AU715286B2 - Human neuropeptide receptor - Google Patents

Description

WO 96/34877 PCT/US95/05616 HUMAN NEUROPEPTIDE RECEPTOR This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. The polypeptides of the present invention are human 7-transmembrane G-protein coupled receptors. More particularly, the polypeptides of the present invention are neuropeptide receptor polypeptides, sometimes hereinafter referred to as neuropeptide receptor polypeptides. The invention also relates to inhibiting the action of such polypeptides.

Obesity is the commonest nutritional disorder in Western societies. More than three in ten adult Americans weigh at least 20% in excess of their ideal body weight (Burroa, M., The New York Times, 17 July 1994). Increased body weight is an important public health problem because it is associated with Type II diabetes, hypertension, hyperlipidemia and certain cancers (Grundy, and Barnett, Disease-a- Month, 36:645-696 (1990)).

Five single-gene mutations in the mouse obesity gene (ob) which result in an obese phenotype have been described (Friedman, J.M. Leibel, R. Cell, 66:217-220 (1990)).

The cloning and sequencing of the mouse ob gene and its human -1- WO 96/34877 PCTIS95/05616 homologue have been reported (Zhang, et al., Nature, 372:425-431 (1994)). The ob gene encodes a 4.5-kb adipose tissue mRNA with a highly conserved 167-amino-acid open reading frame. The predicted amino-acid sequence is 84% identical between human and mouse and has features of a secreted protein. The ob gene product may function as part of a signalling pathway from adipose tissue that acts to regulate the size of the body fat depot (id. 425).

Of the brain regions implicated in the regulation of feeding behavior, the ventromedial nucleus of the hypothalamus (VMH) is considered to be the most important satiety center in the central nervous system (CNS). The energy balance in mammals is therefore postulated to be controlled by a feedback loop in which the amount of stored energy is sensed by the hypothalamus, which adjusts food intake and energy expenditure to maintain a constant body weight (Ombeck, Yale J. Biol. Med., 20:545-552 (1948) and Kennedy, Proc. R. Soc.148:578-592 (1953)). In the lipostasis theory, the size of the body fat depot is regulated by the CNS, with a product of body fat metabolism affecting energy balance by interacting with the hypothalamus (Kennedy, Proc. R. Soc.148:578-592 (1953)).

The inability to identify the putative signal from fat has hindered the validation of the lipostasis theory. The possibility that at least one component of the signalling system circulates in the bloodstream was first suggested by Hervey (Dietrich, et al., Genetics, 131:423-447 (1992)), who showed that the transfer of blood from an animal with a VMH lesion across a vascular graft to an untreated animal (a parabiosis experiment) resulted in a reduction of food intake in the intact animal. It is now significant that there is evidence that the ob gene product is secreted, suggesting that ob may encode this circulating factor.

The ob signal may act directly or indirectly on the CNS to inhibit food intake and/or regulate energy expenditure as -2- WO 96/34877 PCT/US95/05616 part of a homeostatic mechanism to maintain constancy of the adipose mass (Zhang, et al., Nature, 372:425-431, 431 (1994)). The ob gene apparently encodes a protein secreted by fat, and mutations apparently prevent translation or expression of the gene (Rink, Nature, 372:406-407 (1994)).

Parabiosis experiments suggest that the ob receptor is encoded by the mouse db (diabetes) gene (Coleman, D.L., Diabetologia, 14:141-148 (1978)). Mice having a mutation in the db gene are also obese, with the defect possibly being a receptor defect. (Id. at 406).

Neuropeptide Y is similar to the ob gene product in that it mediates the feeding response. Neuropeptide Y acts on at least four types of neuropeptide Y receptors called Y 3 and an atypical YI receptor, which mediates the feeding response stimulated by neuropeptide Y.

Neuropeptide Y has a wide range of biological functions.

Neuropeptide Y is found to be widely distributed in the central nervous system (CNS) and the peripheral nervous system (PNS). In the PNS, neuropeptide Y is found in the noradrenergic sympathetic innervation of blood vessels and other smooth muscle tissues and in neurons within the enteric nervous system. Neuropeptide Y immunoreactive fibers also occur in the non-vascular smooth muscle, surrounding exocrine glands and surface epithelia. Neuropeptide Y also occurs in subpopulations of neurons and is generally co-localized with other neurotransmitters, particular noradrenaline.

In the CNS, neuropeptide Y is contained in GABAergic interneurons in higher centers and in predominantly catecholaminergic cells that project further caudally. For example, neuropeptide Y is contained in interneurons in the cortex, hippocampus, amygdala, basal forebrain and striatum, whereas in the brain stem, neuropeptide Y is contained in noradrenergic neurons of the A, and A 2 groups in the medulla, and the locus coeruleus In the hypothalamus, WO 96/34877 PCTIUS95/05616 neuropeptide Y is found predominantly in the arcuate nucleus and lateral hypothalamus.

Within the peripheral nervous system, neuropeptide Y is present in postganglionic sympathetic nerves, and is colocalized as stated above with other neurotransmitters, including catecholamines. When used pharmacologically, neuropeptide Y has been shown to have a potent vasoconstrictor activity as well as dramatically potentiating the vasoconstriction caused by many other pressor agents.

Particularly high concentrations of neuropeptide Y are found in the sympathetic nerves supplying the coronary, cerebral and renal vasculature and when infused into these vascular beds, neuropeptide Y causes prolonged vasoconstriction that is not reversed by adrenergic blocking agents. These observations have lead to the proposal that neuropeptide Y is the candidate transmitter for pathological vasospasm, a major cause of morbidity and mortality when involving the coronary and cerebral vessels.

Neuropeptide Y also appears to be involved in interaction with the renin angiotensin system. Neuropeptide Y containing sympathetic nerve terminals are found on the juxta-glomerular apparatus of the renal cortex and neuropeptide Y influences renin release. These data, together with the demonstration of all durations in neuropeptide Y concentrations in hypertensive animal models and the pressor response to infusion of the peptide, have resulted in implications of this peptide in hypertension.

Within the central nervous system neuropeptide Y is located predominantly within interneurons where it appears to have a regulatory role. It therefore has widespread and diverse effects including effects on memory and a possible role in Alzheimer's disease. Neuropeptide Y is the most potent known substance to cause an increase in feeding and may play a role in the genetic basis of Type II Diabetes Mellitus. Neuropeptide Y may also play a role as a WO 96/34877 PCTIUS95/05616 regulatory agent and pituitary function as well as potential neuromodulatory function in stress responses and in reproductive function.

In accordance with one aspect of the present invention, there are provided novel mature receptor polypeptides as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof. The receptor polypeptides of the present invention are of human origin.

In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding the receptor polypeptides of the present invention, including mRNAs, DNAs, cDNAs, genomic DNA as well as antisense analogs thereof and biologically active and diagnostically or therapeutically useful fragments thereof.

In accordance with a further aspect of the present invention, there are provided processes for producing such receptor polypeptides by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing nucleic acid sequences encoding the receptor polypeptides of the present invention, under conditions promoting expression of said polypeptides and subsequent recovery of said polypeptides.

In accordance with yet a further aspect of the present invention, there are provided antibodies against such receptor polypeptides.

In accordance with another aspect of the present invention there are provided methods of screening for compounds which bind to and activate or inhibit activation of the receptor polypeptides of the present invention.

In accordance with still another embodiment of the present invention there are provided processes of administering compounds to a host which bind to and activate the receptor polypeptide of the present invention which are useful in the prevention and/or treatment of obesity, WO 96/34877 PCTIUlS95/05616 hyperlipidemia, certain cancers, to stimulate neuronal growth, to regulate neurotransmission, to enhance activity levels and utilization of ingested foods.

In accordance with another aspect -of the present invention there is provided a method of administering the receptor polypeptides of the present invention via gene therapy to treat conditions related to underexpression of the polypeptides or underexpression of a ligand to the receptor polypeptide.

In accordance with still another embodiment of the present invention there are provided processes of administering compounds to a host which bind to and inhibit activation of the receptor polypeptides of the present invention which are useful in the prevention and/or treatment of Alzheimer's disease, Type II Diabetes Mellitus, epilepsy, stress, anxiety, hypertension, cardiovascular disease, psychotic conditions and obesity caused by neuropeptide

Y.

In accordance with yet another aspect of the present invention, there are provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the polynucleotide sequences of the present invention.

In accordance with still another aspect of the present invention, there are provided diagnostic assays for detecting diseases related to mutations in the nucleic acid sequences encoding such polypeptides and for detecting an altered level of the soluble form of the receptor polypeptides.

In accordance with yet a further aspect of the present invention, there are provided processes for utilizing such receptor polypeptides, or polynucleotides encoding such polypeptides, for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors.

These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

WO 96/34877 PCTUS95/05616 The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

Figure 1 shows the cDNA sequence and the corresponding deduced amino acid sequence of the neuropeptide receptor polypeptide of the present invention. The standard oneletter abbreviation for amino acids is used. Sequencing was performed using a 373 Automated DNA sequencer (Applied Biosystems, Inc.).

Figure 2 shows the cDNA sequence and the corresponding deduced amino acid sequence of the neuropeptide receptor splice variant 1 polypeptide of the present invention. The standard one-letter abbreviation for amino acids is used.

Figure 3 shows the cDNA sequence and the corresponding deduced amino acid sequence of the neuropeptide receptor splice variant 2 polypeptide of the present invention. The standard one-letter abbreviation for amino acids is used.

Figure 4 illustrates the amino acid sequence and seven transmembrane regions of the neuropeptide receptor. The transmembrane regions are underlined and denoted with a TM.

Figure 5 illustrates the amino acid sequence and seven transmembrane regions of the neuropeptide receptor splice variant 1. The transmembrane regions are underlined and denoted with a TM.

Figure 6 illustrates the amino acid sequence and seven transmembrane regions of the neuropeptide receptor splice variant 2. The transmembrane regions are underlined and denoted with a TM.

Figure 7 shows the amino acid homology between the human neuropeptide receptor polypeptide of the present invention (and the human neuropeptide Y, receptor).

The receptor polypeptides of the present invention are receptors for ligands, both known and unknown, which modulate the activity of cells in both the central nervous system and peripheral tissues regulated by the central nervous system.

-7- PCT/US9 5 05616 IPEA/US 3 1 MAR 1997 Examples of such ligands are neuropeptide Y, substance P, the human ob gene product and neurokinin B. Accordingly, modulation of the activity of receptor polypeptides of the present invention will have a broad range of therapeutic and diagnostic applications, particularly with respect to the treatment of obesity.

The present inventors have isolated a full-length cDNA clone encoding a human neuropeptide receptor polypeptide.

The present full-length cDNA has been mapped to a location on human chromosome 1 position p31-34 which corresponds to a location on the mouse chromosome 4 where the db gene is found. The mouse db gene is thought to encode the receptor for the obesity gene product.

In accordance with an aspect of the present invention, there are provided isolated nucleic acids (polynucleotides) which encode for the mature polypeptide having the deduced amino acid sequence of Figures 2 (SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone (s) deposited as ATCC Deposit No. 97128 on April 28, 1995.

The polynucleotide of this invention was discovered in a cDNA library derived from human adult hypothalamus. It is structurally related to the G protein-coupled receptor family. The neuropeptide receptor polypeptide contains an open reading frame encoding a protein of 402 amino acid residues. The neuropeptide receptor protein exhibits the highest degree of homology to human neuropeptide Y 1 receptor protein with 52 similarity and 26 identity over the entire amino acid sequence.

The polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be doublestranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequences which encode the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID -8- AMEt)ED S EET WO 96/34877 PCT/US95/05616 NO:1) or that of the deposited clone(s) or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:1) or the deposited cDNA(s).

The polynucleotides which encode for the mature polypeptide of Figure 2 (SEQ ID NO:2) or for the mature polypeptide encoded by the deposited cDNA(s) may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.

Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.

The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptides having the deduced amino acid sequence of Figure 2 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone(s). The variants of the polynucleotide may be naturally occurring allelic variants of the polynucleotides or non-naturally occurring variants of the polynucleotides.

Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 2 (SEQ ID NO:2) or the same mature polypeptide encoded by the cDNA of the deposited clone(s) as well as variants of such polynucleotide which variants encode for a fragment, derivative or analog of the polypeptide of Figure 2 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone(s). Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants. Specific examples of such variants include the WO 96/34877 PCTIU7S95/05616 polynucleotide sequences as set forth in SEQ ID NOS:3 and which encode for splice variant 1 and 2, respectively, of the polypeptide of the present invention.

As hereinabove indicated, the polynucleotides may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID NO:1) or of the coding sequence of the deposited clone(s).

As known in the art, an allelic variant is an alternate form of polynucleotide sequences which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptides.

The polynucleotides may also encode for a soluble form of the neuropeptide receptor polypeptide which is the extracellular portion of the polypeptide which has been cleaved from the TM and intracellular domain of the fulllength polypeptide of the present invention.

The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexahistidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, et al., Cell, 37:767 (1984)).

The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least and more preferably at least 95% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein used, WO 96/34877 PCTIUJS9505616 the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SEQ ID NO:1) or the deposited cDNA(s), i.e. function as a soluble neuropeptide receptor by retaining the ability to bind the ligands for the receptor even though the polypeptide does not function as a membrane bound neuropeptide receptor, for example, by eliciting a second messenger response.

Alternatively, the polynucleotides may be polynucleotides which have at least 20 bases, preferably bases and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which have an identity thereto, as hereinabove described, and which does not retain activity. Such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO: 1, or for variants thereof, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.

The deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. §112.

The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.

-11- WO 96/34877 PCTIUS95/05616 The present invention further relates to a polypeptide which has the deduced amino acid sequence of Figure 2 (SEQ ID NO:2) or which has the amino acid sequence encoded by the deposited cDNA(s), as well as fragments, analogs and derivatives of such polypeptide.

The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 2 (SEQ ID NO:2) or that encoded by the deposited cDNA(s), means polypeptides which either retain substantially the same biological function or activity as such polypeptides, function as a soluble neuropeptide receptor by retaining the ability to bind the ligands of the receptors even though the polypeptides do not function as membrane bound neuropeptide receptors. An analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide. Specific examples are splice variant 1 and 2 of Figures 2 and 3 (SEQ ID NO:4 and 6), respectively.

The polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.

A fragment, derivative or analog of the polypeptide of Figure 2 (SEQ ID NO:2) or that encoded by the deposited cDNA(s) may be one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, (ii) one in which one or more of the amino acid residues includes a substituent group, (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), (iv) one in which the additional amino acids are fused to the mature polypeptide, such as sequence which is employed for purification of the mature polypeptide sequence -12- WO 96/34877 PCTIUJS95/05616 or (iv) splice variants of the mature polypeptide which may have one or more amino acids deleted from the mature polypeptide yet still retain activity corresponding to the mature polypeptide. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region "leader and trailer" as well as intervening sequences (introns) between individual coding segments (exons).

The term "isolated" means that the material is removed from its original environment the natural environment if it is naturally occurring). For example, a naturallyoccurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.

Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The -13- WO 96/34877 PCTfUS95/05616 engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the human neuropeptide receptor genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.

However, any other vector may be used as long as it is replicable and viable in the host.

The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or promoter, the E. coli. lac or trp, the phage lambda PL promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.

The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.

-14- WO 96/34877 PCT/US95/05616 The vector may also include appropriate sequences for amplifying expression.

In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.

As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomyces, Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS or Bowes melanoma; adenoviruses; plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, WO 96/34877 PCTIS95/05616 pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.

Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are PKK232-8 and PCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda PR, PL and trp.

Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L., Dibner, Battey, Basic Methods in Molecular Biology, (1986)).

The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.

Fragments of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis, therefore, the fragments may be employed as intermediates for producing the fulllength polypeptides. Fragments of the polynucleotides of the present invention may be used in a similar manner to -16- WO 96/34877 PCTIUS95/05616 synthesize the full-length polynucleotides of the present invention.

Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.

Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, (1989), the disclosure of which is hereby incorporated by reference.

Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription.

Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), a-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence -17- WO 96/34877 PCTfUS95/05616 can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, stabilization or simplified purification of expressed recombinant product.

Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.

As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.

Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means temperature shift or chemical induction) and cells are cultured for an additional period.

Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.

-18- WO 96/34877 PCTfUS95/05616 Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.

Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.

The neuropeptide receptor polypeptide of the present invention can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography.

Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.

The neuropeptide receptor polypeptide of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and -19- WO 96/34877 PCTfUS95/0516 mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue.

The polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disease.

The human neuropeptide receptor polypeptides of the present invention may be employed in a process for screening compounds which bind to and activate the receptor polypeptide and for compounds which bind to and inhibit activation of the receptor polypeptides of the present invention.

In general, the neuropeptide receptor in isolated, immobilized or cell bound form is contacted with a plurality of compounds and those compounds are selected which bind to and interact with the receptor. The binding or interaction can be measured directly by using radioactively labeled compounds of interest or by the second messenger effect resulting from the interaction or binding of the candidate compound. Alternatively, the candidate compounds can be subjected to competition screening assays, in which a known ligand, preferably labeled with an analytically detectable reagent, most preferably radioactivity, is introduced with the compound to be tested and the compound's capacity to inhibit or enhance the binding of the labeled ligand is measured. Compounds are screened for their increased afffinity and selectivity to the receptor polypeptide of the present invention.

One such screening procedure involves the use of melanophores which are transfected to express the neuropeptide receptor of the present invention. Such a screening technique is described in PCT WO 92/01810 published February 6, 1992.

WO 96/34877 PCTfUS95/05616 For example, to screen for compounds which inhibit activation of the receptor polypeptide of the present invention, the compound and a ligand known to bind to the receptor are both contacted with the melanophore cells.

Inhibition of the signal generated by the ligand indicates that the compound inhibits activation of the receptor.

The screen may be employed for determining a compound which binds to and activates the receptor polypeptide of the present invention by contacting such cells with compounds to be screened and determining whether such compound generates a signal, activates the receptor.

Other examples include the use of cells which express a neuropeptide receptor of the present invention (for example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science, volume 246, pages 181-296 (October 1989). For example, compounds may be contacted with a cell which expresses an neuropeptide receptor polypeptide of the present invention and a second messenger response, e.g. signal transduction or pH changes, may be measured to determine whether the potential compound is effective as an activator or inhibitor.

Another example involves introducing RNA encoding a neuropeptide receptor of the present invention into Xenopus oocytes to transiently express the receptor. The oocytes may then be contacted with the receptor ligand and a compound to be screened, followed by detection of inhibition of or an increase in intracellular calcium.

Another example involves expressing a neuropeptide receptor polypeptide of the present invention on the surface of a cell wherein the receptor is linked to a phospholipase C or D. As representative examples of such cells there may be mentioned endothelial cells, smooth muscle cells, embryonic kidney cells, etc. The screening may be accomplished as hereinabove described by detecting activation -21- WO 96/34877 PCTIUS95/05616 of the receptor or inhibition of activation of the receptor from the phospholipase second signal.

Another method involves determining inhibition of binding of labeled ligand to cells which have a neuropeptide receptor on the surface thereof. Such a method involves transfecting a eukaryotic cell with DNA encoding an neuropeptide receptor polypeptide of the present invention such that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a known ligand. The ligand can be labeled, by radioactivity. The amount of labeled ligand bound to the receptors is measured, by measuring radioactivity of the receptors. If the compound binds to the receptor as determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited.

Another screening technique involves expressing a neuropeptide receptor polypeptide on the surface of a cell wherein the receptor is linked to a second messenger to increase cytosolic calcium levels in transfected CHO cells.

An example of such a method comprises transfecting CHO cells with a nucleic acid sequence encoding a receptor of the present invention such that the receptor is expressed on the surface thereof. The transfected cell is then incubated in a reaction mixture with labeled calcium in the presence of a compound to be screened. The ability of the compound to increase calcium up-take or inhibit calcium up-take can then be determined by measuring the amount of labeled calcium transported into the cells by taking advantage of the label, radioactivity.

Compounds may also be identified by the above methods which bind to specific subregions within the CNS that are important for specific behaviors through indirect interactions with a neuropeptide receptor polypeptide of the present invention.

-22- WO 96/34877 PCTfUS95/05616 To measure intracellular cyclic AMP levels, cyclic AMP is assayed in whole cells treated for 15 minutes at 37 0 C with 100 micromolar isobutylmethylxanthine (IBMX; Sigma).

Transfected cells (1 x 106 0.5 ml reaction) are incubated with 10 micromolar forskolin and various concentrations of known or unknown ligands to the receptor. Reactions are terminated with the addition of HC1 to 0.1M, incubation at room temperature for 15 minutes, neutralization and sample dilution in 50 mM sodium acetate, pH 6.2. Cyclic AMP is quantified by using a radioimmunoassay (Dupont/NEN).

To measure levels of intracellular calcium, transfected cells are suspended in loading medium (modified RPMI 1640 mM Hepes/l% newborn calf serum) and incubated in a spinner flask at 37 0 C for 2.5 hour at 1 x 106 cells per ml.

Cells are then treated with 1 micromolar Fura-2 acetoxymethyl ester (fura-2 AM; Molecular Probes) for 30 minutes at 37 0

C,

washed twice with loading medium, and resuspended at 5 x 106 cells/ml. Immediately before fluorescence spectroscopy, cells are recovered by centrifugation at 1000 rpm and resuspended at 1 x 10 cells/ml in a modified Krebs buffer (135 mM NaCl/4.7 mM KC1/1.2 mM MgSO 4 /1.2 mM KH 2

PO

4 /5 mM NaHCO3/1 mM CaC1 2 /2.8 mM glucose/10 mM hepes, pH 7.4) containing sulfinpyrazone. Bombesin is purchased from Sigma and Auspep. Fluorescence recordings are made on a Hitachi fluorescence spectrometer (F4010) at 340 nm (excitation) and 505 nm (emission) over 10 minutes with slit widths of 5 nm and response time of 2 seconds. Intracellular calcium is quantified by using equations described by Grynkiewicz, et al., J. Bio. Chem. 260:3440-3450, 1985.

The invention also provides a method of treating and/or preventing obesity by administering to a host a compound which binds to and activates the receptor polypeptides of the present invention. Such a compound is other than the ob gene product disclosed in Zhang, et al., Nature, 372:425-431 (1994). The receptor polypeptide of the present invention -23- WO 96/34877 PCT/US95/05616 maps to a human chromosome which corresponds to the position of the mouse chromosome which encodes for the receptor of the ob gene product. The human ob gene encodes a "satiety" factor which binds to and activates the receptor polypeptide of the present invention. Accordingly, a compound which activates the receptor of the present invention will decrease appetite and prevent obesity.

The compounds described above may also be employed to enhance activity level, modify eating behavior, enhance utilization of ingested foods and regulate deposition of fat stores. Conditions related to obesity may also be treated by the compounds which bind to and activate the receptor polypeptides of the present invention including hyperlidimeia, type II diabetes and certain cancers.

These compounds may also be employed to treat and/or prevent other conditions related to an underexpression of the receptor polypeptide of the present invention or ligands which bind thereto, for example, to stimulate neuronal growth.

Specific examples of compounds which inhibit activation of the receptor polypeptides of the present invention include an antibody, or in some cases an oligonucleotide, which binds to the receptor but does not elicit a second messenger response such that the activity of the receptor is prevented.

Another example is proteins which are closely related to the ligands of the receptor, i.e. a fragment of the ligand, which have lost biological function and when binding to the receptor, elicit no response.

Another example includes an antisense construct prepared through the use of antisense technology. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature -24- WO 96/34877 PCTIS9505616 polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and the production of a neuropeptide receptor polypeptide of the present invention. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the receptor (antisense Okano, J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the receptors.

Another example is a small molecule which binds to a neuropeptide receptor polypeptide of the present invention, making it inaccessible to ligands such that normal biological activity is prevented. Examples of small molecules include but are not limited to small peptides or peptide-like molecules and neuropeptide Y fragments and/or derivatives.

Soluble forms of a neuropeptide receptor polypeptide of the present invention, a fragment of the receptor, which binds to the ligand and prevents the ligand from interacting with membrane bound receptors may also inhibit activation of the receptor polypeptides of the present invention.

This invention additionally provides a method of utilizing such compounds which inhibit activation for treating abnormal conditions related to an excess of activity of a neuropeptide receptor polypeptide of the present invention for treating obesity since the neuropeptide receptor polypeptides of the present invention may bind WO 96/34877 PCTIS95/05616 neuropeptide Y which is the most potent known substance to cause an increase in feeding behavior and type II Diabetes Mellitus since neuropeptide Y may play a role in the genetic basis of this disease.

The compounds which inhibit activation of the receptor polypeptides of the present invention may be employed to treat and/or prevent hypertension since neuropeptide Y stimulates renin release and neuropeptide Y is known to have potent vasoconstrictor activity when involving the coronary and cerebral vessels.

The compounds may also be employed to treat Alzheimer's disease since neuropeptide Y receptors are prevalent in the central nervous system and are localized predominantly within interneurons where they appear to have regulatory roles in memory and Alzheimers disease.

The compounds may also be employed to suppress excitatory transmission by neuropeptide Y in the hippocampus and therefore may be employed to treat epileptic seizure, stress and anxiety.

The prevalence of neuropeptide Y receptors in the central nervous system indicates that the compounds which inhibit the neuropeptide receptor polypeptides of the present invention may be used as an antipsychotic drug by regulating neurotransmission.

The compounds which inhibit the receptor polypeptides of the present invention may also be employed to treat pathological vasospasm involving coronary and cerebral vessels.

This invention also provides a method for determining whether a ligand not known to be capable of binding to a neuropeptide receptor of the present invention can bind thereto which comprises contacting the ligand to be identified with a cell comprising the coding sequence of a neuropeptide receptor and expressing same on its surface under conditions sufficient for binding of ligands previously -26- WO 96/34877 PCTIUS5g/05616 identified as binding to such a receptor. In other embodiments cell membrane fractions comprising the receptor or isolated receptors free or immobilized on solid supports may be used to measure binding of the ligand to be tested.

When recombinant cells are used for purposes of expression of the receptor it is preferred to use cells with little or no endogenous receptor activity so that binding, if any, is due to the presence of the expressed receptor of interest.

Preferred cells include human embryonic kidney cells, monkey kidney (HEK-293 cells), fibroblast (COS) cells, Chinese hamster ovary (CHO) cells, Drosophila or murine L-cells. It is also preferred to employ as a host cell, one in which a receptor responsive second messenger system exists. Well known second messenger systems include increases or decreases in phosphoinositide hydrolysis, adenylate cyclase, guanylate cyclase, or ion channel activity in response to ligand binding to extracellular receptor domains. In a further embodiment a specifically designed indicator of receptor binding can be constructed. For example, a fusion protein can be made by fusing the receptor of this invention with a protein domain which is sensitive to receptor ligand binding.

Such a domain referred to here as an indicator domain is capable, itself, or in association with accessory molecules, of generating an analytically detectable signal which is indicative or receptor ligand binding.

This invention also provides a method of detecting expression of a neuropeptide receptor polypeptide of the present invention on the surface of a cell by detecting the presence of mRNA coding for the receptor which comprises obtaining total mRNA from the cell and contacting the mRNA so obtained with a nucleic acid probe comprising a nucleic acid molecule of at least 10 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding the receptor under hybridizing conditions, detecting the presence of mRNA -27- WO 96/34877 PCT/US95/05616 hybridized to the probe, and thereby detecting the expression of the receptor by the cell.

The present invention also provides a method for identifying receptors related to the receptor polypeptides of the present invention. These related receptors may be identified by homology to a neuropeptide receptor polypeptide of the present invention, by low stringency cross hybridization, or by identifying receptors that interact with related natural or synthetic ligands and or elicit similar behaviors after genetic or pharmacological blockade of the neuropeptide receptor polypeptides of the present invention.

Fragments of the genes may be used as a hybridization probe for a cDNA library to isolate other genes which have a high sequence similarity to the genes of the present invention, or which have similar biological activity. Probes of this type preferably have 50 bases or more. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene of the present invention including regulatory and promoter regions, exons and introns. An example of a screen of this type comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the genes of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

The neuropeptide receptor polypeptides and compounds identified above which are polypeptides, may be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy." Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being -28- WO 96/34877 PCT/US95/05616 provided to a patient to be treated with the polypeptide.

Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.

Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.

Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.

In one embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.

The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniues, Vol. 7, No. 9, 980-990 (1989), or any other promoter cellular promoters such as eukaryotic cellular promoters including, but not limited to, the -29- WO 96/34877 PCT/US95/05616 histone, pol III, and P-actin promoters). Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.

The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described); the P-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the genes encoding the polypeptides.

The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, 4-2, i-AM, PAl2, T19-14X, VT-19-17-H2, CRE, CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO 4 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.

WO 96/34877 PCTIUS95/05616 The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.

The soluble neuropeptide receptor polypeptides and compounds which bind to and activate or inhibit activation of a receptor of the present invention may also be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the soluble neuropeptide receptor polypeptide or compounds, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the soluble neuropeptide receptor polypeptides or compounds of the present invention may be employed in conjunction with other therapeutic compounds.

The pharmaceutical compositions may be administered in a convenient manner such as by the topical, intravenous, -31- WO 96/34877 PCT/US95/05616 intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, the pharmaceutical compositions will be administered in an amount of at least about 10 pig/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 Ag/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.

The present invention also contemplates the use of the genes of the present invention as a diagnostic, for example, some diseases result from inherited defective genes. These genes can be detected by comparing the sequences of the defective gene with that of a normal one. Subsequently, one can verify that a "mutant" gene is associated with abnormal receptor activity. In addition, one can insert mutant receptor genes into a suitable vector for expression in a functional assay system colorimetric assay, expression on MacConkey plates, complementation experiments, in a receptor deficient strain of HEK293 cells) as yet another means to verify or identify mutations. Once "mutant" genes have been identified, one can then screen population for carriers of the "mutant" receptor gene.

Individuals carrying mutations in the gene of the present invention may be detected at the DNA level by a variety of techniques. Nucleic acids used for diagnosis may be obtained from a patient's cells, including but not limited to such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki, et al., Nature, 324:163-166 1986) prior to analysis.

RNA or cDNA may also be used for the same purpose. As an example, PCR primers complimentary to the nucleic acid of the -32- WO 96/34877 PCTIS95/05616 instant invention can be used to identify and analyze mutations in the gene of the present invention. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radio labeled RNA of the invention or alternatively, radio labeled antisense DNA sequences of the invention. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures. Such a diagnostic would be particularly useful for prenatal or even neonatal testing.

Sequence differences between the reference gene and "mutants" may be revealed by the direct DNA sequencing method. In addition, cloned DNA segments may be used as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequence primer is used with double stranded PCR product or a single stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radio labeled nucleotide or by an automatic sequencing procedure with fluorescent-tags.

Genetic testing based on DNA sequence differences may be achieved by detection of alterations in the electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Sequences changes at specific locations may also be revealed by nucleus protection assays, such RNase and S1 protection or the chemical cleavage method Cotton, et al., PNAS. USA, 85:4397-4401 1985).

In addition, some diseases are a result of, or are characterized by changes in gene expression which can be detected by changes in the mRNA. Alternatively, the genes of the present invention can be used as a reference to identify individuals expressing a decrease of functiops associated with receptors of this type.

-33- WO 96/34877 PCT/US95/05616 The present invention also relates to a diagnostic assay for detecting altered levels of soluble forms of the neuropeptide receptor polypeptides of the present invention in various tissues. Assays used to detect levels of the soluble receptor polypeptides in a sample derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive-binding assays, Western blot analysis and preferably as ELISA assay.

An ELISA assay initially comprises preparing an antibody specific to antigens of the neuropeptide receptor polypeptides, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme. A sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any neuropeptide receptor proteins attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to neuropeptide receptor proteins. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of neuropeptide receptor proteins present in a given volume of patient sample when compared against a standard curve.

The sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on -34- SUBTITUTE SHEET (RULE 26) WO 96/34877 PCTIS95/05616 an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.

Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA.

Computer analysis of the 3' untranslated region is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process.

These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.

Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.

Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases.

For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

WO 96/34877 PCTIS95/05616 The above techniques were utilized to map the gene corresponding to the neuropeptide receptor of the present invention to chromosome 1 position 31-34.

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per kb).

The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies.

The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.

Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be -36- WO 96/34877 PCTIUS95/05616 obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.

For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBVhybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).

Techniques described for the production of single chain antibodies Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice may be used to express humanized antibodies to immunogenic polypeptide products of this invention.

The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.

In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.

"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be -37- WO 96/34877 PCTIUS95/05616 constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.

"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 Ag of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 Cl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 pg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37'C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D.

et al., Nucleic Acids Res., 8:4057 (1980).

"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.

"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid -38- PCTIUS9 5 0 5 6 1 IPEA/US 31 MAR 1997 fragments (Maniatis, et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase ("ligase") per 0.5 Ag of approximately equimolar amounts of the DNA fragments to be ligated.

Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).

Example 1 Bacterial Expression and Purification of the Neuropeptide Receptor The DNA sequence encoding for neuropeptide receptor, ATCC 97128 is initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' end sequences of the processed neuropeptide receptor gene (minus the signal peptide sequence) and the vector sequences 3' to the gene.

Additional nucleotides corresponding to neuropeptide receptor nucleotide sequence are added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence CACTAAAGCTTAATGGAGCCCTCAGCCACC 3' (SEQ ID NO:7) contains a Hind III restriction enzyme site followed by 18 nucleotides of neuropeptide receptor coding sequence starting from the presumed terminal amino acid of the processed protein codon.

The 3' sequence 5' ACAAGTCCTTGTCCTTCTAGAGGGC 3' (SEQ ID NO:8) and contains an Xbal site. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA). pQE-9 encodes antibiotic resistance (Ampr), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites. pQE-9 is then digested with Hind III and Xbal. The amplified sequences are ligated into pQE-9 and are inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture is then used -39- AMENDED SHEET WO 96/34877 PCTIUS9505616 to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lacI repressor and also confers kanamycin resistance Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells are grown to an optical density 600 (O.D.

6 of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") is then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O leading to increased gene expression. Cells are grown an extra 3 to 4 hours. Cells are then harvested by centrifugation. The cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HC1. After clarification, solubilized neuropeptide receptor is purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984). The protein is eluted from the column in 6 molar guanidine HC1 pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HC1, 100mM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After incubation in this solution for 12 hours the protein is dialyzed to mmolar sodium phosphate.

Example 2 Expression of Recombinant Neuropeptide Receptor in COS cells PCT/US9 5 056 I IPEA/US 3 1 MAR 1997 The expression of plasmid, neuropeptide receptor HA is derived from a vector pcDNA3/Amp (Invitrogen) containing: 1) origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site.

A DNA fragment encoding the entire neuropeptide receptor precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein as previously described Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.

The plasmid construction strategy is described as follows: The DNA sequence encoding for neuropeptide receptor, ATCC 97128, is constructed by PCR using two primers: the primer 5' CCTAGGATGCCCCTCTGCTGCAGCGG 3' (SEQ ID NO:9) contains a BamHI site; the 3' sequence 5' ACAAGTCCTTGT CCTTCTAGAGGGC 3' (SEQ ID NO:10) contains complementary sequences to an XbaI site, translation stop codon, and the last 17 nucleotides of the neuropeptide receptor coding sequence (not including the stop codon). Therefore, the PCR product contains a BamHI site, coding sequence, a translation termination stop codon and an XbaI site. The PCR amplified DNA fragment and the vector, pcDNA3/Amp, are digested with BamHI and XbaI restriction enzymes and ligated. The ligation mixture is transformed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, CA) the transformed culture is plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the -41- AMENDED SW PCT/US9 5 0 5 6 1 IPEA/US 3 1 MAR 1997 correct fragment. For expression of the recombinant neuropeptide receptor, COS cells are transfected with the expression vector by DEAE-DEXTRAN method Sambrook, E.

Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expression of the neuropeptide receptor HA protein is detected by radiolabelling and immunoprecipitation method Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells are labelled for 8 hours with "S-cysteine two days post transfection. Culture media are then collected and cells are lysed with detergent (RIPA buffer (150 mM NaC1, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, Tris, pH (Wilson, I. et al., Id. 37:767 (1984)).

Both cell lysate and culture media are precipitated with a HA specific monoclonal antibody. Proteins precipitated are analyzed on 15% SDS-PAGE gels.

Example 3 Cloning and expression of Neuropeptide Receptor using the baculovirus expression system The DNA sequence encoding the full length neuropeptide receptor protein, ATCC 97128, is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene: The 5' primer has the sequence 5' CGGGATCCGCCATCATGGAG CCCTCAGCCACC 3' (SEQ ID NO:11) and contains a BamHI restriction enzyme site (in bold) followed by 6 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells Mol. Biol. 1987, 196, 947-950, Kozak, The initiation codon for translation "ATG" is underlined).

The 3' primer has the sequence 5' ACAAGTCCTTGTCCTTCT AGAGGGC 3' (SEQ ID NO:12) and contains the cleavage site for the restriction endonuclease XbaI and 5 nucleotides complementary to the 3' non-translated sequence of the -42- AMENDED SNE WO 96/34877 PCT~US9505616 neuropeptide receptor gene. The amplified sequences are isolated from a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, The fragment is then digested with the endonucleases BamHI and XbaI and then purified as described in Example 1. This fragment is designated F2.

The vector pA2 (modification of pVL941 vector, discussed below) is used for the expression of the neuropeptide receptor protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin NO:1, 3 and 5555). This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhidrosis virus (AcMNPV) followed by the recognition sites for the restriction endonucleases BamHI and XbaI. The polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation. For an easy selection of recombinant viruses the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of co-transfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V.A. and Summers, Virology, 170:31-39).

The plasmid is digested with the restriction enzymes BamHI and XbaI and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA is then isolated from a 1% agarose gel as described in Example 1. This vector DNA is designated V2.

Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase. DH5a are then transformed and bacteria identified that contained the plasmid (pBac -43- WO 96/34877 PCTfS95/05616 neuropeptide receptor) with the neuropeptide receptor gene using the enzymes BamHI and XbaI. The sequence of the cloned fragment is confirmed by DNA sequencing.

ig of the plasmid pBac neuropeptide receptor are cotransfected with 1.0 jg of a commercially available linearized baculovirus ("BaculoGold baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Felgner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)).

lg of BaculoGold virus DNA and 5 pg of the plasmid pBac neuropeptide receptor are mixed in a sterile well of a microtiter plate containing 50 Cl of serum free Grace's medium (Life Technologies Inc., Gaithersburg,

MD).

Afterwards 10 pl Lipofectin plus 90 pl Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop wise to the Sf9 insect cells (ATCC CRL 1711) seeded in a mm tissue culture plate with 1 ml Grace' medium without serum. The plate is rocked back and forth to mix the newly added solution. The plate is then incubated for 5 hours at 27 0 C. After 5 hours the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is added. The plate is put back into an incubator and cultivation continued at 27 0 C for four days.

After four days the supernatant is collected and a plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- -44- WO 96/34877 PCTfUS95/05616 Four days after the serial dilution the virus is added to the cells and blue stained plaques are picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 pl of Grace's medium. The agar is removed by a brief centrifugation and the supernatant containing the recombinant baculoviruses is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes are harvested and then stored at 4 0

C.

Sf9 cells are grown in Grace's medium supplemented with heat-inactivated FBS. The cells are infected with the recombinant baculovirus V-neuropeptide receptor at a multiplicity of infection (MOI) of 2. Six hours later the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 .Ci of 5S-methionine and ACi 35 S cysteine (Amersham) are added. The cells are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS- PAGE and autoradiography.

Example 4 Expression via Gene Therapy Fibroblasts are obtained from a subject by skin biopsy.

The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added.

This is then incubated at 37 0 C for approximately one week.

At this time, fresh media is added and subsequently changed WO 96/34877 PCT/US95/05616 every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks.

pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and HindIII and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on agarose gel and purified, using glass beads.

The cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer containing an EcoRI site and the 3' primer having contains a HindIII site.

Equal quantities of the Moloney murine sarcoma virus linear backbone and the EcoRI and HindIII fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria HB101, which are then plated onto agarcontaining kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.

The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin. The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells).

Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed from -46- WO 96/34877 PCT/US95/05616 a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.

The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product.

Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the ''invention may be practiced otherwise than as particularly :"described.

Throughout this specification, unless the context requires otherwise the word "comprise", and variations such as S*"."comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

-47- WO 96/34877 PCTliS95/05616 SEQUENCE LISTING GENERAL INFORMATION: APPLICANT: LI, ET AL.

(ii) TITLE OF INVENTION: Human Neuropeptide Receptor (iii) NUMBER OF SEQUENCES: 12 (iv) CORRESPONDENCE

ADDRESS:

ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN, CECCHI, STEWART OLSTEIN STREET: 6 BECKER FARM ROAD CITY: ROSELAND STATE: NEW JERSEY COUNTRY: USA ZIP: 07068 COMPUTER READABLE

FORM:

MEDIUM TYPE: 3.5 INCH DISKETTE COMPUTER: IBM PS/2 OPERATING SYSTEM: MS-DOS SOFTWARE: WORD PERFECT 5.1 (vi) CURRENT APPLICATION

DATA:

APPLICATION NUMBER: FILING DATE: concurrently

CLASSIFICATION:

(vii) ATTORNEY/AGENT

INFORMATION:

NAME: FERRARO, GREGORY D.

REGISTRATION NUMBER: 36,134 REFERENCE/DOCKET NUMBER: 325800-268 (viii) TELECOMMUNICATION

INFORMATION:

TELEPHONE: 201-994-1700 TELEFAX: 201-994-1744 INFORMATION FOR SEQ ID NO:1: SEQUENCE

CHARACTERISTICS

LENGTH: 1209 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS:

SINGLE

TOPOLOGY: LINEAR (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: ATGGAGCCCT CAGCCACCCC AGGGGCCCAG ATGGGGGTCC CCCCTGGCAG CAGAGAGCCG TCCCCTGTGC CTCCAGACTA TGAAGATGAG TTTCTCCGCT ATCTGTGGCG TGATTATCTG 120 -48- WO 96/34877 WO 9634877PCTfUS95/05616

TACCCAAAAC

CTGGTGGGCA

ACCAACTACT

CCGGCCAGCC

GTCATCCCCT

GCCCTGGACC

GCCCGTGGCT

GCAGTCATGG

GTCTGTCATG

ATTGTCACCT

AACCTCTGGG

CCCrCAGACC

CGCGCCITCC

ATGGTGGTGC

AAGAGGGTGT

AC=TCTCCC

CTCAGTGGCA

GGTCCCTGCG

TCCTTGTAG

AGTATGAGTG

ACACGCTGGT

TCAT1'GTCAA

TGCTGGTGGA

ATCTACAGGC

GCTGGTATGC

CCATCCTGGG

AATGCAGCAG

AACGCTGGGC

ACCTGGCCCC

GCCGCCAGAT

AGCTGGGGGA

TGGCTGAAGT

TGCTGGTCIT

TCGGGATGTI

ACrGGCTGGT AATrCCGGGA

GCTCTCI'GAA

GGTCCTCATC CCAGCCTATG TGGCTGTGTI' CTGCCTGGCC GTGTGGCGGA ACCACCACAT CCTGTCCCTG GCTGACG'rrC TGGTGACTGC CATCACTGAG TCCTGGCTGT TCGGCCATGC TGTGTCCGTG TCAGTGGCAG TGCTAACITCT CATCTGCCAC CCACTA'ITGT TCAAGAGCAC CATCTGGGCT GTGTCGCTGG CCATCATGGT TGTGCTGCCT GAG CTAGCCA ACCGCACACG AGATGACCTC TATCCCAAGA TCTACCACAG ACTGGGCCTC ATGGCCATGG CCTATTTCCA CCCCGGCACC ACCTCAGCAC TGGTGCGGAA CCTGGAGCAG GGCCTGAGTG GAGAGCCCCA GAAGCAGATG CGTGCACGGA GGAAQACAGC CGCCCTCTGC TACCTGCCCA TCAGCGTCCT CCGCCAAGCC AGTGACCGCG AAGCTGTCTA GTACGCCAAC AGCGCTGCCA ACCCCATCAT GCAGTITAAG GCrGCCITCT CCTGCTGCCr GGCCCCTAGT CCCCGCrCCT CTGCCAGCCA

CGTCGTGGCC

GAGGACAGTC

TATCTGCCTG

CCTCTGCAAG

CAGCTI'CATC

AGCCCGGCGG

GCCCCAGGr GCTCTTCrCA

TTGCITCT

GATAITCCGC

CrGGAAGCGC

GCCCCGGGGC

CAAGATGCTG

CGCCTGC

CTACAACTTC

GCCTGGCCTG

CAAGTCMIG

180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1209 INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS LENGTH: 402 AMINO ACIDS TYPE: AMINO ACID

STRANDEDNESS:

TOPOLOGY: LINEAR (ii) MOLECULE TYPE: PROTEIN (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Met Giu Pro Ser Ala Gly Ser Arg Glu Phe Leu Arg Tyr Giu Trp Val Leu Leu Val Gly Asn His Met Arg Thr Ala Asp Val Leu Val Asp Ile Thr Val Ile Pro Tyr Thr Leu Ser Phe Pro Leu Leu Phe Leu Gly Ile Trp Pro Leu Ile Thr Val Val Giu 110 Leu 125 Ile 140 Lys 155 Ala 170 Thr Pro Giy Ala Ser Pro Val Pro Trp Arg Asp Tyr Ala Ala Tyr Val Leu Val Cys Leu Thr Asn Tyr Phe Thr Ala Ile Cys Ser Trp Leu Phe Gin Ala Val Ser Ala Leu Asp Arg Ser Thr Ala Arg Val Ser Leu Ala Gin 10 Pro 25 Leu 40 Ala 55 Ala 70 Ile 85 Leu 100 Giy 115 Val 130 Trp 145 Arg 160 Ile 175 Met Giy Val Pro Asp Tyr Glu Asp Tyr Pro Lys Gin Val Phe Val Val Val Trp Arg Asn Val Asn Leu Ser Pro Ala Ser Leu His Ala Leu Cys Ser Val Ala Val Tyr Ala Ile Cys Ala Arg Gly Ser Met Val Pro Gln Pro Giu Tyr Ala His Leu Leu 105 Lys 120 Leu 135 His 150 Ile 165 Ala 180 -49- WO 96/34877 WO 9634877PCTIUS95/05616 Ala Val Met Glu Thr Arg Leu Phie Tyr Pro Lys Ile Ala Pro Leu Gly Lys Leu Trp Gly Arg Asn Trp Lys Gly Leu Ser Gly Giu Val Lys Gin Met Val Vai Leu Val Leu Asn Val Ser Asp Arg Giu Leu Val Tyr Ala Leu Ser Gly Lys Cys Leu Pro Gly Pro Arg Ser Ser Cys 185 Ser 200 Tyr 215 Leu 230 Arg 245 Arg 260 Giu 275 Met 290 Leu 305 Leu 320 Ala 335 Asn 350 Phe 365 Leu 380 Ala 395 Ser Ser Val Leu Val Cys Asp Giu His Ser Cys Phe Met Ala Met Ala Gin Ile Pro Gly Pro Ser Asp Gin Pro Gin Pro Arg Arg Ala Arg Arg Val Phe Ala Leu Lys Arg Val Phe Val Tyr Ala Cys Ser Ala Ala Asn Arg Giu Gin Phe Gly Pro Cys Gly Ser His Lys Ser Pro 190 Arg 205 Phe 220 Tyr 235 Thr 250 Leu 265 Gly 280 Lys 295 Cys 310 Gly 325 Phe 340 Pro 355 Lys 370 Ser 385 Leu 400 Giu Leu Aia Asn Ti-p Ala Asp Asp Ile Val Thr Tyr Phe Gin Ile Phe Thr Ser Ala Leu Gly Asp Leu Giu Arg Ala Phe Leu Thr Ala Lys Met Tyr Leu Pro Ile Met Phe Arg Gin Thr Phe Ser His Ile Ile Tyr Asn Ala Ala Phe Ser Leu Lys Ala Pro Arg 195 Leu 210 Leu 225 Arg 240 Val 255 Gin 270 Ala 285 Leu 300 Ser 315 Ala 330 Trp, 345 Phe 360 Cys 375 Ser 390 Ser Leu INFORMATION FOR SEQ ID NO:3: SEQUENCE

CHARACTERISTICS

LENGTH: 1110 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS:

SINGLE

TOPOLOGY:

LINEAR

(ii) (xi) MOLECULE TYPE: cDNA SEQUENCE DESCRIPTION: SEQ ID NO:3:

ATGGAGCCCT

TCCCCTGTGC

TACCCAAAAC

CTGGTGGGCA

ACCAACrACT

CCGGCCAGCC

GTCATCCCCT

CCCCTGGACC

GCCCGTGGCT

GCAGTCATGC

CTCTGTCATG

ATTGTCACCT

AAGCTCTGGG

CAGCCACCCC

CTCCAGACTA

AGTATGAGTG

ACACGCTGGT

TCA~rGTCAA

TGCTGGTGGA

ATCTACAGGC

GCTGGTATGC

ccATCCTGGG

AATCCAGCAG

AACGC!TGGGC

ACCTGGCCCC

GCCGCCAGAT

AGGGGCCCAG

TGAAGATGAG

GGTCCTCATC

CTGCCTGGCC

CCTGTCCCTG

CATCACTGAG

TGTGTCCGTG

CATCTGCCAC

CATCTGGGCT

TGTGCTGCCT

AGATGACCTC

ACTrGGGCCTC

CCCCGGCACC

ATGGGGGTCC

TIrTCCGCT

GCAGCCTATG

GTGTGGCGGA

GCTGACGTI'C

TCCTrGGCrGT

TCAGTGGCAG

CCACTA~rGT

GTGTCGCTGG

GAG CTAGCCA

TATCCCAAGA

ATGGCCATGG

ACCrCAGCAC

CCCCTGGCAG

ATCTGTGGCG

TGGCrGTGTr

ACCACCACAT

TGGTGACTGC

TCGGCCATGC

TGCrAACTCr

TCAAGAGCAC

CCATCATGGT

ACCGCACACG

TCTACCAC-AG

CCTATTTCCA

TGGTGCGGAA

CAGAGAGCCG

TGATTATCrG

CGTCGTGGCC

GAGGACAGTC

TATCrGCCTG

CCTCTGCAAG

CAGC=CATC

AGCCCGGCGG

GCCCCAGGCT

GCTCTI'CTCA

TrGCrrCTIT

GATATI'CCGC

CTGGAAGCGC

120 180 240 300 360 420 480 540 600 660 720 780 WO 96/34877 PCTfUS95/05616 CCCTCAGACC AGCTGGGGGA CCTGGAGCAG GGCCTGAGTG GAGAGCCCCA GCCCCGGGGC 840 CGCGCCTTCC TGGCTGAAGT QAAGCAGATG CGTGCACGGA GGAAGACAGC CAAGATGCTG 900 ATGGTGGTGC TGCTGGTCTT CGCCCTCTGC TACCTCCCCA TCAGCGTCCT CAATGTCCTT 960 AAGAGGGTGT TCGGGATGTT CCGCCAAGCC AGTGACCGCG AAGCTGTCA CGCCIGCTIC 1020 ACCTTCTCCC ACTGGCTGGT GTACGCCAAC AGCGCTGCCA ACCCCATCAT CTACAACITC 1080 CTCAGTGGCC TTCCCTGGAG TCTGCTCAP. 1110 INFORMATION FOR SEQ ID NO:4: SEQUENCE CHARACTERISTICS LENGTH: 369 BASE PAIRS TYPE: AMINO ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) (xi)

MOLECULE

SEQUENCE

TYPE: cDNA DESCRIPTION: SEQ ID NO:4: Met Glu Gly Ser Phe Leu Glu Trp Leu Val His Met Ala Asp Val Asp Val Ile Thr Leu Pro Leu Leu Gly Ala Val Thr Arg Tyr Pro Ala Pro Lys Leu Arg Asn Pro Arg Arg Val Gly Arg Val Ile Pro Ser Leu Ile Met Leu Lys Leu Trp Trp Ser Glu Tyr Leu Asn Thr Leu Thr Tyr Phe Phe Trp Glu Phe Ile Gly Gly Lys Ala Pro Leu Ile Thr Val Val Glu 110 Leu 125 Ile 140 Lys 155 Ala 170 Cys 185 Ser 200 Tyr 215 Leu 230 Arg 245 Arg 260 Thr Pro Gly Ala Gin 10 Ser Pro Vai Pro Pro 25 Trp Arg Asp Tyr Leu 40 Ala Ala Tyr Val Ala 55 Leu Val Cys Leu Ala 70 Thr Asn Tyr Phe Ile 85 Thr Ala Ile Cys Leu 100 Ser Trp Leu Phe Gly 115 Gin Ala Val Ser Val 130 Ala Leu Asp Arg Trp 145 Ser Thr Ala Arg Arg 160 Val Ser Leu Ala Ile 175 Ser Ser Val Leu Pro 190 Met Asp Tyr Val Val Val Pro His Ser Tyr Ala Met Glu Gly Val Tyr Glu Pro Lys Phe Val Trp Arg Asn Leu Ala Ser Ala Leu Val Ala Ala Ile Arg Gly Val Pro Leu Ala Ala Asp Val Thr Gin Ile Ser Ala Asp Leu Pro Pro Asp Glu Gin Tyr Val Ala Asn His Ser Leu Leu Leu 105 Cys Lys 120 Val Leu 135 Cys His 150 Ser Ile 165 Gin Ala 180 Asn Arg 195 Asp Leu 210 Tyr Leu 225 Phe Arg 240 Leu Val 255 Glu Gin 270 Val Cys Asp Glu Arg Trp 205 His Ser Cys Phe Phe Ile 220 Met Ala Met Ala Tyr Phe 235 Gin Ile Pro Giy Thr Thr 250 Pro Ser Asp Gln Leu Gly 265 -51- WO 96/34877 WO 9634877PCT/US95/05616 Gly Leu Ser Gly Giu Val Lys Gin Met Val Val Leu Val Leu Asn Val Ser Asp Arg Glu Leu Val Tyr Ala Giu 275 Met 290 Leu 305 Leu 320 Ala 335 Asn 350 Pro Gin Pro Arg Arg Ala Arg Arg Val Phe Ala Leu Lys Arg Val Phe Val Tyr Ala Cys Ser Ala Ala Asn Gly 280 Lys 295 Cys 310 Gly 325 Phe 340 Pro 355 Arg Ala Plie Leu Thr Ala Lys Met Tyr Leu Pro Ile Met Phe Arg Gin Thr Phe Ser His Ile Ile Tyr Asn Ala 285 Leu 300 Ser 315 Ala 330 Trp 345 Phe 360 Leu Ser Gly Leu Pro Trp Ser Leu Leu 365 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS LENGTH: 1133 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIP ATGGAGCCCT CAGCCACCCC AGGGGCCCAG

TCCCCTGTGC

TACCCAAAAC

CTGGTGGGCA

ACCAACTACT

CCGGCCAGCC

GTCATCCCCT

GCCCTGGACC

GCCCGTGGCT

GCAGTCATGG

GTCTGTGATG

ATTGTCACCT

AAGCTCTGGG

CCCTrCAGACC

CGCGCCTTCC

ATGGTGGTGC

AAGAGGGTGT

ACC=CTCCC

CrCAGTGGAT

CTCCAGACTA

AGTATGAGTG

ACACGCTGGT

TCATI'GTCAA

TGCTGGTGGA

ATCTrACAGGC

GCTGGTATGC

CCATCCTGGG

AATGCAGCAG

AACGCTGGGC

ACCTGGCCCC

GCCGCCAGAT

AGCTGGGGGA

TGGCTGAAGT

TGCTGGTCT

TCGGGATGTT

ACrGGCTGGT

GTAAAGAGAA

TGAAGATGAG

GGTCCTCATC

C'rGCCrGGcC CCTrGTCCCTG

CATCACTGAG

TGTGTCCGTG

CATCTGCCAC

CATCTGGGCT

TGTGCTGCCT

AGATGACCTC

ACTGGGCCrC

CCCCGGCACC

CCTGGAGCAG

GAAGCAGATG

CGCCCTCTGC

CCGCCAAGCC

GTACGCCAAC

GAGTCTAGTT

TION:

ATGGGGGI

TrrCTCCG

GCAGCCT.P

GTGTGGC~

GCTGACG'

TCCrGGCr

TCAGTGGC

CCACTATT

GTGTCGC1 GAG CTAGC

TATCCCA;

ATGGCCAI

ACCTrCAGC

GGCCTGAC

CGTGCACC

TACCTrGCC

AGTGACCC

AGCGCTGC

CTGTccTC SEQ ID 'CC CCCCTrGGCAG ,CT ATCTGTGGCG TG TGGCTGTGTT MG ACCACCACAT TC TGGTGACTGCJ GT TCGGCCATGC !AG TGCTAACTCT GT TCAAGAGCAC GO CCATCATGGT C CA ACCGCACACG C

GATCI'ACCACAG

GO CCTrAT=CCA :AC TGGTGCGGAA ;TG GAGAGCCCCA ;GA GGAAGACAGC .CA TCAGCGTCT CG AAGCTGTCTA CA ACCCCATCAT 1AC CATCGTGCCC

:AGAGACCCC

7GATrATCTG

"GTCGTGGCC

!AGGACAGTC

EATCTGCCTG

:CrCTGCAAG ZAGCTrCATC kGCCCGGCGG

CCCCAGGCT

;CTCrrcTCA TrGC'I-CTrT

;ATATTCCGC

-rGGAAGCGC

'CCCCGGGGC

:AAGATGCTG

7AATGTCCT 7GCCTGCTrC -rACAACTTC

:GG

120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1133 INFORMATION FOR SEQ ID NO:6: SEQUENCE CHARACTERISTICS LENGTH: 377 BASE PAIRS TYPE: AMINO ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) (xi) MOLECULE TYPE: cDNA SEQUENCE DESCRIPTION: SEQ ID NO:6: -52- WO 96/34877 Met Glu Pro Gly Ser Arg Phe Leu Arg Giu Trp Val Leu Val Guy His Met Arg Ala Asp Val Val Asp Ile Val Ile Pro Thr Leu Ser Pro Leu Leu Leu Gly Ile Ala Val Met Thr Arg Leu Tyr Pro Ly's Ala Pro Leu Ly's Leu Trp Arg Asn Trp Giy Leu Ser Giu Val Lys Met Val Val Ser Ala Thr Pro Giu Pro Ser Pro Tyr Leu Trp Arg Leu Ile Ala Ala Asn Thr Leu Val Thr Val Thr Asn Leu Val Thr Ala Thr Giu Ser Trp 110 Tyr Leu Gin Ala 125 Phe Phe Trp Giu Phe Ile Gly Gly Lys Guy Gin Leu Ile Ala Leu 140 Ly's Ser Thr 155 Ala Val Ser 170 Ci's Ser Ser 185 Ser Vai Ci's 200 Tyr His Ser 215 Leu Met Ala 230 Arg Gin Ile 245 Arg Pro Ser 260 Giu Pro Gin 275 Met Arg Ala 290 Leu Val Phe 305 Leu Lys Arg 320 Ala Val Tyr 335 Asn Ser Ala 350 Ly's Giu Ly's 365 Guy Ala Gin 10 Val Pro Pro 25 Asp Tyr Leu 40 Tyr Val Ala 55 Ci's Leu Ala 70 Tyr Phe Ile 85 Ile Ci's Leu 100 Leu Phe Gly 115 Val Ser Val 130 Asp Arg Trp 145 Ala Arg Arg 160 Leu Ala Ile 175 Val Leu Pro 190 Asp Giu Arg 205 Ci's Phe Phe 220 Met Ala Tyr 235 Pro Guy Thr 250 Asp Gin Leu 265 Pro Arg Gly 280 Arg Arg Ly's 295 Ala Leu Ci's 310 Val Phe Gly 325 Ala Ci's Phe 340 Ala Asn Pro 355 Ser Leu Val 370 Met Gui' Va Asp Ti'r Gi Ti'r Pro Li' Val Phe Va Val Trp Arl, Val Asn Le, Pro Aia Se: His Ala Lei Ser Val Ali Tyr Ala Ii Ala Arg Gl, Met Val Pr( Giu Leu Ali Trp Ala As; Ile Val Th3 Phe Gin IlE Thr Ser Alz Gui' Asp LetL Arg Ala Phe Thr Ala LyE Ti'r Leu Prc Met Phe Arc Thr Phe Sei Ile Ile Tyl Leu Ser Prc PCTIUS95/05616 1 Pro Pro u Asp Giu s Gin Ti'r 1 Val Ala SAsn His a Ser Leu r Leu Leu 105 a Ci's Li's 120 a Val Leu 135 a Ci's His 150 ~Ser Ile 165 3Gin Ala 180 i Aen Arg 195 Asp Leu 210 Ti'r Leu 225 aPhe Arg 240 i Leu Val 255 1 Giu Gin 270 SLeu Ala 285 ;Met Leu 300 le Ser 315 SGin Ala 330 His Trp 345 Asn Phe 360 Ser Ci's 375 Val Ser Leu Leu Pro Leu Asn Val Asp Arg Glu Val Tyr Ala Ser Gui' Ci's Gui' -53- WO 96/34877 PCT/US95/05616 INFORMATION FOR SEQ ID NO:7: SEQUENCE CHARACTERISTICS LENGTH: 30 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: CACTAAAGCT TAATGGAGCC CTCAGCCACC INFORMATION FOR SEQ ID NO:8: SEQUENCE CHARACTERISTICS LENGTH: 25 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: ACAAGTCCTT GTCCTTCTAG AGGGC INFORMATION FOR SEQ ID NO:9: SEQUENCE CHARACTERISTICS LENGTH: 26 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: CCTAGGATGC CCCTCTGCTG CAGCGG 26 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS LENGTH: 25 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID -54- WO 96/34877 ACAAGTCCTT GTCCTTCTAG AGGGC PCT/US95/05616 INFORMATION FOR SEQ ID NO:11: SEQUENCE CHARACTERISTICS LENGTH: 32 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: CGGGATCCGC CATCATGGAG CCCTCAGCCA CC INFORMATION FOR SEQ ID NO:12: SEQUENCE CHARACTERISTICS LENGTH: 25 BASE PAIRS TYPE: NUCLEIC ACID STRANDEDNESS: SINGLE TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: ACAAGTCCTT GTCCTTCTAG AGGGC

Claims (31)

1. An isolated polynucleotide comprising a member selected from the group consisting of: a polynucleotide encoding amino acids 1-402 of SEQ ID NO:2; a polynucleotide encoding amino acids 1-369 of SEQ ID NO:4; a polynucleotide encoding amino acids 1-377 of SEQ ID NO:6; a polynucleotide encoding full length human Neuropeptide Receptor having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97128; a polynucleotide encoding mature Neuropeptide Receptor having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97128; a polynucleotide encoding amino acids 1-46 of SEQ ID NO:2; S" a polynucleotide encoding amino acids 47-106 of SEQ ID NO:2; a polynucleotide encoding amino acids 112-174 of SEQ ID NO:2; a polynucleotide encoding amino acids 175-213 of SEQ ID NO:2; a polynucleotide encoding amino acids 214-327 of SEQ ID NO:2; S(k) a polynucleotide encoding amino acids 335-402 of SEQ ID NO:2; a polynucleotide encoding amino acids 335-402 of SEQ ID NO:4; and a polynucleotide encoding amino acids 335-369 of SEQ ID NO:4; and a polynucleotide encoding amino acids 335-377 of SEQ ID NO:6. a polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO:1 or the mature protein-encoding portion thereof; a polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO:3 or the mature protein-encoding portion thereof; a polynucleotide comprising the nucleotide sequence set forth in SEQ ID or the mature protein-encoding portion thereof; a polynucleotide comprising the nucleotide sequence of the cDNA contained in ATCC Deposit No. 97128 or the mature protein-encoding portion thereof; a polynucleotide comprising a nucleotide sequence that is capable of hybridizing to any one of to and which is at least 70% identical to the polynucleotide according to any one of to wherein said nucleotide sequence encodes an amino acid equence that is capable of binding to a ligand of a human neuropeptide receptor; P:\OPER\MRO\1943894.CLM 25/11/99 4 4 *44* S 4* a S. 4 S 4 S -57- a polynucleotide fragment of the polynucleotide according to any one of to wherein said fragment is at least 20 nucleotides in length; and a polynucleotide having a nucleotide sequence that is complementary to any one of to

2. The polynucleotide of claim 1 encoding the polypeptide as set forth in SEQ ID NO:2.

3. The isolated polynucleotide of claim 1, encoding amino acids 1 to 369 of SEQ ID NO:4.

4. The isolated polynucleotide of claim 1, encoding amino acids 1 to 377 of SEQ ID NO:6. The isolated polynucleotide of claim 1, encoding the full-length polypeptide encoded by the cDNA contained in ATCC Deposit No. 97128.

6. The isolated polynucleotide of claim 1, encoding the mature polypeptide encoded by the cDNA contained in ATCC Deposit No. 97128.

7. The isolated polynucleotide of claim 1, encoding amino acids 1 to 46 of SEQ ID NO:2.

8. The isolated polynucleotide of claim 1, encoding amino acids 47 to 106 of SEQ ID NO:2.

9. The isolated polynucleotide of claim 1, encoding amino acids 112 to 174 of SEQ ID NO:2. The isolated polynucleotide of claim 1, encoding amino acids 175 to 213 of SEQ ID P:\OPER\MRO\1943894.CLM 25/11/99 -58-

11. The isolated polynucleotide of claim 1, encoding amino acids 214 to 327 of SEQ ID NO:2.

12. The isolated polynucleotide of claim 1, encoding amino acids 335 to 402 of SEQ ID NO:2.

13. The isolated polynucleotide of claim 1, encoding amino acids 335 to 369 of SEQ ID NO:4.

14. The isolated polynucleotide of claim 1, encoding amino acids 335 to 377 of SEQ ID NO:6.

15. The isolated polynucleotide of claim 1 comprising the nucleotide sequence set forth in SEQ ID NO:1 or the mature protein-encoding portion thereof.

16. The isolated polynucleotide of claim 1 comprising the nucleotide sequence set forth in SEQ ID NO:3 or the mature protein-encoding portion thereof. 4 The isolated polynucleotide of claim 1 comprising the nucleotide sequence set forth in SEQ ID NO: 1 or the mature protein-encoding portion thereof. 16. The isolated polynucleotide of claim 1 comprising a first nucleotide sequence set forth at in SEQ ID N:3 ordent the maturny one protein-encoding por 3 or 5 or a second complementaryeof. nucleotide sequence thereto and which hybridizes to any one of said SEQ ID NOs. or said second complementary nucleotide sequence, wherein said first nucleotide sequence encodes an amino acid sequence that is capable of binding to a ligand of a human neuropeptide receptor polypeptide. 4

17. The isolated polynucleotide of claim 1 comprising the nucleotide sequence set forth .in SEQ ID NO:5 or the mature protein-encoding portion thereof.

18. The isolated polynucleotide of claim 1 comprising a fragment nucleotide sequence that is at uleast 70%ides in length of the polynucleotide accordingical to any one of SEQ ID Ns: or 3 or 5 or a second complementary 18. nucleotide sequence thereto and which hybridizes to any one of said SEQ ID NOs. or said second complementary nucleotide sequence, wherein said first nucleotide sequence encodes an amino acid sequence that is capable of binding to a ligand of a human neuropeptide receptor polypeptide.

19. The isolated polynucleotide of claim 1 comprising a fragment of at least 20 contiguous /c6 'ucleotides in length of the polynucleotide according to any one of claims 2 to 18. P:\OPER\MRO\1943894.CLM 25/11/99 00 *0 0 000S 0 *00 9* 0**e 0* S.. 0 U S 00 U *0r 0* -59- The polynucleotide according to any one of claims 1 to 19 comprising DNA.

21. The polynucleotide according to any one of claims 1 to 19 comprising RNA.

22. The polynucleotide of claim 20 wherein the DNA is genomic DNA.

23. The polynucleotide according to any one of claims 1 to 22 comprising a nucleotide sequence that encodes a soluble fragment of the polypeptide of SEQ ID NO:2.

24. The polynucleotide according to any one of claims 1 to 22 comprising a nucleotide sequence that encodes a soluble fragment of the polypeptide of SEQ ID NO:4.

25. The polynucleotide according to any one of claims 1 to 22 comprising a nucleotide sequence that encodes a soluble fragment of the polypeptide of SEQ ID NO:6.

26. The polynucleotide according to any one of claims 1 to 25 when fused to a heterologous nucleic acid molecule.

27. The polynucleotide of claim 26 wherein the heterologous nucleic acid molecule encodes a polypeptide.

28. A recombinant vector comprising the polynucleotide according to any one of claims 1 to 27.

29. A host cell comprising the polynucleotide according to any one of claims 1 to 27 operably connected to a heterologous regulatory sequence. A method of producing a polypeptide comprising expressing from the host cell of claim 29 a polypeptide encoded by the polynucleotide according to any one of claims 1 to 27. \-\AN (JL x& Z,0 A T-X A method of producing a cell capable of expressing a neuropeptide receptor P:\OPER\MRO\1943894.CLM 25/11/99 polypeptide or a homologue thereof which binds a neuropeptide receptor ligand comprising transforming or transfecting a cell with the vector of claim 28 in an expressible format.

32. A polypeptide selected from the group consisting of: a polypeptide comprising amino acids 1 to 402 of SEQ ID NO:2; (ii) a polypeptide comprising amino acids 1 to 369 of SEQ ID NO:4; (iii) a polypeptide comprising amino acids 1 to 377 of SEQ ID NO:6; (iv) a polypeptide comprising the full-length amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 97128; a polypeptide comprising the amino acid sequence of the mature protein 'encoded by the cDNA contained in ATCC Deposit No. 97128; S(vi) a polypeptide comprising amino acids 1 to 46 of SEQ ID NO:2; "(vii) a polypeptide comprising amino acids 47 to 106 of SEQ ID NO:2; (viii) a polypeptide comprising amino acids 112 to 174 of SEQ ID NO:2; (ix) a polypeptide comprising amino acids 175 to 213 of SEQ ID NO:2; a polypeptide comprising amino acids 214 to 327 of SEQ ID NO:2; (xi) a polypeptide comprising amino acids 335 to 402 of SEQ ID NO:2; (xii) a polypeptide comprising amino acids 335 to 369 of SEQ ID NO:4; (xiii) a polypeptide comprising amino acids 335 to 377 of SEQ ID NO:6; 5 (xiv) a polypeptide encoded by the nucleotide sequence set forth in SEQ ID NO:1 or the mature protein-encoding portion thereof or a degenerate nucleotide sequence thereto; (xv) a polypeptide encoded by the nucleotide sequence set forth in SEQ ID NO:3 or the mature protein-encoding portion thereof or a degenerate nucleotide sequence thereto; (xvi) a polypeptide encoded by the nucleotide sequence set forth in SEQ ID or the mature protein-encoding portion thereof or a degenerate nucleotide sequence thereto; (xvii) a polypeptide encoded by a nucleotide sequence that is at least 70% identical to any one of SEQ ID NOs: 1 or 3 or 5 and which hybridizes to any one of said SEQ ID NOs, wherein said polypeptide is capable of binding to a ligand of a human neuropeptide receptor polypeptide; and (xviii) a polypeptide fragment of any one of to (xvii) that is capable of binding to SJL ligand of a human neuropeptide receptor polypeptide. P:\OPER\MRO\1943894CLM 25/11/99 -61-

33. NO:2.

34. NO:4. NO:6. The polypeptide according to claim 32 comprising amino acids 1 to 402 of SEQ ID The polypeptide according to claim 32 comprising amino acids 1 to 369 of SEQ ID The polypeptide according to claim 32 comprising amino acids 1 to 377 of SEQ ID .9 *i 9 *99* C. 9*9 9.

999. 9 9 9. C 36. The polypeptide according to claim 32 comprising the full-length amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 97128. 37. The polypeptide according to claim 32 comprising the amino acid sequence of the mature protein encoded by the cDNA contained in ATCC Deposit No. 97128. 38. The polypeptide according to claim 32 comprising amino acids 1 to 46 of SEQ ID NO:2. 39. The polypeptide according to claim 32 comprising amino acids 47 to 106 of SEQ ID NO:2. The polypeptide according to claim 32 comprising amino acids 112 to 174 of SEQ ID NO:2. 41. The polypeptide according to claim 32 comprising amino acids 175 to 213 of SEQ ID NO:2. 42. The polypeptide according to claim 32 comprising amino acids 214 to 327 of SEQ ID NO:2. The polypeptide according to claim 32 comprising amino acids 335 to 402 of SEQ ID P:\OPER\MRO\1943894.CLM 25/11/99 -62- NO:2. 44. The polypeptide according to claim 32 comprising amino acids 335 to 369 of SEQ ID NO:4. The polypeptide according to claim 32 comprising amino acids 335 to 377 of SEQ ID NO:6. 46. The polypeptide according to claim 32 being encoded by the nucleotide sequence set forth in SEQ ID NO: 1 or the mature protein-encoding portion thereof or a degenerate nucleotide sequence thereto. a 47. The polypeptide according to claim 32 being encoded by the nucleotide sequence set forth in SEQ ID NO:3 or the mature protein-encoding portion thereof or a degenerate nucleotide sequence thereto. 48. The polypeptide according to claim 32 being encoded by the nucleotide sequence set forth in SEQ ID NO:5 or the mature protein-encoding portion thereof or a degenerate nucleotide sequence thereto. 49. The polypeptide according to claim 32 being encoded by a nucleotide sequence that is at least 70% identical to any one of SEQ ID NOs: 1 or 3 or 5 and which hybridizes to any one of said SEQ ID NOs, wherein said polypeptide is capable of binding to a ligand of a human neuropeptide receptor polypeptide. The polypeptide according to claim 32 consisting of a fragment of the polypeptide according to any one of Claims 33 to 49 that is capable of binding to a ligand of a human neuropeptide receptor polypeptide. The polypeptide according to any one of claims 32 to 50 when fused to a heterologous P:\OPER\MRO\1943894.CLM 25/11/99 -63- 52. The polypeptide of claim 50 wherein the fragment is a soluble fragment. 53. An antibody against the polypeptide according to any one of claims 32 to 52. 54. A method of identifying a compound which binds to and activates the polypeptide according to any one of claims 32 to 52 comprising: providing a recombinant host cell expressing said polypeptide on its surface such that said polypeptide is associated with a second component capable of providing a detectable signal in response to the binding of a compound to said polypeptide; (ii) contacting a plurality of compounds with said host cell under conditions sufficient to permit binding of a compound that activates said polypeptide thereto; and (iii) identifying a compound that binds to said polypeptide by detecting the signal produced by said second component. a. 55. A compound that activates a neuropeptide receptor when identified by the method of claim 54. a 56. A method of treatment of a patient having need to activate a neuropeptide receptor comprising administering to said patient a therapeutically-effective amount of the compound of Claim 55 or the antibody of claim 53. 57. The method of claim 56 wherein the compound is a polypeptide and the therapeutically-effective amount of said polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo. 58. A method of identifying compounds which bind to and inhibit activation of the polypeptide according to any one of claims 32 to 52 comprising: providing a recombinant host cell expressing said polypeptide on its surface such that said polypeptide is associated with a second component capable of providing a detectable signal in response to the binding of a compound to said polypeptide; (ii) contacting said host cell with an analytically detectable ligand known to bind P:\OPER\MRO\1943894.CLM 25/11/99 -64- to said polypeptide and a plurality of other compounds being identified under conditions sufficient to permit binding of the ligand to the polypeptide; and (iii) determining whether the ligan binds to the polypeptide by detecting the absence of a signal generated from the interaction of the ligand with the polypeptide, wherein said absence of a signal is indicative that the compound being identified binds to and inhibits activation of the polypeptide. 59. A compound that inhibits activation of a neuropeptide receptor when identified by the method of claim 58. 60. A method of treatment of a patient having need to inhibit the activation of a neuropeptide receptor comprising administering to said patient a therapeutically-effective amount of the compound of Claim 59 or the antibody of claim 53. S 61. The method of claim 60 wherein the compound is a polypeptide and the therapeutically-effective amount of said polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo. 62. A method of determining whether a ligand not known to be capable of binding to the polypeptide according to any one of claims 32 to 52 can bind thereto comprising contacting a recombinant host cell that expresses said polypeptide on its surface with a candidate ligand under conditions sufficient to permit binding of a ligand to said polypeptide and detecting the presence of bound ligand. 63. The method of claim 62 wherein the polypeptide or a membrane fraction of the host cell comprising said polypeptide is isolated from the cell prior to contacting the cell with the candidate ligand to be identified. 64. A method of screening compounds to identify those compounds which bind to the A lypeptide according to any one of claims 32 to 52 comprising: ~~LL 'K P:\OPER\MRO\1943894.CLM 25/11/99 contacting a recombinant host cell that expresses said polypeptide on its surface with a plurality of candidate compounds and an analytically detectable ligand known to bind to said polypeptide under conditions sufficient to permit binding of the analytically detectable ligand to said polypeptide; and (ii) identifying those candidate compounds capable of enhancing or inhibiting the binding of the analytically detectable ligand to the receptor. An antagonist or agonist compound of a neuropeptide receptor protein when identified by the method of claim 64. 66. A method of diagnosing a disease or a susceptibility to a disease of a subject related S: to an under-expression of a neuropeptide receptor polypeptide comprising determining a mutation in a nucleotide sequence derived from said patient that is substantially the same as the nucleotide sequence or the polynucleotide according to any one of claims 1 to 67. A diagnostic method comprising analyzing a sample derived from a subject for the presence of the polypeptide of claim 52. C 68. The diagnostic method of claim 67 comprising an immunoassay. 69. The isolated polynucleotide according to any one of claims 1 to 27 substantially as hereinbefore described with reference to the Figures and/or Examples. The recombinant vector of claim 28 substantially as hereinbefore described with reference to the Figures and/or Examples. 71. The host cell of claim 29 substantially as hereinbefore described with reference to the Figures and/or Examples. AN 72. The method according to claim 30 substantially as hereinbefore described with ference to the Figures and/or Examples. U0 xAT> P:\OPER\MRO\1943894.CLM 25/11/99 -66- 73. The method of claim 31 substantially as hereinbefore described with reference to the Figures and/or Examples. 74. The polypeptide according to any one of claims 32 to 52 substantially as hereinbefore described with reference to the Figures and/or Examples. Use of the compound of claim 55 in the manufacture of a medicament for the treatment of a patient having need to activate a neuropeptide receptor. 76. Use according to claim 75 wherein the compound is a polypeptide and the medicament comprises DNA encoding said polypeptide that is expressible in said patient in vivo. **oo 77. Use of the compound of claim 59 in the manufacture of a medicament for the treatment of a patient having need to inhibit the activation of a neuropeptide receptor. 78. Use according to claim 77 wherein the compound is a polypeptide and the medicament comprises DNA encoding said polypeptide that is expressible in said patient in vivo. 79. A polypeptide when produced by the method according to claim 5 80. A cell capable of expressing a neuropeptide receptor polypeptide or a homologue thereof which binds to a neuropeptide receptor ligand, when produced by the method according to claim 31. DATED this TWENTY SIXTH day of NOVEMBER,

1999. Human Genome Sciences, Inc. By DAVIES COLLISON CAVE Patent Attorneys for the Applicant