WO1997018224A1 - Antigene 2 de cellules-souches humaines - Google Patents

Antigene 2 de cellules-souches humaines Download PDF

Info

Publication number
WO1997018224A1
WO1997018224A1 PCT/US1995/015314 US9515314W WO9718224A1 WO 1997018224 A1 WO1997018224 A1 WO 1997018224A1 US 9515314 W US9515314 W US 9515314W WO 9718224 A1 WO9718224 A1 WO 9718224A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
seq
dna
encoding
Prior art date
Application number
PCT/US1995/015314
Other languages
English (en)
Inventor
Jian Ni
Guo-Liang Yu
Reiner Gentz
Jeannine D. Gocayne
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority to AU45946/96A priority Critical patent/AU4594696A/en
Priority to PCT/US1995/015314 priority patent/WO1997018224A1/fr
Publication of WO1997018224A1 publication Critical patent/WO1997018224A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides More particularly, the polypeptide of the present invention ha ⁇ been putatively identified as human stem cell antigen 2 , sometimes hereinafter referred to as "hSca-2" The invention also relates to inhibiting the action of such polypeptides.
  • the Ly-6 family of cell surface proteins is a group of molecules differentially expressed in several hematopoietic lineages that appears to function m signal transduction and cell activation. Ly-6 antigens are encoded by a multi-gene family and are expressed in both lymphoid and non-lymphoid cells.
  • the Ly-6 super family of molecules includes human CD59, a cell surface protein which protects human complement- mediated membrane damage, squid Sgpl and Sgp2, urokinase plasminogen activator receptor and murine Sca-l and Sca-2
  • cysteine residues which have a conserved motif and a glycosyl phosphatidylinositol (GPI) anchor at the COOH-terminus. Further, there are clear areas of identity between the members at the ammo acid level. Moreover, there are normally 3 to 5 amino acids between cysteines 6 and 7 and the cysteine 8 and cysteine 9 residues are adiacent. An alanine residue is found one residue upstream of the GPI anchor. The GPI anchor is necessary to anchor these cell surface proteins mto the lipid bilayer membrane on the outside of the cell surface.
  • GPI glycosyl phosphatidylinositol
  • the cell surface phenotype of the mtrathymic precursors is similar to that of bone marrow stem cells, except that the former express murine Sca-2 (Wu, L. et al, J Exp Med. , 174:1617-1627 (1991)) .
  • Murine Sca-2 is also expressed by the majority of immature thymocytes, but not by mature peripheral T-cells.
  • Murine Sca-2 is also expressed on B22 + bone marrow cells and peripheral B-cells (Spangrude, G.J et al. , J. Immunol., 141:3697-3707 (1988)) .
  • the mature murine Sca-2 protein contains 82 ammo acids with a predicted molecular mass of 8.8 kDa This sequence contains a relatively high proportion of cysteine residues (10/82) , which suggests that numerous disulfide bonds stabilize this tertiary structure of murine Sca-2.
  • Ser-51 and Ser-56 are both flanked by Pro residues and may be O-glycosylated ⁇ Jentoft, N., Trends Biochem. Sci., 15:291-294 (1990)) and (Gooley, AA et al. , Biochem. Biophys. Res. Commun., 178:1194- 1201 (1991) ) .
  • Murine Sca-2 shows significant structural similarities to mouse Ly-6 antigens, human CD59 and a herpes virus CD59 homolog. A remarkable conservation of all extracellular cysteine residues is evident, with all ten cysteine residues in the putative mature protein conserved between Murine Sca-2 and other sequences. There is clearly an evolutionary relationship between Murine Sca-2 and the Ly-6 family.
  • the C-term us of the Sca-2 prote is enriched for hydrophobic amino acids, indicating that it is probably a signal peptide for the attachment of a GPI moiety for cell membrane anchoring (Ferguson, M.A. and Williams, A.F., Annu. Rev. Biochem., 57:285-320 (1988)) .
  • All sequences of the Ly-6 family have C-terminal hydrophobic signal sequences of GPI attachment or have a GPI anchor
  • the GPI signal sequence directs attachment of a GPI anchor to the c-terminus of murine Sca-2 and this modification occurs both thymocytes and COS cells.
  • GPI-linked molecules have been implicated signal transduction in hematopoietic cells, suggesting an important role for the GPI anchor and cell activation. (Robinson, PJ, Immunol. Today, 12:35-41 (1991)) . It is possible that Sca-2 may also function as a signal transduction molecule, and the presence of a GPI anchor suggests a signalling mechanism in common with other GPI-anchored molecules.
  • This cytolytic activity of human complement is mediated by the assembly of five proteins (c5b, c6, c7, c8 and c9) into a functional membrane attack complex.
  • the c5b-9 complex forms stable pores in the membrane, thereby altering the ion permeability of the cell. This can lead to cell lysis or, in some case, sub-lytic activation.
  • the hemolytic anemia associated with paroxysmal nocturnal hemoglobinu ⁇ a (PNH) can be attributed to increased c5b-9 deposition on erythrocytes. Thrombosis seen in PNH patients may be caused by increased c5b-9 deposition on platelets, which leads to pro-coagulation responses such as increased pro-thrombinase activity.
  • human blood cells are protected against autologous complement activation by membrane proteins that block the assembly of functional complement pores.
  • membrane proteins that block the assembly of functional complement pores.
  • One such protein is human CD59 which inhibits the assembly of c5b- 9 b y interacting with c8 and c9. Accordingly, administration of CD59 prevents hemolytic disease or thrombosis.
  • the CD59 protein may prevent the complemen t mediated lysis and activation of endothelial cell ⁇ whic h leads to hyper acute rejection and therefore may b e administered during xenogeneic organ transplantation.
  • a protein extracted from a urate-calcium oxalate stone has shown high homology to the CD59 protem. (Binette, J.P. and Binette, M.B., Scanning Microc ⁇ . , 7:1107-10 (1993)) .
  • CD59 is also thought to retard the onset of Alzheimer's disease since a detection of the membrane inhibitor of reactive lysis (CD59) has been found in the diseased neurons of the Alzheimer brain, (McGeer, P.L. et al. , Brain Research, 544:315-9 (1991) ) .
  • Urokinase plasminogen activator receptor is also a member of this family and binds plasminogen activator and thus presumably concentrates this protease at a cell surface where it is required and, therefore, may also be considered to act within this functional framework. It is thought that plasminogen activator may be involved in the penetration of extracellular matrices and that its function may be important in metastasis as well a ⁇ in non-pathogenic functions. (Roldin, et al. , EMBO J., 9:467-474 (1990)) .
  • the polypeptide of the present invention ha ⁇ been putatively identified as a human Sca-2 protein as a result of amino acid sequence homology to murine Sca-2, and, therefore, as a member of the Ly-6 protein super-family.
  • a novel mature polypeptide as well as biologically active and diagnosticaliy or therapeutically useful ragments, analogs and derivatives thereof.
  • the polypeptide of the present invention is of human origin.
  • isolated nucleic acid molecules encoding a polypeptide of the present invention including mRNAs, cDNAs, genomic DNAs as well as analogs and biologically active and diagnosticaliy or therapeutically useful fragments thereof.
  • an isolated nucleic acid molecule encoding a mature polypeptide expressed by the DNA contained ATCC Deposit No. 97301.
  • a process for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention, under conditions promoting expression of said protein and subsequent recovery of said prote .
  • a proces ⁇ for utilizing such polypeptide, or polynucleotide encoding such polypeptide for therapeutic purposes for example, to stimulate the maturation and differentiation of the thymocytes, to prevent damage from the complement c5b-9, to prevent hyper-acute rejection, to treat PNH and to treat Alzheimer's disease.
  • hSca-2 agonists which mimic hSca-2.
  • nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to a nucleic acid sequence of the present invention.
  • diagnostic assays for detecting diseases or susceptibility to diseases related to mutations the nucleic acid sequences encoding a polypeptide of the present invention.
  • Figure 1 is an illustration of the cDNA and corresponding deduced ammo acid sequence of the polypeptide of the present invention.
  • the initial 20 am o acids represent a leader sequence and the terminal 29 ammo acids (double underlined) represent the GPI anchor.
  • Sequencing was performed using a 373 automated DNA sequencer (Applied Biosystems, Ine. ) .
  • Figure 2 is an amino acid sequence comparison between the polypeptide of the present invention (top l ne) and the murine Sca-2 precursor (SEQ ID NO:11)
  • an isolated nucleic acid which encodes for the mature polypeptide having the deduced am o acid ⁇ equence of Figure 1 (SEQ ID NO:2) .
  • a polynucleotide encoding a polypeptide of the present invention may be obtained from activated T-cells, human thymus and human cerebellum.
  • the polynucleotide of this invention wa ⁇ discovered in a cDNA library derived from human cerebellum. It is structurally related to the Ly-6 super- family It contams an open reading frame encoding a protein of 131 ammo acid residues.
  • the first 20 ammo acids residues represent a putative leader sequence and the terminal 29 ammo acids represent a GPI anchor
  • the protem may exist as a soluble extracellular protein comprising 81 am o acids after the protein is cleaved from the GPI anchor and the putative leader portion has been removed
  • the protem exhibits the highest degree of homology at the nucleotide level to murine hSca-2 precursor mRNA with 68% identity and 68% similarity over a 185 base pair stretch.
  • the protein also exhibits the highest degree of homology at the am o acid level to murine Sca-2 precursor with 61.240 % identity and 77.519 % similarity over the entire amino acid stretch
  • the molecular weight is 13494.70; the molar extinction coefficient is 3760 and the isoelectric point is 7.79.
  • the polypeptide of the present invention contains conserved motifs characteristic of members of the Ly-6 super- family.
  • the conserved cysteine residues are conserved in the polypeptide of the present invention, namely, 10 cysteines are shown and are located in similar positions to other members of the family. For example, there are three ammo acids between cysteine 6 and cysteine 7 and cysteine 8 and cysteine 9 are adiacent.
  • the GPI anchor comprises a stretch hydrophobic ammo acids which is present in the polypeptide of the present invention and a terminal alanine residue on the mature protem is present directly prior to the GPI anchor.
  • isolated polynucleotides encoding a mature polypeptide expressed by the DNA contained in ATCC Deposit No. 97301, deposited with the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, USA, on September 25, 1995.
  • the deposite d material is a cDNA encoding the full-length hSca- 2 polypeptide inserted into a pBluescript SK(-) vector (Stratagene, La Jolla, CA) .
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double- stranded or s gle-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID NO:l) or may be a different coding sequence, which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID N0:1) .
  • the polynucleotide which encodes for the mature polypeptide of Figure 1 may include, but is not limited to: only the coding sequence for the mature polypeptide; the coding ⁇ equence for the mature polypeptide and additional coding ⁇ equence such as a leader or secretory sequence, a proprotein sequence and a membrane anchor; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • polynucleotide as used for the present invention encompasses a polynucleotide which includes only coding sequence for the polypeptide a ⁇ well as a polynucleotide which includes additional coding and/or non- coding sequence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced ammo acid sequence of Figure 1 (SEQ ID NO:2) .
  • Variants of the polynucleotide may be naturally occurring allelic variants of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotides encoding the same mature polypeptide as shown m Figure 1 (SEQ ID NO:2) as well as variants of such polynucleotides, which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2)
  • Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the codmg sequence shown m Figure 1 (SEQ ID N0:1) .
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
  • the present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptide may b e fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which function ⁇ as a secretory sequence for controlling transport of a polypeptide from the cell and a transmembrane anchor which facilitates attachment of the polypeptide to a cellular membrane.
  • the polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide.
  • the polynucleotides may also encode for a proprotein which is the mature protem plus additional 5' ammo acid residues.
  • a mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains.
  • the polynucleotide of the present invention may encode for a mature protein, for a protem having a prosequence, for a protein having a transmembrane anchor or for a polypeptide having a prosequence, a presequence (leader sequence) and a transmembrane anchor.
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa- hi ⁇ tidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)) .
  • gene means the segment of DNA involved in producmg a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segment ⁇ (exons)
  • Fragments of the full length polynucleotide of the present invention may be used as a hybridization probe for a cDNA library to isolate the full length cDNA and to isolate other cDNAs which have a high sequence similarity to the gene or similar biological activity.
  • Probes of this type preferably have at least 15 bases, may have at least 30 bases and may also contain, for example, 50 or more bases.
  • the probe may al ⁇ o be u ⁇ ed to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene including regulatory and promotor regions, exons, and introns.
  • An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe.
  • Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determme which members of the library the probe hybridizes to.
  • the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 75%, preferably at least 90%, and more preferably at lea ⁇ t 95% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the here above-described polynucleotide ⁇ .
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the ⁇ equence ⁇ .
  • polynucleotides which hybridize to the hereinabove described polynucleotides m encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1 (SEQ ID NO:l) .
  • the polynucleotide may have at least 1 5 bases, preferably at least 30 bases, and more preferably at lea ⁇ t 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity.
  • polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:l, for example, for recovery of the polynucleotide or as a diagnostic pro b e or as a PCR primer.
  • the present invention is directed to polynucleotides having at least a 75% identity, preferably at least 90% and more preferably at least a 95% identity to a polynucleotide which encodes the polypeptide of SEQ ID NO:2 and polynucleotides complementary thereto as well as portions thereof, which portions have at lea ⁇ t 30 consecutive bases and preferably at least 50 consecutive bases and to polypeptides encoded by such polynucleotides.
  • the present invention further relates to a polypeptide which has the deduced am o acid sequence of Figure 1 (SEQ ID NO:2) , as well as fragments, analog ⁇ and derivative ⁇ of ⁇ uch polypeptide.
  • fragment when referring to the polypeptide of Figure 1 (SEQ ID NO:2) , mean ⁇ a polypeptide which retains essentially the same biological function or activity as such polypeptide.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • Such fragments, derivatives and analogs must have sufficient similarity to the polypeptide of SEQ ID NO:2 so that activity of the native polypeptide is retained.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 may be (I) one in which one or more of the amino acid re ⁇ idue ⁇ are substituted with a con ⁇ erved or non-conserved amino acid residue (preferably a conserved ammo acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (1 1 ) one in which one or more of the am o acid residues includes a substituent group, or (111) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional ammo acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence
  • Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it l ⁇ naturally occurring)
  • a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment
  • polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% identity to the polypeptide of SEQ ID NO:2, or which have, at least 90% similarity (at least 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95% ⁇ imilarity ( ⁇ till more preferably at least 95% identity) to the polypeptide of SEQ ID NO.2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 ammo acids
  • Fragment ⁇ or portion ⁇ of the polypeptide ⁇ of the pre ⁇ ent invention may be employed for producing the corre ⁇ ponding full-length polypeptide by peptide ⁇ ynthesis, therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragment ⁇ or portions of the polynucleotide ⁇ of the present invention may be used to ⁇ ynthesize full-length polynucleotides of the present invention.
  • the present invention also relate ⁇ to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expres ⁇ ion vector
  • the vector may be, for example, m the form of a plasmid, a viral particle, a phage, etc
  • the engineered host cells can be cultured conventional nutrient media modified as appropriate for activating promoters, selecting transformant ⁇ or amplifying the gene ⁇ of the present invention.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
  • the polynucleotide may be mcluded m any one of a variety of expression vectors for expressing a polypeptide.
  • expression vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g. , derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long as it is replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
  • the DNA sequence is inserted into an appropriate restriction endonuclease s ⁇ te(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the DNA sequence m the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • promoter as representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. col . lac or trp, the phage lambda P, promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequence ⁇ for amplifying expression.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the vector containing the appropriate DNA sequence a ⁇ hereinabove de ⁇ cribed, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
  • bacterial cells such as E. col . Streptomyces. Salmonella typhimurium,- fungal cells, such as yeast; insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS or Bowes melanoma; adenoviruses; plant cell ⁇ , etc.
  • yeast bacterial cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9
  • animal cells such as CHO, COS or Bowes melanoma
  • adenoviruses plant cell ⁇ , etc.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the construct ⁇ comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • suitable vectors and promoters are known to those of skill in the art, and are commercially available.
  • the following vectors are provided by way of example,- Bacterial.
  • pQE70, pQE60, pQE-9 Qiagen
  • pBS pDIO
  • phagesc ⁇ pt ps ⁇ X174
  • pBluescript SK pBSKS
  • pNH8A pNH16a, pNHl ⁇ A, pNH46A (Stratagene); pTRC99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia); Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
  • any other plasmid or vector may be used as long as they are replicable and viable in the host.
  • Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
  • Two appropriate vectors are pKK232-8 and pCM7.
  • Particular named bacterial promoters include lad , lacZ, T3 , T7, gp , lambda P R , P, and trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTR ⁇ from retrovirus, and mouse metalloth ⁇ one ⁇ n-I . Selection of the appropriate vector and promoter is well with the level of ordinary skill m the art .
  • the present invention relates to host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such a ⁇ a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell .
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L. , Dibner, M. , Battey, I., Basic Method ⁇ in Molecular Biology, (1986) ) .
  • the constructs in host cells can be used n a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expres ⁇ ed m mammalian cell ⁇ , yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al. , Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989) , the disclosure of which is hereby incorporated by reference.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription.
  • Example ⁇ include the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. col and S. cerevisiae Trpl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , ot-factor, acid phosphatase, or heat shock proteins, among others.
  • the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protem into the periplasmic space or extracellular medium.
  • the heterologou ⁇ ⁇ equence can encode a fusion protein including an N-termmal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired prote together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification withm the host.
  • Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) .
  • Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEMl (Promega Biotec, Madison, WI, USA)
  • the ⁇ e pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
  • the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
  • Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, somcation, mechanical disruption, or use of cell lysing agents, such methods are well known to those skilled
  • mammalian cell culture system ⁇ can also be employed to expres ⁇ recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981) , and other cell lines capable of expressing a compatible vector, for example, the C127. 3T3, CHO, HeLa and BHK cell lines .
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences.
  • DNA sequence ⁇ derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
  • the polypeptide can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, a ⁇ necessary, m completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) .
  • a prokaryotic or eukaryotic host for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture
  • the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • Polypeptides of the invention may also include an initial methionine amino acid residue.
  • polynucleotide and polypeptide of the present invention may be employed to stimulate thymocyte maturation and differentiation.
  • the polypeptide of the present invention may also be employed to protect astrocytes during inflammatory and infectious disorders of the nervous system.
  • the polypeptide of the present invention may also be employed to prevent complement-mediated lysis and activation of endothelial cells for the treatment of hyper-acute rejection. In this manner, the polypeptide of the present inventionmay be employed during xenogeneic organ transplantation.
  • the polypeptide of the present invention may also be employed to prevent and/or treat PNH and the as ⁇ ociated disorders, for example, hemolytic anemia, pancytopenia and venous thrombosis Retroviral gene therapy with the hSca-2 polynucleotide could also provide a treatment for PNH patients.
  • the polypeptide of the present invention may also provide a treatment for Alzheimer's disea ⁇ e which ⁇ characterized by lysi ⁇ of neuronal cells.
  • polypeptide of the present invention may al ⁇ o be employed as an anti-inflammatory, anti-coagulant and as an anti-tumoral agent.
  • polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disea ⁇ e.
  • This invention provides a method for identification of the receptor for hSca-2.
  • the gene encoding the receptor can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting (Coligan, et al. , Current Protocols in Immun., 1(2) , Chapter 5, (1991)) .
  • expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to hSca-2, and a cDNA library created from thi ⁇ RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to hSca-2.
  • Transfected cells which are grown on glass slides are exposed to labeled hSca- 2 hSca-2 can be labeled by a variety of means including lodination or inclusion of a recognition site for a site- specific protein kinase. Following fixation and incubation, the slides are subjected to auto-radiographic analysis. Positive pools are identified and sub-pools are prepared and re-transfected using an iterative sub-pooling and re- ⁇ creening proces ⁇ , eventually yielding a ⁇ ingle clone that encode ⁇ the putative receptor.
  • labeled ligand can be photoaffmity linked with cell membrane or extract preparations that express the receptor molecule
  • Cross- linked material is resolved by PAGE and exposed to X-ray film
  • the labeled complex containing the ligand-receptor can be excised, resolved into peptide fragments, and subjected to protein microsequencing.
  • the amino acid sequence obtaine d from microsequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor.
  • This invention provides a method of screening compounds to identify those which enhance (agonists) or block (antagonist ⁇ ) interaction of hSca-2 with its receptor
  • a mammalian cell or membrane preparation expressing the hSca-2 receptor would be incubated with labeled hSca-2 in the presence of the compound. The ability of the compound to enhance or block this interaction could then be measured.
  • the response of a known second messenger system following interaction of hSca-2 and receptor would be measured and compared in the presence or absence of the compounds.
  • second messenger systems include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.
  • the present invention also relates to an assay for identifying potential antagonists specific to hSca-2.
  • An example of such an assay combines hSca-2 and a potential antagonist with membrane-bound hSca-2 receptors or recombinant hSca-2 receptors under appropriate conditions for a competitive inhibition assay.
  • hSca-2 can be labeled, such as by radioactivity, such that the number of hSca-2 molecules bound to the receptor will determine the effectiveness of the potential antagonist.
  • Potential antagonists include an antibody, or in some cases, an oligopeptide, which binds to the polypeptide.
  • a potential antagonist may be a closely related protem which binds to the receptor sites, however, they are inactive forms of the polypeptide and thereby prevent the action of hSca-2 since receptor sites are occupied.
  • Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the pre ⁇ ent invention, l ⁇ used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs m length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved m tran ⁇ c ⁇ ption (triple helix - see Lee et al. , Nucl.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into hSca-2 polypeptide (Antisense - Okano, J. Neurochem. , 56:560 (1991) ; Oligodeoxynucleotides a ⁇ Anti ⁇ ense Inhibitor ⁇ of Gene Expression, CRC Press, Boca Raton, FL (1988) ) .
  • the oligonucleotides described above can also be delivered to cells such that the antisen ⁇ e RNA or DNA may be expressed in vivo to inhibit production of hSca-2.
  • Potential antagonist ⁇ include a small molecule which binds to and occupies the catalytic site of the polypeptide thereby making the catalytic site inaccessible to substrate such that normal biological activity ⁇ prevented
  • small molecules include but are not limited to small peptides or peptide-like molecules.
  • the antagonists may be employed to prevent tumor metastasis of cancer cells and therefore to prevent or treat neoplasia.
  • the antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
  • compositions comprise a therapeutically effective amount of the polypeptide or antagonist, and a pharmaceutically acceptable carrier or excipient .
  • a suitable pharmaceutical carrier include ⁇ but i ⁇ not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds.
  • the pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, parenterally, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes.
  • the pharmaceutical composition ⁇ are admini ⁇ tered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
  • hSca-2 polypeptides and antagonists which are polypeptides may also be employed in accordance with the present invention by expres ⁇ ion of ⁇ uch polypeptides m vivo, which l ⁇ often referred to a ⁇ "gene therapy.”
  • cell ⁇ from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cell ⁇ then being provided to a patient to be treated with the polypeptide.
  • a polynucleotide DNA or RNA
  • cells may be engineered by the use of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expression of a polypeptide m vivo by, for example, procedures known in the art.
  • a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest.
  • These producer cells may be administered to a patient for engineering cells m vivo and expression of the polypeptide m vivo.
  • Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus
  • the retroviral plasmid vector is derived from Moloney Murine Leukemia Viru ⁇ .
  • the vector include ⁇ one or more promoter ⁇ .
  • Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter,- and the human cytomegalovirus (CMV) promoter de ⁇ cribed in Miller, et al. , Biotechniques. Vol. 7, No. 9, 980-990 (1989) , or any other promoter (e.g., cellular promoters such a ⁇ eukaryotic cellular promoter ⁇ including, but not limited to, the histone, pol III, and 3-actm promoter ⁇ ) .
  • CMV cytomegalovirus
  • viral promoter ⁇ which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoter ⁇ .
  • TK thymidine kinase
  • B19 parvovirus promoter ⁇ The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
  • Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter,- or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter,- heat shock promoters; the albumin promoter,- the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described) ; the / 3-actin promoter,- and human growth hormone promoters.
  • the promoter also may be the native promoter which controls
  • the retroviral plasmid vector is employed to transduce packaging cell line ⁇ to form producer cell lines.
  • packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ⁇ -2 , ⁇ t-AM, PA12, T19-14X, VT-19-17-H2, ⁇ CKE , ⁇ CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described m Miller, Human Gene Therapy. Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety.
  • the vector may transduce the packaging cells through any mean ⁇ known m the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP0 4 precipitation.
  • the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host
  • the producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence (s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either n vi tro or in vivo.
  • the transduced eukaryotic cells will express the nucleic acid sequence (s) encoding the polypeptide.
  • Eukaryotic cell ⁇ which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cell ⁇ .
  • This invention is also related to the use of the gene of the present invention as a diagnostic. Detection of a mutated form of the gene will allow a diagnosis of a disease or a susceptibility to a disease which results from expression of a mutated hSca-2 polypeptide.
  • Nucleic acids for diagnosis may be obtained from a patient's cells, mcludmg but not limited to blood, urine, saliva, tissue biop ⁇ y and autopsy material
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al . , Nature, 324:163-166 (1986)) prior to analysis.
  • RNA or cDNA may also be used for the same purpose
  • PCR primers complementary to the nucleic acid encoding hSca-2 can be used to identify and analyze mutations.
  • deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutation ⁇ can be identified by hybridizing amplified DNA to radiolabeled RNA or alternatively, radiolabeled antisense DNA sequence ⁇ . Perfectly matched sequence ⁇ can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
  • Sequence differences between the reference gene and genes having mutations may be revealed by the direct DNA sequencing method.
  • cloned DNA segment ⁇ may be employed a ⁇ probe ⁇ to detect specific DNA segments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequencing primer is used with double-stranded PCR product or a s gle- ⁇ tranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic ⁇ equencing procedures with fluorescent-tag ⁇ .
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequence ⁇ may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different position ⁇ according to their specific melting or partial melting temperatures (see, e.g., Myers et al . , Science, 230:1242 (1985) ) .
  • Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)) .
  • nuclease protection assays such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)) .
  • the detection of a specific DNA sequence may be achieved by methods ⁇ uch as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g. , Restriction Fragment Length Polymorphisms (RFLP) ) and Southern blotting of genomic DNA.
  • restriction enzymes e.g. , Restriction Fragment Length Polymorphisms (RFLP)
  • mutations can also be detected by m si tu analysi ⁇ .
  • the present invention also relates to a diagnostic assay for detecting altered levels of the polypeptide of the present invention in various tissue ⁇ since an over-expression of the proteins compared to normal control tissue samples can detect the presence of neoplasia.
  • Assays used to detect levels of the polypeptide of the present invention in a sample derived from a host are well-known to those of skill in the art and include radioimmunoassays, compet111ve-binding assays, Western Blot analysis and preferably an ELISA assay.
  • An ELISA assay initially comprises preparing an antibody specific to the hSca-2 antigen, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody.
  • a detectable reagent such as radioactivity, fluorescence or m this example a horseradish peroxidase enzyme
  • a solid support e.g. a poly ⁇ tyrene dish
  • Any free protem binding site ⁇ on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin.
  • the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any of the polypeptide of the present invention attached to the polystyrene dish.
  • a competition assay may be employed wherein antibodies specific to the polypeptide of the present invention are attached to a solid support and labeled hSca-2 and a sample derived from the host are passed over the solid support an d the amount of label detected attached to the solid support can be correlated to a quantity of the polypeptide of the present invention in the sample.
  • sequences of the present invention are also valuable for chromo ⁇ ome identification.
  • the sequence is ⁇ pecifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there ⁇ a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromo ⁇ omes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3 ' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification proce ⁇ s. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clone ⁇ in an analogous manner.
  • Other mapping strategies that can similarly be used to map to its chromosome include in si tu hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in si tu hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • FISH Fluorescence in si tu hybridization
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb) .
  • polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto
  • These antibodies can be, for example, polyclonal or monoclonal antibodies
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragment ⁇ , or the product of an Fab expression library Various procedures Jcnown in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
  • Example ⁇ include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al. , 1983, Immunology Today 4:72) , and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, m Monoclonal Antibodies and Cancer Therapy, Alan R. Li ⁇ , Inc., pp. 77-96)
  • Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids accord with published procedures.
  • equivalent plasmids to those described are known m the art and will be apparent to the ordinarily ⁇ killed artisan.
  • “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certam sequences in the DNA.
  • the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan
  • typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
  • typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume.
  • Appropriate buffer ⁇ and sub ⁇ trate amounts for particular restriction enzyme ⁇ are specified by the manufacturer. Incubation times of about 1 hour at 37"C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
  • Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a pho ⁇ phate with an ATP m the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
  • Ligase refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T. , et al., Id., p. 146) . Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
  • ligase T4 DNA ligase
  • the 5' oligonucleotide primer ha ⁇ the ⁇ equence 5' CGCGGATCCATGCTGATGTGCTT 3' (SEQ ID NO:3) contains a BamHI restriction enzyme site followed by 14 nucleotides of hSca-2 coding sequence starting from the presumed terminal amino acid of the processed protein codon.
  • the 3' sequence 5' CGCGGATCCCTACGCACTGAAATTGCAC 3' contains complementary sequences to BamHI site and is followed by 18 nucleotides of hSca-2.
  • the restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expres ⁇ ion vector pQE-60. (Qiagen, Inc., Chatsworth, CA, 91311) .
  • pQE-60 encodes antibiotic re ⁇ istance (Amp r ) , a bacterial origin of replication (on) , an IPTG-regulatable promoter operator (P/O) , a ribosome binding site (RBS) , a 6- Hi ⁇ tag and restriction enzyme sites.
  • pQE-60 was then digested with Bamhl .
  • the amplified sequences were ligated into pQE-60 and were inserted in frame with the sequence encoding for the histidine tag and the RBS.
  • the ligation mixture was then used to transform E. col strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) .
  • Ml5/rep4 contains multiple copies of the plasmid pREP4, which expresse ⁇ the lad repressor and also confers kanamycin resistance (Kan r ) .
  • Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis. Clones containing the desired constructs were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1.250. The cells were grown to an optical density 600 (O.D *"") of between 0.4 and 0.6. IPTG (“Isopropyl-B-D-thiogalacto pyranoside”) wa ⁇ then added to a final concentration of 1 mM.
  • O.D * optical density 600
  • IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression.
  • Cells were grown an extra 3 to 4 hours. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCl. After clarification, solubilized hSca-2 was purified from this ⁇ olution by chromatography on a Nickel-Chelate column under condition ⁇ that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al . , J. Chromatography 411:177-184 (1984)) .
  • hSca-2 (95 % pure was eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this ⁇ olution for 12 hour ⁇ the protein wa ⁇ dialyzed to 10 mmolar sodium phosphate.
  • the 5' primer has the sequence 5' CGCGGATCCGCCA TCATGAAGATLT ⁇ CITG 3' (SEQ ID NO:5) and contains a BamHI restriction enzyme site (in bold) followed by 6 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cell ⁇ (Kozak, M. , J. Mol. Biol., 196:947-950 (1987) which is just behind the first 15 nucleotides of the hSca-2 gene (the initiation codon for translation "ATG" is underlined) .
  • the 3 ' primer has the sequence 5' CGCGGATCCCTA CGCACTGAAATTGCAC 3' (SEQ ID NO:6) and contains the cleavage site for the restriction endonuclease BamHI and 18 nucleotides complementary to the 3 ' translated sequence of the extracellular part of hSca-2.
  • the amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean,” BIO 101 Inc., La Jolla, Ca.) .
  • the fragment wa ⁇ then digested with the endonuclease ⁇ BamHI, and purified again on a 1% agaro ⁇ e gel .
  • Thi ⁇ fragment is designated F2.
  • the vector pA2 (modification of pVL941 vector, discussed below) is used for the expression of the hSca-2 prote using the baculoviru ⁇ expression system (for review see Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555)
  • This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonucleases BamHI.
  • the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
  • the beta-galacto ⁇ idase gene from E.coli is inserted m the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequence ⁇ are flanked at both sides by viral ⁇ equence ⁇ for the cell-mediated homologou ⁇ recombination of co-tran ⁇ fected wild-type viral DNA.
  • baculoviru ⁇ vectors could be used in place of pA2 such as pRGl and pA2-GP in which case the 5' primer is 5' CGCGGATCCCCTGATGTGCTT 3' (SEQ ID NO:7) and the 3' primer is 5' CGCGGATCCCTACAACCCG CCATCGCC 3' (SEQ ID NO:8) , pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39) .
  • the DNA was then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) . This vector DNA is designated V2.
  • Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase.
  • E.coli HBlOl cells were then transformed and bacteria identified that contained the plasmid (pBachSca-2) with the hSca-2 gene using the enzyme BamHI .
  • the sequence of the cloned fragment was confirmed by DNA sequencing. 5 ⁇ g of the plasmid pBachSca-2 was co-transfected with
  • the plate was rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hour ⁇ at 27°C. After 5 hour ⁇ the transfection solution was removed from the plate and 1 ml of Grace's insect medium ⁇ upplemented with 10% fetal calf serum was added. The plate was put back into an incubator and cultivation continued at 27°C for four days.
  • plaque assay performed similar as de ⁇ cribed by Summers and Smith (supra) .
  • an agarose gel with "Blue Gal” (Life Technologie ⁇ Inc., Gaithersburg) was u ⁇ ed which allows an easy isolation of blue stained plaques (A detailed description of a "plaque assay” can also be found in the user's guide for insect cell culture and baculovirology distributed by Life TECH ⁇ Inc., Gaithersburg, page 9- 10) .
  • the virus wa ⁇ added to the cells and blue stained plaques were picked with the tip of an Eppendorf pipette.
  • the agar containing the recombinant viruses was then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
  • the agar was removed by a brief centrifugation and the supernatant containing the recombinant baculovirus was used to infect Sf9 cell ⁇ seeded in 35 mm dishes Four days later the supernatant ⁇ of these culture dishes were harvested and then stored at 4°C
  • Sf9 cells were grown m Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells were infected with the recombinant baculoviru ⁇ V-hSca-2 at a multiplicity of infection (MOI) of 2.
  • MOI multiplicity of infection
  • the medium wa ⁇ removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologie ⁇ Inc., Gaithersburg) .
  • the cells were further incubated for 16 hours before they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography
  • plasmid, hSca-2 HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillm resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, an SV40 intron and polyadenylation site.
  • a DNA fragment encoding the entire hSca-2 precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protem expres ⁇ ion is directed under the CMV promoter.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protem a ⁇ previously de ⁇ cribed (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37:767, (1984)) .
  • the infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid const-ruction strategy is described as follows: The DNA sequence encoding hSca-2, ATCC # 97301, was constructed by PCR u ⁇ ing two primer ⁇ the 5' primer 5' CGCGGATCCGCC ⁇ TCATG- -GATCrrTCTTG 3' (SEQ ID NO:9) contains a BamHI site followed by hSca-2 coding sequence starting from the initiation codon; the 3' sequence 5' GCGCTCTAGATCAA GCGTAGTCTGGGACGTCGTATGGGTACAACCCGCC1ATCGCCCGCLACTGAAATTGCAC3'
  • the PCR product conta ⁇ a BamHI site, hSca-2 coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xbal site.
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp were digested with BamHI and Xbal restriction enzyme and ligated
  • the ligation mixture was tran ⁇ formed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resi ⁇ tant colonies were ⁇ elected.
  • Plasmid DNA was isolated from transformants and examined by restriction analysis for the presence of the correct fragment For expression of the recombinant hSca-2 COS cells were transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Pres ⁇ ,
  • Fibroblasts are obtained from a subject by skm biopsy.
  • the resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tis ⁇ ue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask.
  • the flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, l ⁇ added. Thi ⁇ l ⁇ then incubated at 37°C for approximately one week.
  • pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and Hindlll and ⁇ ubsequently treated with calf intestinal phosphatase
  • the linear vector is fractionated on agarose gel and purified, using glas ⁇ bead ⁇ .
  • the cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences re ⁇ pectively.
  • the 5' primer containing an EcoRI site and the 3' primer further includes a Hindlll site
  • Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and Hindlll fragment are added together, the presence of T4 DNA ligase
  • the resulting mixture is maintained under conditions appropriate for ligation of the two fragments.
  • the ligation mixture is used to transform bacteria HBlOl, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.
  • the amphotropic pA317 or GP+aml2 packaging cell ⁇ are grown m tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin.
  • DMEM Dulbecco's Modified Eagles Medium
  • CS calf serum
  • penicillin and streptomycin The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector.
  • the packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells) .
  • Fresh media is added to the transduced producer cell ⁇ , and subsequently, the media is harvested from a 10 cm plate of confluent producer cells.
  • the spent media containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cell ⁇ and this media is then used to infect fibroblast cells.
  • Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
  • the engineered fibroblasts are then injected mto the host, either alone or after having been grown to confluence on cytodex 3 microcarrier bead ⁇ .
  • the fibroblasts now produce the protein product.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • MOLECULE TYPE CDNA
  • SEQUENCE DESCRIPTION SEQ ID NO:l:
  • MOLECULE TYPE PROTEIN
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:4:
  • MOLECULE TYPE Oligonucleotide
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:6:
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:7:
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:8:
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO: 9:

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un polypeptide de l'antigène 2 de cellules-souches humaines et l'ADN (ARN) codant pour un tel polypeptide, ainsi que des procédés pour produire ces polypeptides par des techniques de recombinaison. L'invention concerne également des techniques utilisant ces polypeptides pour stimuler la maturation et la différentiation de thymocytes, protéger des cellules neurales, empêcher les rejets durant la transplantation d'organes, traiter l'hémoglobinurie paroxystique nocturne, la maladie d'Alzheimer et les inflammations. L'invention concerne également des tests diagnostiques pour identifier des mutations dans la séquence de l'acide nucléique codant pour le polypeptide de l'invention et pour détecter des niveaux modifiés de ce polypeptide dans le but de dépister des maladies telles que le cancer.
PCT/US1995/015314 1995-11-13 1995-11-13 Antigene 2 de cellules-souches humaines WO1997018224A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU45946/96A AU4594696A (en) 1995-11-13 1995-11-13 Human stem cell antigen 2
PCT/US1995/015314 WO1997018224A1 (fr) 1995-11-13 1995-11-13 Antigene 2 de cellules-souches humaines

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1995/015314 WO1997018224A1 (fr) 1995-11-13 1995-11-13 Antigene 2 de cellules-souches humaines

Publications (1)

Publication Number Publication Date
WO1997018224A1 true WO1997018224A1 (fr) 1997-05-22

Family

ID=22250160

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1995/015314 WO1997018224A1 (fr) 1995-11-13 1995-11-13 Antigene 2 de cellules-souches humaines

Country Status (2)

Country Link
AU (1) AU4594696A (fr)
WO (1) WO1997018224A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998000540A1 (fr) * 1996-07-03 1998-01-08 Incyte Pharmaceuticals, Inc. Antigenes de cellules souches chez l'homme, adn codant lesdits antigenes et leur utilisation
EP1114861A1 (fr) * 1998-09-17 2001-07-11 Otsuka Pharmaceutical Co., Ltd. Gene ly6h
US6673535B1 (en) 1996-05-08 2004-01-06 Cedars-Sinai Medical Center Methods of detecting spinocerebellar Ataxia-2 nucleic acids
US6844431B1 (en) * 1996-05-08 2005-01-18 Cedars-Sinai Medical Center Nucleic acid encoding spinocerebellar ataxia-2 and products related thereto
WO2010051783A1 (fr) 2008-11-06 2010-05-14 Cpn S.R.O. Procédé de préparation de dérivés de l'acide hyaluronique réticulé par du dtpa et modification desdits dérivés

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
9TH INTERNATIONAL CONGRESS OF IMMUNOLOGY, issued 1995, ANTICA et al., "Tissue Distribution of the Stem Cell Antigen SCA-2 Revisited", page 493, Abstract Number 2923. *
9TH INTERNATIONAL CONGRESS OF IMMUNOLOGY, issued 1995, CLASSON et al., "The Structure of Mouse Stem Cell Antigen Sca-2", page 727, Abstract Number 4312. *
JOURNAL OF IMMUNOLOGY, Volume 141, Number 11, issued 01 December 1988, SPANGRUDE et al., "The Stem Cell Antigens Sca-1 and Sca-2 Subdivide Thymic and Peripheral T Lymphocytes Into Unique Subsets", pages 3697-3707. *
JOURNAL OF IMMUNOLOGY, Volume 155, issued 1995, SAITOH et al., "Modulation of TCR-Mediated Signaling Pathway by Thymic Shared Antigen-1 (TSA-1)/Stem Cell Antigen-2 (Sca-2)", pages 5574-5581. *
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, Volume 91, Number 12, issued 1994, CLASSON et al., "Mouse Stem Cell Antigen Sca-2 is a Member of the Ly-6 Family of Cell Surface Proteins", pages 5296-5300. *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6673535B1 (en) 1996-05-08 2004-01-06 Cedars-Sinai Medical Center Methods of detecting spinocerebellar Ataxia-2 nucleic acids
US6844431B1 (en) * 1996-05-08 2005-01-18 Cedars-Sinai Medical Center Nucleic acid encoding spinocerebellar ataxia-2 and products related thereto
US8975018B2 (en) 1996-05-08 2015-03-10 Cedars-Sinai Medical Center Method of detecting expanded CAG repeat region in spinocerebellar ataxia-2 gene
WO1998000540A1 (fr) * 1996-07-03 1998-01-08 Incyte Pharmaceuticals, Inc. Antigenes de cellules souches chez l'homme, adn codant lesdits antigenes et leur utilisation
US5856136A (en) * 1996-07-03 1999-01-05 Incyte Pharmaceuticals, Inc. Human stem cell antigens
EP1114861A1 (fr) * 1998-09-17 2001-07-11 Otsuka Pharmaceutical Co., Ltd. Gene ly6h
EP1114861A4 (fr) * 1998-09-17 2004-10-13 Otsuka Pharma Co Ltd Gene ly6h
US7432363B2 (en) 1998-09-17 2008-10-07 Otsuka Pharmaceutical Co., Ltd. Ly6H gene
US7582732B2 (en) 1998-09-17 2009-09-01 Osaka Pharmaceutical Co., Ltd. Ly6h polypeptide
WO2010051783A1 (fr) 2008-11-06 2010-05-14 Cpn S.R.O. Procédé de préparation de dérivés de l'acide hyaluronique réticulé par du dtpa et modification desdits dérivés

Also Published As

Publication number Publication date
AU4594696A (en) 1997-06-05

Similar Documents

Publication Publication Date Title
US6346246B1 (en) Antibodies that bind human haemopoietic maturation factor
US20070154908A1 (en) Connective Tissue Growth Factor-2
US20090197278A9 (en) Antibodies to hADA2
US6759512B1 (en) Human neuronal attachment factor-1
US20060148708A1 (en) C5a receptor
WO1997035976A9 (fr) Facteur de differenciation epidermique
WO1997035976A2 (fr) Facteur de differenciation epidermique
US20010036650A1 (en) C5a receptor
WO1997018224A1 (fr) Antigene 2 de cellules-souches humaines
US6537539B2 (en) Immune cell cytokine
WO1996039424A1 (fr) Facteur c stimulant les cellules tueuses naturelles
US20030108552A1 (en) Human inhibitor of apoptosis gene 1
US6245540B1 (en) Human choline acetyltransferase
WO1997029189A1 (fr) Facteur 1 de fixation neuronale humain
US20030022312A1 (en) Human hepatoma-derived growth factor-2
US6130061A (en) Human stem cell antigen 2
US6255079B1 (en) Polynucleotides encoding natural killer cell enhancing factor C
US5798223A (en) Polynucleotides encoding human amine transporter and methods of using the same
EP0833846A1 (fr) Recepteur couple de proteines g humaines (hetgq23)
AU716100B2 (en) Human vascular endothelial growth factor 3
EP0832124A1 (fr) Recepteur d'amines humaines
AU716415B2 (en) Pineal gland specific gene-1
US5962268A (en) DNA encoding an immune cell cytokine
EP0815220A1 (fr) Transporteur d'amine humaine
CA2223888A1 (fr) Cystatine e humaine

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA CN JP KR MX NZ

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 97512224

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA