EP0833846A1 - Human g-protein coupled receptor (hetgq23) - Google Patents

Abstract

Human G-protein coupled receptor polypeptides and DNA (RNA) encoding such polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed were methods for utilizing such polypeptides for identifying antagonists and agonists to such polypeptides and methods of using the agonists and antagonists therapeutically to treat conditions related to the underexpression and overexpression of the G-protein coupled receptor polypeptides, respectively. Also disclosed are diagnostic methods for detecting a mutation in the G-protein coupled receptor nucleic acid sequences and an altered level of the soluble form of the receptors.

Description

HUMAN G-PROTEIN COUPLED RECEPTOR (HETGQ23)

This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention are human 7- transmembrane receptors. The invention also relates to inhibiting the action of such polypeptides .

It is well established that many medically significant biological processes are mediated by proteins participating in signal transduction pathways that involve G-proteins and/or second messengers, e.g., cAMP (Lef owitz, Nature, 351:353-354 (1991)) . Herein these proteins are referred to as proteins participating in pathways with G-proteins or PPG proteins. Some examples of these proteins include the GPC receptorε, such as those for adrenergic agents and dopamine (Kobilka, B.K., et al. , PNAS, 84:46-50 (1987) ; Kobilka, B.K., et al., Science, 238:650-656 (1987) ; Bunzow, J.R. , et al. , Nature, 336:783-787 (1988)) , G-proteins themselves, effector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins, e.g., protein kinase A and protein kinase C (Simon, M.I., et al. , Science, 252:802-8 (1991) ) . For example, in one form of signal transduction, the effect of hormone binding is activation of an enzyme, adenylate cyclase, inside the cell. Enzyme activation by hormones is dependent on the presence of the nucleotide GTP, and GTP also influences hormone binding. A G-protein connects the hormone receptors to adenylate cyclase. G- protein was shown to exchange GTP for bound GDP when activated by hormone receptors. The GTP-carrying form then binds to an activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G-protein itself, returns the G- protein to its basal, inactive form. Thus, the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal.

The membrane protein gene superfamily of G-protein coupled receptors has been characterized as having seven putative transmembrane domains. The domains are believed to represent transmembrane α-helices connected by extracellular or cytoplasmic loops. G-protein coupled receptors include a wide range of biologically active receptors, such as hormone, viral, growth factor and neuroreceptors.

G-protein coupled receptors have been characterized as including these seven conserved hydrophobic stretches of about 20 to 30 amino acids, connecting at least eight divergent hydrophilic loops. The G-protein family of coupled receptors includes dopamine receptors which bind to neuroleptic drugs used for treating psychotic and neurological disorders. Other examples of members of this family include calcitonin, adrenergic, endothelin, cAMP, adenosine, muscarinic, acetylcholine, serotonin, histamine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-1 receptor, rhodopsins, odorant, cytomegalovirus receptors, etc.

Most G-protein coupled receptors have single conserved cysteine residues in each of the first two extracellular loops which form disulfide bonds that are believed to stabilize functional protein structure. The 7 transmembrane regions are designated as TMl, TM2, TM3, TM4, TM5, TM6, and TM7. TM3 has been implicated in signal transduction.

Phosphorylation and lipidation (palmitylation or farnesylation) of cysteine residues can influence signal transduction of some G-protein coupled receptors. Most G- protein coupled receptors contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus. For several G-protein coupled receptors, such as the β-adrenoreceptor, phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization.

For some receptors, the ligand binding sites of G- protein coupled receptors are believed to comprise a hydrophilic socket formed by several G-protein coupled receptors transmembrane domains, which socket is surrounded by hydrophobic residues of the G-protein coupled receptors. The hydrophilic side of each G-protein coupled receptor transmembrane helix is postulated to face inward and form the polar ligand binding site. TM3 has been implicated in several G-protein coupled receptors as having a ligand binding site, such as including the TM3 aspartate residue. Additionally, TM5 serines, a TM6 asparagine and TM6 or TM7 phenylalanines or tyrosines are also implicated in ligand binding.

G-protein coupled receptors can be intracellularly coupled by heterotrimeric G-proteins to various intracellular enzymes, ion channels and transporters (see, Johnson et al . , Endoc, Rev., 10:317-331 (1989)) . Different G-protein α- subunits preferentially stimulate particular effectors to modulate various biological functions in a cell. Phosphorylation of cytoplasmic residues of G-protein coupled receptors have been identified as an important mechanism for the regulation of G-protein coupling of some G-protein coupled receptors . G-protein coupled receptors are found in numerous sites within a mammalian host.

In accordance with one aspect of the present invention, there are provided novel polypeptides as well as biologically active and diagnostically or therapeutically useful fragments and derivatives thereof. The polypeptides of the present invention are of human origin.

In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding the polypeptide of the present invention including mRNAs, DNAs, cDNAs, genomic DNA as well as antisense analogs thereof and biologically active and diagnostically or therapeutically useful fragments thereof.

In accordance with a further aspect of the present invention, there is provided a process for producing such polypeptides by recombinant techniques which comprises culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention , under conditions promoting expression of said polypeptide and subsequent recovery of said polypeptide.

In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.

In accordance with another aspect of the present invention there are provided methods of screening for compounds which bind to and activate or inhibit activation of the receptor polypeptides of the present invention and for receptor ligands.

In accordance with still another embodiment of the present invention there is provided a process of using such activating compounds to stimulate the receptor polypeptide of the present invention for the treatment of conditions related to the under-expression of the G-protein coupled receptors. In accordance with another aspect of the present invention there is provided a process of using such inhibiting compounds for treating conditions associated with over-expression of the G-protein coupled receptors.

In accordance with yet another aspect of the present invention there is provided non-naturally occurring synthetic, isolated and/or recombinant G-protein coupled receptor polypeptides which are fragments, consensus fragments and/or sequences having conservative amino acid substitutions, of at least one transmembrane domain of the G- protein coupled receptor of the present invention, such that the receptor may bind G-protein coupled receptor ligands, or which may also modulate, quantitatively or qualitatively, G- protein coupled receptor ligand binding.

In accordance with still another aspect of the present invention there are provided synthetic or recombinant G- protein coupled receptor polypeptides, conservative substitution and derivatives thereof, antibodies, anti- idiotype antibodies, compositions and methods that can be useful as potential modulators of G-protein coupled receptor function, by binding to ligands or modulating ligand binding, due to their expected biological^' properties, which may be used in diagnostic, therapeutic and/or research applications.

It is still another object of the present invention to provide synthetic, isolated or recombinant polypeptides which are designed to inhibit or mimic various G-protein coupled receptors or fragments thereof, as receptor types and subtypes.

In accordance with yet a further aspect of the present invention, there is also provided diagnostic probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the nucleic acid sequences of the present invention.

In accordance with yet another object of the present invention, there is provided a diagnostic assay for detecting a disease or susceptibility to a disease related to a mutation in a nucleic acid sequence of the present invention.

These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

Figure 1 shows the cDNA sequence and the corresponding deduced amino acid sequence of the G-protein coupled receptor of the present invention. The standard one-letter abbreviation for amino acids are used. Sequencing was performed using a 373 Automated DNA sequencer (Applied Biosystems, Inc. ) .

Figure 2 is an illustration of the amino acid homology between the polypeptide of the present invention (top line) and human endothelial differentiation protein (edg-1) gene mRNA (bottom line) .

Figure 3 is an illustration of the secondary structural features of the G-protein coupled receptor. The first 7 illustrations set forth the regions of the amino acid sequence which are alpha helices, 'beta sheets, turn regions or coiled regions. The boxed areas are the areas which correspond to the region indicated. The second set of figures illustrate areas of the amino acid sequence which are exposed to intracellular, cytoplasmic or are membrane- spanning. The hydrophilicity part illustrates areas of the protein sequence which are in the lipid bilayer of the membrane and are, therefore, hydrophobic, and areas outside the lipid bilayer membrane which are hydrophilic. The antigenic index corresponds to the hydrophilicity plot, since antigenic areas are areas outside the lipid bilayer membrane and are capable of binding antigens. The surface probability plot further corresponds to the antigenic index and the hydrophilicity plot. The amphipathic plots show those regions of the 13 sequences which are polar and non-polar. The flexible regions correspond to the second set of illustrations in the sense that flexible regions are those which are outside the membrane and inflexible regions are transmembrane regions.

In accordance with an aspect of the present invention, there are provided isolated nucleic acids (polynucleotides) which encode for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 97,130 on 4-28-95.

A polynucleotide encoding the polypeptide of the present invention was isolated from a cDNA library derived from human endometrial tumor tissue. It is structurally related to the G protein-coupled receptor family. It contains an open reading frame encoding a protein of 364 amino acid residues. The protein exhibits the highest degree of homology to a human EDG-1 protein with 36 % identity and 61 % similarity over a 364 amino acid stretch. Potential ligands to the receptor polypeptide of the present invention include but are not limited to anandamide, serotonin, adrenalin and noradrenalin, platelet activating factor, thrombin, C5a and bradykinin, chemokine, and platelet activating factor.

The polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID N0:1) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID N0:1) or the deposited cDNA. The polynucleotides which encode for the mature polypeptides of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.

Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.

The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone. The variants of the polynucleotides may be a naturally occurring allelic variant of the polynucleotides or a non- naturally occurring variant of the polynucleotides.

Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO:2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variants include deletion variar^~s, substitution variants and addition or insertion variants.

As hereinabove indicated, the polynucleotides may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure .1 (SEQ ID N0:1) or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptides .

The polynucleotides may also encode for a soluble form of the receptor polypeptide of the present invention which is the extracellular portion of the polypeptide which has been cleaved from the TM and intracellular domain of the full- length polypeptide of the present invention.

The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptides of the present invention. The marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al. , Cell, 37:767 (1984)) .

The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons) .

Fragments of the full length gene of the present invention may be used as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity. Probes of this type preferably have at leaεt 20 or 30 bases and may contain, for example, 50 or more bases. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene of the present invention including regulatory and promotor regions, exons, and introns. An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SEQ ID NO:l) or the deposited cDNA(s) .

Alternatively, the polynucleotide may have at least 20 bases, preferably at least 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:l, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.

Thus, the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90% and more preferably at least a 95% identity to a polynucleotide which encodes the polypeptide of SEQ ID NO:2 as well as fragments thereof, which fragments have at least 20 or 30 bases and preferably at least 50 bases ^' and to polypeptides encoded by such polynucleotides .

The deposit (s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. §112. The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.

The present invention further relates to a G-protein coupled receptor polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivativeε of such polypeptide.

The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA, means a polypeptide which either retains substantially the same biological function or activity as such polypeptide, i.e. functions as a G-protein coupled receptor, or retains the ability to bind the ligand or the receptor even though the polypeptide does not function as a G-protein coupled receptor, for example, a soluble form of the receptor. An analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

The polypeptides of the present invention may be recombinant polypeptides, a natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides. The fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID N0:2) or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acids are fused to the mature polypeptide which is employed for purification of the mature polypeptide or (v) one in which a fragment of the polypeptide is soluble, i.e. not membrane bound, yet still binds ligands to the membrane bound receptor. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) . For example, a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

The polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% similarity (preferably at least a 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least a 90% similarity (more preferably at least a 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least a 95% similarity (still more preferably at least a 95% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.

As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.

Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.

The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.

Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the G- protein coupled receptor genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and εynthetic DNA εequenceε, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmidε and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies . However, any other vector may be used as long aε it iε replicable and viable in the hoεt.

The appropriate DNA εequence may be inεerted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(ε) by procedureε known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

The DNA sequence in the expreεεion vector iε operatively linked to an appropriate expression control sequence (s) (promoter) to direct mRNA syntheεiε. Aε representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda P_ promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruseε. The expreεsion vector also contains a ribosome binding site for tranεlation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expresεion.

In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.

As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as _______________ ,

Streptomyces, Salmonella tvphimurium; fungal cells, such aε yeast; insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS or Bowes melanoma; adenoviruεeε; plant cellε, etc. The selection of an approp- _.ate host is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the preεent invention alεo includeε recombinant constructs comprising one or more of the sequenceε aε broadly deεcribed above. The constructs comprise a vector, such aε a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to thoεe of εkill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen) , pbs, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; pTRC99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia) . Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) . However, any other plasmid or vector may be used as long aε they are replicable and viable in the host. Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P_R, P_L and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retroviruε, and mouse metallothionein-I . Selection of the appropriate vector and promoter is well within the level of ordinary εkill in the art.

In a further embodiment, the preεent invention relates- to host cells containing the above-described conεtructε. The hoεt cell can be a higher eukaryotic cell, εuch aε a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the hoεt cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated tranεfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986) ) .

The constructε in hoεt cellε can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizerε.

Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructε of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hoεtε are deεcribed by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989) , the disclosure of which is hereby incorporated by reference. Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increaεed by inεerting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegaloviruε early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenoviruε enhancerε.

Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downεtream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phoεphoglycerate kinase (PGK) , α-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural εequence is asεembled in appropriate phaεe with tranεlation initiation and termination sequences. Optionally, the heterologous εequence can encode a fuεion protein including an N-terminal ^' identification peptide imparting deεired characteriεtics, e.g., stabilization or simplified purification of expressed recombinant product.

Useful expression vectors for bacterial use are constructed by inserting a structural DNA εequence encoding a deεired protein together with εuitable translation initiation and termination signalε in operable reading phaεe with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hoεts for transformation include E. coli. Bacillus subtilis. Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.

As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) . Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madiεon, WI, USA) . Theεe pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.

Following transformation of a suitable host strain and growth of the hoεt εtrain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.

Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the reεulting crude extract retained for further purification.

Microbial cellε employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agentε, such methods are well know to those skilled in the ar .

Various mammalian cell culture systemε can also be employed to express recombinant protein. Examples of mammalian expreεsion systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981) , and other cell lineε capable of expreεsing a compatible vector, for example, the C127, 3T3, CHOHS293, HeLa and BHK cell lines . Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, tranεcriptional termination sequences, and 5' flanking nontranscribed sequences . DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements .

The G-protein coupled receptor polypeptide of the preεent invention can be recovered and purified from recombinant cell cultures by methods including ammonium εulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification εtepε.

The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniqueε from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) . Depending upon the host employed in a recombinant production procedure, the polypeptideε of the preεent invention may be glycoεylated or may be non-glycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue.

The G-protein coupled receptorε of the preεent invention may be employed in a proceεε for εcreening for compounds which activate (agonists) or inhibit activation (antagonists) of the receptor polypeptide of the present invention .

In general, εuch εcreening procedureε involve providing appropriate cellε which express the receptor polypeptide of the present invention on the surface thereof. Such cells include cells from mammals, yeast, drosophila or E. Coli . In particular, a polynucleotide encoding the receptor of the preεent invention iε employed to tranεfect cells to thereby express the G-protein coupled receptor. The expressed receptor is then contacted with a test compound to observe binding, stimulation or inhibition of a functional responεe.

One such screening procedure involves the use of melanophores which are transfected to express the G-protein coupled receptor of the preεent invention. Such a εcreening technique is described in PCT WO 92/01810 published February 6, 1992.

Thuε, for example, such assay may be employed for screening for a compound which inhibits activation of the receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both the receptor ligand and a compound to be screened. Inhibition of the εignal generated by the ligand indicateε that a compound is a potential antagonist for the receptor, i.e., inhibits activation of the receptor.

The screen may be employed for determining a compound which activates the receptor by contacting such cellε with compounds to be screened and determining whether such compound generates a signal, i.e., activates the receptor.

Other screening techniques include the use of cells which express the G-protein coupled receptor (for example, transfected CHO cellε) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science, volume 246, pages 181-296 (October 1989) . For example, compounds may be contacted with a cell which expresses the receptor polypeptide of the present invention and a second messenger responεe, e.g. εignal transduction or pH changes, may be measured to determine whether the potential compound activates or inhibits the receptor.

/mother such screening technique involves introducing RNA encoding the G-protein coupled receptor into Xenopus oocytes to transiently express the receptor. The receptor oocytes may then be contacted with the receptor ligand and a compound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of screening for compounds which are thought to inhibit activation of the receptor.

Another screening technique involves expressing the G- protein coupled receptor in which the receptor is linked to a phospholipase C or D. As representative exampleε of such cells, there may be mentioned endothelial cellε, εmooth muscle cells, embryonic kidney cells, etc. The screening may be accomplished as hereinabove deεcribed by detecting activation of the receptor or inhibition of activation of the receptor from the phoεpholipaεe εecond εignal.

Another method involveε screening for compounds which inhibit activation of the receptor polypeptide of the present invention antagonistε by determining inhibition of binding of labeled ligand to cellε which have the receptor on the surface thereof. Such a method involves transfecting a eukaryotic cell with DNA encoding the G-protein coupled receptor such that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a known ligand. The ligand can be labeled, e.g., by radioactivity. The amount of labeled ligand bound to the receptors iε meaεured, e.g., by meaεuring radioactivity of the receptorε. If the compound binds to the receptor as determined by a reduction of labeled ligand which bindε to the receptorε, the binding of labeled ligand to the receptor iε inhibited.

G-protein coupled receptorε are ubiquitous in the mammalian host and are responsible for many biological functions, including many pathologies. Accordingly, it is desirouε to find compounds and drugs which stimulate the G- protein coupled receptor on the one hand and which can inhibit the function of a G-protein coupled receptor on the other hand. For example, compounds which activate the G-protein coupled receptor may be employed for therapeutic purposeε, εuch as the treatment of aεthma, Parkinson's disease, acute heart failure, hypotension, urinary retention, and osteoporosis .

In general, compounds which inhibit activation of the G- protein coupled receptor may be employed for a variety of therapeutic purposes, for example, for the treatment of hypertension, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy and psychotic and neurological disorders, including schizophrenia, manic excitement, depresεion, delirium, dementia or severe mental retardation, dyskineεias, such aε Huntington's disease or Gilles dela Tourett'ε εyndrome, among otherε . Compoundε which inhibit G-protein coupled receptorε have alεo been uεeful in reverεing endogenous anorexia and in the control of bulimia.

An antibody may antagonize a G-protein coupled receptor of the present invention, or in some cases an oligopeptide, which bind to the G-protein coupled receptor but does not elicit a second messenger response such that the activity of the G-protein coupled receptors is prevented. Antibodies include anti-idiotypic antibodies which recognize unique determinants generally asεociated with the antigen-binding εite of an antibody. Potential antagonist compounds also include proteins which are closely related to the ligand of the G-protein coupled receptors, i.e. a fragment of the ligand, which have lost biological function and when binding to the G-protein coupled receptor, elicit no reεponse.

An antisense construct prepared through the use of antisense technology, may be used to control gene expression through triple-helix formation or antisenεe DNA or RNA, both of which methodε are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairε in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al. , Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988) ; and Dervan et al. , Science, 251: 1360 (1991)) , thereby preventing transcription and the production of G-protein coupled receptor. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks tranεlation of mRNA molecules into G-protein coupled receptor (antisense - Okano, J. Neurochem., 56:560 (1991) ; Oligodeoxynucleotides as Antisense Inhibitors of Gene Expresεion, CRC Preεε, Boca Raton, FL (1988)) . The oligonucleotides described above can alεo be delivered to cells such that the antisense RNA or DNA may be expresεed in vivo to inhibit production of G-protein coupled receptor.

A εmall molecule which bindε to the G-protein coupled receptor, making it inaccessible to ligands εuch that normal biological activity is prevented, for example small peptides or peptide-like molecules, may also be used to inhibit activation of the receptor polypeptide of the present invention.

A εoluble form of the G-protein coupled receptor, e.g. a fragment of the receptorε, may be uεed to inhibit activation of the receptor by binding to the ligand to a polypeptide of the preεent invention and preventing the ligand from interacting with membrane bound G-protein coupled receptors.

This invention additionally provides a method of treating an abnormal condition related to an excess of G- protein coupled receptor activity which compriseε administering to a subject the inhibitor compoundε as hereinabove described along with a pharmaceutically acceptable carrier in an amount effective to inhibit activation by blocking binding of ligands to the G-protein coupled receptors, or by inhibiting a second signal, and thereby alleviating the abnormal conditions.

The invention also provides a method of treating abnormal conditions related to an under-expreεεion of G- protein coupled receptor activity which compriεes administering to a subject a therapeutically effective amount of a compound which activates the receptor polypeptide of the present invention as deεcribed above in combination with a pharmaceutically acceptable carrier, to thereby alleviate the abnormal conditionε.

The εoluble form of the G-protein coupled receptor, and compounds which activate or inhibit such receptor, may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide or compound, and a pharmaceutically acceptable carrier or excipient. Such a carrier includeε but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinationε thereof. The formulation εhould εuit the mode of administration.

The invention also provides a pharmaceutical pack or kit comprising one or more containerε filled with one or more of the ingredientε of the pharmaceutical compositions of the invention. Asεociated with εuch container(ε) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticalε or biological productε, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the pharmaceutical compositionε may be employed in conjunction with other therapeutic compounds.

The pharmaceutical compositions may be administered in a convenient manner εuch aε by the topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical compositions are administered in an amount which is effective for treating and/or propnylaxis of the εpecific indication. In general, the pharmaceutical compositions will be administered in an amount of at least about 10 μg/kg body weight and in moεt cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 μg/kg to about 1 mg/kg body weight daily, taking into account the routeε of administration, symptoms, etc.

The G-protein coupled receptor polypeptides, and compoundε which activate or inhibit which are also compounds may be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy."

Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide. Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the preεent invention.

Similarly, cellε may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the preεent invention may be administered to a patient for engineering cells in vivo and expreεsion of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachingε of the present invention. For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.

Retroviruεes from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus. In one embodiment, the retroviral plaεmid vector is derived from Moloney Murine Leukemia Virus .

The vector includes one or more promoters . Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegaloviruε (CMV) promoter deεcribed in Miller, et al . , Biotechnicrues . Vol. 7, No. 9, 980-990 (1989) , or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and /3-actin promoters) . Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.

The nucleic acid sequence encoding the polypeptide of the present invention iε under the control of a εuitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoterε, εuch aε the cytomegaloviruε (CMV) promoter; the respiratory syncytial viruε (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoterε; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described) ; the 3-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the genes encoding the polypeptides .

The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines . Examples of packaging cells which may be tranεfected include, but are not limited to, the PE501, PA317, ψ-2 , PA12, T19-14X, VT-19-17-H2, ^CRE, ^CRIP, GP+E-86, GP+envAml2, and DAN cell lineε aε deεcribed in Miller, Human Gene Therapy. Vol. 1, pg. 5-14 (1990) , which is incorporated herein by reference in its entirety. The vector may transduce the packaging cellε through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP0₄ precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.

The producer cell line generates infectiouε retroviral vector particleε which include the nucleic acid sequence (s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cellε, either in vi tro or in vivo. The tranεduced eukaryotic cells will express the nucleic acid sequence (s) encoding the polypeptide. Eukaryotic cells which may be tranεduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic εtem cellε, hepatocyteε, fibroblaεtε, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.

The present invention also provides a method for determining whether a ligand not known to be capable of binding to a G-protein coupled receptor of the present invention can bind to such receptor which comprises contacting a mammalian cell which expresses a G-protein coupled receptor with the ligand under conditions permitting binding of ligands to the G-protein coupled receptor, detecting the presence of a ligand which binds to the receptor and thereby determining whether the ligand binds to the G-protein coupled receptor.

This invention further provides a method of screening drugs to identify drugε which specifically interact with, and bind to, the human G-protein coupled receptors on the surface of a cell which comprises contacting a mammalian cell comprising an isolated DNA molecule encoding the G-protein coupled receptor with a plurality of drugs, determining thoεe drugs which bind to the mammalian cell, and thereby identifying drugs which specifically interact with and bind to a human G-protein coupled receptor of the present invention. Such drugs may then be used therapeutically to either activate or inhibit activation of the receptors of the present invention.

This invention also provides a method of detecting expreεsion of the G-protein coupled receptor on the surface of a cell by detecting the presence of mRNA coding for a G- protein coupled receptor which compriseε obtaining total mRNA from the cell and contacting the mRNA so obtained with a nucleic acid probe of the present invention capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human G- protein coupled receptor under hybridizing conditions, detecting the presence of mRNA hybridized to the probe, and thereby detecting the expreεεion of the G-protein coupled receptor by the cell.

This invention is also related to the use of the G- protein coupled receptor genes as part of a diagnostic aεεay for detecting diseaseε or εuεceptibility to diεeaεeε related to the presence of mutations in the nucleic acid sequences with encode the receptor polypeptides of the preεent invention. Such diεeaεes, by way of example, are related to cell transformation, such as tumors and cancers. Individuals carrying mutations in the human G-protein coupled receptor gene may be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis may be obtained from a patient's cellε, εuch as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al . , Nature, 324:163-166 (1986)) prior to analysis. RNA or cDNA may also be uεed for the same purpose. Aε an example, PCR primerε complementary to the nucleic acid encoding the G-protein coupled receptor proteinε can be used to identify and analyze G-protein coupled receptor mutations. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radiolabeled G-protein coupled receptor RNA or alternatively, radiolabeled G-protein coupled receptor antiεenεe DNA sequences . Perfectly matched sequences can be distinguiεhed from miεmatched duplexes by RNase A digeεtion or by differences in melting temperatures.

Sequence differenceε between the reference gene and gene having mutationε may be revealed by the direct DNA sequencing method. In addition, cloned DNA segmentε may be employed as probes to detect specific DNA segments . The sensitivity of this method is greatly enhanced when combined with PCR. For example, a εequencing primer iε used with double-stranded PCR product or a single-εtranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedureε with radiolabeled nucleotide or by automatic εequencing procedures with fluorescent-tags .

Genetic teεting based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small εequence deletions and insertions can be visualized by high resolution gel electrophoresis . DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al . , Science, 230:1242 (1985) ) .

Sequence changes at specific locations may also be revealed by nuclease protection asεays, such aε RNaεe and SI protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)) .

Thuε, the detection of a εpecific DNA εequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphiεms (RFLP) ) and Southern blotting of genomic DNA.

In addition to more conventional gel-electrophoresis and DNA εequencing, mutations can alεo be detected by in si tu analyεiε .

The present invention also relates to a diagnostic assay for detecting altered levels of soluble forms of the receptor polypeptides of the preεent invention in variouε tissues . Asεays used to detect levels of the soluble receptor polypeptides in a sample derived from a host are well known to those of skill in the art and include radioimmunoasεayε, competitive-binding assays, Western blot analysis and preferably as ELISA aεεay.

An ELISA aεεay initially comprises preparing an antibody specific to antigens of the receptor polypeptide, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, fluorescence or in this example a horseradiεh peroxidaεe enzyme . A εample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non¬ specific protein such aε bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies at- ;ach to any receptor polypeptides of the present invention attached to the polyεtyrene diεh. All unbound monoclonal antibody iε waεhed out with buffer. The reporter antibody linked to horεeradiεh peroxidaεe iε now placed in the diεh reεulting in binding of the reporter antibody to any monoclonal antibody bound to receptor proteinε. Unattached reporter antibody is then washed out . Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of receptor proteins present in a given volume of patient sample when compared against a standard cυrve.

The sequences of the present invention are alεo valuable for chromoεome identification. The εequence iε specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphismε) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with gene associated with diseaεe.

Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification procesε. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes . Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment. PCR mapping of somatic cell hybrids is a rapid procedure for asεigning a particular DNA to a particular chromoεome. Using the present invention with the εame oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomeε or pools of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in si tu hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to conεtruct chromosome specific-cDNA librarieε.

Fluorescence in si tu hybridization (FISH) of a cDNA clone to a metaphase chromoεomal εpread can be uεed to provide a preciεe chromoεomal location in one εtep. This technique can be used with cDNA as short as 50 or 60 baεeε. For a review of thiε technique, see Verma et al., Human Chromosomes: A Manual of Basic Techniqueε, Pergamon Press, New York (1988) .

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromoεome can be correlated with genetic map data. Such data are found, for example, in V. McKuεic , Mendelian Inheritance in Man (available on line through Johnε Hopkins University Welch Medical Library) . The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes) .

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individualε. If a mutation iε obεerved in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region asεociated with the diεease could be one of between 50 and 500 potential cauεative geneε. (Thiε assumes 1 megabase mapping resolution and one gene per 20 kb) .

The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodieε can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expreεεion library. Variouε procedures known in the art may be used for the production of such antibodies and fragments .

Antibodies generated against the polypeptides corresponding to a sequence of the preεent invention can be obtained by direct injection of the polypeptideε into an animal or by adminiεtering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itεelf. In thiε manner, even a εequence encoding only a fragment of the polypeptideε can be used to generate antibodies binding the whole native polypeptides . Such antibodies can then be used to isolate the polypeptide from tiεεue expressing that polypeptide.

For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Exampleε _.nclude the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497) , the trioma technique, the human B-cell hybridoma technique (Kozbor et al . , 1983, Immunology Today 4:72) , and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Lisε, Inc., pp. 77-96) .

Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice may be used to express humanized antibodies to immunogenic polypeptide products of this invention.

The present invention will be further described with reference to the following exampleε; however, it is to be underεtood that the present invention is not limited to such examples. All parts or amountε, unleεε otherwise specified, are by weight.

In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.

"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmidε herein are either commercially available, publicly available on an unreεtricted baεiε, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artiεan.

"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain εequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other require^ments were uεed as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 unitε of enzyme in about 20 μl of buffer εolution. For the purpoεe of iεolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 unitε of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37'C are ordinarily used, but may vary in accordance with the supplier's instructionε. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment .

Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980) .

"Oligonucleotides" refers to either a single εtranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically syntheεized. Such εynthetic oligonucleotideε have no 5' phoεphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.

"Ligation" refers to the process of forming phosphodieεter bondε between two double εtranded nucleic acid fragments (Maniatiε, T., et al . , Id., p. 146) . Unleεε otherwiεe provided, ligation may be accompliεhed using known buffers and conditionε with 10 units to T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amounts of the DNA fragments to be ligated.

Unlesε otherwiεe εtated, tranεformation was performed as described in the method of Grahamj F. and Van der Eb, A., Virology, 52:456-457 (1973) .

Example 1 Bacterial Expresεion and Purification of the G-Protein Coupled Receptor (GPRC) polypeptide

The DNA εequence encoding GPRC, ATCC # 97,130, is initially amplified using PCR oligonucleotide primers correεponding to the 5' and 3' end sequences of the processed GPRC nucleotide sequence. Additional nucleotides corresponding to the GPRC nucleotide sequence are added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence 5' CACAGGATCCCGTGGCTGCCATCTCTACTTC 3' (SEQ ID NO:3) contains a BatnHT restriction enzyme εite followed by 17 nucleotides of GPRC coding sequence εtarting from the presumed second amino acid of the processed protein. The 3' sequence; 5' TCTCAGGTACCGTTCTCTAAACCACAGAGTGGTCA (SEQ ID NO:4 ) contains complementary sequences to an ASP718 site and is followed by 19 nucleotideε of GPRC coding sequence. The restriction enzyme siteε correspond to the restriction enzyme sites on the bacterial expression vector pQE-31 (Qiagen, Inc. Chatsworth, CA) . pQE-31 encodes antibiotic resiεtance (Amp^r) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/0) , a riboεome binding εite (RBS) , a 6-Hiε tag and restriction enzyme sites. pQE-31 is then digested with BamHT and ASP718. The amplified sequences are ligated into pQE-31 and are inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture is then uεed to tranεform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) . M15/rep4 contains multiple copieε of the plaεmid pREt_^, which expresses the lad repressor and also conferε kanamycin reεistance (Kan^r) . Transformantε are identified by their ability to grow on LB plateε and ampicillin/kanamycin reεiεtant colonies are εelected. Plaεmid DNA is isolated and confirmed by restriction analysis.

Clones containing the desired constructs are grown overnight (0/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The 0/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cellε are grown to an optical density 600 (O.D.⁶⁰⁰) of between 0.4 and 0.6. IPTG ("Isopropyl-B-D- thiogalacto pyranoside") iε then added to a final concentration of 1 mM. IPTG induceε by inactivating the lad repressor, clearing the P/O leading to increased gene expression. Cells are grown an extra 3 to 4 hours. Cells are then harvested by centrifugation. The cell pellet is εolubilized in the chaotropic agent 6 Molar Guanidine HCl . After clarification, solubilized GPRC is purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al . , J. Chromatography 411:177-184 (1984)) . GPRC is eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM εodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this εolution for 12 hours the protein is dialyzed to 10 mmolar sodium phosphate .

Example 2 Expresεion of Recombinant GPCR in COS7 cells

The expresεion of plasmid, GPRC HA was derived from a vector pcDNA3/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resiεtance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation εite. A DNA fragment encoding the entire GPRC precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression was directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilεon, H. Niman, R. Heighten, A Cherenεon, M. Connolly, and R. Lerner, 1984, Cell 37, 767) . The infusion of HA tag to the target protein allows eaεy detection of the recombinant protein with an antibody that recognizes the HA epitope.

The plasmid construction strategy was desc: bed as follows :

The DNA sequence encoding GPRC, ATCC # 97,130, was constructed by PCR using two primers: the 5' primer 5' CAACCACAGGGATCCCATGGCTGCCATCTCTACTTCCATCCCTGTA 3' (SEQ ID NO:5) contains a BamHI site (bold) followed by 27 nucleotides of GPRC coding sequence starting from the initiation codon; the 3' sequence 5' CCCCTCGAGCTAAACCACAGAGTGGTCATTGCT GTGAACTCCAGCC 3' (SEQ ID NO:6) contains complementary sequences to an Xhol site, translation stop codon, HA tag and the last 24 nucleotides of the GPRC coding sequence (not including the εtop codon) . Therefore, the PCR product contains a Hindlll site, GPRC coding sequence followed by HA tag fused in frame, a translation termination εtop codon next to the HA tag, and an Xhol εite. The PCR amplified DNA fragment and the vector, pcDNA3/Amp, were digeεted with Hindlll and Xhol restriction enzymes and ligated. The ligation mixture was transformed into E. coli strain DH5α, the transformed cultur. waε plated on ampicillin media plateε and resistant colonies were selected. Plaεmid DNA waε iεolated from transformants and examined by restriction analysis for the presence of the correct fragment . For expresεion of the recombinant GPRC, C0S7 cells were transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatiε, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)) . The expresεion of the GPRC HA protein waε detected by radiolabeling and immunoprecipitation method (E. Harlow, D. Lane, Antibodieε: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)) . Cells were labelled for 8 hours with ³⁵S-cysteine two days post transfection. Culture media were then collected and cells were lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5) . (Wilson, I. et al. , Id. 37:767 (1984)) . Both cell lysate and culture media were precipitated with a HA εpecific monoclonal antibody. Proteinε precipitated were analyzed on 15% SDS-PAGE gelε.

Example 3 Cloning and expression of GPRC using the baculovirus expression system

The DNA sequence encoding the full length GPRC protein, ATCC # 97,130, waε amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:

The 5' primer has the sequence 5' TTCACCACCTACCTGGATCC ACAGAGCTGTCATGGCTGCC 3' (SEQ ID NO:7) and contains a BamHI restriction enzyme εite (in bold) followed by 11 nucleotideε reεernbling an efficient εignal for the initiation of translation in eukaryotic cellε (Kozak, M. , J. Mol. Biol., 196:947-950 (1987) which was just behind the first 9 nucleotides of the GPRC gene (the initiation codon for translation "ATG" is underlined) .

The 3' primer has the sequence 5' CCTCATCTCAGGTACCGTT CTAAACCACAGAGTGG 3' (SEQ ID NO:8) and containε the cleavage site for the ASP718 restriction endonuclease and 10 nucleotides complementary to the 3' non-translated sequence of the GPRC gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.) . The fragment was then digested with the endonuclease BamHI and then purified again on a 1% agarose gel. This fragment was designated F2.

The vector pA2 (modification of pVL941 vector, discussed below) was uεed for the expreεεion of the GPRC protein uεing the baculoviruε expression syεtem (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) . This expreεεion vector contains the strong polyhedrin promoter of the Autographa califomica nuclear polyhedrosiε virus (AcMNPV) followed by the recognition sites for the restriction endonuclease BamHI . The polyadenylation site of the simian virus (SV)40 was used for efficient polyadenylation. For an easy selection of recombinant virus the beta-galactosidaεe gene from E.coli was inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin εequenceε were flanked at both εides by viral sequences for the cell-mediated homologous recombination of cotranεfected wild-type viral DNA. Many other baculoviruε vectorε could be uεed in place of pA2 such as pAc373, pVL941, PRGl and pAcIMl (Luckow, V.A. and Summers, M.D. , Virology, 170:31-39) .

The plaεmid waε digeεted with the restriction enzymes ASP718 and BamHT then dephosp.iorylated uεing calf intestinal phosphatase by procedures known in the art. The DNA was then isolated from a 1% agaroεe gel uεing the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) . This vector DNA was designated V2.

Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligaεe. E.coli DH5c_ cellε were then transformed and bacteria identified that contained the plasmid (pBacGPRC) with the GPRC gene uεing the enzymeε BamHI . The sequence of the cloned fragment was confirmed by DNA sequencing.

5 μg of the plasmid pBacGPRC was cotransfected with 1.0 μg of a commercially available ^' linearized baculovirus

("BaculoGold™ baculovirus DNA", Pharmingen, San Diego, CA. ) uεing the lipofection method (Feigner et al. Proc. Natl.

Acad. Sci. USA, 84:7413-7417 (1987)) . lμg of BaculoGold™ virus DNA and 5 μg of the plasmid pBacGPRC were mixed in a εterile well of a microtiter plate containing 50 μl of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD) . Afterwards 10 μl Lipofectin plus 90 μl Grace's medium were added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture was added dropwise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without εerum. The plate was rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27°C. After 5 hours the transfection εolution waε removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum was added. The plate was put back into an incubator and cultivation continued at 27°C for four days.

After four days the supernatant waε collected and a plaque assay performed similar as described by Summers and Smith (supra) . As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque aεsay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .

Four days after the serial dilution, the virus were added to the cells and blue εtained plaqueε were picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses was then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar was removed by a brief centrifugation and the supernatant containing the recombinant baculovirus was used to infect Sf9 cells seeded in 35 mm disheε. Four days later the supernatants of these culture dishes were harvested and then εtored at 4°C.

Sf9 cells were grown in Grace's medium εupplemented with 10% heat-inactivated FBS. The cells were infected with the recombinant baculovirus V-GPRC at a multiplicity of infection

(MOD of 2. Six hours later the medium was removed and replaced with SF900 II medium minus methionine and cysteine

(Life Technologies Inc., Gaithersburg) . 42 hours later 5 μCi of ³⁵S-methionine and 5 μCi ³⁵S cysteine (Amersham) were added. The cellε were further incubated for 72 hourε before they were harvested by cell lysis in hypotonic phosphate buffer and centrifuged to collect the cell membranes and the labelled proteins visualized by SDS-PAGE and autoradiography. Example 4 Expresεion via Gene Therapy

Fibroblasts are obtained from a subject by skin biopsy. The resulting tiεsue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tisεue culture flask, approximately ten pieces are placed in each flask. The flaεk is turned upside down, closed tight and left at room temperature over night . After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and freεh media (e.g., Ham'ε F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then incubated at 37°C for approximately one week. At thiε time, fresh media is added and subsequently changed every several days . After an additional two weeks in culture, a monolayer of fibroblastε emerge. The monolayer is trypsinized and scaled into larger flasks. pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and Hindlll and subsequently treated with calf intestinal phosphataεe. The linear vector iε fractionated on agarose gel and purified, using glass beads .

The cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequenceε reεpectively. The 5' primer contains an EcoRI site and the 3' primer further includeε a Hindlll site. Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments . The ligation mixture is used to transform bacteria HBlOl, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted. The amphotropic pA317 or GP+aml2 packaging cellε are grown in tiεsue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin. The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells) .

Freεh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and thiε media is then used to infect fibroblast cells. Media is removed from a εub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. Thiε media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblaεts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, εuch as neo or his.

The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product.

Numerous modifications and variations of the present invention were posεible in light of the above teachingε and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than aε particularly described. SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: LI, ET AL.

(ii) TITLE OF INVENTION: Human G Protein Coupled

Receptor (iii) NUMBER OF SEQUENCES: 8

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN,

CECCHI, STEWART & OLSTEIN

(B) STREET: 6 BECKER FARM ROAD

(C) CITY: ROSELAND

(D) STATE: NEW JERSEY

(E) COUNTRY: USA

(F) ZIP: 07068

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: 3.5 INCH DISKETTE

(B) COMPUTER: IBM PS/2

(C) OPERATING SYSTEM: MS-DOS

(D) SOFTWARE: WORD PERFECT 5.1

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: FERRARO, GREGORY D.

(B) REGISTRATION NUMBER: 36,134

(C) REFERENCE/DOCKET NUMBER: 325800-358

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 201-994-1700

(B) TELEFAX: 201-994-1744

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 2456 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

GGAACCGCCC CACCGTGGTG GCGGCCGCCC AGAACTAGTG GATCCCCCGG GCTGCAGGAA 60 TTCGGCACGA GCAGACACAC TTGCTTTGGT TTACAGATCC AGTGAAGTGA AAAATCAGAA 120 CTAGAAACGT ATGCACCTTC CTAGCAGCAA AGCCGCTTCT GCGTTCTTCG CAGCCTCCAG 180

TGCAGGGCGG CGCTGGGAGA AACTTTGCGC CTTCTGGAAA GTTTAGAAAG TGAGCCACGA 240 AAGAGAGGCC ACATTTCCGG GGTTTTGCGG GCCCCGCGAT GTTTTCCAGA GCTTTTCGAG 300

TGGGAAGAGG AGAGCGACAA CGTGAAAATG CCCCGTGCCG GGGCGTCCAC CGGAGTCCTG 360

CCAGCTGTCC GGCGCTGGGG TGGACGTCTG ATTTATGAAG CTCCCCATCC ACCTATCTGA 420

GTACCTGACT TCTCAGGACT GACACCTACA GCATCAGGTA CACAGCTTCT CCTAGCATGA 480 CTTCGATCTG ATCAGCAAAC AAGAAAATTT GTCTCCCGTA GTTCTGGGGC GTGTTCACCA 540

CCTACAACCA CAGAGCTGTC ATGGCTGCCA TCTCTACTTC CATCCCTGTA ATTTCACAGC 600

CCCAGTTCAC AGCCATGAAT GAACCACAGT GCTTCTACAA CGAGTCCATT GCCTTCTTTT 660

ATAACCGAAG TGGAAAGCAT CTTGCCACAG AATGGAACAC AGTCAGCAAG CTGGTGATGG 720

GACTTGGAAT CACTGTTTGT ATCTTCATCA TGTTGGCCAA CCTATTGGTC ATGGTGGCAA 780

TCTATGTCAA CCGCCGCTTC CATTTTCCTA TTTATTACCT AATGGCTAAT CTGGCTGCTG 840 CAGACTTCTT TGCTGGGTTG GCCTACTTCT ATCTCATGTT CAACACAGGA CCCAATACTC 900

GGAGACTGAC TGTTAGCACA TGGCTCCTTC GTCAGGGCCT CATTGACACC AGCCTGACGG 960

CATCTGTGGC CAACTTACTG GCTATTGCAA TCGAGAGGCA CATTACGGTT TTCCGCATGC 1020

AGCTCCACAC ACGGATGAGC AACCGGCGGG TAGTGGTGGT CATTGTGGTC ATCTGGACTA 1080

TGGCCATCGT TATGGGTGCT ATACCCAGTG TGGGCTGGAA CTGTATCTGT GATATTGAAA 1140

ATTGTTCCAA CATGGCACCC CTCTACAGTG ACTCTTACTT AGTCTTCTGG GCCATTTTCA 1200

ACTTGGTGAC CTTTGTGGTA ATGGTGGTTC TCTATGCTCA CATCTTTGGC TATGTTCGCC 1260

AGAGGACTAT GAGAATGTCT CGGCATAGTT CTGGACCCCG GCGGAATCGG GATACCATGA 1320

TGAGTCTTCT GAAGACTGTG GTCATTGTGC TTGGGGCCTT TATCATCTGC TGGACTCCTG 1380

GATTGGTTTT GTTACTTCTA GACGTGTGCT GTCCACAGTG CGACGTGCTG GCCTATGAGA 1440

AATTCTTCCT TCTCCTTGCT GAATTCAACT CTGCCATGAA CCCCATCATT TACTCCTACC 1500

GCGACAAAGA AATGAGCGCC ACCTTTAGGC AGATCCTCTG CTGCCAGCGC AGTGAGAACC 1560

CCACCGGCCC CACAGAAGGC TCAGACCGCT CGGCTTCCTC CCTCAACCAC ACCATCTTGG 1620

CTGGAGTTCA CAGCAATGAC CACTCTGTGG TTTAGAACGG AAACTGAGAT GAGGAACCAG 1680

CCGTCCTCTC TTGTAGGATA AACAGCCTCC CCCTACCCAA TTGCCAGGGC AAGGTGGGGT 1740

GTGAGAGAGG AGAAAAGTCA ACTCATGTAC TTAAACACTA ACCAATGACA GTATTTGTTC 1800

CTGGACCCCA CAAGACTTGA TATATATTGA AAATTAGCTT ATGTGACAAC CCTCATCTTG 1860

ATCCCCATCC CTTCTGAAAG TAGGAAGTTG GAGCTCTTGC AATGGAATTC AAGAACAGAC 1920

TCTGGAGTGT CCATTTAGAC TACACTAACT AGACTTTTAA AAGATTGTGT GTGGTTTGGT 1980

GCAAGTCAGA ATAAATTCTG GCTAGTTGAA TCCACAACTT CATTTATATA CAGGCTTCCC 2040

TTTTTTATTT TTAAAGGATA CGTTTCACTT AATAAACACG TTTATGCCTA TCAGCATGTT 2100

TGTGATGGAT GAGACTATGG ACTGCTTTTA AACTACCATA ATTCCATTTT TTCCCTTACA 2160

TAGGAAAACT GTAAGTTGGA ATTATCTTTT GGTTAGAAAG CATGCATGTA ATGTATGTAT 2220

GCAGCATGCC TTACTTAAAA AGATTAAAAG GATACTAATG TTAAATCTTC TAGGAAATAG 2280

AACCTAGACT TCAAAGCCAG TATTTGTTTA GGTCATGAAG CAAACAATGC TCTAATCACA 2340

ATATTAACTG TTTAATTAAA ATGTTGTAAC AAGTATAAAA CAGGGAATGT AAGTTTATTA 2 00

CCAAAGTGAT ATGTATTCCA AAAAAGGTCA TAGAAGATGA AGCAACTATA ATATTG 2456

(2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 364 AMINO ACIDS

(B) TYPE: AMINO ACID

(C) STRANDEDNESS:

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: PROTEIN

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Ala Ala lie Ser Thr Ser lie Pro Val lie Ser Gin Pro Gin

5 10 15

Phe Thr Ala Met Asn Giu Pro Gin Cys Phe Tyr Aεn Giu Ser lie

20 25 30

Ala Phe Phe Tyr Asn Arg Ser Gly Lys His Leu Ala Thr Giu Trp

35 40 45 Asn Thr Val Ser Lys Leu Val Met Gly Leu Gly lie Thr Val Cys

50 55 60 lie Phe lie Met Leu Ala Asn Leu Leu Val Met Val Ala lie Tyr

65 70 75

Val Asn Arg Arg Phe Hiε Phe Pro lie Tyr Tyr Leu Met Ala Asn

80 85 90

Leu Ala Ala Ala Asp Phe Phe Ala Gly Leu Ala Tyr Phe Tyr Leu

95 100 105

Met Phe Aεn Thr Gly Pro Aεn Thr Arg Arg Leu Thr Val Ser Thr

110 115 120

Trp Leu Leu Arg Gin Gly Leu lie Asp Thr Ser Leu Thr Ala Ser

125 130 135

Val Ala Asn Leu Leu Ala lie Ala lie Giu Arg His lie Thr Val

140 145 150

Phe Arg Met Gin Leu His Thr Arg Met Ser Asn Arg Arg Val Val

155 160 165

Val Val He Val Val He Trp Thr Met Ala He Val Met Gly Ala

170 175 180

He Pro Ser Val Gly Trp Asn Cys He Cyε Aεp He Giu Asn Cys

185 190 195

Ser Asn Met Ala Pro Leu Tyr Ser Asp Ser Tyr Leu Val Phe Trp

200 205 210

Ala He Phe Asn Leu Val Thr Phe Val Val Met Val Val Leu Tyr

215 220 225

Ala His He Phe Gly Tyr Val Arg Gin Arg Thr Met Arg Met Ser

230 235 240

Arg His Ser Ser Gly Pro Arg Arg Asn Arg Asp Thr Met Met Ser

245 250 255

Leu Leu Lys Thr Val Val He Val Leu Gly Ala Phe He He Cys

260 265 270

Trp Thr Pro Gly Leu Val Leu Leu Leu Leu Aεp Val Cys Cys Pro

275 • 280 285

Gin Cys Asp Val Leu Ala Tyr Giu Lys Phe Phe Leu Leu Leu Ala

290 295 300

Giu Phe Asn Ser Ala Met Asn Pro He He Tyr Ser Tyr Arg Asp

305 310 315

Lys Giu Met Ser Ala Thr Phe Arg Gin He Leu Cys Cys Gin Arg

320 325 330

Ser Giu Asn Pro Thr Gly Pro Thr Giu Gly Ser Asp Arg Ser Ala

335 340 345

Ser Ser Leu Asn His Thr He Leu Ala Gly Val His Ser Asn Asp

350 355 360

Hiε Ser Val Val

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: (2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: Oligonucleotide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

(2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 46 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: CAACCACAGG GATCCCATGG CTGCCATCTC TACTTCCATC CCTGTA 46

(2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 46 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: CCCCTCGAGC TAAACCACAG AGTGGTCATT GCTGTGAACT CCAGCC 46

(2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 40 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: TTCACCACCT ACCTGGATCC ACAGAGCTGT CATGGCTGCC 40

(2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 35 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: CCTCATCTCA GGTACCGTTC TAAACCACAG AGTGG 35

Claims

WHAT IS CLAIMED IS:

1 • An iεolated polynucleotide compriεing a member εelected from the group conεisting of:

(a) a polynucleotide encoding the polypeptide as set forth in SEQ ID NO:2;

(b) a polynucleotide encoding the polypeptide expressed by the DNA contained in ATCC Deposit No. 97,130;

(c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b) ; and

(d) a polynucleotide fragment of the polynucleotide of (a) , (b) , or (c) .

2. The polynucleotide of Claim 1 encoding the polypeptide comprising amino acid 1 to amino acid 364 as set forth in SEQ ID NO:2.

3. A vector containing the polynucleotide of Claim 1.

4. A host cell genetically engineered with the vector of Claim 3.

5. A process for producing a polypeptide comprising: expressing from the host cell of Claim 4 the polypeptide encoded by εaid DNA.

6. A process for producing cells capable of expreεεing a polypeptide compriεing genetically engineering cellε with the vector of Claim 3.

7. A polypeptide εelected from the group conεiεting of (i) a polypeptide having the deduced amino acid εequence of SEQ ID NO:2 and fragments, analogs and derivatives thereof; and (ii) a polypeptide encoded by the cDNA of ATCC Deposit No. 97,130 and fragments, analogs and derivatives of said polypeptide.

8. The polypeptide of Claim 7 wherein the polypeptide has the deduced amino acid sequence of SEQ ID NO:2.

9. An antibody against the polypeptide of claim 7.

10. A compound which activates the polypeptide of claim 7.

11. A compound which inhibits activation of the polypeptide of claim 7.

12. A method for the treatment of a patient having need to activate a receptor comprising: administering to the patient a therapeutically effective amount of the compound of claim 10.

13. A method for the treatment of a patient having need to inhibit a receptor comprising: administering to the patient a therapeutically effective amount of the compound of claim 11.

14. The method of claim 12 wherein said compound is a polypeptide and a therapeutically effective amount of the compound is administered by providing to the patient DNA encoding εaid agoniεt and expressing said agonist in vivo.

15. The method of claim 13 wherein εaid compound is a polypeptide and a therapeutically effective amount of the compound is administered by providing to the patient DNA encoding said antagonist and expresεing said antagonist in vivo.

16. A method for identifying a compound which bind to and activate the polypeptide of claim 7 comprising: contacting a compound with cells expressing on the surface thereof the polypeptide of claim 7, εaid polypeptide being aεsociated with a second component capable of providing a detectable signal in response to the binding of a compound to said polypeptide said contacting being under conditions sufficient to permit binding of compound to the polypeptide; and identifying a compound capable of polypeptide binding by detecting the signal produced by said second component.

17. A method for identifying compounds which bind to and inhibit activation of the polypeptide of claim 7 comprising: contacting an analytically detectable ligand known to bind to the receptor polypeptide of claim 7 and a compound with host cells expressing on the surface thereof the polypeptide of claim 7, said polypeptide being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said polypeptide under conditions to permit binding to the polypeptide; and determining whether the ligand binds to the polypeptide by detecting the absence of a signal generated from the interaction of the ligand with the polypeptide.

18. A proceεε for diagnoεing in a patient a disease or a suεceptibility to a diεeaεe related to an under- expreεεion of the polypeptide of claim 7 compriεing: determining a mutation in the nucleic acid sequence encoding said polypeptide in a sample derived from a patient.

19. A diagnostic process comprising: analyzing for the presence of the polypeptide of claim 7 in a sample derived from a host.