WO1996034877A1 - Recepteur de neuropeptides humain - Google Patents

Recepteur de neuropeptides humain Download PDF

Info

Publication number
WO1996034877A1
WO1996034877A1 PCT/US1995/005616 US9505616W WO9634877A1 WO 1996034877 A1 WO1996034877 A1 WO 1996034877A1 US 9505616 W US9505616 W US 9505616W WO 9634877 A1 WO9634877 A1 WO 9634877A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
receptor
polynucleotide
dna
leu
Prior art date
Application number
PCT/US1995/005616
Other languages
English (en)
Inventor
Daniel R. Soppet
Yi Li
Craig A. Rosen
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority to CA002220036A priority Critical patent/CA2220036A1/fr
Priority to KR1019970707846A priority patent/KR19990008320A/ko
Priority to PCT/US1995/005616 priority patent/WO1996034877A1/fr
Priority to EP95918991A priority patent/EP0828751A4/fr
Priority to JP8533257A priority patent/JPH11505110A/ja
Priority to AU24707/95A priority patent/AU715286B2/en
Priority to US08/462,509 priority patent/US6410701B1/en
Publication of WO1996034877A1 publication Critical patent/WO1996034877A1/fr
Priority to US09/393,696 priority patent/US20030022277A1/en
Priority to US10/077,874 priority patent/US20020115155A1/en
Priority to US11/758,687 priority patent/US20080027020A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2869—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against hormone receptors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides.
  • the polypeptides of the present invention are human 7-transmembrane G-protein coupled receptors. More particularly, the polypeptides of the present invention are neuropeptide receptor polypeptides, sometimes hereinafter referred to as neuropeptide receptor polypeptides.
  • the invention also relates to inhibiting the action of such polypeptides.
  • Obesity is the commonest nutritional disorder in Western societies. More than three in ten adult Americans weigh at least 20% in excess of their ideal body weight (Burroa, M. , The New York Times, 17 July 1994) . Increased body weight is an important public health problem because it is associated with Type II diabetes, hypertension, hyperlipidemia and certain cancers (Grundy, S.M., and Barnett, J.P., Disease-a- Month, 36:645-696 (1990)).
  • the cloning and sequencing of the mouse ob gene and its human homologue have been reported (Zhang, Y. , et al., Nature, 372:425-431 (1994)).
  • the ob gene encodes a 4.5-kb adipose tissue mRNA with a highly conserved 167-amino-acid open reading frame.
  • the predicted amino-acid sequence is 84% identical between human and mouse and has features of a secreted protein.
  • the ob gene product may function as part of a signalling pathway from adipose tissue that acts to regulate the size of the body fat depot (id. 425) .
  • ventromedial nucleus of the hypothalamus is considered to be the most important satiety center in the central nervous system (CNS) .
  • the energy balance in mammals is therefore postulated to be controlled by a feedback loop in which the amount of stored energy is sensed by the hypothalamus, which adjusts food intake and energy expenditure to maintain a constant body weight (Ombeck, J.R., Yale J. Biol. Med., 20:545-552 (1948) and Kennedy, G.C., Proc. R. Soc.148:578-592 (1953)).
  • the size of the body fat depot is regulated by the CNS, with a product of body fat metabolism affecting energy balance by interacting with the hypothalamus (Kennedy, G.C., Proc. R. Soc.148:578-592 (1953)).
  • the ob signal may act directly or indirectly on the CNS to inhibit food intake and/or regulate energy expenditure as part of a homeostatic mechanism to maintain constancy of the adipose mass (Zhang, Y., et al., Nature, 372:425-431, 431 (1994) ) .
  • the ob gene apparently encodes a protein secreted by fat, and mutations apparently prevent translation or expression of the gene (Rink, T., Nature, 372:406-407 (1994) ) .
  • db diabetes
  • Mice having a mutation in the db gene are also obese, with the defect possibly being a receptor defect. (Id. at 406) .
  • Neuropeptide Y is similar to the ob gene product in that it mediates the feeding response. Neuropeptide Y acts on at least four types of neuropeptide Y receptors called Y 1# Y 2 , Y 3 and an atypical Y, receptor, which mediates the feeding response stimulated by neuropeptide Y.
  • Neuropeptide Y has a wide range of biological functions. Neuropeptide Y is found to be widely distributed in the central nervous system (CNS) and the peripheral nervous system (PNS) . In the PNS, neuropeptide Y is found in the noradrenergic sympathetic innervation of blood vessels and other smooth muscle tissues and in neurons within the enteric nervous system. Neuropeptide Y immunoreactive fibers also occur in the non-vascular smooth muscle, surrounding exocrine glands and surface epithelia. Neuropeptide Y also occurs in subpopulations of neurons and is generally co-localized with other neurotransmitters, particular noradrenaline.
  • neuropeptide Y is contained in GABAergic interneurons in higher centers and in predominantly catecholaminergic cells that project further caudally.
  • neuropeptide Y is contained in interneurons in the cortex, hippocampus, amygdala, basal forebrain and striatum, whereas in the brain stem, neuropeptide Y is ⁇ contained in noradrenergic neurons of the A, and A 2 groups in the medulla, and the locus coeruleus (LC) .
  • LC locus coeruleus
  • neuropeptide Y is found predominantly in the arcuate nucleus and lateral hypothalamus.
  • neuropeptide Y is present in postganglionic sympathetic nerves, and is co- localized as stated above with other neurotransmitters, including catecholamines.
  • neuropeptide Y has been shown to have a potent vasoconstrictor activity as well as dramatically potentiating the vasoconstriction caused by many other pressor agents.
  • Particularly high concentrations of neuropeptide Y are found in the sympathetic nerves supplying the coronary, cerebral and renal vasculature and when infused into these vascular beds, neuropeptide Y causes prolonged vasoconstriction that is not reversed by adrenergic blocking agents.
  • Neuropeptide Y also appears to be involved in interaction with the renin angiotensin system. Neuropeptide Y containing sympathetic nerve terminals are found on the juxta-glomerular apparatus of the renal cortex and neuropeptide Y influences renin release.
  • neuropeptide Y Within the central nervous system neuropeptide Y is located predominantly within interneurons where it appears to have a regulatory role. It therefore has widespread and diverse effects including effects on memory and a possible role in Alzheimer's disease. Neuropeptide Y is the most potent known substance to cause an increase in feeding and may play a role in the genetic basis of Type II Diabetes Mellitus. Neuropeptide Y may also play a role as a regulatory agent and pituitary function as well as potential neuromodulatory function in stress responses and in reproductive function.
  • novel mature receptor polypeptides as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
  • the receptor polypeptides of the present invention are of human origin.
  • nucleic acid molecules encoding the receptor polypeptides of the present invention, including mRNAs, DNAs, cDNAs, genomic DNA as well as antisense analogs thereof and biologically active and diagnostically or therapeutically useful fragments thereof.
  • processes for producing such receptor polypeptides by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing nucleic acid sequences encoding the receptor polypeptides of the present invention, under conditions promoting expression of said polypeptides and subsequent recovery of said polypeptides.
  • processes of administering compounds to a host which bind to and inhibit activation of the receptor polypeptides of the present invention which are useful in the prevention and/or treatment of Alzheimer's disease, Type II Diabetes Mellitus, epilepsy, stress, anxiety, hypertension, cardiovascular disease, psychotic conditions and obesity caused by neuropeptide Y.
  • nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the polynucleotide sequences of the present invention.
  • diagnostic assays for detecting diseases related to mutations in the nucleic acid sequences encoding such polypeptides and for detecting an altered level of the soluble form of the receptor polypeptides.
  • Figure 1 shows the cDNA sequence and the corresponding deduced amino acid sequence of the neuropeptide receptor polypeptide of the present invention.
  • the standard one- letter abbreviation for amino acids is used. Sequencing was performed using a 373 Automated DNA sequencer (Applied Biosystems, Inc.) .
  • Figure 2 shows the cDNA sequence and the corresponding deduced amino acid sequence of the neuropeptide receptor splice variant 1 polypeptide of the present invention.
  • the standard one-letter abbreviation for amino acids is used.
  • Figure 3 shows the cDNA sequence and the corresponding deduced amino acid sequence of the neuropeptide receptor splice variant 2 polypeptide of the present invention.
  • the standard one-letter abbreviation for amino acids is used.
  • Figure 4 illustrates the amino acid sequence and seven transmembrane regions of the neuropeptide receptor.
  • the transmembrane regions are underlined and denoted with a TM.
  • Figure 5 illustrates the amino acid sequence and seven transmembrane regions of the neuropeptide receptor splice variant 1.
  • the transmembrane regions are underlined and denoted with a TM.
  • Figure 6 illustrates the amino acid sequence and seven transmembrane regions of the neuropeptide receptor splice variant 2.
  • the transmembrane regions are underlined and denoted with a TM.
  • Figure 7 shows the amino acid homology between the human neuropeptide receptor polypeptide of the present invention (and the human neuropeptide Y, receptor) .
  • the receptor polypeptides of the present invention are receptors for ligands, both known and unknown, which modulate the activity of cells in both the central nervous system and peripheral tissues regulated by the central nervous system.
  • ligands are neuropeptide Y, substance P, the human ob gene product and neurokinin B. Accordingly, modulation of the activity of receptor polypeptides of the present invention will have a broad range of therapeutic and diagnostic applications, particularly with respect to the treatment of obesity.
  • the present inventors have isolated a full-length cDNA clone encoding a human neuropeptide receptor polypeptide.
  • the present full-length cDNA has been mapped to a location on human chromosome 1 position p31-34 which corresponds to a location on the mouse chromosome 4 where the db gene is found.
  • the mouse db gene is thought to encode the receptor for the obesity gene product.
  • nucleic acids which encode for the mature polypeptide having the deduced amino acid sequence of Figures 2 (SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone(s) deposited as ATCC Deposit No. on April 27, 1995.
  • the polynucleotide of this invention was discovered in a cDNA library derived from human adult hypothalamus. It is structurally related to the G protein-coupled receptor family.
  • the neuropeptide receptor polypeptide contains an open reading frame encoding a protein of 402 amino acid residues.
  • the neuropeptide receptor protein exhibits the highest degree of homology to human neuropeptide ⁇ receptor protein with 52 % similarity and 26 % identity over the entire amino acid sequence.
  • the polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequences which encode the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID N0:1) or that of the deposited clone(s) or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID N0:1) or the deposited cDNA(s) .
  • polynucleotides which encode for the mature polypeptide of Figure 2 (SEQ ID NO:2) or for the mature polypeptide encoded by the deposited cDNA(s) may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptides having the deduced amino acid sequence of Figure 2 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone(s).
  • the variants of the polynucleotide may be naturally occurring allelic variants of the polynucleotides or non-naturally occurring variants of the polynucleotides.
  • the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 2 (SEQ ID NO:2) or the same mature polypeptide encoded by the cDNA of the deposited clone(s) as well as variants of such polynucleotide which variants encode for a fragment, derivative or analog of the polypeptide of Figure 2 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone(s).
  • nucleotide variants include deletion variants, substitution variants and addition or insertion variants. Specific examples of such variants include the polynucleotide sequences as set forth in SEQ ID NOS:3 and 5 which encode for splice variant 1 and 2, respectively, of the polypeptide of the present invention.
  • the polynucleotides may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure l (SEQ ID N0:1) or of the coding sequence of the deposited clone(s).
  • an allelic variant is an alternate form of polynucleotide sequences which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptides.
  • the polynucleotides may also encode for a soluble form of the neuropeptide receptor polypeptide which is the extracellular portion of the polypeptide which has been cleaved from the TM and intracellular domain of the full- length polypeptide of the present invention.
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
  • the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides.
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • polypeptides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SEQ ID N0:1) or the deposited cDNA(s) , i.e. function as a soluble neuropeptide receptor by retaining the ability to bind the ligands for the receptor even though the polypeptide does not function as a membrane bound neuropeptide receptor, for example, by eliciting a second messenger response.
  • the polynucleotides may be polynucleotides which have at least 20 bases, preferably 30 bases and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which have an identity thereto, as hereinabove described, and which does not retain activity.
  • Such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO: 1, or for variants thereof, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
  • the deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 TJ.S.C. ⁇ 112.
  • the sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein.
  • a license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
  • the present invention further relates to a polypeptide which has the deduced amino acid sequence of Figure 2 (SEQ ID N0:2) or which has the amino acid sequence encoded by the deposited cDNA(s) , as well as fragments, analogs and derivatives of such polypeptide.
  • fragment when referring to the polypeptide of Figure 2 (SEQ ID NO:2) or that encoded by the deposited cDNA(s) , means polypeptides which either retain substantially the same biological function or activity as such polypeptides, i.e., function as a soluble neuropeptide receptor by retaining the ability to bind the ligands of the receptors even though the polypeptides do not function as membrane bound neuropeptide receptors.
  • An analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide. Specific examples are splice variant 1 and 2 of Figures 2 and 3 (SEQ ID NO:4 and 6) , respectively.
  • polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.
  • a fragment, derivative or analog of the polypeptide of Figure 2 (SEQ ID NO:2) or that encoded by the deposited cDNA(s) may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, (ii) one in which one or more of the amino acid residues includes a substituent group, (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) , (iv) one in which the additional amino acids are fused to the mature polypeptide, such as sequence which is employed for purification of the mature polypeptide sequence or (iv) splice variants of the mature polypeptide which may have one or more amino acids deleted from the mature polypeptide yet still retain activity corresponding to the mature polypeptide.
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region “leader and trailer” as well as intervening sequences (introns) between individual coding segments (exons) .
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) .
  • a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
  • the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the human neuropeptide receptor genes.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
  • the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long as it is replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
  • the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • promoter for example, LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
  • bacterial cells such as E. coli. Streptomyces. Salmonella typhimurium
  • fungal cells such as yeast
  • insect cells such as Drosophila S2 and Spodoptera Sf9
  • animal cells such as CHO, COS or Bowes melanoma
  • adenoviruse ⁇ plant cells, etc.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • a promoter operably linked to the sequence.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen) , pbs, pDIO, phagescript, psiX174, pbluescript ⁇ SK, pbsk ⁇ , pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; pTRC99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia) .
  • Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
  • any other plasmid or vector may be used as long as they are replicable and viable in the host.
  • Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
  • Two appropriate vectors are PKK232-8 and PCM7.
  • Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • the present invention relates to host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)) .
  • constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
  • Fragments of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis, therefore, the fragments may be employed as intermediates for producing the full- length polypeptides. Fragments of the polynucleotides of the present invention may be used in a similar manner to synthesize the full-length polynucleotides of the present invention.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPi gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , o.-factor, acid phosphatase, or heat shock proteins, among others.
  • the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
  • the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella tvphimurium and various species within the genera Pseudomona ⁇ , Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) .
  • cloning vector pBR322 ATCC 37017
  • Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA) .
  • pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
  • the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
  • mammalian cell culture systems can also be employed to express recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibrobla ⁇ t ⁇ , described by Gluzman, Cell, 23:175 (1981) , and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any neces ⁇ ary ribo ⁇ ome binding sites, polyadenylation site, splice donor and acceptor site ⁇ , tran ⁇ criptional termination ⁇ equences, and 5' flanking nontranscribed sequences.
  • DNA sequence ⁇ derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontran ⁇ cribed genetic element ⁇ .
  • the neuropeptide receptor polypeptide of the present invention can be recovered and purified from recombinant cell cultures by methods including ammonium ⁇ ulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, pho ⁇ phocellulo ⁇ e chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • the neuropeptide receptor polypeptide of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) .
  • a prokaryotic or eukaryotic host for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture
  • the polypeptides of the present invention may be glycosylated or may be non-glyco ⁇ ylated.
  • Polypeptides of the invention may also include an initial methionine amino acid residue.
  • polynucleotides and polypeptides of the pre ⁇ ent invention may be employed a ⁇ research reagents and materials for discovery of treatments and diagnostic ⁇ to human di ⁇ ease.
  • the human neuropeptide receptor polypeptides of the present invention may be employed in a proce ⁇ for ⁇ creening compounds which bind to and activate the receptor polypeptide and for compounds which bind to and inhibit activation of the receptor polypeptides of the present invention.
  • the neuropeptide receptor in isolated, immobilized or cell bound form is contacted with a plurality of compounds and tho ⁇ e compound ⁇ are ⁇ elected which bind to and interact with the receptor.
  • the binding or interaction can be mea ⁇ ured directly by u ⁇ ing radioactively labeled compound ⁇ of intere ⁇ t or by the ⁇ econd me ⁇ enger effect re ⁇ ulting from the interaction or binding of the candidate compound.
  • the candidate compound ⁇ can be subjected to competition screening assays, in which a known ligand, preferably labeled with an analytically detectable reagent, most preferably radioactivity, is introduced with the compound to be tested and the compound's capacity to inhibit or enhance the binding of the labeled ligand is measured.
  • Compounds are screened for their increased afffinity and selectivity to the receptor polypeptide of the present invention.
  • One such screening procedure involves the use of melanophores which are transfected to express the neuropeptide receptor of the present invention.
  • a screening technique is described in PCT WO 92/01810 published February 6, 1992.
  • the compound and a ligand known to bind to the receptor are both contacted with the melanophore cells. Inhibition of the signal generated by the ligand indicates that the compound inhibits activation of the receptor.
  • the screen may be employed for determining a compound which bind ⁇ to and activates the receptor polypeptide of the present invention by contacting such cell ⁇ with compound ⁇ to be screened and determining whether such compound generates a signal, i.e., activates the receptor.
  • ⁇ extra ⁇ cellular pH changes caused by receptor activation for example, a ⁇ de ⁇ cribed in Science, volume 246, page ⁇ 181-296 (October 1989) .
  • compound ⁇ may be contacted with a cell which expre ⁇ e ⁇ an neuropeptide receptor polypeptide of the present invention and a second messenger response, e.g. signal transduction or pH changes, may be measured to determine whether the potential compound is effective as an activator or inhibitor.
  • Another example involves introducing RNA encoding a neuropeptide receptor of the present invention into Xenopu ⁇ oocytes to transiently express the receptor.
  • the oocytes may then be contacted with the receptor ligand and a compound to be screened, followed by detection of inhibition of or an increase in intracellular calcium.
  • Another example involves expres ⁇ ing a neuropeptide receptor polypeptide of the pre ⁇ ent invention on the surface of a cell wherein the receptor is linked to a phospholipa ⁇ e C or D.
  • a neuropeptide receptor polypeptide of the pre ⁇ ent invention on the surface of a cell wherein the receptor is linked to a phospholipa ⁇ e C or D.
  • endothelial cells smooth muscle cell ⁇ , embryonic kidney cells, etc.
  • the screening may be accompli ⁇ hed a ⁇ hereinabove de ⁇ cribed by detecting activation of the receptor or inhibition of activation of the receptor from the phospholipase second ⁇ ignal.
  • Another method involve ⁇ determining inhibition of binding of labeled ligand to cells which have a neuropeptide receptor on the surface thereof.
  • Such a method involves transfecting a eukaryotic cell with DNA encoding an neuropeptide receptor polypeptide of the pre ⁇ ent invention ⁇ uch that the cell expresse ⁇ the receptor on it ⁇ ⁇ urface and contacting the cell with a compound in the presence of a labeled form of a known ligand.
  • the ligand can be labeled, e.g., by radioactivity.
  • the amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the compound bind ⁇ to the receptor a ⁇ determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited.
  • Another screening technique involves expres ⁇ ing a neuropeptide receptor polypeptide on the surface of a cell wherein the receptor is linked to a ⁇ econd me ⁇ enger to increa ⁇ e cyto ⁇ olic calcium level ⁇ in tran ⁇ fected CHO cell ⁇ .
  • An example of ⁇ uch a method comprises transfecting CHO cells with a nucleic acid sequence encoding a receptor of the present invention such that the receptor i ⁇ expre ⁇ ed on the ⁇ urface thereof.
  • the tran ⁇ fected cell is then incubated in a reaction mixture with labeled calcium in the presence of a compound to be screened.
  • the ability of the compound to increase calcium up-take or inhibit calcium up-take can then be determined by measuring the amount of labeled calcium transported into the cells by taking advantage of the label, e.g., radioactivity.
  • Compounds may also be identified by the above methods which bind to specific subregions within the CNS that are important for specific behaviors through indirect interactions with a neuropeptide receptor polypeptide of the present invention.
  • cyclic AMP is as ⁇ ayed in whole cell ⁇ treated for 15 minute ⁇ at 37°C with 100 micromolar isobutylmethylxanthine (IBMX; Sigma) .
  • Transfected cells (1 x 10 6 / 0.5 ml reaction) are incubated with 10 micromolar forskolin and variou ⁇ concentration ⁇ of known or unknown ligands to the receptor.
  • tran ⁇ fected cell ⁇ are suspended in loading medium (modified RPMI 1640 medium/10 mM Hepes/1% newborn calf serum) and incubated in a spinner fla ⁇ k at 37°C for 2.5 hour at 1 x 10 6 cell ⁇ per ml.
  • loading medium modified RPMI 1640 medium/10 mM Hepes/1% newborn calf serum
  • Cell ⁇ are then treated with 1 micromolar Fura-2 acetoxymethyl ester (fura-2 AM; Molecular Probes) for 30 minute ⁇ at 37°C, washed twice with loading medium, and re ⁇ uspended at 5 x 10 6 cells/ml.
  • cell ⁇ are recovered by centrifugation at 1000 rpm and re ⁇ u ⁇ pended at 1 x 10 cell ⁇ /ml in a modified Kreb ⁇ buffer (135 mM NaCl/4.7 mM KC1/1.2 mM MgS0 4 /l.2 mM KH 2 P0 4 /5 mM NaHC0 3 /l mM CaCl 2 /2.8 mM glucose/10 mM hepes, pH 7.4) containing sulfinpyrazone. Bombesin is purchased from Sigma and Auspep.
  • Fluorescence recording ⁇ are made on a Hitachi fluore ⁇ cence spectrometer (F4010) at 340 nm (excitation) and 505 nm (emis ⁇ ion) over 10 minute ⁇ with slit widths of 5 nm and respon ⁇ e time of 2 ⁇ econd ⁇ .
  • the invention also provides a method of treating and/or preventing obesity by administering to a host a compound which binds to and activates the receptor polypeptides of the present invention.
  • a compound is other than the ob gene product disclosed in Zhang, et al., Nature, 372:425-431 (1994) .
  • the receptor polypeptide of the present invention maps to a human chromosome which correspond ⁇ to the po ⁇ ition of the mouse chromosome which encode ⁇ for the receptor of the ob gene product.
  • the human ob gene encode ⁇ a " ⁇ atiety" factor which bind ⁇ to and activate ⁇ the receptor polypeptide of the pre ⁇ ent invention. Accordingly, a compound which activate ⁇ the receptor of the present invention will decrease appetite and prevent obesity.
  • the compounds described above may also be employed to enhance activity level, modify eating behavior, enhance utilization of ingested foods and regulate deposition of fat stores.
  • Conditions related to obesity may also be treated by the compounds which bind to and activate the receptor polypeptides of the present invention including hyperlidimeia, type II diabetes and certain cancers.
  • the ⁇ e compound ⁇ may al ⁇ o be employed to treat and/or prevent other condition ⁇ related to an underexpre ⁇ ion of the receptor polypeptide of the pre ⁇ ent invention or ligand ⁇ which bind thereto, for example, to ⁇ timulate neuronal growth.
  • compounds which inhibit activation of the receptor polypeptides of the present invention include an antibody, or in some case ⁇ an oligonucleotide, which bind ⁇ to the receptor but does not elicit a second me ⁇ enger re ⁇ ponse such that the activity of the receptor i ⁇ prevented.
  • Antisen ⁇ e technology can be u ⁇ ed to control gene expre ⁇ sion through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in tran ⁇ cription (triple helix - ⁇ ee Lee et al., Nucl. Acid ⁇ Re ⁇ ., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)), thereby preventing tran ⁇ cription and the production of a neuropeptide receptor polypeptide of the present invention.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the receptor (antisense - Okano, J. Neurochem.
  • oligonucleotides as Antisen ⁇ e Inhibitor ⁇ of Gene Expre ⁇ sion, CRC Press, Boca Raton, FL (1988) ) .
  • the oligonucleotides de ⁇ cribed above can al ⁇ o be delivered to cell ⁇ such that the antisen ⁇ e RNA or DNA may be expre ⁇ ed in vivo to inhibit production of the receptor ⁇ .
  • Another example i ⁇ a ⁇ mall molecule which bind ⁇ to a neuropeptide receptor polypeptide of the pre ⁇ ent invention, making it inaccessible to ligands such that normal biological activity i ⁇ prevented.
  • small molecule ⁇ include but are not limited to small peptides or peptide-like molecules and neuropeptide Y fragments and/or derivatives.
  • Soluble forms of a neuropeptide receptor polypeptide of the present invention e.g., a fragment of the receptor, which binds to the ligand and prevents the ligand from interacting with membrane bound receptors may also inhibit activation of the receptor polypeptides of the present invention.
  • This invention additionally provide ⁇ a method of utilizing ⁇ uch compounds which inhibit activation for treating abnormal conditions related to an excess of activity of a neuropeptide receptor polypeptide of the present invention for treating obesity
  • the neuropeptide receptor polypeptides of the present invention may bind neuropeptide Y which is the most potent known sub ⁇ tance to cause an increase in feeding behavior and type II Diabetes Mellitus since neuropeptide Y may play a role in the genetic basis of this disease.
  • the compounds which inhibit activation of the receptor polypeptide ⁇ of the present invention may be employed to treat and/or prevent hypertension ⁇ ince neuropeptide Y stimulates renin release and neuropeptide Y is known to have potent vasoconstrictor activity when involving the coronary and cerebral ves ⁇ el ⁇ .
  • the compound ⁇ may al ⁇ o be employed to treat Alzheimer' ⁇ di ⁇ ea ⁇ e ⁇ ince neuropeptide Y receptor ⁇ are prevalent in the central nervou ⁇ ⁇ y ⁇ tem and are localized predominantly within interneuron ⁇ where they appear to have regulatory role ⁇ in memory and Alzheimer ⁇ di ⁇ ea ⁇ e.
  • the compounds may also be employed to ⁇ uppres ⁇ excitatory tran ⁇ mission by neuropeptide Y in the hippocampus and therefore may be employed to treat epileptic seizure, stress and anxiety.
  • neuropeptide Y receptors in the central nervou ⁇ ⁇ ystem indicates that the compounds which inhibit the neuropeptide receptor polypeptides of the present invention may be used as an antipsychotic drug by regulating neurotransmis ⁇ ion.
  • the compound ⁇ which inhibit the receptor polypeptide ⁇ of the pre ⁇ ent invention may al ⁇ o be employed to treat pathological vasospa ⁇ m involving coronary and cerebral vessels.
  • This invention also provides a method for determining whether a ligand not known to be capable of binding to a neuropeptide receptor of the present invention can bind thereto which comprise ⁇ contacting the ligand to be identified with a cell compri ⁇ ing the coding ⁇ equence of a neuropeptide receptor and expressing same on its surface under conditions sufficient for binding of ligands previously identified a ⁇ binding to such a receptor.
  • cell membrane fractions comprising the receptor or i ⁇ olated receptor ⁇ free or immobilized on ⁇ olid ⁇ upport ⁇ may be used to measure binding of the ligand to be tested.
  • recombinant cells When recombinant cells are used for purposes of expres ⁇ ion of the receptor it is preferred to use cells with little or no endogenous receptor activity so that binding, if any, is due to the presence of the expres ⁇ ed receptor of intere ⁇ t.
  • Preferred cell ⁇ include human embryonic kidney cell ⁇ , monkey kidney (HEK-293 cell ⁇ ), fibrobla ⁇ t (COS) cell ⁇ , Chine ⁇ e hamster ovary (CHO) cells, Drosophila or murine L-cell ⁇ . It is also preferred to employ as a host cell, one in which a receptor respon ⁇ ive second messenger system exists.
  • Well known second mes ⁇ enger ⁇ y ⁇ tems include increase ⁇ or decrea ⁇ e ⁇ in pho ⁇ phoino ⁇ itide hydroly ⁇ is, adenylate cyclase, guanylate cycla ⁇ e, or ion channel activity in re ⁇ pon ⁇ e to ligand binding to extracellular receptor domain ⁇ .
  • a ⁇ pecifically de ⁇ igned indicator of receptor binding can be con ⁇ tructed.
  • a fu ⁇ ion protein can be made by fu ⁇ ing the receptor of thi ⁇ invention with a protein domain which is sensitive to receptor ligand binding.
  • Such a domain referred to here as an indicator domain i ⁇ capable, itself, or in association with accessory molecules, of generating an analytically detectable signal which is indicative or receptor ligand binding.
  • This invention also provides a method of detecting expression of a neuropeptide receptor polypeptide of the present invention on the surface of a cell by detecting "the presence of mRNA coding for the receptor which comprises obtaining total mRNA from the cell and contacting the mRNA so obtained with a nucleic acid probe comprising a nucleic acid molecule of at least 10 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding the receptor under hybridizing conditions, detecting the presence of mRNA hybridized to the probe, and thereby detecting the expression of the receptor by the cell.
  • the present invention also provides a method for identifying receptors related to the receptor polypeptide ⁇ of the present invention.
  • These related receptors may be identified by homology to a neuropeptide receptor polypeptide of the present invention, by low stringency cros ⁇ hybridization, or by identifying receptor ⁇ that interact with related natural or ⁇ ynthetic ligand ⁇ and or elicit ⁇ imilar behaviors after genetic or pharmacological blockade of the neuropeptide receptor polypeptides of the present invention.
  • Fragments of the genes may be used as a hybridization probe for a cDNA library to isolate other gene ⁇ which have a high ⁇ equence similarity to the genes of the present invention, or which have ⁇ imilar biological activity.
  • Probe ⁇ of this type preferably have 50 base ⁇ or more.
  • the probe may al ⁇ o be u ⁇ ed to identify a cDNA clone corre ⁇ ponding to a full length tran ⁇ cript and a genomic clone or clone ⁇ that contain the complete gene of the pre ⁇ ent invention including regulatory and promoter region ⁇ , exon ⁇ and intron ⁇ .
  • An example of a screen of this type comprises isolating the coding region of the gene by using the known DNA ⁇ equence to ⁇ ynthesize an oligonucleotide probe.
  • Labeled oligonucleotides having a ⁇ equence complementary to that of the gene ⁇ of the pre ⁇ ent invention are u ⁇ ed to ⁇ creen a library of human cDNA, genomic DNA or mRNA to determine which member ⁇ of the library the probe hybridizes to.
  • neuropeptide receptor polypeptides and compounds identified above which are polypeptide ⁇ may be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy. "
  • cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
  • a polynucleotide DNA or RNA
  • cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expres ⁇ ion of a polypeptide in vivo by, for example, procedure ⁇ known in the art.
  • a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the pre ⁇ ent invention may be admini ⁇ tered to a patient for engineering cell ⁇ in vivo and expre ⁇ ion of the polypeptide in vivo.
  • the expres ⁇ ion vehicle for engineering cell ⁇ may be other than a retroviru ⁇ , for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
  • Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Viru ⁇ , and mammary tumor viru ⁇ .
  • the retroviral pla ⁇ mid vector i ⁇ derived from Moloney Murine Leukemia Viru ⁇ .
  • the vector include ⁇ one or more promoter ⁇ .
  • Suitable promoter ⁇ which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechni ⁇ ues. Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and j ⁇ -actin promoters) .
  • CMV human cytomegalovirus
  • viral promoters which may be employed include, but are not limited to, adenovirus promoter ⁇ , thymidine kina ⁇ e (TK) promoter ⁇ , and B19 parvovirus promoters.
  • TK thymidine kina ⁇ e
  • B19 parvovirus promoters The selection of a ⁇ uitable promoter will be apparent to tho ⁇ e ⁇ killed in the art from the teachings contained herein.
  • Suitable promoter ⁇ which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter,- heat ⁇ hock promoters; the albumin promoter; the ApoAI promoter,- human globin promoters,- viral thymidine kinase promoters, such as the Herpe ⁇ Simplex thymidine kinase promoter,- retroviral LTRs (including the modified retroviral LTRs hereinabove described) ,- the 0-actin promoter; and human growth hormone promoters.
  • the promoter also includes, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or
  • the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
  • packaging cell ⁇ which may be tran ⁇ fected include, but are not limited to, the PE501, PA317, ⁇ -2 , ⁇ - ⁇ M, PA12, T19-14X, VT-19-17-H2, ⁇ CRE , i ⁇ CRIP, GP+E-86, GP+envAml2, and DAN cell line ⁇ as described in Miller, Human Gene Therapy. Vol. 1, pgs. 5-14 (1990) , which is incorporated herein by reference in its entirety.
  • the vector may tran ⁇ duce the packaging cell ⁇ through any mean ⁇ known in the art.
  • retroviral pla ⁇ mid vector may be encap ⁇ ulated into a lipo ⁇ ome, or coupled to a lipid, and then admini ⁇ tered to a host.
  • the producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence( ⁇ ) encoding the polypeptide ⁇ .
  • retroviral vector particle ⁇ then may be employed, to tran ⁇ duce eukaryotic cells, either in vi tro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence( ⁇ ) encoding the polypeptide.
  • Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cell ⁇ , a ⁇ well a ⁇ hematopoietic stem cell ⁇ , hepatocyte ⁇ , fibrobla ⁇ t ⁇ , myoblasts, keratinocyte ⁇ , endothelial cells, and bronchial epithelial cells.
  • compositions comprise a therapeutically effective amount of the soluble neuropeptide receptor polypeptide or compounds, and a pharmaceutically acceptable carrier or excipient.
  • a carrier include ⁇ but i ⁇ not limited to ⁇ aline, buffered ⁇ aline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • the formulation ⁇ hould ⁇ uit the mode of admini ⁇ tration.
  • the invention al ⁇ o provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical composition ⁇ of the invention.
  • a ⁇ ociated with ⁇ uch container( ⁇ ) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or ⁇ ale of pharmaceutical ⁇ or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the soluble neuropeptide receptor polypeptides or compounds of the present invention may be employed in conjunction with other therapeutic compounds.
  • the pharmaceutical compositions may be admini ⁇ tered in a convenient manner ⁇ uch a ⁇ by the topical, intravenous, intraperitoneal, intramuscular, subcutaneou ⁇ , intrana ⁇ al or intradermal routes.
  • the pharmaceutical compositions are admini ⁇ tered in an amount which i ⁇ effective for treating and/or prophylaxi ⁇ of the specific indication.
  • the pharmaceutical composition ⁇ will be admini ⁇ tered in an amount of at lea ⁇ t about 10 ⁇ g/kg body weight and in mo ⁇ t ca ⁇ e ⁇ they will be admini ⁇ tered in an amount not in exce ⁇ of about 8 mg/Kg body weight per day.
  • the dosage is from about 10 g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
  • the present invention al ⁇ o contemplate ⁇ the use of the genes of the present invention as a diagnostic, for example, some diseases result from inherited defective genes.
  • the ⁇ e gene ⁇ can be detected by comparing the ⁇ equence ⁇ of the defective gene with that of a normal one. Sub ⁇ equently, one can verify that a "mutant" gene i ⁇ a ⁇ sociated with abnormal receptor activity.
  • mutant receptor genes into a suitable vector for expres ⁇ ion in a functional as ⁇ ay ⁇ ystem (e.g., colorimetric as ⁇ ay, expre ⁇ ion on MacConkey plate ⁇ , complementation experiment ⁇ , in a receptor deficient ⁇ train of HEK293 cell ⁇ ) a ⁇ yet another mean ⁇ to verify or identify mutations.
  • a functional as ⁇ ay ⁇ ystem e.g., colorimetric as ⁇ ay, expre ⁇ ion on MacConkey plate ⁇ , complementation experiment ⁇ , in a receptor deficient ⁇ train of HEK293 cell ⁇
  • Nucleic acids used for diagnosis may be obtained from a patient's cell ⁇ , including but not limited to such a ⁇ from blood, urine, saliva, tissue biopsy and autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki, et al., Nature, 324:163-166 1986) prior to analy ⁇ i ⁇ .
  • RNA or cDNA may also be used for the ⁇ ame purpose.
  • PCR primers complimentary to the nucleic acid of the in ⁇ tant invention can be used to identify and analyze mutations in the gene of the pre ⁇ ent invention.
  • deletion ⁇ and in ⁇ ertion ⁇ can be detected by a change in ⁇ ize of the amplified product in compari ⁇ on to the normal genotype.
  • Point mutation ⁇ can be identified by hybridizing amplified DNA to radio labeled RNA of the invention or alternatively, radio labeled antisense DNA sequence ⁇ of the invention.
  • Perfectly matched ⁇ equence ⁇ can be di ⁇ tingui ⁇ hed from mismatched duplexes by RNase A dige ⁇ tion or by difference ⁇ in melting temperatures. Such a diagnostic would be particularly useful for prenatal or even neonatal testing.
  • Sequence differences between the reference gene and "mutants" may be revealed by the direct DNA sequencing method.
  • cloned DNA segment ⁇ may be used a ⁇ probe ⁇ to detect ⁇ pecific DNA ⁇ egment ⁇ .
  • the sensitivity of this method i ⁇ greatly enhanced when combined with PCR.
  • a sequence primer is used with double stranded PCR product or a ⁇ ingle ⁇ tranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures with radio labeled nucleotide or by an automatic sequencing procedure with fluorescent-tags.
  • DNA ⁇ equence difference ⁇ may be achieved by detection of alterations in the electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Sequences changes at specific location ⁇ may al ⁇ o be revealed by nucleu ⁇ protection assay ⁇ , such RNase and Si protection or the chemical cleavage method (e.g. Cotton, et al., PNAS. USA. 85:4397-4401 1985) .
  • ⁇ ome di ⁇ eases are a result of, or are characterized by changes in gene expression which can be detected by changes in the mRNA.
  • the genes of the present invention can be u ⁇ ed a ⁇ a reference to identify individuals expressing a decrease of functions as ⁇ ociated with receptors of thi ⁇ type.
  • the present invention also relates to a diagnostic as ⁇ ay for detecting altered level ⁇ of soluble forms of the neuropeptide receptor polypeptide ⁇ of the pre ⁇ ent invention in variou ⁇ tissues.
  • Assays used to detect levels of the soluble receptor polypeptide ⁇ in a sample derived from a ho ⁇ t are well known to those of skill in the art and include radioimmunoas ⁇ ays, competitive-binding assay ⁇ , Western blot analysis and preferably as ELISA assay.
  • An ELISA assay initially comprises preparing an antibody specific to antigens of the neuropeptide receptor polypeptides, preferably a monoclonal antibody.
  • a reporter antibody is prepared against the monoclonal antibody.
  • a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxida ⁇ e enzyme.
  • the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any neuropeptide receptor proteins attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer.
  • the reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to neuropeptide receptor proteins. Unattached reporter antibody is then washed out.
  • Peroxidase substrates are then added to the dish and the amount of color developed in a given time period i ⁇ a measurement of the amount of neuropeptide receptor proteins present in a given volume of patient sample when compared against a standard curve.
  • sequences of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromo ⁇ ome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNA ⁇ to chromo ⁇ ome ⁇ according to the present invention i ⁇ an important fir ⁇ t ⁇ tep in correlating tho ⁇ e sequences with genes a ⁇ ociated with di ⁇ ease.
  • sequences can be mapped to chromosome ⁇ by preparing PCR primer ⁇ (preferably 15-25 bp) from the cDNA.
  • Computer analy ⁇ i ⁇ of the 3' untranslated region is used to rapidly ⁇ elect primer ⁇ that do not ⁇ pan more than one exon in the genomic DNA, thu ⁇ complicating the amplification proce ⁇ .
  • the ⁇ e primer ⁇ are then used for PCR screening of somatic cell hybrids containing individual human chromosome ⁇ . Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
  • mapping of somatic cell hybrid ⁇ i ⁇ a rapid procedure for a ⁇ igning a particular DNA to a particular chromosome.
  • ⁇ ublocalization can be achieved with panel ⁇ of fragment ⁇ from ⁇ pecific chromosomes or pools of large genomic clones in an analogous manner.
  • Other mapping strategie ⁇ that can ⁇ imilarly be u ⁇ ed to map to it ⁇ chromosome include in situ hybridization, prescreening with labeled flow- ⁇ orted chromo ⁇ ome ⁇ and pre ⁇ election by hybridization to con ⁇ truct chromo ⁇ ome ⁇ pecific-cDNA librarie ⁇ .
  • Fluore ⁇ cence in si tu hybridization (FISH) of a cDNA clone to a metapha ⁇ e chromo ⁇ omal spread can be used to provide a preci ⁇ e chromo ⁇ omal location in one step.
  • This technique can be used with cDNA as short as 50 or 60 base ⁇ .
  • thi ⁇ technique ⁇ ee Verma et al., Human Chromo ⁇ omes: a Manual of Basic Techniques, Pergamon Pres ⁇ , New York (1988) .
  • the above techniques were utilized to map the gene corresponding to the neuropeptide receptor of the present invention to chromosome 1 position 31-34.
  • a cDNA precisely localized to a chromosomal region as ⁇ ociated with the di ⁇ ea ⁇ e could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb) .
  • polypeptides, their fragments or other derivatives, or analogs thereof, or cells expres ⁇ ing them can be u ⁇ ed as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodie ⁇ .
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library.
  • Various procedure ⁇ known in the art may be used for the production of such antibodie ⁇ and fragment ⁇ .
  • Antibodie ⁇ generated again ⁇ t the polypeptide ⁇ corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptide ⁇ to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a ⁇ equence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodie ⁇ can then be u ⁇ ed to i ⁇ olate the polypeptide from tissue expressing that polypeptide.
  • any technique which provides antibodies produced by continuou ⁇ cell line culture ⁇ can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodie ⁇ (Cole, et al., 1985, in Monoclonal Antibodie ⁇ and Cancer Therapy, Alan R. Li ⁇ s, Inc., pp. 77-96).
  • Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmid ⁇ in accord with published procedure ⁇ .
  • equivalent pla ⁇ mid ⁇ to those described are known in the art and will be apparent to the ordinarily skilled artisan.
  • “Digestion” of DNA refer ⁇ to catalytic cleavage of the DNA with a re ⁇ triction enzyme that act ⁇ only at certain sequences in the DNA.
  • the various re ⁇ triction enzyme ⁇ used herein are commercially available and their reaction conditions, cofactors and other requirements were u ⁇ ed a ⁇ would be known to the ordinarily ⁇ killed arti ⁇ an.
  • For analytical purpo ⁇ es typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
  • isolating DNA fragment ⁇ for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume.
  • buffer ⁇ and substrate amounts for particular restriction enzymes are specified by the manufacturer.
  • Incubation time ⁇ of about 1 hour at 37"C are ordinarily u ⁇ ed, but may vary in accordance with the ⁇ upplier' ⁇ in ⁇ truction ⁇ .
  • After dige ⁇ tion the reaction i ⁇ electrophore ⁇ ed directly on a polyacrylamide gel to i ⁇ olate the desired fragment.
  • Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980).
  • Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strand ⁇ which may be chemically ⁇ ynthe ⁇ ized. Such ⁇ ynthetic oligonucleotide ⁇ have no 5' pho ⁇ phate and thu ⁇ will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
  • Ligaation refers to the proce ⁇ s of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T. , et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffer ⁇ and conditions with 10 units to T4 DNA ligase ("liga ⁇ e") per 0.5 ⁇ g of approximately equimolar amount ⁇ of the DNA fragment ⁇ to be ligated.
  • liga ⁇ e T4 DNA ligase
  • ATCC # is initially amplified u ⁇ ing PCR oligonucleotide primer ⁇ corre ⁇ ponding to the 5' and 3' end ⁇ equence ⁇ of the proce ⁇ ed neuropeptide receptor gene (minus the signal peptide ⁇ equence) and the vector sequences 3' to the gene. Additional nucleotides corre ⁇ ponding to neuropeptide receptor nucleotide sequence are added to the 5' and 3' sequence ⁇ respectively.
  • the 5' oligonucleotide primer has the sequence 5' CACTAAAGCTTAATGGAGCCCTCAGCCACC 3' (SEQ ID NO:7) contains a Hind III restriction enzyme site followed by 18 nucleotides of neuropeptide receptor coding sequence starting from the pre ⁇ umed terminal amino acid of the processed protein codon.
  • the restriction enzyme sites correspond to the restriction enzyme site ⁇ on the bacterial expre ⁇ ion vector pQE-9 (Qiagen, Inc. Chat ⁇ worth, CA) .
  • pQE-9 encode ⁇ antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/O) , a ribosome binding site (RBS) , a 6-His tag and restriction enzyme sites.
  • pQE-9 is then digested with Hind III and Xbal.
  • the amplified ⁇ equence ⁇ are ligated into pQE-9 and are in ⁇ erted in frame with the sequence encoding for the hi ⁇ tidine tag and the RBS.
  • the ligation mixture i ⁇ then u ⁇ ed to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure de ⁇ cribed in Sambrook, J.
  • M15/rep4 contain ⁇ multiple copie ⁇ of the pla ⁇ mid pREP4, which expre ⁇ ses the lad repressor and also confer ⁇ kanamycin re ⁇ i ⁇ tance (Kan r ) .
  • Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resi ⁇ tant colonie ⁇ are ⁇ elected. Pla ⁇ mid DNA i ⁇ i ⁇ olated and confirmed by re ⁇ triction analy ⁇ i ⁇ .
  • Clones containing the desired con ⁇ truct ⁇ are grown overnight (0/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) .
  • the O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250.
  • the cells are grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6.
  • IPTG I ⁇ opropyl-B-D-thiogalacto pyrano ⁇ ide
  • IPTG induce ⁇ by inactivating the la repressor, clearing the P/O leading to increased gene expression.
  • Cells are grown an extra 3 to 4 hour ⁇ .
  • Cell ⁇ are then harve ⁇ ted by centrifugation.
  • the cell pellet i ⁇ ⁇ olubilized in the chaotropic agent 6 Molar Guanidine HC1.
  • ⁇ olubilized neuropeptide receptor i ⁇ purified from thi ⁇ ⁇ olution by chromatography on a Nickel-Chelate column under condition ⁇ that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984).
  • the protein i ⁇ eluted from the column in 6 molar guanidine HC1 pH 5.0 and for the purpo ⁇ e of renaturation adjusted to 3 molar guanidine HC1, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hours the protein is dialyzed to 10 mmolar sodium phosphate.
  • Example 2 Expres ⁇ ion of Recombinant Neuropeptide Receptor in COS cells
  • the expre ⁇ ion of plasmid, neuropeptide receptor HA is derived from a vector pcDNA3/Amp (Invitrogen) containing: l) SV40 origin of replication, 2) ampicillin re ⁇ i ⁇ tance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation ⁇ ite.
  • the HA tag correspond ⁇ to an epitope derived from the influenza hemagglutinin protein as previou ⁇ ly de ⁇ cribed (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767) .
  • the infusion of HA tag to the target protein allows ea ⁇ y detection of the recombinant protein with an antibody that recognize ⁇ the HA epitope.
  • ATCC # is con ⁇ tructed by PCR u ⁇ ing two primers: the
  • 5' primer 5' CCTAGGATGCCCCTCTGCTGCAGCGG 3' contains a BamHI site; the 3' sequence 5' ACAAGTCCTTGT CCTTCTAGAGGGC 3' (SEQ ID NO:10) contain ⁇ complementary ⁇ equence ⁇ to an Xbal ⁇ ite, tran ⁇ lation stop codon, and the last 17 nucleotides of the neuropeptide receptor coding ⁇ equence (not including the ⁇ top codon) . Therefore, the PCR product contains a BamHI site, coding sequence, a tran ⁇ lation termination ⁇ top codon and an Xbal site.
  • the PCR amplified DNA fragment and the vector, pcDNA3/Amp, are digested with BamHI and Xbal restriction enzyme ⁇ and ligated.
  • the ligation mixture i ⁇ tran ⁇ formed into E. coli ⁇ train SURE (Stratagene Cloning Sy ⁇ tems, La Jolla, CA) the transformed culture i ⁇ plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA i ⁇ i ⁇ olated from tran ⁇ formant ⁇ and examined by re ⁇ triction analy ⁇ i ⁇ for the pre ⁇ ence of the correct fragment.
  • COS cell ⁇ are tran ⁇ fected with the expre ⁇ sion vector by DEAE-DEXTRAN method (J.
  • the 5' primer has the ⁇ equence 5' CGGGATCCGCCATCATGGAG CCCTCAGCCACC 3' (SEQ ID NO:11) and contain ⁇ a BamHI restriction enzyme site (in bold) followed by 6 nucleotide ⁇ re ⁇ embling an efficient ⁇ ignal for the initiation of tran ⁇ lation in eukaryotic cells (J. Mol. Biol. 1987, 196. 947-950, Kozak, M.) .
  • the initiation codon for translation "ATG” i ⁇ underlined) .
  • the 3' primer ha ⁇ the ⁇ equence 5' ACAAGTCCTTGTC I r AGAGGGC 3' (SEQ ID NO:12) and contain ⁇ the cleavage ⁇ ite for the restriction endonuclease Xbal and 5 nucleotides complementary to the 3' non-translated sequence of the neuropeptide receptor gene.
  • the amplified ⁇ equence ⁇ are i ⁇ olated from a 1% agaro ⁇ e gel u ⁇ ing a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) .
  • the fragment i ⁇ then dige ⁇ ted with the endonuclea ⁇ es BamHI and Xbal and then purified as described in Example 1. Thi ⁇ fragment i ⁇ de ⁇ ignated F2.
  • the vector pA2 (modification of pVL941 vector, di ⁇ cussed below) is used for the expres ⁇ ion of the neuropeptide receptor protein u ⁇ ing the baculoviru ⁇ expre ⁇ ion system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of method ⁇ for baculoviru ⁇ vector ⁇ and in ⁇ ect cell culture procedure ⁇ , Texa ⁇ Agricultural Experimental Station Bulletin NO:l, 3 and 5555) .
  • Thi ⁇ expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhidrosi ⁇ virus (AcMNPV) followed by the recognition sites for the restriction endonuclea ⁇ es BamHI and Xbal.
  • the polyadenylation ⁇ ite of the ⁇ imian virus (SV)40 is used for efficient polyadenylation.
  • the beta-galactosida ⁇ e gene from E.coli i ⁇ in ⁇ erted in the ⁇ ame orientation a ⁇ the polyhedrin promoter followed by the polyadenylation ⁇ ignal of the polyhedrin gene.
  • the polyhedrin ⁇ equence ⁇ are flanked at both ⁇ ide ⁇ by viral ⁇ equence ⁇ for the cell-mediated homologou ⁇ recombination of co-tran ⁇ fected wild-type viral DNA.
  • baculoviru ⁇ vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39) .
  • the plasmid is digested with the restriction enzymes BamHI and Xbal and then dephosphorylated u ⁇ ing calf intestinal phosphatase by procedures known in the art.
  • the DNA i ⁇ then i ⁇ olated from a 1% agaro ⁇ e gel a ⁇ de ⁇ cribed in Example 1. This vector DNA is designated V2.
  • Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase.
  • DH5 ⁇ are then tran ⁇ formed and bacteria identified that contained the pla ⁇ mid (pBac neuropeptide receptor) with the neuropeptide receptor gene u ⁇ ing the enzyme ⁇ BamHI and Xbal .
  • the ⁇ equence of the cloned fragment is confirmed by DNA sequencing.
  • 5 ⁇ g of the plasmid pBac neuropeptide receptor are co- tran ⁇ fected with 1.0 ⁇ g of a commercially available linearized baculoviru ⁇ ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Feigner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987) ) .
  • the plate i ⁇ rocked back and forth to mix the newly added ⁇ olution.
  • the plate i ⁇ then incubated for 5 hour ⁇ at 27°C.
  • the tran ⁇ fection ⁇ olution i ⁇ removed from the plate and 1 ml of Grace' ⁇ in ⁇ ect medium ⁇ upplemented with 10% fetal calf serum is added.
  • the plate i ⁇ put back into an incubator and cultivation continued at 27°C for four day ⁇ .
  • the viru ⁇ i ⁇ added to the cell ⁇ and blue stained plaque ⁇ are picked with the tip of an Eppendorf pipette.
  • the agar containing the recombinant viru ⁇ e ⁇ is then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
  • the agar is removed by a brief centrifugation and the ⁇ upernatant containing the recombinant baculoviruses is used to infect Sf9 cells seeded in 35 mm dishe ⁇ .
  • the ⁇ upernatant ⁇ of the ⁇ e culture di ⁇ hes are harvested and then stored at 4°C.
  • Sf9 cell ⁇ are grown in Grace' ⁇ medium ⁇ upplemented with 10% heat-inactivated FBS.
  • the cells are infected with the recombinant baculovirus V-neuropeptide receptor at a multiplicity of infection (MOD of 2.
  • MOD multiplicity of infection
  • the medium is removed and replaced with SF900 II medium minu ⁇ methionine and cy ⁇ teine (Life Technologie ⁇ Inc., Gaithersburg) . 42 hour ⁇ later 5 ⁇ Ci of 35 S-methionine and 5 ⁇ Ci 35 S cy ⁇ teine (Amer ⁇ ham) are added.
  • the cell ⁇ are further incubated for 16 hour ⁇ before they are harve ⁇ ted by centrifugation and the labelled protein ⁇ vi ⁇ ualized by SDS- PAGE and autoradiography.
  • Fibroblast ⁇ are obtained from a ⁇ ubject by ⁇ kin biop ⁇ y.
  • the fla ⁇ k i ⁇ turned up ⁇ ide down, clo ⁇ ed tight and left at room temperature over night.
  • the fla ⁇ k i ⁇ After 24 hour ⁇ at room temperature, the fla ⁇ k i ⁇ inverted and the chunk ⁇ of ti ⁇ ue remain fixed to the bottom of the fla ⁇ k and fre ⁇ h media (e.g., Ham' ⁇ F12 media, with 10% FBS, penicillin and streptomycin, is added. Thi ⁇ i ⁇ then incubated at 37°C for approximately one week. At thi ⁇ time, fre ⁇ h media i ⁇ added and ⁇ ubsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer i ⁇ trypsinized and scaled into larger fla ⁇ k ⁇ . pMV-7 (Kir ⁇ chmeier, P.T.
  • fre ⁇ h media e.g., Ham' ⁇ F12 media, with 10% FBS, penicillin and streptomycin
  • DNA " , 7:219-25 (1988) flanked by the long terminal repeat ⁇ of the Moloney murine ⁇ arcoma viru ⁇ is digested with EcoRI and Hindlll and ⁇ ub ⁇ equently treated with calf inte ⁇ tinal pho ⁇ phatase.
  • the linear vector is fractionated on agarose gel and purified, u ⁇ ing gla ⁇ s bead ⁇ .
  • the cDNA encoding a polypeptide of the present invention is amplified using PCR primer ⁇ which corre ⁇ pond to the 5' and 3' end ⁇ equences respectively.
  • the 5' primer containing an EcoRI ⁇ ite and the 3' primer having contain ⁇ a Hindlll ⁇ ite.
  • Equal quantities of the Moloney murine sarcoma virus linear backbone and the EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase.
  • the resulting mixture is maintained under conditions appropriate for ligation of the two fragments.
  • the ligation mixture is used to transform bacteria HB101, which are then plated onto agar- containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.
  • the amphotropic pA317 or GP+aml2 packaging cells are grown in ti ⁇ ue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin.
  • DMEM Dulbecco's Modified Eagles Medium
  • CS calf serum
  • the MSV vector containing the gene i ⁇ then added to the media and the packaging cell ⁇ are transduced with the vector.
  • the packaging cells now produce infectiou ⁇ viral particle ⁇ containing the gene (the packaging cell ⁇ are now referred to a ⁇ producer cell ⁇ ) .
  • Media is removed from a ⁇ ub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells.
  • the engineered fibrobla ⁇ t ⁇ are then injected into the ho ⁇ t, either alone or after having been grown to confluence on cytodex 3 microcarrier bead ⁇ .
  • the fibrobla ⁇ t ⁇ now produce the protein product.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • GCCCGTGGCT CCATCCTGGG CATCTGGGCT GTGTCGCTGG CCATCATGGT GCCCCAGGCT 540
  • CTCAGTGGCA AATTCCGGGA GCAGTTTAAG GCTGCCTTCT CCTGCTGCCT GCCTGGCCTG 1140
  • GCCCGTGGCT CCATCCTGGG CATCTGGGCT GTGTCGCTGG CCATCATGGT GCCCCAGGCT 540
  • CTCTGTCATG AACGCTGGGC AGATGACCTC TATCCCAAGA TCTACCACAG TTGCTTCTTT 660
  • GCCCGTGGCT CCATCCTGGG CATCTGGGCT GTGTCGCTGG CCATCATGGT GCCCCAGGCT 540
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO: 7: CACTAAAGCT TAATGGAGCC CTCAGCCACC 30
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:8: ACAAGTCCTT GTCCTTCTAG AGGGC 25
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO: 9: CCTAGGATGC CCCTCTGCTG CAGCGG 26
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:11: CGGGATCCGC CATCATGGAG CCCTCAGCCA CC 32
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:12: ACAAGTCCTT GTCCTTCTAG AGGGC 25

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Endocrinology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne des polypeptides récepteurs de neuropeptides humains et l'ADN (ARN) les codant, ainsi qu'une procédure de production desdits polypeptides par des techniques de recombinaison. Elle porte aussi sur des méthodes d'utilisation desdits polypeptides pour identifier des antagonistes et des agonistes dirigés contre lesdits polypeptides, ainsi que sur des méthodes d'utilisation des agonistes et antagonistes pour le traitement curatif d'états liés respectivement à la sous-expression et la surexpression des polypeptides récepteurs de neuropeptides. Elle se rapporte encore à des méthodes diagnostiques pour détecter une mutation dans les séquences nucléotidiques du récepteur de neuropeptides et un niveau modifié de la forme soluble des récepteurs.
PCT/US1995/005616 1995-05-05 1995-05-05 Recepteur de neuropeptides humain WO1996034877A1 (fr)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CA002220036A CA2220036A1 (fr) 1995-05-05 1995-05-05 Recepteur de neuropeptides humain
KR1019970707846A KR19990008320A (ko) 1995-05-05 1995-05-05 사람 뉴로펩티드 수용체
PCT/US1995/005616 WO1996034877A1 (fr) 1995-05-05 1995-05-05 Recepteur de neuropeptides humain
EP95918991A EP0828751A4 (fr) 1995-05-05 1995-05-05 Recepteur de neuropeptides humain
JP8533257A JPH11505110A (ja) 1995-05-05 1995-05-05 ヒトニューロペプチドレセプター
AU24707/95A AU715286B2 (en) 1995-05-05 1995-05-05 Human neuropeptide receptor
US08/462,509 US6410701B1 (en) 1995-05-05 1995-06-05 Human neuropeptide receptor
US09/393,696 US20030022277A1 (en) 1995-05-05 1999-09-10 Human neuropeptide receptor
US10/077,874 US20020115155A1 (en) 1995-05-05 2002-02-20 Human neuropeptide receptor
US11/758,687 US20080027020A1 (en) 1995-05-05 2007-06-06 Human Neuropeptide Receptor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CA002220036A CA2220036A1 (fr) 1995-05-05 1995-05-05 Recepteur de neuropeptides humain
PCT/US1995/005616 WO1996034877A1 (fr) 1995-05-05 1995-05-05 Recepteur de neuropeptides humain

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US08/462,509 Continuation-In-Part US6410701B1 (en) 1995-05-05 1995-06-05 Human neuropeptide receptor

Publications (1)

Publication Number Publication Date
WO1996034877A1 true WO1996034877A1 (fr) 1996-11-07

Family

ID=25679790

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1995/005616 WO1996034877A1 (fr) 1995-05-05 1995-05-05 Recepteur de neuropeptides humain

Country Status (3)

Country Link
EP (1) EP0828751A4 (fr)
CA (1) CA2220036A1 (fr)
WO (1) WO1996034877A1 (fr)

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0849361A2 (fr) * 1996-12-17 1998-06-24 Smithkline Beecham Corporation Nouveaux ligands du recepteur de neuropeptides HFGAN72
WO1998047514A1 (fr) * 1997-04-24 1998-10-29 Merck Sharp & Dohme Limited Utilisation d'un antagoniste du recepteur nk-1 et d'un inhibiteur selectif de reabsorption de la serotonine (ssri) dans le traitement de l'obesite
EP0875565A2 (fr) * 1997-04-30 1998-11-04 Smithkline Beecham Corporation Nouveau récepteur couplé à la protéine G (HFGAN72Y)
EP0875566A2 (fr) * 1997-04-30 1998-11-04 Smithkline Beecham Corporation Nouveau récepteur couplé à la protéine G
EP0884387A2 (fr) * 1997-06-11 1998-12-16 Smithkline Beecham Corporation Récepteur 7-transmembrane humain HLWAR77
EP0893498A2 (fr) * 1997-07-25 1999-01-27 Smithkline Beecham Corporation Clone de cADN MY1 codant pour un récepteur 7-transmembranaire humain
WO1999030670A2 (fr) * 1997-12-15 1999-06-24 Smithkline Beecham Plc Procedes de traitement utilisant de nouveaux ligands du recepteur hfgan72 de neuropeptides et leurs agonistes ou antagonistes
US6001963A (en) * 1996-12-17 1999-12-14 Smithkline Beecham Corporation Ligands of the neuropeptide receptor HFGAN72
WO2000000606A1 (fr) * 1998-06-29 2000-01-06 Garvan Institute Of Medical Research Gene du recepteur npy-y7
WO2000047284A2 (fr) * 1999-02-12 2000-08-17 Smithkline Beecham P.L.C. Nouvelle utilisation des antagonistes des recepteurs de l'orexine
WO2001017532A1 (fr) * 1999-09-10 2001-03-15 Human Genome Sciences, Inc. Recepteur humain du neuropeptide
WO2001030991A2 (fr) * 1999-10-25 2001-05-03 Decode Genetics Ehf. Gene narcoleptique humain
US6319710B1 (en) 1999-08-23 2001-11-20 Decode Genetics Ehf. Human narcolepsy gene
WO2002015941A1 (fr) * 2000-08-25 2002-02-28 Hormos Medical Corporation Procede pour reduire la surproduction de neuropeptide y chez une personne
US6410701B1 (en) 1995-05-05 2002-06-25 Human Genome Sciences, Inc. Human neuropeptide receptor
EP1956020A2 (fr) 2001-05-05 2008-08-13 Smithkline Beecham Plc Dérivés 1-[2-(hétérocyclyl-aminométhyl)-pipéridin-1-YL]-1-(2-méthyl-5-phényl-hétérocyclyl)- méthanone et composés similaires en tant que antagonists oréxin-1 pour le traitement de la obesité
WO2010072722A1 (fr) 2008-12-23 2010-07-01 Glaxo Group Limited Dérivés de pipéridine pouvant être utilisés en tant qu'agonistes de l'orexine
WO2010122151A1 (fr) 2009-04-24 2010-10-28 Glaxo Group Limited 3 -azabicyclo [4.1.0] heptanes utilisés comme antagonistes de l'orexine
WO2011023578A1 (fr) 2009-08-24 2011-03-03 Glaxo Group Limited Dérivés de 5-méthylpipéridine comme antagonistes de récepteurs à orexines pour le traitement d'un trouble du sommeil
WO2011023585A1 (fr) 2009-08-24 2011-03-03 Glaxo Group Limited Dérivés de pipéridine utilisés comme antagonistes d'orexines
US8093255B2 (en) 2008-10-09 2012-01-10 Glaxo Group Limited Imidazo[1,2-A]pyrimidines as orexin receptor antagonists
US8129384B2 (en) 2008-10-09 2012-03-06 Glaxo Group Limited Imidazo[1,2-a]pyrazines as orexin receptor antagonists
WO2012039371A1 (fr) 2010-09-22 2012-03-29 エーザイ・アール・アンド・ディー・マネジメント株式会社 Composé de cyclopropane
WO2012089607A1 (fr) 2010-12-28 2012-07-05 Glaxo Group Limited Nouveaux composés dotés d'un cœur 3a-azabicyclo[4.1.0]heptane agissant sur les récepteurs d'orexine
WO2012089606A1 (fr) 2010-12-28 2012-07-05 Glaxo Group Limited Dérivés azabicyclo [4.1.0] hept-4-yle en tant qu'antagonistes du récepteur humain de l'orexine
KR20170035917A (ko) 2014-08-06 2017-03-31 에자이 알앤드디 매니지먼트 가부시키가이샤 피리미딘-1-올 화합물의 제조 방법, 및 이의 중간체
US10188652B2 (en) 2014-10-23 2019-01-29 Eisai R&D Management Co., Ltd. Compositions and methods for treating insomnia
WO2021127359A1 (fr) 2019-12-20 2021-06-24 Eisai R&D Management Co., Ltd. Utilisation de lemborexant pour le traitement de l'insomnie
WO2022014680A1 (fr) 2020-07-17 2022-01-20 エーザイ・アール・アンド・ディー・マネジメント株式会社 Composé de pipéridine substitué et son application
KR20220061950A (ko) 2019-09-13 2022-05-13 에자이 알앤드디 매니지먼트 가부시키가이샤 불면증을 치료하기 위한 약제학적 조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0804575A1 (fr) * 1994-08-11 1997-11-05 Takeda Chemical Industries, Ltd. Proteine receptrice couplee a une proteine g, sa production et son utilisation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FASEB JOURNAL, Volume 8, issued January 1994, LaNOUE et al., "Abnormal A Adenosine Receptor Function in Genetic Obesity", pages 72-80. *
See also references of EP0828751A4 *

Cited By (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6410701B1 (en) 1995-05-05 2002-06-25 Human Genome Sciences, Inc. Human neuropeptide receptor
USRE40988E1 (en) * 1996-12-17 2009-11-17 Smithkline Beecham Corporation Ligands of the neuropeptide receptor HFGAN72
US6001963A (en) * 1996-12-17 1999-12-14 Smithkline Beecham Corporation Ligands of the neuropeptide receptor HFGAN72
EP0849361A3 (fr) * 1996-12-17 2000-04-19 Smithkline Beecham Corporation Nouveaux ligands du recepteur de neuropeptides HFGAN72
EP0849361A2 (fr) * 1996-12-17 1998-06-24 Smithkline Beecham Corporation Nouveaux ligands du recepteur de neuropeptides HFGAN72
WO1998047514A1 (fr) * 1997-04-24 1998-10-29 Merck Sharp & Dohme Limited Utilisation d'un antagoniste du recepteur nk-1 et d'un inhibiteur selectif de reabsorption de la serotonine (ssri) dans le traitement de l'obesite
US6162805A (en) * 1997-04-24 2000-12-19 Merck Sharp & Dohme Limited Use of an NK-1 receptor antagonist and an SSRI for treating obesity
EP1156110A3 (fr) * 1997-04-30 2003-12-10 Smithkline Beecham Corporation Récepteur couplé à une protéine G (HFGAN72Y)
EP0875565A2 (fr) * 1997-04-30 1998-11-04 Smithkline Beecham Corporation Nouveau récepteur couplé à la protéine G (HFGAN72Y)
EP1156110A2 (fr) * 1997-04-30 2001-11-21 Smithkline Beecham Corporation Récepteur couplé à une protéine G (HFGAN72Y)
US5935814A (en) * 1997-04-30 1999-08-10 Smithkline Beecham Corporation Polynucleotides encoding HFGAN72Y receptor
EP0875566A3 (fr) * 1997-04-30 1999-12-29 Smithkline Beecham Corporation Nouveau récepteur couplé à la protéine G
EP0875565A3 (fr) * 1997-04-30 1999-12-29 Smithkline Beecham Corporation Nouveau récepteur couplé à la protéine G (HFGAN72Y)
EP1154019A3 (fr) * 1997-04-30 2003-05-28 SmithKline Beecham Corporation Récepteur couplé à une protéine G (HFGAN72X)
US6020157A (en) * 1997-04-30 2000-02-01 Smithkline Beecham Corporation Polynucleotides encoding HFGAN72X receptor
EP0875566A2 (fr) * 1997-04-30 1998-11-04 Smithkline Beecham Corporation Nouveau récepteur couplé à la protéine G
EP0884387A3 (fr) * 1997-06-11 2000-07-05 Smithkline Beecham Corporation Récepteur 7-transmembrane humain HLWAR77
EP0884387A2 (fr) * 1997-06-11 1998-12-16 Smithkline Beecham Corporation Récepteur 7-transmembrane humain HLWAR77
EP0893498A2 (fr) * 1997-07-25 1999-01-27 Smithkline Beecham Corporation Clone de cADN MY1 codant pour un récepteur 7-transmembranaire humain
EP0893498A3 (fr) * 1997-07-25 2000-01-26 Smithkline Beecham Corporation Clone de cADN MY1 codant pour un récepteur 7-transmembranaire humain
US6166193A (en) * 1997-07-25 2000-12-26 Board Of Regents, University Of Texas System Polynucleotides encoding MY1 receptor
WO1999030670A2 (fr) * 1997-12-15 1999-06-24 Smithkline Beecham Plc Procedes de traitement utilisant de nouveaux ligands du recepteur hfgan72 de neuropeptides et leurs agonistes ou antagonistes
WO1999030670A3 (fr) * 1997-12-15 1999-08-19 Smithkline Beecham Plc Procedes de traitement utilisant de nouveaux ligands du recepteur hfgan72 de neuropeptides et leurs agonistes ou antagonistes
US6664229B2 (en) 1997-12-15 2003-12-16 Smithkline Beecham P.L.C. Methods for treatment using novel ligands of the neuropeptide receptor HFGAN72
US6803232B1 (en) 1998-06-29 2004-10-12 The Garvan Institute Of Medical Research NPY-Y7 receptor gene
WO2000000606A1 (fr) * 1998-06-29 2000-01-06 Garvan Institute Of Medical Research Gene du recepteur npy-y7
WO2000047284A2 (fr) * 1999-02-12 2000-08-17 Smithkline Beecham P.L.C. Nouvelle utilisation des antagonistes des recepteurs de l'orexine
EP1352651A3 (fr) * 1999-02-12 2003-11-12 Smithkline Beecham Plc Nouvelle utilisation des antagonistes des récepteurs d'orexine
WO2000047284A3 (fr) * 1999-02-12 2000-12-14 Smithkline Beecham Plc Nouvelle utilisation des antagonistes des recepteurs de l'orexine
US6506774B1 (en) 1999-02-12 2003-01-14 Smithkline Beecham P.L.C. Use of orexin receptor antagonists
EP1352651A2 (fr) * 1999-02-12 2003-10-15 Smithkline Beecham Plc Nouvelle utilisation des antagonistes des récepteurs d'orexine
US6319710B1 (en) 1999-08-23 2001-11-20 Decode Genetics Ehf. Human narcolepsy gene
EP1223946A1 (fr) * 1999-09-10 2002-07-24 Human Genome Sciences Recepteur humain du neuropeptide
EP1223946A4 (fr) * 1999-09-10 2003-05-07 Human Genome Sciences Inc Recepteur humain du neuropeptide
WO2001017532A1 (fr) * 1999-09-10 2001-03-15 Human Genome Sciences, Inc. Recepteur humain du neuropeptide
US6410712B1 (en) 1999-10-25 2002-06-25 Decode Genetics Ehf. Human narcolepsy gene
WO2001030991A3 (fr) * 1999-10-25 2001-12-06 Decode Genetics Ehf Gene narcoleptique humain
WO2001030991A2 (fr) * 1999-10-25 2001-05-03 Decode Genetics Ehf. Gene narcoleptique humain
WO2002015941A1 (fr) * 2000-08-25 2002-02-28 Hormos Medical Corporation Procede pour reduire la surproduction de neuropeptide y chez une personne
EP1956020A2 (fr) 2001-05-05 2008-08-13 Smithkline Beecham Plc Dérivés 1-[2-(hétérocyclyl-aminométhyl)-pipéridin-1-YL]-1-(2-méthyl-5-phényl-hétérocyclyl)- méthanone et composés similaires en tant que antagonists oréxin-1 pour le traitement de la obesité
US8129384B2 (en) 2008-10-09 2012-03-06 Glaxo Group Limited Imidazo[1,2-a]pyrazines as orexin receptor antagonists
US8093255B2 (en) 2008-10-09 2012-01-10 Glaxo Group Limited Imidazo[1,2-A]pyrimidines as orexin receptor antagonists
WO2010072722A1 (fr) 2008-12-23 2010-07-01 Glaxo Group Limited Dérivés de pipéridine pouvant être utilisés en tant qu'agonistes de l'orexine
WO2010122151A1 (fr) 2009-04-24 2010-10-28 Glaxo Group Limited 3 -azabicyclo [4.1.0] heptanes utilisés comme antagonistes de l'orexine
WO2011023578A1 (fr) 2009-08-24 2011-03-03 Glaxo Group Limited Dérivés de 5-méthylpipéridine comme antagonistes de récepteurs à orexines pour le traitement d'un trouble du sommeil
WO2011023585A1 (fr) 2009-08-24 2011-03-03 Glaxo Group Limited Dérivés de pipéridine utilisés comme antagonistes d'orexines
US8268848B2 (en) 2010-09-22 2012-09-18 Eisai R&D Management Co., Ltd. Cyclopropane compound
WO2012039371A1 (fr) 2010-09-22 2012-03-29 エーザイ・アール・アンド・ディー・マネジメント株式会社 Composé de cyclopropane
WO2012089607A1 (fr) 2010-12-28 2012-07-05 Glaxo Group Limited Nouveaux composés dotés d'un cœur 3a-azabicyclo[4.1.0]heptane agissant sur les récepteurs d'orexine
WO2012089606A1 (fr) 2010-12-28 2012-07-05 Glaxo Group Limited Dérivés azabicyclo [4.1.0] hept-4-yle en tant qu'antagonistes du récepteur humain de l'orexine
KR20170035917A (ko) 2014-08-06 2017-03-31 에자이 알앤드디 매니지먼트 가부시키가이샤 피리미딘-1-올 화합물의 제조 방법, 및 이의 중간체
US10188652B2 (en) 2014-10-23 2019-01-29 Eisai R&D Management Co., Ltd. Compositions and methods for treating insomnia
US10702529B2 (en) 2014-10-23 2020-07-07 Eisai R&D Management Co., Ltd. Compositions and methods for treating insomnia
US11026944B2 (en) 2014-10-23 2021-06-08 Eisai R&D Management Co., Ltd. Compositions and methods for treating insomnia
KR20220061950A (ko) 2019-09-13 2022-05-13 에자이 알앤드디 매니지먼트 가부시키가이샤 불면증을 치료하기 위한 약제학적 조성물
WO2021127359A1 (fr) 2019-12-20 2021-06-24 Eisai R&D Management Co., Ltd. Utilisation de lemborexant pour le traitement de l'insomnie
WO2022014680A1 (fr) 2020-07-17 2022-01-20 エーザイ・アール・アンド・ディー・マネジメント株式会社 Composé de pipéridine substitué et son application
US11479552B2 (en) 2020-07-17 2022-10-25 Eisai R&D Management Co., Ltd. Substituted piperidine compounds and their use
KR20230040953A (ko) 2020-07-17 2023-03-23 에자이 알앤드디 매니지먼트 가부시키가이샤 치환된 피페리딘 화합물 및 이의 적용례

Also Published As

Publication number Publication date
EP0828751A4 (fr) 1999-01-20
CA2220036A1 (fr) 1996-11-07
EP0828751A1 (fr) 1998-03-18

Similar Documents

Publication Publication Date Title
WO1996034877A1 (fr) Recepteur de neuropeptides humain
WO1996034095A1 (fr) Recepteurs du facteur de necrose tumorale chez l'homme
WO1996039515A9 (fr) Facteur de croissance endotheliale vasculaire 2 humain
EP0815137A1 (fr) Chemokine recepteur hdgnr10 aux proteines g humaines
EP0817800A1 (fr) Recepteurs couples par une proteine-g humaine
WO1996028546A1 (fr) Recepteur humain du facteur de necrose tumorale
WO1996016087A1 (fr) Recepteur couple a la proteine g
US20080027020A1 (en) Human Neuropeptide Receptor
WO1996039439A1 (fr) Hcegh45, recepteur de proteines g humaines
WO1996039442A1 (fr) Htnad29 recepteurs de proteines g
US5958729A (en) Human G-protein receptor HCEGH45
WO1996006862A1 (fr) Sous-unite epsilon de recepteur gaba¿a?
WO1996039438A1 (fr) Recepteur hibeb69 de proteines g
WO1997018224A1 (fr) Antigene 2 de cellules-souches humaines
EP0833846A1 (fr) Recepteur couple de proteines g humaines (hetgq23)
EP0832124A1 (fr) Recepteur d'amines humaines
AU763711B2 (en) Human neuropeptide receptor
US5928890A (en) Human amine receptor
AU715286B2 (en) Human neuropeptide receptor
US20030165901A1 (en) Human G-protein receptor HGBER32
AU716415B2 (en) Pineal gland specific gene-1
AU760468B2 (en) G-protein receptor HTNAD29
WO1997017358A1 (fr) Proteine de transformation mammaire
AU2003259580A1 (en) Human Neuropeptide Receptor
US20020146778A1 (en) Pineal gland specific gene-1

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 95197841.1

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA CN JP KR MX NZ US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2220036

Country of ref document: CA

Ref document number: 2220036

Country of ref document: CA

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 1996 533257

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1019970707846

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 1995918991

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1995918991

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1019970707846

Country of ref document: KR

WWR Wipo information: refused in national office

Ref document number: 1019970707846

Country of ref document: KR