WO1996027009A1 - Transporteur d'amine humaine - Google Patents

Transporteur d'amine humaine Download PDF

Info

Publication number
WO1996027009A1
WO1996027009A1 PCT/US1995/002645 US9502645W WO9627009A1 WO 1996027009 A1 WO1996027009 A1 WO 1996027009A1 US 9502645 W US9502645 W US 9502645W WO 9627009 A1 WO9627009 A1 WO 9627009A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
dna
amine transporter
human amine
Prior art date
Application number
PCT/US1995/002645
Other languages
English (en)
Inventor
Yi Li
Liang Cao
Craig A. Rosen
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority to AU22719/95A priority Critical patent/AU2271995A/en
Priority to EP95916097A priority patent/EP0815220A4/fr
Priority to JP8526210A priority patent/JPH11506309A/ja
Priority to US08/894,840 priority patent/US5859200A/en
Priority to PCT/US1995/002645 priority patent/WO1996027009A1/fr
Priority to US08/471,496 priority patent/US5798223A/en
Publication of WO1996027009A1 publication Critical patent/WO1996027009A1/fr
Priority to US09/139,675 priority patent/US6117426A/en
Priority to US09/502,018 priority patent/US6630443B2/en
Priority to US10/619,485 priority patent/US20040156841A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/20—Hypnotics; Sedatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/24—Antidepressants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/26—Psychostimulants, e.g. nicotine, cocaine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is a human amine transporter. The invention also relates to inhibiting the action of such polypeptides.
  • Neurosensory and neuromotor functions are carried out by neurotransmission.
  • Neurotransmission is the conductance of a nerve impulse from one neuron, called the presynaptic neuron, to another neuron, called the postsynaptic neuron, across the synaptic cleft. Transmission of the nerve impulse across the synaptic cleft involves the secretion of neurotransmitter substances.
  • the neurotransmitter is packaged into vesicles in the presynaptic neuron and released into the synaptic cleft to find its receptor at the postsynaptic neuron. Transmission of the nerve impulse is normally transient.
  • synaptic transmission An essential property of synaptic transmission is the rapid termination of action following neurotransmitter release.
  • neurotransmitters including catecholamine, serotonin, and certain amino acids (e.g., gamma-aminobutyric acid (GABA) , glutamate and glycine)
  • GABA gamma-aminobutyric acid
  • glutamate and glycine gamma-aminobutyric acid
  • This rapid re-accumulation of a neurotransmitter is the result of re-uptake by the presynaptic terminals.
  • the various molecular structures for re-uptake are highly specific for such neurotransmitters as choline and the biogenic amines (low molecular weight neurotransmitter substances such as dopamine, norepinephrine, epinephrine, serotonin and histamine) .
  • These molecular apparatuses are termed transporters. These transporters move neurotransmitter substances from the synaptic cleft back across the cell membrane of the presynaptic neuron into the cytoplasm of the presynaptic terminus and therefore terminate the function of these substances. Inhibition or stimulation of neurotransmitter uptake provides a means for modulating the effects of the endogenous neurotransmitters.
  • Re-uptake of neurotransmitter substances by the transporters may be sodium-dependent.
  • the GABA transporter is a member of the recently described sodium- dependent neurotransmitter transporter gene family.
  • These transporters are transmembrane receptor complexes having an extracellular portion, a transmembrane portion and an intracellular portion.
  • a significant degree of homology exists in the transmembrane domains of the entire family of sodium- ependent neurotransmitter transporter proteins, with considerable stretches of identical amino acids, while much less homology is apparent in the intracellular and extracellular loops connecting these domains.
  • the extracellular loop in particular seems to be unique for each transporter. This region may contribute to substrate and/or inhibitor specificities. Identifying the novel amine transporter of the present invention and elucidating the structural and functional distinctions between different types of transporters is important in understanding the cellular and molecular bases of behavior and disease.
  • polypeptide of the present invention has been putatively identified as an amine transporter. This identification has been made as a result of amino acid sequence homology to the rat amine transporter.
  • a novel mature polypeptide which is a human amine transporter, as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
  • isolated nucleic acid molecules encoding a human amine transporter, including mRNAs, DNAs, cDNAs, genomic DNAs as well as analogs and biologically active and diagnostically or therapeutically useful fragments and derivatives thereof.
  • a process for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a human amine transporter nucleic acid sequence, under conditions promoting expression of said protein and subsequent recovery of said protein.
  • a method for utilizing such agonists for stimulating the amine transporter uptake of neurotransmitter ligands for the treatment of diseases related to under-expression of the amine transporter or over- expression of the ligand is provided.
  • nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to human amine transporter sequences.
  • diagnostic assays for detecting diseases related to the under-expression and over-expression of the amine transporter polypeptide and mutations in the nucleic acid sequences encoding such polypeptide are provided.
  • Figure 1 illustrates the cDNA sequence and corresponding deduced amino acid sequence of the human amine transporter of the present invention.
  • the standard one-letter abbreviations for amino acids are used.
  • Sequencing was performed using a 373 Automated DNA sequencer (Applied Biosysterns, Inc.) . Sequencing accuracy is predicted to be greater than 97% accurate.
  • Figure 2 is an illustration of an amino acid homology alignment between the amine transporter and a rat amine transporter (retrieved from Genbank public database) .
  • the amine transporter of the present invention may be responsible for re-uptake of one or any of the amine neurotransmitters present in mammalian cells.
  • examples of such amine transporters include dopamine, norepinephrine, epinephrine, serotonin and histamine, and other amino acid transmitters, including GABA, glycine and glutamate.
  • nucleic acid which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75980 on December 16, 1994.
  • a polynucleotide encoding a polypeptide of the present invention may be obtained from a variety of human tissues.
  • the polynucleotide of this invention was discovered in a cDNA library derived from a human adrenal gland tumor. It is structurally related to the amine transporter family. It contains an open reading frame encoding a protein of 470 amino acid residues. The protein exhibits the highest degree of homology to the rat amine transporter with 80 % identity and 86 % similarity over a 468 amino acid stretch.
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID No. 2) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure l (SEQ ID No. 2) or the deposited cDNA.
  • the polynucleotide which encodes for the mature polypeptide of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the deposited cDNA may include only the coding sequence for the mature polypeptide or the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure l (SEQ ID No. 2) or the polypeptide encoded by the cDNA of the deposited clone.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non- naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID No. 2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID No. 2) or the polypeptide encoded by the cDNA of the deposited clone.
  • Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID No.
  • allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
  • the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides.
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • the polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as ⁇ . the mature polypeptide encoded by the cDNA of Figure 1 (SEQ ID No.
  • the present invention further relates to a human amine transporter polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.
  • fragment when referring to the polypeptide of Figure 1 (SEQ ID No. 2) or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID No. 2) or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) .
  • a conserved or non-conserved amino acid residue preferably a conserved amino acid residue
  • substituted amino acid residue may or may not be one encoded by the genetic code
  • one or more of the amino acid residues includes a substituent group
  • the mature polypeptide is fused with another compound, such as a compound to increase the half-
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) .
  • a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
  • the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the human amine transporter genes.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
  • the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40 bacterial plasmids; phage DNA; baculovirus,- yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabi.es.
  • any other vector may be used as long as it is replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
  • the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • promoter for example, LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
  • bacterial cells such as E. coli. Streptomyces. Salmonella typhimurium
  • fungal cells such as yeast
  • insect cells such as Drosophila S2 and Spodoptera Sf9
  • animal cells such as CHO, HEK, COS or Bowes melanoma
  • adenoviruses,- plant cells etc.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • a promoter operably linked to the sequence.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen) , pBS, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH ⁇ A, pNH16a, pNHl ⁇ A, pNH46A (Stratagene) ; ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia).
  • Eukaryotic pWLNEO, PSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
  • Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
  • CAT chloramphenicol transferase
  • Two appropriate vectors are PKK232-8 and PC 7.
  • Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • the present invention relates to host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L., Dibner, M. , Battey, I., Basic Methods in Molecular Biology, (1986)) .
  • constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
  • Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference. Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , a-factor, acid phosphatase, or heat shock proteins, among others.
  • the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences.
  • the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella tvphimurium -and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) .
  • cloning vector pBR322 ATCC 37017
  • Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA) .
  • pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
  • the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
  • Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
  • mammalian cell culture systems can also be employed to express recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981) , and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HEK, HeLa and BHK cell lines.
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
  • the human amine transporter polypeptide can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) .
  • a prokaryotic or eukaryotic host for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture
  • the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • Polypeptides of the invention may also include an initial methionine amino acid residue.
  • Fragments of the full length human amine transporter gene may be used as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity.
  • Probes of this type generally have at least 20 bases. Preferably, however, the probes have at least 30 bases and generally do not exceed 50 bases, although they may have a greater number of bases.
  • the probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete human amine transporter gene including regulatory and promotor regions, exons, emd introns.
  • a screen comprises isolating the coding region of the human amine transporter gene by using the known DNA sequence to synthesize an oligonucleotide probe.
  • Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
  • This invention provides a method for determining amine neurotransmitters which are transported by the human amine transporter of the present invention.
  • An example of an assay which will identify these neurotransmitters comprises infecting mammalian cells with recombinant vaccinia virus strain VTF-7 encoding a T7 RNA polymerase and following such infection with liposome-mediated transfection with the amine transporter gene through the use of a vector, for example, pBSSKII(-). Controlled transfections are also done with equivalent amounts of vector alone. Assays are performed eight hours following transfection in modified Krebs-Ringer- HEPES buffer. Cells are then incubated with E ⁇ ] neurotransmitter (for example, GABA, dopamine, serotonin, etc.) .
  • E ⁇ ] neurotransmitter for example, GABA, dopamine, serotonin, etc.
  • Uptake is stopped by placing the cells on ice. Cells are solubilized in one percent SDS, and the amount of radioactivity accumulated is determined by liquid scintillation counting. A significant amount of uptake determines that the particular neurotransmitter is taken up by the human amine transporter of the present invention by determining background using control transfections with pBSSKII for each assay and subtracting the values obtained from the signals determined for the specific amine neurotransmitters.
  • This invention also provides a method of detecting expression of an amine transporter on the surface of a cell by detecting the presence of mRNA coding for an amine transporter.
  • This method comprises obtaining total mRNA from the cell using methods well-known in the art and contacting the mRNA so obtained with a nucleic acid probe of at least 15 nucleotides and which is capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding a human amine transporter, under hybridizing conditions, detecting the presence of mRNA hybridized to the probe, and thereby detecting the expression of the amine transporter by the cell.
  • Hybridization of probes to target nucleic acid molecules such as mRNA molecules employs techniques well known in the art.
  • nucleic acids are extracted by precipitation from lysed cells and the mRNA is isolated from the extract using a column which binds the poly-A tails of the mRNA molecules.
  • the mRNA is then exposed to radioactively labelled probe on a nitrocellulose membrane, and the probe hybridizes to and thereby labels complementary mRNA sequences. Binding may be detected by autoradiography or scintillation counting. However, other methods for performing these steps are well known to those of skill in the art.
  • an antibody directed to the human amine transporter may be employed under conditions permitting binding of the antibody to the transporter, and detecting the presence of the transporter on the surface of the cell. Such a method may be employed for determining whether a given cell is defective in expression of the amine transporter. Detection methods include fluorescent markers bound to the antibodies.
  • the invention also provides a method for determining whether a compound not known to be capable of specifically binding to a human amine transporter can specifically bind to the human amine transporter, which comprises contacting a mammalian cell comprising a plasmid adapted for expression in a mammalian cell which plasmid further comprises a DNA which expresses the amine transporter on the cell surface with the compound under conditions permitting binding of ligands known to bind to the amine transporter, detecting the presence of any compound bound to the mammalian amine transporter, the presence of bound compound indicating that the compound is capable of specifically binding to the human amine transporter.
  • This invention also provides a method of screening drugs to identify drugs which specifically interact with, and bind to a human amine transporter on the surface of a cell which comprises contacting a mammalian cell which expresses the human amine transporter on the surface of a cell with a plurality of drugs, detecting those drugs which bind to the cell, and thereby identifying drugs which specifically interact with, and bind to, the human amine transporter.
  • the present invention further provides a method for identifying agonist or antagonist compounds to the human amine transporter of the present invention by the employment of competition assays.
  • An example of such an assay for identifying antagonists comprises contacting a neuronal cell which expresses the human amine transporter on the surface thereof with a known neurotransmitter, in the presence of a potential compound to determine the amount of neurotransmitter transported. Controls may also be prepared in the absence of the potential compound and the amount of amine neurotransmitter transported by the cell upon comparison to the control cell indicates if the potential compound stimulated transport or inhibited transport of the labeled amine neurotransmitter by the transfected mammalian cell.
  • human amine transporter antagonists include an antibody directed to the human amine transporter which comprises, for example, a monoclonal antibody directed to an epitope of a human amine transporter present on the surface of the cell. These -antibodies are useful to detect the presence of human amine transporters or to inhibit the function of the transporters in humans.
  • Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide sequence which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix - see Lee et al., Nucl.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the human amine transporter polypeptide (antisense - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)).
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of human amine transporter.
  • Potential antagonists also include a soluble form of a human amine transporter, e.g. a fragment of the transporter, which binds to the neurotransmitter and prevents it from interacting with the human amine transporter.
  • Potential antagonists further include a small molecule which binds to and occupies the extracellular portion of the human amine transporter thereby making the human amine transporter inaccessible to the neurotransmit ⁇ -er such that transport is inhibited.
  • small molecules include but are not limited to small peptides or peptide-like molecules.
  • This invention additionally provides a method of treating an abnormal condition related to an excess of amine transporter activity which comprises administering to a subject the antagonist as hereinabove described along with a pharmaceutically acceptable carrier in an amount effective to block binding of naturally occurring substrates to the amine transporters and thereby alleviate the abnormal condition.
  • abnormal conditions include epilepsy, schizophrenia, depression, cognitive impairment, anxiety and migraine headaches.
  • the invention also provides a method of treating abnormal conditions related to an under-expression of amine transporter activity which comprises administering to a subject an amount of the agonist described above in combination with a pharmaceutically acceptable carrier, in an amount effective to enhance binding of naturally occurring substrates to the amine transporter and thereby alleviate the abnormal conditions.
  • abnormal conditions are Parkinson's disease and Alzheimer's disease.
  • compositions comprise a therapeutically effective amount of the transporter, agonist or antagonist and a pharmaceutically acceptable carrier or excipient.
  • a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the pharmaceutical compositions may be employed in conjunction with other therapeutic compounds.
  • the pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes.
  • the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
  • human amine transporter and agonists and antagonists which are polypeptides may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy.”
  • cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
  • a polynucleotide DNA or RNA
  • cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
  • a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo.
  • the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
  • This invention is also related to the use of the human amine transporter gene as part of a diagnostic assay for detecting diseases or susceptibility to diseases related to the presence of mutations in the human amine transporter genes. Such diseases are related to under-expression of the human amine transporter.
  • Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al . , Nature, 324:163- 166 (1986)) prior to analysis.
  • RNA or cDNA may also be used for the same purpose.
  • PCR primers complementary to the nucleic acid encoding the human amine transporter protein can be used to identify and analyze human amine transporter mutations.
  • deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled human amine transporter RNA or alternatively, radiolabeled human amine transporter antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures. Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis.
  • DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al . , Science, 230:1242 (1985)).
  • Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)).
  • nuclease protection assays such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)).
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP) ) and Southern blotting of genomic DNA.
  • restriction enzymes e.g., Restriction Fragment Length Polymorphisms (RFLP)
  • mutations can also be detected by in si tu analysis.
  • sequences of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease. Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA.
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner.
  • Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with cDNA as short as 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
  • FISH requires use of the clones from which the expression sequence tag was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 is probably not necessary to get good results a reasonable percentage of the time.
  • Verma et al. Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988) .
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb) .
  • polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Mil ⁇ tein, 1975, Nature, 256:495-497), the trio a technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
  • Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
  • “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
  • the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
  • plasmid or DNA fragment typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
  • isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 * C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
  • Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980) .
  • Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
  • Ligase refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T. , et al., Id., p. 146) . Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
  • ligase T4 DNA ligase
  • the DNA sequence encoding human amine transporter is initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' end sequences of the processed amine transporter nucleic acid sequence (minus the signal peptide sequence) . Additional nucleotides corresponding to amine transporter gene are added to the 5' and 3' sequences respectively.
  • the 5' oligonucleotide primer has the sequence 5' GACTAAAGCTTAATGCTCCGGCCCATTCTG 3' (SEQ ID No. 3) contains a Hindi11 restriction enzyme site followed by 18 nucleotides of human amine transporter coding sequence starting from the presumed terminal amino acid of the processed protein.
  • the 3' sequence 5' GAACTTCTAGACGGTCAGCCATGGTGACTGG 3' contains complementary sequences to an Xbal site and is followed by 20 nucleotides of the human amine transporter gene.
  • the restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA) .
  • pQE-9 encodes antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/O) , a ribosome binding site (RBS) , a 6- Hi ⁇ tag and restriction enzyme sites.
  • pQE-9 is then digested with HindiII and Xbal.
  • the amplified sequences are ligated into pQE-9 and are inserted in frame with the sequence encoding for the histidine tag and the RBS.
  • the ligation mixture is then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) .
  • M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kan r ) .
  • Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected.
  • Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells are grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6. IPTG (“Isopropyl-B-D- thiogalacto pyranoside”) is then added to a final concentration of 1 mM. IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression.
  • O.D. 600 optical density 600
  • Human amine transporter protein is eluted from the column in 6 molar guanidine HC1 pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HC1, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hours the protein is dialyzed to 10 mmolar sodium phosphate.
  • the DNA sequence encoding the full length human amine transporter protein, ATCC # 75980, is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
  • the 5' primer has the sequence 5' CGGGATCCCTCC TGG T CCGGCCCATTCTG 3' (SEQ ID No. 5) and contains a BamHI restriction enzyme site (in bold) followed by 4 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M. , J. Mol. Biol., 196:947-950 (1987) which is just behind the first 18 nucleotides of the human amine transporter gene (the initiation codon for translation "ATG" is underlined) .
  • the 3' primer has the sequence 5' CGGGATCCCGCT CAGCCATGGTGACTGGT 3' (SEQ ID No. 6) and contains the cleavage site for the restriction endonuclease BamHI and 18 nucleotides complementary to the 3' non-translated sequence of the human amine transporter gene.
  • the amplified sequences are isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.). The fragment is then digested with the endonucleases BamHI and then purified again on a 1% agarose gel. This fragment is designated F2.
  • the vector pRGl (modification of pVL941 vector, discussed below) is used for the expression of the human amine transporter protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) .
  • This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonucleases BamHI.
  • the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
  • the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of co-transfected wild-type viral DNA.
  • Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
  • the plasmid is digested with the restriction enzymes BamHI and then dephosphorylated using calf intestinal phosphatase by procedures known in the art.
  • the DNA is then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated V2.
  • Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase.
  • E.coli HB101 cells are then transformed and bacteria identified that contained the plasmid (pBac-Human amine transporter) with the human amine transporter gene using the enzyme BamHI. The sequence of the cloned fragment is confirmed by DNA sequencing.
  • 5 ⁇ g of the plasmid pBac-Human amine transporter is co- transfected with 1.0 ⁇ g of a commercially available linearized baculovirus ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Feigner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)) .
  • l ⁇ g of BaculoGoldTM virus DNA and 5 ⁇ g of the plasmid pBac-Human amine transporter are mixed in a sterile well of a microtiter plate containing 50 ⁇ l of serum free Grace's medium (Life Technologies Inc., Gaithe- ⁇ sburg, MD) . Afterwards 10 ⁇ l Lipofectin plus 90 ⁇ l Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop- wise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with l ml Grace's medium without serum. The plate is rocked back and forth to mix the newly added solution.
  • Sf9 insect cells ATCC CRL 1711
  • the plate is then incubated for 5 hours at 27°C. After 5 hours the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is added. The plate is put back into an incubator and cultivation continued at 27°C for four days.
  • plaque assay After four days the supernatant is collected and a plaque assay performed similar as described by Summers and Smith (supra) . As a modification an agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) is used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay” can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
  • the viruses are added to the cells and blue stained plaques are picked with the tip of an Eppendorf pipette.
  • the agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
  • the agar is removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes.
  • the supernatants of these culture dishes are harvested and then stored at 4°C.
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells are infected with the recombinant baculovirus V-Human amine transporter at a multiplicity of infection (MOD of 2.
  • MOD multiplicity of infection
  • the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg) .
  • the cells are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS- PAGE and autoradiography.
  • plasmid, Human amine transporter HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site.
  • a DNA fragment encoding the entire Human amine transporter precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter.
  • the HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, et al., Cell, 37:767, (1984)). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is described as follows:
  • the DNA sequence encoding Human amine transporter is constructed by PCR using two primers: the 5' primer 5' GTCCJ.AGCTTGCCACCATGCTGCGGCCCATTCTG 3' (SEQ ID No. 7) contains a HindiII site followed by 18 nucleotides of Human amine transporter coding sequence starting from the initiation codon; the 3' sequence 5' CTAGCTCGAGTCAGCCATGG TGACTGGTAGCGTAGTC ⁇ GGGACGTCGTATGGGTAGCA 3' (SEQ ID No. 8) contains complementary sequences to an Xhol site, translation stop codon, HA tag and the last 18 nucleotides of the Human amine transporter coding sequence (not including the stop codon) .
  • the PCR product contains a Hindlll site, human amine transporter coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Hindlll site.
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp are digested with Hindlll and Xhol restriction enzyme and ligated.
  • the ligation mixture is transformed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, CA) the transformed culture is plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the correct fragment.
  • COS cells are transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)) .
  • the expression of the Human amine transporter HA protein is detected by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells are labelled for 8 hours with 35 S-cysteine two days post transfection.
  • Example 4 Expression pattern of Human amine transporter in human tissue Northern blot analysis is carried out to examine the levels of expression of Human amine transporter in human tissues.
  • Total cellular RNA samples are isolated with RNAzolTM B system (Biotecx Laboratories, Inc. Houston, TX) .
  • About lO ⁇ g of total RNA isolated from each human tissue specified is separated on 1% agarose gel and blotted onto a nylon filter (Sambrook, Fritsch, and Maniati ⁇ , Molecular Cloning, Cold Spring Harbor Press, (1989)).
  • the labeling reaction is done according to the Stratagene Prime-It kit with 50ng DNA fragment.
  • the labeled DNA is purified with a Select-G-50 column (5 Prime - 3 Prime, Inc. Boulder, CO) .
  • the filter is then hybridized with radioactive labeled full length Human amine transporter gene at 1,000,000 cpm/ml in 0.5 M NaP0 4 , pH 7.4 and 7% SDS overnight at 65 * C. After wash twice at room temperature and twice at 60"C with 0.5 x SSC, 0.1% SDS, the filter is then exposed at -70"C overnight with an intensifying screen.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • TCCTGCGTTA TCCCCCTGAT TCTGTGGATA ACCGTATTNC CGCCTTTGAG TGAGCTGATA 60
  • CCGCTCNCCN CAGCCGAACG ACCGAGCGCA GCGAGTCAGT GAGCGAGGAA GCGGAAGAGC 120
  • GCCCAATACG CAAACCGCCT CTCCCCGCGC GTTGGCCGAT TCATTAATGC AGCTGGCACG 180
  • CACACTGCCC ATCTGGATGA TGCAGACCAT GTGCTCCCCC AAGTGGCAGC TGGGTCTAGC 1740
  • CTGTGTTCCT CTGGCTCACA AAAATTTTGG TCTCATTGGC CCCAATGCAG GGCTTGGCCT 1920
  • TTTTCTNCCA TTTATTTTAT TTATTWACTA AAGTGAATGA TTTTACTGTG GYTAAATCTA 2640
  • Gly Leu lie Gly Pro Asn Ala
  • Gly Leu Gly Leu Xaa lie Gly Met
  • Val Glu Ser Ser Met Met Pro lie Met Gly His Leu Val Asp Pro
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:7:

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Psychiatry (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Anesthesiology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pain & Pain Management (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention, qui traite d'un polypeptide transporteur d'amine humaine et d'un ADN (ARN) codant pour celui-ci, porte également sur la marche à suivre pour le fabriquer par des techniques de recombinaison. Sont également présentées des techniques destinées à la détection d'agonistes et d'antagonistes de ce polypeptide ainsi que des méthodes thérapeutiques faisant appel à ces mêmes agonistes et antagonistes s'agissant du traitement de maladies dues à une sous-expression ou à une sur-expression du transporteur de l'amine humaine relevant de cette invention. Il est, en outre, fait état de procédés permettant de déceler des mutations dans une séquence d'acide nucléique codant pour ce polypeptide ainsi que des modifications de degré de la forme soluble de ce polypeptide.
PCT/US1995/002645 1995-03-01 1995-03-01 Transporteur d'amine humaine WO1996027009A1 (fr)

Priority Applications (9)

Application Number Priority Date Filing Date Title
AU22719/95A AU2271995A (en) 1995-03-01 1995-03-01 Human amine transporter
EP95916097A EP0815220A4 (fr) 1995-03-01 1995-03-01 Transporteur d'amine humaine
JP8526210A JPH11506309A (ja) 1995-03-01 1995-03-01 ヒトアミン輸送体
US08/894,840 US5859200A (en) 1995-03-01 1995-03-01 Human amine transporter
PCT/US1995/002645 WO1996027009A1 (fr) 1995-03-01 1995-03-01 Transporteur d'amine humaine
US08/471,496 US5798223A (en) 1995-03-01 1995-06-06 Polynucleotides encoding human amine transporter and methods of using the same
US09/139,675 US6117426A (en) 1995-03-01 1998-08-25 Human amine transporter polypeptide fragments
US09/502,018 US6630443B2 (en) 1995-03-01 2000-02-11 Human amine transporter antibodies
US10/619,485 US20040156841A1 (en) 1995-03-01 2003-07-16 Human amine transporter

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1995/002645 WO1996027009A1 (fr) 1995-03-01 1995-03-01 Transporteur d'amine humaine

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US08/471,496 Continuation-In-Part US5798223A (en) 1995-03-01 1995-06-06 Polynucleotides encoding human amine transporter and methods of using the same

Publications (1)

Publication Number Publication Date
WO1996027009A1 true WO1996027009A1 (fr) 1996-09-06

Family

ID=22248753

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1995/002645 WO1996027009A1 (fr) 1995-03-01 1995-03-01 Transporteur d'amine humaine

Country Status (4)

Country Link
EP (1) EP0815220A4 (fr)
JP (1) JPH11506309A (fr)
AU (1) AU2271995A (fr)
WO (1) WO1996027009A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001013715A2 (fr) * 1999-08-24 2001-03-01 The Babraham Institute Modele animal et ses utilisations
WO2001021792A1 (fr) * 1999-09-21 2001-03-29 Chugai Seiyaku Kabushiki Kaisha Genes transporteurs oatp-b, c, d et e

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5688936A (en) * 1992-06-11 1997-11-18 The Regents Of The University Of California Vesicle membrane transport proteins
JP3583778B2 (ja) * 1993-01-29 2004-11-04 ニューロスフィアーズ ホウルディングス リミテッド 神経幹細胞の遺伝子修飾

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CELL, Volume 70, issued 21 August 1992, Y. LIU et al., "A cDNA That Suppresses MPP+ Toxicity Encodes A Vesicular Amine Transporter", pages 539-551. *
FEBS LETTERS, Volume 318, No. 3, issued March 1993, C.K. SURRATT et al., "A Human Synaptic Vesicle Monoamine Transporter cDNA Predicts Posttranslational Modification, Reveals Chromosome 10 Gene Localization and Identifies TaqI RFLPs", pages 325-330. *
FEBS LETTERS, Volume 335, No. 1, issued November 1993, E. KREJCI et al., "Expression and Regulation of the Bovine Vesicular Monoamine Transporter Gene", pages 27-32. *
GENOMICS, Volume 18, No. 3, issued December 1993, D. PETER et al., "Chromosomal Localization of the Human Vesicular Amine Transporter Genes", pages 720-723. *
PROC. NATL. ACAD. SCI. U.S.A., Volume 89, issued November 1992, J.D. ERICKSON et al., "Expression Cloning of A Reserpine-Sensitive Vesicular Monoamine Transporter", pages 10993-10997. *
See also references of EP0815220A4 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001013715A2 (fr) * 1999-08-24 2001-03-01 The Babraham Institute Modele animal et ses utilisations
WO2001013715A3 (fr) * 1999-08-24 2001-09-20 Babraham Inst Modele animal et ses utilisations
WO2001021792A1 (fr) * 1999-09-21 2001-03-29 Chugai Seiyaku Kabushiki Kaisha Genes transporteurs oatp-b, c, d et e
US7045316B2 (en) 1999-09-21 2006-05-16 Chugai Seiyaku Kabushiki Kaisha Transporter genes OATP-B,C,D, and E
US8748128B2 (en) 1999-09-21 2014-06-10 Chugai Seiyaku Kabushiki Kaisha Transporter genes OATP-B, C, D, and E

Also Published As

Publication number Publication date
JPH11506309A (ja) 1999-06-08
AU2271995A (en) 1996-09-18
EP0815220A1 (fr) 1998-01-07
EP0815220A4 (fr) 2000-10-11

Similar Documents

Publication Publication Date Title
CA2210444C (fr) Facteur-2 de croissance des keratinocytes
US20090197278A9 (en) Antibodies to hADA2
US20030078391A1 (en) Connective tissue growth factor-2
US20020106740A1 (en) Human G-protein receptor HPRAJ70
US6319700B1 (en) Human choline acetyltransferase
US20040126371A9 (en) Immune cell cytokine
WO1996023410A1 (fr) Enzymes 7, 8 et 9 de conjugaison d'ubiquitine
AU687962B2 (en) Human stanniocalcin-alpha
US5859200A (en) Human amine transporter
WO1997018224A1 (fr) Antigene 2 de cellules-souches humaines
WO1996027009A1 (fr) Transporteur d'amine humaine
US6630443B2 (en) Human amine transporter antibodies
WO1996021736A1 (fr) Geranylgeranyle pyrophosphate synthetase humaine
US20020086362A1 (en) Human amine receptor
US20020119487A1 (en) Human stem cell antigen 2
US5945321A (en) Ubiquitin conjugating enzymes 7, 8 and 9
AU753987B2 (en) Keratinocyte growth factor-2
EP1284292A2 (fr) Gène de translocation 3 de cellules B humaines
EP0815199A1 (fr) Desoxycytidine kinase 2 humaine
US20020058610A1 (en) Mammary transforming protein
JP2002330795A (ja) ヒトアミン輸送体
CA2430223A1 (fr) Facteur-2 de croissance des keratinocytes

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 08471496

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2158567

Country of ref document: CA

AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA CN JP KR MX NZ US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 1996 526210

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1995916097

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1995916097

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 08894840

Country of ref document: US

WWW Wipo information: withdrawn in national office

Ref document number: 1995916097

Country of ref document: EP