CA2220978A1 - Human g-protein coupled receptor (hetgq23) - Google Patents

Abstract

Human G-protein coupled receptor polypeptides and DNA (RNA) encoding such polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed were methods for utilizing such polypeptides for identifying antagonists and agonists to such polypeptides and methods of using the agonists and antagonists therapeutically to treat conditions related to the underexpression and overexpression of the G-protein coupled receptor polypeptides, respectively. Also disclosed are diagnostic methods for detecting a mutation in the G-protein coupled receptor nucleic acid sequences and an altered level of the soluble form of the receptors.

Description

W O 96/39436 PCT~US95/07137 XUMAN G-PROTEIN COUPLED RECEPTOR (HETGQ23) This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention are human 7-transmembrane receptors. The invention also relates to inhibiting the action of such polypeptides.
It is well established that many medically significant biological processes are mediated by proteins participating in signal transduction pathways that involve G-proteins and/or second mes~engers, e.g., cAMP (Lefkowitz, Nature, 351:353-354 (1991)). Herein these proteins are referred to a~ proteins participating in pathways with G-proteins or PPG
proteins. Some examples of these proteins include the GPC
receptors, such as those for adrenergic agents and dopamine (Kobilka, B.K., et al., PNAS, 84:46-50 (1987); Kobilka, B.K., et al., Science, 238:650-656 (1987); Bunzow, J.R., et al., Nature, 336:783-787 (1988)), G-proteins themselves, effector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins, e.g., protein ~ kinase A and protein k nase C (Simon, M.I., et al., Science, 252:802-8 (1991)).
.

W O 96/39436 PCT~US95107137 For example, in one ~orm o~ signal transduction, the e~ect o~ hormone binding is activation o~ an enzyme, adenylate cyclase, inside the cell. Enzyme activation by hormones is dependent on the presence o~ the nucleotide GTP, and GTP also in~luences hormone binding. A G-protein connects the hormone receptors to adenylate cyclase. G-protein was shown to exchange GTP ~or bound GDP when activated by hormone receptors. The GTP-carrying ~orm then binds to an activated adenylate cyclase. Hydrolysis o~ GTP
to GDP, catalyzed by the G-protein itsel~, returns the G-protein to its basal, inactive ~orm. Thus, the G-protein serves a dual role, as an intermediate that relays the signal ~rom receptor to e~ector, and as a clock that controls the duration o~ the signal.
The membrane protein gene super~amily o~ G-protein coupled receptors has been characterized as having seven putative transmembrane domains. The domains are believed to represent transmembrane ~-helices connected by extracellular or cytoplasmic loops. G-protein coupled receptors include a wide range of biologically active receptors, such as hormone, viral, growth ~actor and neuroreceptors.
G-protein coupled receptors have been characterized as including these seven conserved hydrophobic stretches o~
about 20 to 30 amino acids, connecting at least eight divergent hydrophilic loops. The G-protein ~amily o~ coupled receptors includes dopamine receptors which bind to neuroleptic drugs used ~or treating psychotic and neurological disorders. Other examples o~ members o~ this ~amily include calcitonin, adrenergic, endothelin, cAMP, adenosine, muscarinic, acetylcholine, serotonin, histamine, thrombin, kinin, ~ollicle stimulating hormone, opsins, endothelial di~erentiation gene-1 receptor, rhodopsins, odorant, cytomegalovirus receptors, etc.
Most G-protein coupled receptors have single conserved cysteine residues in each o~ the ~irst two extracellular loops which ~orm disul~ide bonds that are believed to stabilize ~unctional protein structure. The 7 transmembrane regions are designated as TMl, TM2, TM3, TM4, TM5, TM6, and TM7. TM3 has been implicated in signal transduction.
Phosphorylation and lipidation (palmitylation or ~arnesylation) of cysteine residues can in~luence signal transduction o~ some G-protein coupled receptors. Most G-protein coupled receptors contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus. For several G-protein coupled receptors, such as the ~-adrenoreceptor, phosphorylation by protein kinase A
and/or specific receptor kinases mediates receptor desensitization.
For some receptors, the ligand binding sites o~ G-protein coupled receptors are believed to comprise a hydrophilic socket formed by several G-protein coupled receptors transmembrane domains, which socket is surrounded by hydrophobic residues of the G-protein coupled receptors.
The hydrophilic side o~ each G-protein coupled receptor transmembrane helix is postulated to ~ace inward and ~orm the polar ligand binding site. TM3 has been implicated in several G-protein coupled receptors as having a ligand binding site, such as including the TM3 aspartate residue.
Additionally, TM5 serines, a TM6 asparagine and TM6 or TM7 phenylalanines or tyrosines are also implicated in ligand binding.
G-protein coupled receptors can be intracellularly coupled by heterotrimeric G-proteins to various intracellular enzymes, ion channels and transporters (see, Johnson et al., Endoc., Rev., 10:317-331 (1989)). Di~erent G-protein ~-subunits pre~erentially stimulate particular ef~ectors to modulate various biological ~unctions in a cell.
Phosphorylation o~ cytoplasmic residues of G-protein coupled receptors have been identi~ied as an important mechanism ~or the regulation of G-protein coupling o~ some G-protein coupled receptors. G-protein coupled receptors are found in numerous sites within a m~m~l ian host.
In accordance with one aspect of the present invention, there are provided novel polypeptides as well as biologically active and diagnostically or therapeutically useful fragments and derivatives thereof. The polypeptides of the present invention are of human origin.
In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding the polypeptide of the present invention including mRNAs, DNAs, cDNAs, genomic DNA as well as antisense analogs thereof and biologically active and diagnostically or therapeutically useful fragments thereof.
In accordance with a further aspect of the present invention, there is provided a process for producing such polypeptides by recombinant techniques which comprises culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention , under conditions promoting expression of said polypeptide and subsequent recovery of said polypeptide.
In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.
In accordance with another aspect of the present invention there are provided methods of screening for compounds which bind to and activate or inhibit activation of the receptor polypeptides of the present invention and for receptor ligands.
In accordance with still another embodiment of the present invention there is provided a process of using such activating compounds to stimulate the receptor polypeptide of the present invention for the treatment of conditions related to the under-expression of the G-protein coupled receptors.

W O 96/39436 PCT~US95/07137 In accordance with another aspect of the present invention there is provided a process of using such inhibiting compounds for treating conditions associated with over-expression of the G-protein coupled receptors.
In accordance with yet another aspect of the present invention there is provided non-naturally occurring ~ synthetic, isolated and/or recombinant G-protein coupled receptor polypeptides which are fragments, consensus fragments and/or sequences having conservative amino acid substitutions, of at least one transmembrane ~o~; n of the G-protein coupled receptor of the present invention, such that the receptor may bind G-protein coupled receptor ligands, or which may also modulate, quantitatively or qualitatively, G-protein coupled receptor ligand binding.
In accordance with still another aspect of the present invention there are provided synthetic or recombinant G-protein coupled receptor polypeptides, conservative substitution and derivatives thereof, antibodies, anti-idiotype antibodies, compositions and methods that can be useful as potential modulators of G-protein coupled receptor function, by binding to ligands or modulating ligand binding, due to their expected biological properties, which may be used in diagnostic, therapeutic and/or research applications.
It is still another object of the present invention to provide synthetic, isolated or recombinant polypeptides which are designed to inhibit or mimic various G-protein coupled receptors or ~ragments thereof, as receptor types and subtypes.
In accordance with yet a further aspect of the present invention, there is also provided diagnostic probes comprising nucleic acid molecules of sufficient length to speci~ically hybridize to the nucleic acid sequences o~ the present invention.
In accordance with yet another object of the present invention, there is provided a diagnostic assay for detecting O 96/39436 PCT~US95/07137 a disease or susceptibility to a disease related to mutation in a nucleic acid sequence o~ the present invention These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.
The ~ollowing drawings are illustrative of embodiments o~ the invention and are not meant to limit the scope o~ the invention as encompassed by the claims.
Figure 1 shows the cDNA sequence and the corresponding deduced amino acid sequence of the G-protein coupled receptor of the present invention. The standard one-letter abbreviation for amino acids are used. Sequencing was performed using a 373 Automated DNA sequencer (Applied Biosystems, Inc.).
Figure 2 is an illustration o~ the amino acid homology between the polypeptide o~ the present invention (top line) and hllm~n endothelial dif~erentiation protein (edg-1) gene mRNA (bottom line).
Figure 3 is an illustration o~ the secondary structural ~eatures of the G-protein coupled receptor. The ~irst 7 illustrations set forth the regions of the amino acid sequence which are alpha helices,-beta sheets, turn regions or coiled regions. The boxed areas are the areas which correspond to the region indicated. The second set of figures illustrate areas of the amino acid sequence which are exposed to intracellular, cytoplasmic or are membrane-spanning. The hydrophilicity part illustrates areas of the protein sequence which are in the lipid bilayer o~ the membrane and are, therefore, hydrophobic, and areas outside the lipid bilayer membrane which are hydrophilic. The antigenic index corresponds to the hydrophilicity plot, since antigenic areas are areas outside the lipid bilayer membrane and are capable o~ binding antigens. The sur~ace probability plot ~urther corresponds to the antigenic index and the hydrophilicity plot. The amphipathic plots show those regions of the 13 se~uences which are polar and non-polar.
The flexible regions correspond to the second set of illustrations in the sense that flexible regions are those which are outside the membrane and inflexible regions are transmembrane regions.
In accordance with an aspect of the present invention, there are provided isolated nucleic acids (polynucleotides) which encode for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 97,130 on 4-28-95.
A polynucleotide encoding the polypeptide of the present invention was isolated from a cDNA library derived from hllm~n endometrial tumor tissue. It is structurally related to the G protein-coupled receptor family. It contains an open reading frame encoding a protein of 364 amino acid residues.
The protein exhibits the highest degree of homology to a hl~m~n EDG-l protein with 36 ~ identity and 61 ~ simila~ity over a 364 amino acid stretch. Potential ligands to the receptor polypeptide of the present invention include but are not limited to ~n~n~m; de, serotonin, adrenalin and noradrenalin, platelet activating factor, thrombin, C5a and bradykinin, chemokine, and platelet activating factor.
The polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID
NO:1) or that of the deposited clone or may be a different coding sequence which coding se~uence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:1) or the deposited cDNA.

W O 96/39436 PCT~US95/07137 The polynucleotides which encode ~or the mature polypeptides o~ Figure 1 (SEQ ID NO:2) or ~or the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence ~or the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' o~ the coding sequence ~or the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding' sequence ~or the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
The present invention ~urther relates to variants o~ the hereinabove described polynucleotides which encode ~or ~ragments, analogs and derivatives o~ the polypeptide having the deduced amino acid sequence o~ Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA o~ the deposited clone.
The variants of the polynucleotides may be a naturally occurring allelic variant of the polynucleotides or a non-naturally occurring variant o~ the polynucleotides.
Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO:2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants o~ such polynucleotides which variants encode ~or a ~ragment, derivative or analog o~ the polypeptide o~ Figure 1 (SEQ ID
NO:2) or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variants include deletion variar-s, substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotides may have a coding sequence which is a naturally occurring allelic variant o~ the coding sequence shown in Figure 1 (SEQ ID
NO:1) or o~ the coding sequence o~ the deposited clone. As known in the art, an allelic variant is an alternate ~orm o~
a polynucleotide sequence which may have a substitution, W096/39436 PCT~S95/07137 deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptides.
The polynucleotides may also encode for a soluble form of the receptor polypeptide of the present invention which is the extracellular portion of the polypeptide which has been cleaved from the TM and intracellular domain of the full-length polypeptide of the present invention.
The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptides of the present invention.- The marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a m~mm~l ian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
Fragments of the full length gene of the present invention may be used as a hybridization probe ~or a cDNA
library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity. Probes of this type preferably have at least 20 or 30 bases and may contain, for example, 50 or more bases. The probe may also be used to identify a cDNA
clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene of the present invention including regulatory and promotor regions, exons, and introns. An example of a screen comprises isolating the _ g _ coding region o~ the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene o~ the present invention are used to screen a library o~ human cDNA, genomic DNA or mRNA to determine which members o~ the library the probe hybridizes to.
The present invention ~urther relates to polynucleotides which hybridize to the hereinabove-described sequences i~ there is at least 70~, pre~erably at least 90~, and more pre~erably at least 95~ identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95~ and pre~erably at least 97~ identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a pre~erred embodiment encode polypeptides which either retain substantially the same biological ~unction or activity as the mature polypeptide encoded by the cDNAs o~ Figure 1 (SEQ ID N0:1) or the deposited cDNA(s).
Alternatively, the polynucleotide may have at least 20 bases, pre~erably at least 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide o~ the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes ~or the polynucleotide of SEQ ID NO:1, ~or example, ~or recovery o~ the polynucleotide or as a diagnostic probe or as a PCR primer.
Thus, the present invention is directed to polynucleotides having at least a 70~ identity, preferably at least 90~ and more pre~erably at least a 95~ identity to a polynucleotide which encodes the polypeptide o~ SEQ ID N0:2 as well as ~ragments thereo~, which ~ragments have at least 20 or 30 bases and preferably at least 50 bases and to polypeptides encoded by such polynucleotides.
The deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. 112.
The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
The present invention further relates to a G-protein coupled receptor polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.
The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA, means a polypeptide which either retains substantially the same biological function or activity as such polypeptide, i.e. ~unctions as a G-protein coupled receptor, or retains the ability to bind the ligand or the receptor even though the polypeptide does not function as a G-protein coupled receptor, for example, a soluble form of the receptor. An analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
The polypeptides of the present invention may be recombinant polypeptides, a natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.

O 96/39436 PCTrUS95/07137 The fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA
may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more o~ the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide which is employed for purification of the mature polypeptide or (v) one in which a ~ragment of the polypeptide is soluble, i.e. not membrane bound, yet still binds ligands to the membrane bound receptor. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living ~n;m~l iS not isolated, but the same polynucleotide or polypeptide, separated ~rom some or all o~ the coexisting materials in the natural system, i8 isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
The polypeptides o~ the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70~
similarity (preferably at least a 70~ identity) to the polypeptide of SEQ ID NO:2 and more preferably at least a 90~
similarity (more preferably at least a 90~ identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least a 95~ similarity (still more preferably at least a 95~
identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the G-protein coupled receptor genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
The polynucleotides o~ the present invention may be employed for producing polypeptides by recombinant techniques. Thus, ~or example, the polynucleotide may be included in any one o~ a variety o~ expression vectors ~or expressing a polypeptide. Such vectors include chromosomal, nonch~omosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived ~rom combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, ~owl pox virus, and pseudorabies.
However, any other vector may be used as long as it is replicable and viable in the host.
The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples o~ such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or tr~, the phage lambda P~
promoter and other promoters known to control expression o~
genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also contains a ribosome binding site ~or translation initiation and a transcription terminator.
The vector may also include appropriate se~uences ~or amplifying expression.
In addition, the expression vectors pre~erably contain one or more selectable marker genes to provide a phenotypic trait ~or selection o~ trans~ormed host cells such as dihydrofolate reductase or neomycin resistance ~or eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to trans~orm an appropriate host to permit the host to express the protein.
As representative examples o~ appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomyces, Salmonella ty~himurium; ~ungal cells, such as yeast; insect cells such as Droso~hila S2 and S~odo~tera S~9;
~n; m~ 1 cells such as CHO, COS or Bowes melanoma;
adenoviruses; plant cells, etc. The selection o~ an approp__ate host is deemed to be within the scope o~ those skilled in the art from the teachings herein.
More particularly, the present invention also includes recombinant constructs comprising one or more o~ the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence o~ the invention has been inserted, in a ~orward or reverse orientation. In a pre~erred aspect o~ this embodiment, the construct ~urther comprises regulatory sequences, including, ~or example, a promoter, operably linked to the sequence. Large numbers o~ suitable vectors and promoters are known to those o~ skill in the art, and are commercially available. The ~ollowing vectors are provided by way o~ example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.

W O 96/39436 PCTrUS95/07137 Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda P~, PL and trp.
Eukaryotic promoters include CMV immediate early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a m~mm~lian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).
The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the reco~mbinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.

W O 96/39436 PCT~US95/07137 Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. ~nh~ncers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription.
Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma ~nh~ncer on the late side of the replication origin, and adenovirus enhancers.
Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), ~-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences.
Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified puri~ication of expressed recombinant product.
Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter o~ choice.
As a representative but nonlimiting example, use~ul expression vectors for bacterial use can comprise a selectable marker and bacterial origin o~ replication derived ~rom commercially available plasmids comprising genetic elements o~ the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, ~or example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "backbone"
sections are combined with an appropriate promoter and the structural sequence to be expressed.
Following trans~ormation o~ a suitable host strain and growth o~ the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured ~or an additional period.
Cells are typically harvested by centri~ugation, disrupted by physical or chemical means, and the resulting crude extract retained for ~urther puri~ication.
Microbial cells employed in expression of proteins can be disrupted by any convenient method, including ~reeze-thaw cycling, sonication, mechanical disruption, or use o~ cell lysing agents, such methods are well know to those skilled in the art.
Various m~mm~l ian cell culture systems can also be employed to express recombinant protein. Examples of m~mm~l ian expression systems include the COS-7 lines o~
monkey kidney ~ibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable o~ expressing a compatible vector, ~or example, the C127, 3T3, CHOHS293, HeLa and BHK cell lines. M~mm~lian expression vectors will comprise an origin o~ replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, W O 96/39436 PCTrUS95107137 transcriptional termination sequences, and 5' ~ianking nontranscribed sequences.- DNA sequences derived ~rom the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
~ The G-protein coupled receptor polypeptide o~ the present invention can be recovered and puri~ied ~rom recombinant cell cultures by methods including ammonium sul~ate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, af~inity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein re~olding steps can be used, as necessary, in completing con~iguration of the mature protein. Finally, high per~ormance liquid chromatography (HPLC) can be employed ~or ~inal puri~ication steps.
The polypeptides of the present invention may be a naturally puri~ied product, or a product o~ chemical synthetic procedures, or produced by recombinant techniques ~rom a prokaryotic or eukaryotic host (~or example, by bacterial, yeast, higher plant, insect and m~mm~lian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides o~ the present invention may be glycosylated or may be non-glycosylated.
Polypeptides o~ the invention may also include an initial methionine amino acid residue.
The G-protein coupled receptors of the present invention may be employed in a process ~or screening ~or compounds which activate (agonists) or inhibit activation (antagonists) o~ the receptor polypeptide of the present invention .
In general, such screening procedures involve providing appropriate cells which express the receptor polypeptide o~
the present invention on the sur~ace thereo~. Such cells include cells ~rom m~mm~l S, yeast, drosophila or E. Coli . In particular, a polynucleotide encoding the receptor o~ the present invention is employed to trans~ect cells to thereby express the G-protein coupled receptor. The expressed receptor is then contacted with a test compound to observe binding, stimulation or inhibition of a functional response.
One such screening procedure involves the use of melanophores which are transfected to express the G-protein coupled receptor of the present invention. Such a screening technique is described in PCT WO 92/01810 published February 6, 1992.
Thus, for example, such assay may be employed for screening for a compound which inhibits activation of the receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both the receptor ligand and a compound to be screened. Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor, i.e., inhibits activation of the receptor.
The screen may be employed for determ; n; ng a compound which activates the receptor by contacting such cells with compounds to be screened and determining whether such compound generates a signal, i.e., activates the receptor.
Other screening techniques include the use of cells which express the G-protein coupled receptor (~or example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science, volume 246, pages 181-296 (October 1989). For example, compounds may be contacted with a cell which expresses the receptor polypeptide of the present invention and a second messenger response, e.g.
signal transduction or pH changes, may be measured to determine whether the potential compound activates or inhibits the receptor.
Another such screening technique involves introducing RNA encoding the G-protein coupled receptor into Xenopus oocytes to transiently express the receptor. The receptor oocytes may then be contacted with the receptor ligand and a CA 02220978 l997-ll-l3 W O 96139436 PCT~US95tO7137 compound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of screening for compounds which are thought to inhibit activation of the receptor.
Another screening technique involves expressing the G-protein coupled receptor in which the receptor is linked to a phospholipase C or D. As representative examples of such cells, there may be mentioned endothelial cells, smooth muscle cells, embryonic kidney cells, etc. The screening may be accomplished as hereinabove described by detecting activation of the receptor or inhibition of activa~ion of the receptor from the phospholipase second signal.
Another method involves screening for compounds which inhibit activation of the receptor polypeptide of the present invention antagonists by determining inhibition of binding o~
labeled ligand to cells which have the receptor on the surface thereof. Such a method involves transfecting a eukaryotic cell with DNA encoding the G-protein coupled receptor such that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a known ligand. The ligand can be labeled, e.g., by radioactivity. The amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. I~ the compound binds to the receptor as determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited.
G-protein coupled receptors are ubiquitous in the m~mm~l ian host and are responsible for many biological functions, including many pathologies. Accordingly, it is desirous to ~ind compounds and drugs which stimulate the G-protein coupled receptor on the one hand and which can inhibit the ~unction o~ a G-protein coupled receptor on the other hand.

W O 96/39436 PCT~US95/07137 For example, compounds which activate the G-protein coupled receptor may be employed for therapeutic purposes, such as the treatment of asthma, Parkinson's disease, acute heart failure, hypotension, urinary retention, and osteoporosis.
In general, compounds which inhibit activation of the G-protein coupled receptor may be employed for a variety of therapeutic purposes, for example, for the treatment of hypertension, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy and psychotic and neurological disorders, including schizophrenia, manic excitement, depression, delirium, dementia or severe mental retardation, dyskinesias, such as Huntington's disease or Gilles dela Tourett's syndrome, among others. Compounds which inhibit G-protein coupled receptors have also been useful in reversing endogenous anorexia and in the control of bulimia.
An antibody may antagonize a G-protein coupled receptor of the present invention, or in some cases an oligopeptide, which bind to the G-protein coupled receptor but does not elicit a second messenger response such that the activity of the G-protein coupled receptors is prevented. Antibodies include anti-idiotypic antibodies which recognize unique determ;n~nts generally associated with the antigen-binding site of an antibody. Potential antagonist compounds also include proteins which are closely related to the ligand of the G-protein coupled receptors, i.e. a fragment of the ligand, which have lost biological function and when binding to the G-protein coupled receptor, elicit no response.
An antisense construct prepared through the use of antisense technology, may be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature W O 96/39436 PCT~US95/07137 polypeptides o~ the present invention, is used to design an antisense RNA oligonucleotide o~ ~rom about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region o~ the gene involved in transcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and the production o~ G-protein coupled receptor. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation o~ mRNA
molecules into G-protein coupled receptor (antisense - Okano, J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors o~ Gene Expression, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA
may be expressed in vivo to inhibit production o~ G-protein coupled receptor.
A small molecule which binds to the G-protein coupled receptor, making it inaccessible to ligands such that normal biological activity is prevented, ~or example small peptides or peptide-like molecules, may also be used to inhibit activation of the receptor polypeptide o~ the present invention.
A soluble ~orm of the G-protein coupled receptor, e.g.
a ~ragment o~ the receptors, may be used to inhibit activation o~ the receptor by binding to the ligand to a polypeptide o~ the present invention and preventing the ligand ~rom interacting with membrane bound G-protein coupled receptors.
This invention additionally provides a method o~
treating an abnormal condition related to an excess o~ G-protein coupled receptor activity which comprises administering to a subject the inhibitor compounds as hereinabove described along with a pharmaceutically acceptable carrier in an amount e~ective to inhibit activation by blocking binding o~ ligands to the G-protein coupled receptors, or by inhibiting a second signal, and thereby alleviating the abnormal conditions.
The invention also provides a method o~ treating abnormal conditions related to an under-expression o~ G-protein coupled receptor activity which comprises administering to a subject a therapeutically ef~ective amount of a compound which activates the receptor polypeptide of the present invention as described above in combination with a pharmaceutically acceptable carrier, to thereby alleviate the abnormal conditions.
The soluble form of the G-protein coupled receptor, and compounds which activate or inhibit such receptor, may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically e~ective amount of the polypeptide or compound, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.
The invention also provides a pharmaceutical pack or kit comprising one or more containers ~illed with one or more o~
the ingredients of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the ~orm prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency o~
manufacture, use or sale for human administration. In addition, the pharmaceutical compositions may be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be administered in a convenient manner such as by the topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical compositions are CA 02220978 l997-ll-l3 administered in an amount which is effective for treating and/or propnylaxis of the specific indication. In general, the pharmaceutical compositions will be administered in an amount of at least about 10 ~g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ~g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
The G-protein coupled receptor polypeptides, and compounds which activate or inhibit which are also compounds may be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy."
Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
Similarly, cells may be engineered in vivo ~or expression of a polypeptide in vivo by, ~or example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA
encoding the polypeptide o~ the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings o~ the present invention. For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may W O 96/39436 PCTnJS95/07137 be used to engineer cells in vivo a~ter combination with a suitable delivery vehicle.
Retroviruses ~rom which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human ;mml~node~iciency virus, adenovirus, Myeloproli~erative Sarcoma Virus, and m~mm~ry tumor virus.
In one embodiment, the retroviral plasmid vector is derived ~rom Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the hllm~n cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ~-actin promoters). Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art ~rom the teachings contained herein.
The nucleic acid sequence encoding the polypeptide o~
the present invention is under the control o~ a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs -W O 96/39436 PCT~US95/07137 (including the modi~ied retroviral LTKs hereinabove described); the ~-actin promoter; and hllm~n growth hormone promoters. The promoter also may be the native promoter which controls the genes encoding the polypeptides.
The retroviral plasmid vector is employed to transduce packaging cell lines to ~orm producer cell lines. Examples o~ packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-14X, VT-19-17-H2, ~CRE, ~CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pg.
5-14 (1990), which is incorporated herein by re~erence in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use o~ liposomes, and CaPO4 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
The producer cell line generates in~ectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, ~ibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
The present invention also provides a method ~or determining whether a ligand not known to be capable o~
binding to a G-protein coupled receptor o~ the present invention can bind to such receptor which comprises contacting a mammalian cell which expresses a G-protein coupled receptor with the ligand under conditions permitting binding o~ ligands to the G-protein coupled receptor, CA 02220978 l997-ll-l3 W O 96/39436 PCT~US95/07137 detecting the presence of a ligand which binds to the receptor and thereby determining whether the ligand binds to the G-protein coupled receptor.
This invention further provides a method of screening drugs to identify drugs which specifically interact with, and bind to, the hl~m~n G-protein coupled receptors on the surface of a cell which comprises contacting a m~mm~l ian cell comprising an isolated DNA molecule encoding the G-protein coupled receptor with a plurality of drugs, determining those drugs which bind to the m~m~1 ian cell, and thereby identifying drugs which specifically interact with and bind to a hllm~n G-protein coupled receptor of the present invention. Such drugs may then be used therapeutically to either activate or inhibit activation of the receptors of the present invention.
This invention also provides a method of detecting expression of the G-protein coupled receptor on the surface of a cell by detecting the presence of mRNA coding for a G-protein coupled receptor which comprises obtaining total mRNA
from the cell and contacting the mRNA so obtained with a nucleic acid probe of the present invention capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human G-protein coupled receptor under hybridizing conditions, detecting the presence of mRNA hybridized to the probe, and thereby detecting the expression of the G-protein coupled receptor by the cell.
This invention is also related to the use of the G-protein coupled receptor genes as part of a diagnostic assay for detecting diseases or susceptibility to diseases related to the presence of mutations in the nucleic acid sequences with encode the receptor polypeptides of the present invention. Such diseases, by way of example, are related to cell transformation, such as tumors and cancers.

CA 02220978 l997-ll-l3 W O 96/39436 PCT~US95/07137 Individuals carrying mutations in the human G-protein coupled receptor gene may be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA
may be used directly for detection or may be amplified ~ enzymatically by using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis. RNA or cDNA may also be used ~or the same purpose. As an example, PCR primers complementary to the nucleic acid encoding the G-protein coupled receptor proteins can be used to identify and analyze G-protein coupled receptor mutations. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
Point mutations can be identified by hybridizing amplified DNA to radiolabeled G-protein coupled receptor RNA or alternatively, radiolabeled G-protein coupled receptor antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
Sequence differences between the re~erence gene and gene having mutations may be revealed by the direct DNA sequencing method. In addition, cloned DNA segments may be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer is used with double-stranded PCR
product or a single-stranded template molecule generated by a modi~ied PCR. The sequence determination is per~ormed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.
Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA

W O 96/39436 PCTrUS95/07137 ~ragments o~ di~erent sequences may be distinguished on denaturing ~ormamide gradient gels in which the mobilities o~
di~erent DNA ~ragments are retarded in the gel at di~erent positions according to their speci~ic melting or partial melting temperatures (see, e.g., Myers et al., Science, 230:1242 (1985)).
Sequence changes at speci~ic locations may also be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 (1985)).
Thus, the detection o~ a speci~ic DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use o~
restriction enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP)) and Southern blotting o~ genomic DNA.
In addition to more conventional gel-electrophoresis and DNA sequencing, mutations can also be detected by in si tu analysis.
The present invention also relates to a diagnostic assay ~or detecting altered levels o~ soluble ~orms o~ the receptor polypeptides of the present invention in various tissues.
Assays used to detect levels o~ the soluble receptor polypeptides in a sample derived ~rom a host are well known to those o~ skill in the art and include radioimmunoassays, competitive-binding assays, Western blot analysis and pre~erably as ELISA assay.
An ELISA assay initially comprises preparing an antibody speci~ic to antigens o~ the receptor polypeptide, pre~erably a monoclonal antibody. In addition a reporter antibody i8 prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, ~luorescence or in this example a horseradish peroxidase enzyme. A sample is now removed ~rom a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any f ree protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies a~-:ach to any receptor polypeptides of the present invention attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to receptor proteins. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of receptor proteins present in a given volume of patient sample when compared against a standard curve.
The se~uences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual hllm~n chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presen~ly available for marking chromosomal location. The mapping o~ DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with gene associated with disease.
Briefly, sequences can be mapped to chromosomes by preparing PCR primers (pre~erably 15-25 bp) ~rom the cDNA.
Computer analysis of the 3' untranslated region is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process.
These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the hllm~n gene corresponding to the primer will yield an amplified fragment.

=

W O 96/39436 PCTrUS95/07137 PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels o~
fragments from specific chromosomes or pools of large genomic clones in an analogous m~nner. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled ~low-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) o~ a cDNA
clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases.
For a review of this technique, see Verma et al., Human Chromosomes: A ~nll~ 1 of Basic Techniques, Pergamon Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusic , Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic sequence between a~fected and unaf~ected individuals. I~ a mutation is observed in some or all of the a~ected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one WO 96/39436 PCT~US95/07137 of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).
The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies ~ can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes chimeric, single chain, and hllm~n;zed antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an ~n; m~ 1 or by administering the polypeptides to an animal, preferably a nonhllm~n. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples nclude the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice may be used to W O 96/39436 PCTrUS95/07137 express hllm~n;zed antibodies to immunogenic polypeptide products of this invention.
The present invention will be ~urther described with re~erence to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise speci~ied, are by weight.
In order to ~acilitate understanding o~ the following examples certain ~requently occurring methods and/or terms will be described.
"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, co~actors and other require-~nts were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 ~g of plasmid or DNA
fragment is used with about 2 units o~ enzyme in about 20 ~1 o~ buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 ~g of DNA are digested with 20 to 250 units o~ enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is W O 96/39436 PCTrUS95/07137 electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D.
et al., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase ("ligase") per 0.5 ~g of approximately equimolar amounts of the DNA fragments to be ligated.
Unless otherwise stated, transformation was performed as described in the method of Graham; F. and Van der Eb, A., Virology, 52:456-457 (1973).

Example 1 Bacterial Expression and Purification of the G-Protein Coupled Receptor (GPRC) polypeptide The DNA sequence encoding GPRC, ATCC # 97,130, is initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' end sequences o~ the processed GPRC nucleotide sequence. Additional nucleotides corresponding to the GPRC nucleotide sequence are added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence 5' CACAGG~TCCCGTGGCTGCCATCTCTACTTC 3' (SEQ ID NO:3) contains a BamHT restriction enzyme site W 096/39436 PCT~US95/07137 followed by 17 nucleotides of GPRC coding sequence starting from the presumed second amino acid o~ the processed protein.
The 3' sequence; 5' TCTCAGGTACCGTTCTCTAAACCACAGAGTGGTCA (SEQ
ID NO:4 ) contains complementary sequences to an ASP718 site and is followed by 19 nucleotides of GPRC coding sequence.
The restriction enzyme sites corre~pond to the restriction enzyme sites on the bacterial expression vector pQE-31 (Qiagen, Inc. Chatsworth, CA). pQE-31 encodes antibiotic resistance (Ampr), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites.
pQE-31 is then digested with BamHT and ASP718. The ampli~ied sequences are ligated into pQE-31 and are inserted in frame with the sequence encoding for the histidine tag and the RBS.
The ligation mixture is then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies of the plasmid pREE-, which expresses the lacI repressor and also confers kanamycin resistance (Kanr).
Transformants are identified by their ability to grow on LB
plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis.
Clones containing the desired constructs are grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N
culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells are grown to an optical density 600 (o.D.600) o~ between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") is then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene expression. Cells are grown an extra 3 to 4 hours. Cells are then harvested by centrifugation. The cell pellet is W O 96/39436 PCT~US95/07137 solubilized in the chaotropic agent 6 Molar Guanidine HCl.
After clarification, solubilized GPRC is purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 (1984)). GPRC is eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpo~e of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After incubation in this solution for 12 hours the protein is dialyzed to 10 mmolar sodium phosphate.

Example 2 ExPression of Recombinant GPCR in COS7 cells The expression of plasmid, GPRC HA was derived from a vector pcDNA3/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire GPRC precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression was directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid construction strategy was desc: ~ed as follows:
The DNA sequence encoding GPRC, ATCC # 97,130, was constructed by PCR using two primers: the 5' primer 5' CAACCACAGGGATCCCATGGCTGCCATCTCTACTTCCATCCCTGTA 3' (SEQ ID

W O 96/39436 PCT~US95/07137 NO:5) contains a BamHI site (bold) ~ollowed by 27 nucleotides o~ GPRC coding sequence starting ~rom the initiation codon;
the 3' sequence 5' CCCCTCGAGCTAAACCACAGAGTGGTCATTGCT
GTGAACTCCAGCC 3' (SEQ ID NO:6) contains complementary sequences to an XhoI site, translation stop codon, HA tag and the last 24 nucleotides o~ the GPRC coding sequence (not including the stop codon). There~ore, the PCR product contains a HindIII site, GPRC coding sequence ~ollowed by HA
tag ~used in ~rame, a translation termination stop codon next to the HA tag, and an XhoI site. The PCR ampli~ied DNA
~ragment and the vector, pcDNA3/Amp, were digested with HindIII and XhoI restriction enzymes and ligated. The ligation mixture was trans~ormed into E. coli strain DH5~, the trans~ormed cultur was plated on ampicillin media plates and resistant colonies were selected. Plasmid DNA was isolated ~rom trans~ormants and ~m; ned by restriction analysis ~or the presence o~ the correct ~ragment. For expression o~ the recombinant GPRC, COS7 cells were trans~ected with the expression vector by DEAE-DEXTRAN method (J. Sam~rook, E. Fritsch, T. Maniatis, Molecular Cloning: A
Laboratory M~nll~l, Cold Spring Laboratory Press, (1989)).
The expression of the GPRC HA protein was detected by radiolabeling and ;mmllnoprecipitation method (E. Harlow, D.
Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells were labelled ~or 8 hours with 35S-cysteine two days post trans~ection. Culture media were then collected and cells were lysed with detergent (RIPA
bu~er (150 mM NaCl, 1~ NP-40, 0.1~ SDS, 1~ NP-40, 0.5~ DOC, 50mM Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)).
Both cell lysate and culture media were precipitated with a HA speci~ic monoclonal antibody. Proteins precipitated were analyzed on 15~ SDS-PAGE gels.

Example 3 W O 96/39436 PCTrUS95/07137 Cloninq and exPression of GPRC usinq the baculovirus expression system The DNA sequence encoding the full length GPRC protein, ATCC # 97,130, was amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5' TTCACCACCTACCTGGATCC
ACAGAGCTGTCATGGCTGCC 3' (SEQ ID NO:7) and contains a BamHI
restriction enzyme site (in bold) followed by 11 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987) which was just behind the first 9 nucleotides of the GPRC gene (the initiation codon for translation "ATG" is underlined).
The 3' primer has the sequence 5' CCTCATCTCAGGTACCGTT
CTAAACCACAGAGTGG 3' (SEQ ID NO:8) and contains the cleavage site for the ASP718 restriction ~n~onllclease and 10 nucleotides complementary to the 3' non-translated sequence of the GPRC gene. The amplified sequences were isolated from a 1~ agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the endonuclease BamHI and then purified again on a 1~ agarose gel. This fragment was designated F2.
The vector pA2 (modi~ication o~ pVL941 vector, discussed below) was used ~or the expression of the GPRC protein using the baculovirus expression system ~for review see: Summers, M.D. and Smith, G.E. 1987, A m~nll~l of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expression vector contains the strong polyhedrin promoter o~
the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonuclease BamHI. The polyadenylation site of the simian virus (SV)40 was used for e~icient polyadenylation. For an easy selection of recombinant virus the beta-galactosidase gene from E.coli was inserted in the same orientation as the polyhedrin promoter ~ollowed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences were ~lanked at both sides by viral sequences ~or the cell-mediated homologous recombination o~
cotrans~ected wild-type viral DNA. Many other baculovirus vectors could be used in place o~ pA2 such as pAc373, pVL941, PRGl and pAcIM1 (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
The plasmid was digested with the restriction enzymes ASP718 and BamHT then dephos~norylated using cal~ intestinal phosphatase by procedures known in the art. The DNA was then isolated ~rom a 1~ agarose gel using the commercially available kit ("Geneclean" BI0 101 Inc., La Jolla, Ca.).
This vector DNA was designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli DH5~ cells were then trans~ormed and bacteria identi~ied that contained the plasmid (pBacGPRC) with the GPRC gene using the enzymes BamHI. The sequence o~ the cloned ~ragment was con~irmed by DNA sequencIng.
5 ~g o~ the plasmid pBacGPRC was cotrans~ected with 1.0 ~g o~ a commercially available linearized baculovirus ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA.) using the lipo~ection method (Felgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 (1987)).
l~g o~ BaculoGoldTM virus DNA and 5 ~g o~ the plasmid pBacGPRC were mixed in a sterile well o~ a microtiter plate cont~;n;ng 50 ~1 o~ serum free Grace's medium (Li~e Technologies Inc., Gaithersburg, MD). A~terwards 10 ~1 Lipo~ectin plus 90 ~1 Grace's medium were added, mixed and incubated ~or 15 minutes at room temperature. Then the trans~ection mixture was added dropwise to the S~9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate was rocked back and ~orth to mix the newly added solution. The plate was then incubated for 5 hours at 27~C. A~ter 5 hours the trans~ection solution was removed ~rom the plate and 1 ml o~
Grace's insect medium supplemented with 10~ ~etal cal~ serum was added. The plate was put back into an incubator and cultivation continued at 27~C ~or ~our days.
A~ter four days the supernatant was collected ,and a plaque assay per~ormed similar as described by Summers and Smith (supra). As a modi~ication an agarose gel with "Blue Gal" (Li~e Technologies Inc., Gaithersburg) was used which allows an easy isolation o~ blue stained plaques. (A
detailed description o~ a "plaque assay" can also be ~ound in the user's guide for insect cell culture and baculovirology distributed by Li~e Technologies Inc., Gaithersburg, page 9-10) .
Four days a~ter the serial dilution, the virus were added to the cells and blue stained plaques were picked with the tip o~ an Eppendor~ pipette. The agar containing the recombinant viruses was then resuspended in an Eppendor~ tube containing 200 ~l o~ Grace's medium. The agar was removed by a brie~ centrifugation and the supernatant containing the recombinant baculovirus was used to in~ect S~9 cells seeded in 35 mm dishes. Four days later the supernatants o~ these culture dishes were harvested and then stored at 4~C.
S~9 cells were grown in Grace's medium supplemented with 10~ heat-inactivated FBS. The cells were in~ected with the recombinant baculovirus V-GPRC at a multiplicity o~ infection (MOI) o~ 2. Six hours later the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Li~e Technologies Inc., Gaithersburg). 42 hours later 5 ~Ci o~ 35S-methionine and 5 ~Ci 35S cysteine (Amersham) were added.
The cells were ~urther incubated for 72 hours be~ore they were harvested by cell lysis in hypotonic phosphate bu~er and centri~uged to collect the cell membranes and the labelled proteins visualized by SDS-PAGE and autoradiography.

Exam~le 4 ExPression via Gene Therapy Fibroblasts are obtained from a subject by skin biopsy.
The resulting tissue is placed in tissue-culture me~ium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10~ FBS, penicillin and streptomycin, is added.
This is then incubated at 37~C ~or approximately one week.
At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer o~ ~ibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is di~sted with EcoRI and HindIII and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on agarose gel and purified, using glass beads.
The cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer contains an EcoRI site and the 3' primer ~urther includes a HindIII site.
Equal quantities of the Moloney murine sarcoma virus linear backbone and the ampli~ied EcoRI and HindIII ~ragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria HB101, which are then plated onto agar-containing kanamycin ~or the purpose of con~irming that the vector had the gene o~ interest properly inserted.

W O 96/39436 . PCTAUS95/07137 The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10~ calf serum (CS), penicillin and streptomycin. The MSV vector containing the ~ gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the media is harvested ~rom a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to ~e-llove detached producer cells and this media is then used to infect fibroblast cells. Media i8 ~e.lloved ~rom a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
The engineered fibroblasts are then injected into the host, either alone or a~ter having been grown to con~luence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product.
Numerous modifications and variations o~ the present invention were possible in light o~ the above teachings and, there~ore, within the scope o~ the appended claims, the invention may be practiced otherwise than as particularly described.

W O 96/39436 PCT~US95/07137 SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: LI, ET AL.
(ii) TITLE OF INVENTION: Human G Protein Coupled Receptor (iii) NUMBER OF SEQUENCES: 8 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN, CECCHI, STEWART & OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) COUNTRY: USA
(F) ZIP: 07068 (V) COM~U'l'h'~ READABLE FORM:
(A) MEDIUM TYPE: 3.5 INCH DISKETTE
(B) COM~u l~h~: IBM PS/2 (C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36,134 (C) REFERENCE/DOCKET NUMBER: 325800-358 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700 (B) TELEFAX: 201-994-1744 (2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 2456 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: cDNA

CA 02220978 l997-ll-l3 WO 96/39436 PCTrUS9~/07137 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
WAACCGCCC CACC~1 W~1~ GCGGCCGCCC AGAACTAGTG GA'1'CCCCC W GCTGCAGGAA 60 TTCGGCACGA GCAGACACAC TTG~'1-1-1'W'1' TTACAGATCC AGTGAAGTGA AAAATCAGAA 120 CTAGAAACGT ATGCACCTTC CTAGCAGCAA AGCCGCTTCT GC~11~1-1CG CAGCCTCCAG 180 AAGAGAGGCC ACA111CCGG GGTTTTGCGG GCCCCGC'~AT ~11-1-1C-AGA G~'1-1''1''1'C~AG 300 TGGGAAGAGG AGAGCGACAA CGTGAAAATG CCCC~1~CCG GGGCGTCCAC CGGAGTCCTG 360 CTTCGATCTG ATCAGCAAAC AAGAAAATTT ~L~1~CCC~LA ~ GG W C ~L~11~ACCA 540 CCCAGTTCAC AGCCATGAAT GAACCACAGT GCTTCTACAA CGAGTCCATT GC~'1-1'~'1-1-11' 660 ATAACCGAAG TGGAAAGCAT CTTGCCACAG AATGGAACAC AGTCAGCAAG ~1 W1~ATGG 720 GACTTGGAAT CA~L~'11-1'~'1' ATCTTCATCA TGTTGGCCAA CCTATTGGTC ATGGTGGCAA 780 TCTATGTCAA CCGCCG~'11'C CA~1111~C~1~A TTTATTACCT AATGGCTAAT CTGGCTGCTG 840 CAGACTTCTT TG~'1'~&~'1-1'~ GCCTACTTCT ATCTCATGTT CAACACAGGA CCCAATACTC 9OO
GGAGACTGAC TGTTAGCACA TGG~'1'C~'1-1'C GTCAGGGCCT CATTGACACC AGCCTGACGG 9 60 AGCTCCACAC ACGGATGAGC AACCGGCGGG TA~'1'W'1'W'1' CA'1_L~'LW'LC ATCTGGACTA 10 80 A'1-L~'1-1'C~AA CATGGCACCC CTCTACAGTG ACT~TTACTT A~ 1-L~L~G GCCATTTTCA 1200 A~ W~L~AC ~''1"1-1'~'1'G~'1'A A'LW'1'W'L'LC TCTATGCTCA CATCTTTGGC TA'1'~'1-1'CGCC 1260 TGA~'L~'1_L~L GAAGACTGTG GTCATTGTGC TTGGGGCCTT TATCATCTGC TGGACTCCTG 1380 GATTGGTTTT GTTACTTCTA GACGTGTGCT GTCCACAGTG CGAC~L~LG GCCTATGAGA 1440 AATTCTTCCT 'L~'1'C~'1-1'GCT GAATTCAACT CTGCCATGAA CCCCATCATT TACTCCTACC 1500 GCGACAAAGA AATGAGCGCC ACCTTTAGGC AGALC~L~LG CTGCCAGCGC AGTGAGAACC 1560 CCACCGGCCC CACAGAA W C TCAGACCGCT CGG~1-1'C~'1'C CCTCAACCAC ACCATCTTGG 1620 CTGGAGTTCA CAGCAATGAC CA~-1~L~1~G TTTAGAACGG AAACTGAGAT GA WAACCAG 1680 C~'~'L~'L~'LC TTGTAGGATA AACAGCCTCC CCCTACCCAA TTGCCAGGGC AAW'L~W'l' 1740 GTGAGAGAGG AGAAAAGTCA ACTCATGTAC TTAAACACTA ACCAATGACA GTA'1-1-1~'1-LC 1800 CTGGACCCCA CAAGACTTGA TATATATTGA AAATTAGCTT ATGTGACAAC C ~CATCTTG 1860 ATCCCCATCC ~'1-1'~'1'~AAAG TA WAAGTTG GAGCTCTTGC AATGGAATTC AAGAACAGAC 1920 TCTGGAGTGT CCATTTAGAC TACACTAACT AGACTTTTAA AAGATTGTGT ~'LG~'1-1-1'W L 19 80 '1-1-1-1-1-1'ATTT TTAAAGGATA C~'1-11'~'ACTT AATAAACACG TTTATGCCTA TCAGCATGTT 2100 TGTGATGGAT GAGACTATGG ACTGCTTTTA AACTACCATA ATTCCATTTT '1-1'CC~'1-1'ACA 2160 AACCTAGACT TCAAAGCCAG TA'1_1_L~'1_1_1'A GGTCATGAAG CAAACAATGC TCTAATCACA 2340 ATATTAACTG TTTAATTAAA A'1'~'1_L~'1'AAC AAGTATAAAA CAGGGAATGT AAGTTTATTA 2400 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 364 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
~et Ala Ala Ile Ser Thr Ser Ile Pro Val Ile Ser Gln Pro Gln Phe Thr Ala Met Asn Glu Pro Gln Cys Phe Tyr Asn Glu Ser Ile Ala Phe Phe Tyr Asn Arg Ser Gly Lys His Leu Ala Thr Glu Trp Asn Thr Val Ser Lys Leu Val Met Gly Leu Gly Ile Thr Val Cys 60~le Phe Ile Met Leu Ala Asn Leu Leu Val Met Val Ala Ile Tyr 75~al Asn Arg Arg Phe His Phe Pro Ile Tyr Tyr Leu Met Ala Asn 90~eu Ala Ala Ala Asp Phe Phe Ala Gly Leu Ala Tyr Phe Tyr Leu 100 105~et Phe Asn Thr Gly Pro Asn Thr Arg Arg Leu Thr Val Ser Thr 110 115 120~rp Leu Leu Arg Gln Gly Leu Ile Asp Thr Ser Leu Thr Ala Ser 125 130 135~al Ala Asn Leu Leu Ala Ile Ala Ile Glu Arg His Ile Thr Val 140 145 150~he Arg Met Gln Leu His Thr Arg Met Ser Asn Arg Arg Val Val 155 160 165~al Val Ile Val Val Ile Trp Thr Met Ala Ile Val Met Gly Ala 170 175 180~le Pro Ser Val Gly Trp Asn Cys Ile Cys Asp Ile Glu Asn Cys 185 190 195~er Asn Met Ala Pro Leu Tyr Ser Asp Ser Tyr Leu Val Phe Trp 200 205 210~la Ile Phe Asn Leu Val Thr Phe Val Val Met Val Val Leu Tyr 215 220 225~la His Ile Phe Gly Tyr Val Arg Gln Arg Thr Met Arg Met Ser 230 235 240~rg His Ser Ser Gly Pro Arg Arg Asn Arg Asp Thr Met Met Ser 245 250 255~eu Leu Lys Thr Val Val I le Val Leu Gly Ala Phe I le I le Cys 260 265 270~rp Thr Pro Gly Leu Val Leu Leu Leu Leu Asp Val Cys Cys Pro 275 280 285~ln Cys Asp Val Leu Ala Tyr Glu Lys Phe Phe Leu Leu Leu Ala 290 295 300~lu Phe Asn Ser Ala Met Asn Pro Ile Ile Tyr Ser Tyr Arg Asp 305 310 315~ys Glu Met Ser Ala Thr Phe Arg Gln Ile Leu Cys Cys Gln Arg 320 325 330~er Glu Asn Pro Thr Gly Pro Thr Glu Gly Ser Asp Arg Ser Ala 335 340 345~er Ser Leu Asn His Thr Ile Leu Ala Gly Val His Ser Asn Asp 350 355 360~is Ser Val Val (2) INFORMATION FOR SEQ ID NO: 3:
( i ) SEQUENCE CHARACTERISTICS
(A) LENGTH: BASE PAIRS
( B ) TYPE: NUCLE I C ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
( ii ) MOLECULE TYPE: Oligonucleotide W O 96/39436 PCTrUS95/07137 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOhOGY: LINEAR
(ii) MOLECULE TYPE. Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS
(A) L~N~l~: 46 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 46 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: ~ligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 40 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 35 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

Claims (19)

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide encoding the polypeptide as set forth in SEQ ID NO:2;
(b) a polynucleotide encoding the polypeptide expressed by the DNA contained in ATCC Deposit No. 97,130;
(c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b); and (d) a polynucleotide fragment of the polynucleotide of (a), (b), or (c).

2. The polynucleotide of Claim 1 encoding the polypeptide comprising amino acid 1 to amino acid 364 as set forth in SEQ ID NO:2.

3. A vector containing the polynucleotide of Claim 1.

4. A host cell genetically engineered with the vector of Claim 3.

5. A process for producing a polypeptide comprising:
expressing from the host cell of Claim 4 the polypeptide encoded by said DNA.

6. A process for producing cells capable of expressing a polypeptide comprising genetically engineering cells with the vector of Claim 3.

7. A polypeptide selected from the group consisting of (i) a polypeptide having the deduced amino acid sequence of SEQ ID NO:2 and fragments, analogs and derivatives thereof; and (ii) a polypeptide encoded by the cDNA of ATCC

Deposit No. 97,130 and fragments, analogs and derivatives of said polypeptide.

8. The polypeptide of Claim 7 wherein the polypeptide has the deduced amino acid sequence of SEQ ID
NO:2.

9. An antibody against the polypeptide of claim 7.

10. A compound which activates the polypeptide of claim 7.

11. A compound which inhibits activation of the polypeptide of claim 7.

12. A method for the treatment of a patient having need to activate a receptor comprising: administering to the patient a therapeutically effective amount of the compound of claim 10.

13. A method for the treatment of a patient having need to inhibit a receptor comprising: administering to the patient a therapeutically effective amount of the compound of claim 11.

14. The method of claim 12 wherein said compound is a polypeptide and a therapeutically effective amount of the compound is administered by providing to the patient DNA
encoding said agonist and expressing said agonist in vivo.

15. The method of claim 13 wherein said compound is a polypeptide and a therapeutically effective amount of the compound is administered by providing to the patient DNA
encoding said antagonist and expressing said antagonist in vivo.

16. A method for identifying a compound which bind to and activate the polypeptide of claim 7 comprising:
contacting a compound with cells expressing on the surface thereof the polypeptide of claim 7, said polypeptide being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said polypeptide said contacting being under conditions sufficient to permit binding of compound to the polypeptide; and identifying a compound capable of polypeptide binding by detecting the signal produced by said second component.

17. A method for identifying compounds which bind to and inhibit activation of the polypeptide of claim 7 comprising:
contacting an analytically detectable ligand known to bind to the receptor polypeptide of claim 7 and a compound with host cells expressing on the surface thereof the polypeptide of claim 7, said polypeptide being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said polypeptide under conditions to permit binding to the polypeptide; and determining whether the ligand binds to the polypeptide by detecting the absence of a signal generated from the interaction of the ligand with the polypeptide.

18. A process for diagnosing in a patient a disease or a susceptibility to a disease related to an under-expression of the polypeptide of claim 7 comprising:
determining a mutation in the nucleic acid sequence encoding said polypeptide in a sample derived from a patient.

19. A diagnostic process comprising:
analyzing for the presence of the polypeptide of claim 7 in a sample derived from a host.