem.. 31:423-426 (1985)).
  • cystatin C At least one type II cystatin, designated cystatin C, appears to be expressed in all tissues (Abrahamson, M. , et al., Biochem. J.. 268:287-294 (1990)). In contrast, S-type cystatins are found predominantly in saliva (Abrahamson, M. , et al., J. Biol. Chem.. 261:11282-11289 (1986)). Cystatins and derivative peptides possess antibacterial and antiviral activities (Bjorck, et al. (1989, 1990)), consistent with their presence in secretions bathing epithelial surfaces directly exposed to the environment. The cystatins may also modulate the immune response. This could occur directly, by inhibiting cysteine proteases releases by macrophages (Bieth, J. , Cysteine Proteinases and Their Inhibitors. V. Turk, ed.
  • type II cystatins might perform a variety of protective functions at epithelial surfaces.
  • the human type II cystatin gene family consists of at least seven members.
  • HCAA cystatin C
  • Glu - * Leu mutation in the gene encoding cystatin C. This leads to deposition of amyloid fibrils comprised of this mutant cystatin C in the cerebral arteries, which appears to cause fatal hemorrhaging (Ghiso, J., et al., PNAS. USA. 83:2974-2978 (1986)).
  • polypeptide of the present invention has been putatively identified as a CysE as a result of amino acid sequence homology to cystatin C. This identification has been made as a result of amino acid sequence homology.
  • polypeptide of the present invention is of human origin.
  • nucleic acid molecules encoding a polypeptide of the present invention, including mRNAs, DNAs, cDNAs, genomic DNAs as well as analogs and biologically active and diagnostically or therapeutically useful fragments thereof.
  • a process for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a human nucleic acid sequence encoding a polypeptide of the present invention, under conditions promoting expression of said protein and subsequent recovery of said protein.
  • a process for utilizing such polypeptide, or polynucleotide encoding such polypeptide for therapeutic purposes for example, to inhibit cathepsins and prevent osteoporosis, tumor metastases, viral replication, inflammation, purulent bronchiectasis to protect the retina, to prevent leukoencephalopathy, to reduce caries, to treat allergic reactions, to treat cachexia and muscle wasting, and to prevent a yloidosis, and as a antimicrobial agent.
  • nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to nucleic acid sequences encoding a polypeptide of the present invention.
  • diagnostic assays for detecting diseases or susceptibility to diseases related to mutations in the nucleic acid sequences encoding a polypeptide of the present invention.
  • Figure 1 illustrates the cDNA and corresponding deduced amino acid sequence of the polypeptide of the present invention.
  • the standard one-letter abbreviation for amino acids is used. Sequencing was performed using a 373 automated DNA sequencer (Applied Biosystems, Inc.) .
  • Figure 2 illustrates the amino acid sequence homology between the polypeptide of the present invention (top line) and human cystatin C (bottom line) .
  • nucleic acid which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 97103 on March 20, 1995.
  • the polynucleotide of this invention was discovered in a cDNA library derived from primary culture amniotic cells. It is structurally related to the cystatin II superfamily. It contains an open reading frame encoding a protein of 148 amino acid residues of which approximately the first 28 amino acids residues are the putative leader sequence such that the mature protein comprises 120 amino acids. The protein exhibits the highest degree of homology to human cystatin C with 33.566% identity and 53.846% similarity over a 147 amino acid stretch.
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure l (SEQ ID N0:1) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID N0:1) or the deposited cDNA.
  • the polynucleotide which encodes for the mature polypeptide of Figure 1 (SEQ ID N0:2) or for the mature polypeptide encoded by the deposited cDNA may include, but is not limited to: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non- coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non- naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure l
  • nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID N0:1) or of the coding sequence of the deposited clone.
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
  • the present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptide may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell.
  • the polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide.
  • the polynucleotides may also encode for a proprotein which is the mature protein plus additional 5' amino acid residues.
  • a mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains.
  • the polynucleotide of the present invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence) .
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
  • gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as ' intervening sequences (introns) between individual coding segments (exons) .
  • Fragments of the full length CysE gene may be used as a hybridization probe for a cDNA library to isolate the full length CysE gene and to isolate other genes which have a high sequence similarity to the CysE gene or similar biological activity.
  • Probes of this type preferably have at least 30 bases and may contain, for example, 50 or more bases.
  • the probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete CysE gene including regulatory and promotor regions, exons, and introns.
  • An example of a screen comprises isolating the coding region of the CysE gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
  • the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides.
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • polypeptides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure l (SEQ ID N0:1) or the deposited cDNA(s) .
  • the polynucleotide may have at least 20 bases, preferably 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity.
  • such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:l, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
  • the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90% and more preferably at least a 95% identity to a polynucleotide which encodes the polypeptide of SEQ ID NO:2 as well as fragments thereof, which fragments have at least 30 bases and preferably at least 50 bases and to polypeptides encoded by such polynucleotides.
  • the present invention further relates to a CysE polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.
  • fragment when referring to the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure l (SEQ ID NO:2) or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.
  • Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) .
  • a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
  • polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
  • similarity between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
  • Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
  • the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the CysE genes.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
  • the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long as it is replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
  • the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed _o be within the scope of those skilled in the art.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • promoter for example, LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
  • bacterial cells such as E. coli. Streptomyces. Salmonella tvphimurium
  • fungal cells such as yeast
  • insect cells such as Drosophila S2 and Spodootera Sf_9
  • animal cells such as CHO, COS or Bowes melanoma
  • adenoviruses plant cells, etc.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • a promoter operably linked to the sequence.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen) , pBS, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; ptrc99a, pKK223- 3, pKK233-3, pDR540, pRITS (Pharmacia); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
  • any other plasmid or vector may be used as long as they are replicable and viable in the host.
  • Promoter regions can be selected from any desired gene using CAT (chloraraphenicol transferase) vectors or other vectors with selectable markers.
  • Two appropriate vectors are pKK232-8 and pCM7.
  • Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R P L and trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • the present invention relates to host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L. , Dibner, M. , Battey, I., Basic Methods in Molecular Biology, (1986)) .
  • constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y. , (1989) , the disclosure of which is hereby incorporated by reference.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples include the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
  • the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
  • the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella tvphimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) .
  • cloning vector pBR322 ATCC 37017
  • Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA) .
  • pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
  • the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
  • Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well known to those skilled in the art.
  • mammalian cell culture systems can also be employed to express recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981) , and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
  • the polypeptide of the present invention can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) .
  • a prokaryotic or eukaryotic host for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture
  • the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • Polypeptides of the invention may also include an initial methionine amino acid residue.
  • CysE polypeptide of the present invention may be employed to inhibit human cathepsin enzymes and the resulting pathologies related to the action of these cathepsins.
  • CysE may be employed to treat osteoporosis, behcet disease, hypercalcemia, osteomalicia, allergic skin diseases, allergic rhinitis and allergic purpura.
  • CysE may be employed to prevent tumor metastases.
  • the CysE polypeptide may be employed as an antimicrobial agent to halt the growth of certain microbial agents, for example, streptococci and to reduce dental caries by reducing the production of acids which contribute to caries.
  • the CysE polypeptide may also be employed as an antiviral agent to treat infection caused by viruses, for example, to prevent the replication of herpes simplex virus (HSV) .
  • the CysE polypeptide may also be employed to protect the retina against attack by the cystein proteinases.
  • the CysE polypeptide of the present invention may also be employed to treat cachexia and muscle wasting by preventing the action of cysteine proteinases.
  • the CysE polypeptide may also be employed to modify inflammation, for example, that associated with rheumatoid arthritis, and to treat septic shock.
  • the CysE polypeptide may also be employed to treat purulent bronchiectasis.
  • the polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disease.
  • This invention provides a method for identification of the receptor for the cystatin E polypeptide.
  • the gene encoding the receptor can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting (Coligan, et al., Current Protocols in Immun. , 1(2), Chapter 5, (1991)).
  • expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the cystatin E polypeptide, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the cystatin E polypeptide. Transfected cells which are grown on glass slides are exposed to labeled cystatin E polypeptide.
  • the cystatin E polypeptide can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. Following fixation and incubation, the slides are subjected to auto-radiographic analysis. Positive pools are identified and sub-pools are prepared and re-transfected using an iterative sub-pooling and re-screening process, eventually yielding a single clone that encodes the putative receptor.
  • labeled ligand can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE and exposed to X-ray film.
  • the labeled complex containing the ligand-receptor can be excised, resolved into peptide fragments, and subjected to protein microseguencing.
  • the amino acid sequence obtained from microsequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor.
  • This invention provides a method of screening compounds to identify those which bind to the cystatin E receptor and induce a second messenger response therefrom.
  • a mammalian cell or membrane preparation expressing the cystatin E receptor is incubated in the presence of the compound to be screened.
  • the response of a known second messenger system following interaction of the compound and the receptor is measured and compared to the second messenger response induced by cystatin E.
  • second messenger systems include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.
  • the polypeptide of the present invention and agonist compounds may be assayed for an ability to inhibit cyteine proteinase activity which assay comprises determining equilibrium constants for dissociation (Kj) of cystatin E complexes with papain and human cathepsin B, by continuous rate assays with 10 ⁇ M Z-Phe-Arg-NHMec as substrate in 100 M sodium phosphate buffer (Nicklin, M.J.H., and Barrett, A.J., Biochem. J., 223:245-253 (1984).
  • the buffer contains 1 mM dithiothreitol and 2 mM EDTA and is adjusted to pH 6.5 for papain assay and to pH 6.0 for cathepsin B assays.
  • Cathepsin B is preincubated for 20 min in assay buffer at room temperature before use.
  • the enzyme concentrations in the assays are 0.05-0.25 nM.
  • the highest cystatin E concentration tried in cathepsin B assays is 100 nM.
  • the inhibitor concentrations giving informative inhibition, i.e. , resulting in a new steady state rate within l hour after addition of inhibitor, are 20-50 nM in the papain assays.
  • Substrate hydrolysis at 37°C is monitored in a Perkin-Elmer Cetus LS50 fluorometer at excitation and emission wavelengths of 360 and 460 nm, respectively. K-.
  • compositions comprise a therapeutically effective amount of the polypeptide or agonist, and a pharmaceutically acceptable carrier or excipient.
  • a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the polypeptides or agonists of the present invention may be employed in conjunction with other therapeutic compounds.
  • the pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes.
  • the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
  • CysE polypeptides and agonist compounds which are polypeptides may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy.”
  • cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
  • a polynucleotide DNA or RNA
  • cells may be engineered by the use of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
  • a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest.
  • These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo.
  • Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.
  • the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
  • the vector includes one or more promoters.
  • Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechni ⁇ ues. Vol. 7, No. 9, 980-990 (1989) , or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and 3-actin promoters) .
  • CMV human cytomegalovirus
  • viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
  • the nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter.
  • suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter,- heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promcters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described) ; the 3-actin promoter; and human growth hormone promoters.
  • the promoter also may be the native promoter which controls the
  • the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
  • packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ⁇ -2 , ⁇ - ⁇ J ⁇ , PA12, T19-14X, VT-19-17-H2, ⁇ CRE , CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990) , which is incorporated herein by reference in its entirety.
  • the vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP0 4 precipitation.
  • the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
  • the producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence (s) encoding the polypeptides .
  • the transduced eukaryotic cells will express the nucleic acid sequence (s) encoding the polypeptide.
  • Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
  • the disease hereditary cystatin C amaloid angiopathy causes fatal hemorrhaging, and may be associated with Alzheimer's disease, Down's syndrome, Parkinson's, dimentia, and could lead to death before age 40.
  • This invention therefore, relates to the use of the CysE gene as a diagnostic. Detection of a mutated form of CysE will allow a diagnosis of a disease similar to HCCAA which results from a mutation in the CysE gene.
  • Nucleic acids for diagnosis may be obtained from a patient's cells, including but not limited to blood, urine, saliva, tissue biopsy and autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis.
  • RNA or cDNA may also be used for the same purpose.
  • PCR primers complementary to the nucleic acid encoding CysE can be used to identify and analyze CysE mutations.
  • deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled CysE RNA or alternatively, radiolabeled CysE antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
  • Sequence differences between the reference gene and genes having mutations may be revealed by the direct DNA sequencing method.
  • cloned DNA segments may be employed as probes to detect specific DNA segments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al . , Science, 230:1242 (1985)).
  • Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)).
  • nuclease protection assays such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)).
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP) ) and Southern blotting of genomic DNA.
  • restriction enzymes e.g., Restriction Fragment Length Polymorphisms (RFLP)
  • mutations can also be detected by in si tu analysis.
  • sequences of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner.
  • Other mapping strategies that can similarly be used to map to its chromosome include in si tu hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in si tu hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • FISH fluorescence in si tu hybridization
  • This technique can be used with cDNA having at least 50 or 60 bases.
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes l megabase mapping resolution and one gene per 20 kb) .
  • the polypeptides, their fragments or other derivativ or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then.be used to isolate the polypeptide from tissue expressing that polypeptide.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497) , the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) .
  • Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures.
  • equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
  • “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
  • the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
  • For analytical purposes typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
  • For the purpose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37"C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
  • Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980).
  • Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
  • Ligase refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, I., et al., Id., p. 146) . Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
  • ligase T4 DNA ligase
  • the DNA sequence encoding CysE is initially amplified using PCR oligonucleotide primers corresponding to the 5' sequences of the processed CysE protein (minus the signal peptide sequence) and the vector sequences 3' to the CysE gene. Additional nucleotides corresponding to CysE were added to the 5' and 3' sequences respectively.
  • the 5' oligonucleotide primer has the sequence 5' CGCCCATGGCGGCCG
  • CAGGAG 3' contains an Ncol restriction enzyme site followed by CysE coding sequence starting from the presumed terminal amino acid of the processed protein.
  • the 3' sequence 5' CGC-AAGCTTTC ⁇ C ⁇ TCTGC ⁇ AAAAGTTGGC 3' contains complementary sequences to a Hindlll site and is followed by CysE coding sequence.
  • the restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA, 91311) .
  • pQE-9 encodes antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/0) , a ribosome binding site (RBS) , a 6- His tag and restriction enzyme sites.
  • pQE-9 was then digested with Ncol and Hindlll. The amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture was then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J.
  • M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kan r ) .
  • Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis. Clones containing the desired constructs were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250.
  • the cells were grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6.
  • IPTG Isopropyl-B-D-thiogalacto pyranoside
  • IPTG induces by inactivating the lacl repressor, clearing the P/O leading to increased gene expression.
  • Cells were grown an extra 3 to 4 hours.
  • Cells were then harvested by centrifugation.
  • the cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCI. After clarification, solubilized CysE was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E.
  • CysE was eluted from the column in 6 molar guanidine HCI pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCI, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hours the protein was dialyzed to 10 mmolar sodium phosphate.
  • the 5' primer has the sequence 5' CGCGGATCCGCCATCATGGCGC GTTCGAACCTC 3' (SEQ ID NO:5) and contains a BamHI restriction enzyme site (in bold) followed by an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987) and 18 nucleotides of the CysE gene (the initiation codon for translation "ATG" is underlined) .
  • the 3 ' primer has the sequence 5' CGCGGATCCTCACATCT GCAAAAAGTTGGCTT 3' (SEQ ID NO:6) and contains the cleavage site for the restriction endonuclease BamHI and nucleotides complementary to the 3' non-translated sequence of the CysE gene.
  • the amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) . The fragment was then digested with the endonuclease BamHI and then purified again on a 1% agarose gel. This fragment is designated F2.
  • the vector pA2 (modification of pVL941 vector, discussed below) is used for the expression of the CysE protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) .
  • This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonuclease BamHI.
  • the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
  • the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of co- ransfected wild-type viral DNA.
  • Many other baculovirus vectors could be used in place of pA2, such as pRGl pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39) .
  • the plasmid was digested with the restriction enzyme BamHI and then dephosphorylated using calf intestinal phosphatase by procedures known in the art.
  • the DNA was then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated V2.
  • Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase.
  • E.coli HB101 cells were then transformed and bacteria identified that contained the plasmid (pBacCysE) with the CysE gene using the enzyme BamHI. The sequence of the cloned fragment was confirmed by DNA sequencing.
  • the plate was rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27°C. After 5 hours the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum was added. The plate was put back into an incubator and cultivation continued at 27°C for four days.
  • plaque assay performed similar as described by Summers and Smith (supra) .
  • an agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques.
  • a detailed description of a "plaque assay” can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
  • the virus was added to the cells, blue stained plaques were picked with the tip of an Eppendorf pipette.
  • the agar containing the recombinant viruses was then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
  • the agar was removed by a brief centrifugation and the supernatant containing the recombinant baculovirus was used to infect Sf9 cells seeded in 35 mm dishes.
  • the supernatants of these culture dishes were harvested and then stored at 4°C.
  • Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells were infected with the recombinant baculovirus V-CysE at a multiplicity of infection (MOD of 2.
  • MOD multiplicity of infection
  • the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg) .
  • the cells were further incubated for 16 hours before they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
  • CysE HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, an SV40 intron and polyadenylation site.
  • a DNA fragment encoding the entire CysE precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R.
  • HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is described as follows:
  • the DNA sequence encoding CysE was constructed by PCR on the original EST cloned using two primers: the 5' primer 5' GCGCGGATCCACCATGGCGCGTTCG 3' (SEQ ID NO:7) contains a BamHI site followed by 12 nucleotides of CysE coding sequence starting from the initiation codon,- the 3' sequence 5' GCGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTACAT CTGCACAAA 3' (SEQ ID NO:8) contains complementary sequences to an Xbal site, translation stop codon, HA tag and nucleotides of the CysE coding sequence (not including the stop codon) .
  • the PCR product contains a BamHI site, CysE coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xbal site.
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp were digested with BamHI and Xbal restriction enzyme and ligated.
  • the ligation mixture was transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) approximately ten pieces are placed in each flask. The flask the transformed culture was plated on ampicillin media plates and resistant colonies were selected. Plasmid DNA was isolated from transformants and examined by restriction analysis for the presence of the correct fragment.
  • CysE For expression of the recombinant CysE, COS cells were transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)) . The expression of the CysE HA protein was detected by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)) . Cells were labelled for 8 hours with 3S S-cysteine two days post transfection.
  • Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask,
  • the cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively.
  • the 5' primer containing an EcoRI site and the 3' primer having contains a Hindlll site.
  • Equal quantities of the Moloney murine sarcoma virus linear backbone and the EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase.
  • the resulting mixture is maintained under conditions appropriate for ligation of the two fragments.
  • the ligation mixture is used to transform bacteria HB101, which are then plated onto agar- containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.
  • the amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin.
  • DMEM Dulbecco's Modified Eagles Medium
  • CS calf serum
  • penicillin and streptomycin The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector.
  • the packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells) .
  • Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells.
  • the spent media containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells.
  • Media is removed from a sub-confluent plate of fibroblasts and quickly replaced

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

La présente invention concerne un polypeptide de CysE humaine et l'ADN (RNA) codant ce polypeptide, ainsi qu'une procédure de production dudit polypeptide par techniques de recombinaison. Elle concerne également des procédés d'utilisation dudit polypeptide dans le traitement de l'ostéoporose, de métastases tumorales, d'infections microbiennes, d'infections virales, de chocs septiques, d'inflammations, d'irritations de la rétine, de caries, de cachexie et d'atrophie musculaire. L'invention concerne également des méthodes de diagnostic permettant de détecter des mutations dans la séquence de codage et des modifications de la concentration des polypeptides dans un échantillon tiré d'un hôte.
PCT/US1995/007135 1995-06-05 1995-06-05 Cystatine e humaine WO1996039418A1 (fr)

Priority Applications (6)

Application Number Priority Date Filing Date Title
KR1019970708867A KR19990022387A (ko) 1995-06-05 1995-06-05 사람 시스타틴 e
AU27670/95A AU717477B2 (en) 1995-06-05 1995-06-05 Human cystatin E
JP9500362A JPH11507811A (ja) 1995-06-05 1995-06-05 ヒトシスタチンｅ
PCT/US1995/007135 WO1996039418A1 (fr) 1995-06-05 1995-06-05 Cystatine e humaine
CA002223888A CA2223888A1 (fr) 1995-06-05 1995-06-05 Cystatine e humaine
EP95922973A EP0842187A4 (fr) 1995-06-05 1995-06-05 Cystatine e humaine

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
PCT/US1995/007135 WO1996039418A1 (fr) 1995-06-05 1995-06-05 Cystatine e humaine
CA002223888A CA2223888A1 (fr) 1995-06-05 1995-06-05 Cystatine e humaine

Publications (1)

Publication Number Publication Date
WO1996039418A1 true WO1996039418A1 (fr) 1996-12-12

Family

ID=25679905

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1995/007135 WO1996039418A1 (fr) 1995-06-05 1995-06-05 Cystatine e humaine

Country Status (3)

Country Link
EP (1) EP0842187A4 (fr)
CA (1) CA2223888A1 (fr)
WO (1) WO1996039418A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5998373A (en) * 1997-06-09 1999-12-07 Incyte Pharmaceuticals, Inc. Carboxypeptidase inhibitor

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5212297A (en) * 1989-05-16 1993-05-18 University Of Kansas cDNA clones encoding chicken egg white cystatin
US5432264A (en) * 1987-05-22 1995-07-11 Novo Nordisk A/S Recombinant 3-des-OH-cystatin C produced by expression in a procaryotic host cell

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK260987D0 (da) * 1987-05-22 1987-05-22 Nordisk Gentofte Fremgangsmaade til fremstilling af et humant protein samt dna-sekvens til anvendelse ved udoevelse af fremgangsmaaden
CA2002820A1 (fr) * 1988-11-18 1990-05-18 Kazunori Hanada Utilisation des cystatines en pharmacie
JP3460851B2 (ja) * 1993-04-28 2003-10-27 雪印乳業株式会社 新規システインプロテアーゼインヒビター

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5432264A (en) * 1987-05-22 1995-07-11 Novo Nordisk A/S Recombinant 3-des-OH-cystatin C produced by expression in a procaryotic host cell
US5212297A (en) * 1989-05-16 1993-05-18 University Of Kansas cDNA clones encoding chicken egg white cystatin

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BIOCHEM. BIOPHYS. RES. COMM., Volume 162, Number 3, issued 15 August 1989, SAITOH et al., "The Human Cystatin C Gene (CST3) is a Member of the Cystatin Gene Family Which is Localized on Chromosome 20", pages 1324-1331. *
GENE, Volume 61, issued 1987, SAITOH et al., "Human Cysteine-Proteinase Inhibitors: Nucleotide Sequence Analysis of Three Members of the Cystatin Gene Family", pages 329-338. *
J. BIOL. CHEM., Volume 266, Number 30, issued 25 October 1991, FREIJE et al., "Structure and Expression of the Gene Encoding Cystatin D, a Novel Human Cysteine Proteinase Inhibitor", pages 20538-20543. *
See also references of EP0842187A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5998373A (en) * 1997-06-09 1999-12-07 Incyte Pharmaceuticals, Inc. Carboxypeptidase inhibitor
WO1999064609A1 (fr) * 1997-06-09 1999-12-16 Incyte Pharmaceuticals, Inc. Nouvel inhibiteur de carboxypeptidase d'origine humaine

Also Published As

Publication number Publication date
CA2223888A1 (fr) 1996-12-12
EP0842187A4 (fr) 2000-04-12
EP0842187A1 (fr) 1998-05-20

Similar Documents

Publication Publication Date Title
US7482326B2 (en) Endothelial-monocyte activating polypeptide III
US6448042B1 (en) Human tissue inhibitor of metalloproteinase-4
US20070154908A1 (en) Connective Tissue Growth Factor-2
US20050186616A1 (en) Human cystatin F
US20040086967A1 (en) Human criptin growth factor
US20090197278A9 (en) Antibodies to hADA2
AU708868B2 (en) Keratinocyte growth factor-2
US5985601A (en) DNA encoding human cystatin E
US6617132B2 (en) Human cystatin E polynucleotides
US6955885B2 (en) Human stanniocalcin-alpha
WO1996035703A1 (fr) Inhibiteur humain du gene 1 de l'apoptose
US5695980A (en) Polynucleotides, vectors, cells and an expression method for human MutT2
US20030073159A1 (en) Human inhibitor of apoptosis gene 1
WO1996039424A1 (fr) Facteur c stimulant les cellules tueuses naturelles
WO1997018224A1 (fr) Antigene 2 de cellules-souches humaines
US6255079B1 (en) Polynucleotides encoding natural killer cell enhancing factor C
US6130061A (en) Human stem cell antigen 2
AU717477B2 (en) Human cystatin E
US5798223A (en) Polynucleotides encoding human amine transporter and methods of using the same
EP0842187A1 (fr) Cystatine e humaine
AU716100B2 (en) Human vascular endothelial growth factor 3
WO1997037021A1 (fr) Cystatine f humaine
AU762694B2 (en) Human criptin growth factor
AU4262500A (en) Human cystatin E
MXPA97009390A (en) Cistatine and hum

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 95197884.5

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AM AT AU BB BG BR BY CA CH CN CZ DE DK ES FI GB GE HU JP KE KG KP KR KZ LK LT LU LV MD MG MN MW MX NO NZ PL PT RO RU SD SE SI SK TJ TT UA US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE MW SD SZ UG AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: PA/a/1997/009390

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 1997 500362

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2223888

Country of ref document: CA

Ref document number: 2223888

Country of ref document: CA

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1019970708867

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 1995922973

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1995922973

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1019970708867

Country of ref document: KR

WWW Wipo information: withdrawn in national office

Ref document number: 1019970708867

Country of ref document: KR