WO1996023410A1 - Enzymes 7, 8 et 9 de conjugaison d'ubiquitine - Google Patents

Enzymes 7, 8 et 9 de conjugaison d'ubiquitine Download PDF

Info

Publication number
WO1996023410A1
WO1996023410A1 PCT/US1995/001250 US9501250W WO9623410A1 WO 1996023410 A1 WO1996023410 A1 WO 1996023410A1 US 9501250 W US9501250 W US 9501250W WO 9623410 A1 WO9623410 A1 WO 9623410A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
uce
polynucleotide
seq
dna
Prior art date
Application number
PCT/US1995/001250
Other languages
English (en)
Inventor
Jian Ni
Reiner Gentz
Mark D. Adams
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority to AU18690/95A priority Critical patent/AU1869095A/en
Priority to JP8523484A priority patent/JPH11501802A/ja
Priority to PCT/US1995/001250 priority patent/WO1996023410A1/fr
Priority to EP95910898A priority patent/EP0814661A4/fr
Priority to US08/875,272 priority patent/US5945321A/en
Publication of WO1996023410A1 publication Critical patent/WO1996023410A1/fr
Priority to US08/903,396 priority patent/US5968797A/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A61P21/02—Muscle relaxants, e.g. for tetanus or cramps
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention are Ubiquitin Conjugating Enzymes 7, 8 and 9, sometimes hereinafter referred to as "UCE 7, 8 and 9.” The invention also relates to modulating the action of such polypeptides.
  • Mammalian cells contain two distinct proteolytic pathways that are involved in different aspects of protein breakdown.
  • One of these is ubiquitin-dependent, it is a major pathway in eukaryotes involved in the selective degradation of abnormal and short-lived proteins.
  • Ubiquitin is a highly conserved 76 amino acid residue protein present in eukaryotic cells either free or covalently attached to a great variety of proteins.
  • the post-translational attachment of ubiquitin to other proteins is catalyzed by ubiquitin conjugating enzymes and involves the formation of an isopeptide bond between the C-terminal glycine residue of ubiquitin and the epsilon-amino group of a lysine-residue in an acceptor protein.
  • Ubiquitin-protein conjugation is highly selective and is required for a surprising variety of cellular functions. Genetic studies in yeast showed that ubiquitin conjugating enzymes are required for DNA repair, induced mutagenesis, sporulation, repression of retrotransposition, cell cycle progression, cell viability, heat shock resistance, cadmium tolerance, and peroxisome biogenesis.
  • ubiquitin conjugating enzymes are required for DNA repair, induced mutagenesis, sporulation, repression of retrotransposition, cell cycle progression, cell viability, heat shock resistance, cadmium tolerance, and peroxisome biogenesis.
  • Several in vivo substrates have been identified, including histone ⁇ , actin, cell surface receptors, the MAT ⁇ 2 transcriptional repressor, the tumor suppressor protein p53, the Mos kinase and cyclins.
  • UCE 7, 8 and 9 may play a major role in selective protein degradation in human cells.
  • the ubiquitin gene is one of the genes known to be stimulated during the apoptotic death program and ubiquitin of nuclear proteins might be involved in chromatin disorganization and oligonucleosomal fragmentation, which are among the key events occurring in apoptosis.
  • Apoptosis the classical type of programmed cell death, can be triggered in many cell types by widely diverse stimuli, for example, gamma rays at low doses can induce apoptosis in vi tro in interphase human lymphocytes. In this type of apoptosis induction, activated gene expression is necessary for the fulfillment of the death program. It has been reported (Delic, J., et al . , Mol.
  • Perturbations of ubiquitin system can also induce a programmed necrotic response in plants such as leaf curling, vascular tissue alterations and necrotic lesions.
  • Ubiquitin can inhibit the cytotoxic properties of platelets and the production of oxygen metabolites by these cells. Moreover, this molecule is able to act as a proaggregating factor and seems of a great interest in pathologies involving defects in platelet aggregation. Ubiquitin also plays a role in the regulation of immunological disorders in which platelets seem to be implicated such as hymenoptera venom hypersensitivity and aspirin-sensitive asthma, since in both situations, ubiquitin is able to inhibit the cytotoxic function of platelets. Ubiquitin has also been shown to be increased in patients with Alzheimer's disease (Taddei, N. , et al . , Neurosci.
  • Ubiquitin-proteasome system also plays a major role in specific processing and subsequent presentation of MHC class I-restricted antigens.
  • Maturation of the pl05 NF-kB precursor into the active p50 subunit of the transcriptional activator also proceeds in a ubiquitin and proteasome-dependent manner. Furthermore, inhibitors to the proteasome block degradation of IkBa and thus prevent tumor necrosis factor alpha induced activation of NF-kB and its entry into the nucleus.
  • the unstable c-Jun but not the stable v-Jun, is multi- ubiquitinated and degraded.
  • the escape of the oncogenic v- Jun from ubiquitin-dependent degradation suggests a route to the malignant transformation.
  • Another proto-oncoprotein, c- Mos is also degraded by the ubiquitin system.
  • HPV human papilloma virus
  • lymphocyte homing receptor including the lymphocyte homing receptor, growth hormone receptor, and growth factor receptor (PDGF, steel factor) were also found to be modified by ubiquitin.
  • PDGF growth factor receptor
  • polypeptides of the present invention have been putatively identified as UCE 7, 8 and 9. This identification has been made as a result of amino acid sequence homology.
  • novel mature polypeptides which are UCE 7, 8 and 9, as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
  • the polypeptides of the present invention are of human origin.
  • nucleic acid molecules encoding UCE 7, 8 and 9 including mRNAs, DNA's, cDNA's, genomic DNA, as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
  • a process for producing such polypeptides by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a human UCE 7, 8 or 9 nucleic acid sequence, under conditions promoting expression of said proteins and subsequent recovery of said proteins.
  • polypeptides or polynucleotides encoding such polypeptides for therapeutic purposes, for example, to treat malignant transformations, immunological disorders, to mark unwanted cells for cell death, and to screen for agonists and antagonists which interact with the polypeptides.
  • antagonists to such polypeptides which may be employed to inhibit the action of such polypeptides, for example, in the treatment of atrophying skeletal muscle, cervical carcinoma and certain tumors, Alzheimer's disease, endemic pemphigus foliaceus and African swine fever.
  • nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to UCE 7, 8 and 9 sequences.
  • diagnostic assays for detecting diseases or susceptibility to diseases related to mutations in UCE 7, 8 or 9 nucleic acid sequences or over-expression of the polypeptides encoded by such sequences.
  • Figure l illustrates the cDNA sequence and the corresponding deduced amino acid sequence of UCE 7 polypeptide.
  • the standard one-letter abbreviations for amino acids is used.
  • Sequencing was performed using a 373 Automated DNA sequencer (Applied Biosystems, Inc. ) . Sequencing accuracy is predicted to be greater than 97% accurate.
  • Figure 2 illustrates the cDNA sequence and the corresponding deduced amino acid sequence of UCE 8 polypeptide.
  • Figure 3 illustrates the cDNA sequence and the corresponding deduced ammo acid sequence of UCE 9 polypeptide.
  • Figure 4 illustrates the amino acid sequence homology between UCE 7 and UCE from Drosophila melanogaster.
  • Figure 5 illustrates the ammo acid sequence homology between UCE 8 and the Caenorhabditis elegans UCE gene product.
  • Figure 6 illustrates the amino acid sequence homology between UCE 9 and UCE from Saccharomyces cerevisiae.
  • nucleic acid which encodes for the mature polypeptides having the deduced ammo acid sequence of Figures l, 2 and 3 (SEQ ID No. 2, 4 and 6) , or for the mature polypeptides encoded by the cDNAs of the clone deposited as ATCC Deposit No. 75877, 75876 and 75878 on August 29, 1994 encoding UCE 7, 8 and 9, respectively.
  • a polynucleotide encoding a UCE 7 polypeptide of the present invention may be obtained from tumor testis, activated T-cells and chondrosarcoma.
  • the polynucleotide of this invention was discovered in a cDNA library derived from Raji cells (cycloheximide treated) . It is structurally related to the human ubiquitin conjugating enzyme family. It contains an open reading frame encoding a protein of 147 amino acid residues. The protein exhibits the highest degree of homology to UCE from Drosophila melanogastor with 93 % identity and 96 % similarity over a 147 amino acid stretch.
  • a polynucleotide encoding a UCE 8 polypeptide of the present invention may be obtained from osteoclastoma, tumor testis and activated T-cells.
  • the polynucleotide of this invention was discovered in a cDNA library derived from human fetal brain. It is structurally related to the human ubiquitin conjugating enzyme family. It contains an open reading frame encoding a protein of 154 amino acid residues. The protein exhibits the highest degree of homology to UCE from Caenorhabditis elegans with 55 % identity and 78 % similarity over a 154 amino acid stretch.
  • a polynucleotide encoding a UCE 9 polypeptide of the present invention may be obtained from embryo, smooth muscle and greater omentum.
  • the polynucleotide of this invention was discovered in a cDNA library derived from human greater omentum. It is structurally related to the human ubiquitin conjugating enzyme family. It contains an open reading frame encoding a protein of 193 amino acid residues. The protein exhibits the highest degree of homology to UCE from S. cerevisiae with 61 % identity and 72 % similarity over a 193 amino acid stretch.
  • the polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figures l, 2 and 3 (SEQ ID No.
  • the polynucleotide which encodes for the mature polypeptides of Figures l, 2 and 3 (SEQ ID No. 2, 4 and 6) or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptides as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequences of Figures l, 2 and 3 (SEQ ID No. 2, 4 and 6) or the polypeptides encoded by the cDNA(s) of the deposited clone.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotides encoding the same mature polypeptides as shown in Figures l, 2 and 3 (SEQ ID No. 2, 4 and 6) or the same mature polypeptide encoded by the cDNA(s) of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptides of Figures l, 2 and 3 (SEQ ID No. 2, 4 and 6) or the polypeptides encoded by the cDNA(s) of the deposited clone(s).
  • Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequences shown in Figures l, 2 and 3 (SEQ ID No. 1, 3 and 5) or of the coding sequence of the deposited clones.
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptides.
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptides of the present invention.
  • the marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptides fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al . , Cell, 37:767 (1984)) .
  • the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides.
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptides encoded by the cDNA of Figure l, 2 and 3 (SEQ ID No. l, 3 and 5) or the deposited cDNAs.
  • the deposit( ⁇ ) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. ⁇ 112.
  • the sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein.
  • a license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
  • the present invention further relates to UCE 7, 8 and 9 polypeptides which have the deduced amino acid sequence of Figures l, 2 and 3 (SEQ ID No. 2, 4 and 6) or which has the amino acid sequence encoded by the deposited cDNAs, as well as fragments, analogs and derivatives of such polypeptide.
  • fragment when referring to the polypeptides of Figures 1, 2 and 3 (SEQ ID No. 2, 4 and 6) or that encoded by the deposited cDNA(s), means polypeptides which retain essentially the same biological function or activity as such polypeptides.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.
  • the fragment, derivative or analog of the polypeptides of Figures 1, 2 and 3 (SEQ ID No.
  • the deposited cDNA(s) may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) .
  • a conserved or non-conserved amino acid residue preferably a conserved amino acid residue
  • substituted amino acid residue may or may not be one encoded by the genetic code
  • one or more of the amino acid residues includes a substituent group
  • the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) .
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) .
  • a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
  • the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the UCE 7, 8 and 9 genes.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
  • the polynucleotides may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long as it is replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
  • the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • promoter for example, LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also contains a riboso e binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the polypeptide.
  • bacterial cells such as E. coli. Streptomyces, Salmonella typhimurium.
  • fungal cells such as yeast
  • insect cells such as Drosophila S2 and Spodoptera Sf9
  • animal cells such as CHO, COS or Bowes melanoma,- adenoviruses,- plant cells, etc.
  • the selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • a promoter operably linked to the sequence.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen) , pBS, pDiO, phagescript, psiXl74, pbluescript SK, pbsks, pNH8A, pNHi6a, pNHl ⁇ A, pNH46A (Stratagene) ; pTRC99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia) .
  • Eukaryotic pWLNEO, PSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3 , pBPV, pMSG, pSVL (Pharmacia) .
  • any other plasmid or vector may be used as long as they are replicable and viable in the host.
  • Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
  • Two appropriate vectors are pKK232-8 and pCM7.
  • Particular named bacterial promoters include lad, lacZ, T3 , T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidme kinase, early and late SV40, LTRs from retrovirus, and mouse metalloth ⁇ one ⁇ n-I . Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • the present invention relates to host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986) ) .
  • constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers .
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al. , Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
  • the heterologous structural sequence is assembled in appropriate phase with translation, initiation and termination sequences.
  • the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella tvphimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) .
  • cloning vector pBR322 ATCC 37017
  • Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEMi (Promega Biotec, Madison, WI, USA) .
  • pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
  • the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
  • Cells are typically harvested by centrifuga ion, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
  • mammalian cell culture systems can also be employed to express recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981) , and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
  • the UCE 7, 8 and 9 polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) .
  • a prokaryotic or eukaryotic host for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture
  • the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • Polypeptides of the invention may also include an initial methionine amino acid residue.
  • UCE 7, 8 and 9 polypeptides and agonists and antagonists which are polypeptides, described below, may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy" .
  • cells from a patient may b engineered with a polynucleotide (DNA or RNA) encoding polypeptide ex vivo, with the engineered cells then bein provided to a patient to be treated with the polypeptide.
  • DNA or RNA polynucleotide
  • Such methods are well-known in the art.
  • cell may be engineered by procedures known in the art by use of retroviral particle containing RNA encoding a polypeptide o the present invention.
  • cells may be engineered in vivo fo expression of a polypeptide in vivo by, for example, procedures known in the art.
  • a produce cell for producing a retroviral particle containing RN encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo an expression of the polypeptide in vivo.
  • the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
  • the UCE 7, 8 and 9 polypeptides may be employed to provide a signal for the lymphocyte homing receptor thereby regulating lymphocyte trafficking.
  • the growth hormone receptor also utilizes ubiquitin to signal ligands, and, therefore, the UCE 7, 8 and 9 polypeptides may be employed to regulate activation of the growth receptor.
  • UCE 7, 8 and 9 polypeptides may be employed to overcome many viral infections by overcoming the suppressed programmed cell death induced by these viruses, since programmed cell death may be one of the primary antiviral defense mechanisms of cells.
  • UCE 7, 8 and 9 polypeptides may also be employed to treat immuno-suppression related disorders, such as AIDS, by targeting virus infected cells for cell death.
  • UCE 7, 8 and 9 may also be employed to inhibit the cytotoxic properties of platelets and the production of oxygen metabolites by platelets. These polypeptides may also be employed to regulate immunological disorders in which platelets seem to be involved, for example, hymenoptera venom hypersensitivity and aspirin-sensitive asthma.
  • UCE 7, 8 and 9 may also be employed to treat malignant transformation because proto-oncoproteins c-Mos and v-Jun are degraded in a ubiquitin-dependent manner.
  • Fragments of the full length UCE genes may be used as a hybridization probe for a cDNA library to isolate the full length UCE genes and to isolate other genes which have a high sequence similarity to these genes or similar biological activity.
  • Probes of this type generally have at least 20 bases. Preferably, however, the probes have at least 30 bases and generally do not exceed 50 bases, although they may have a greater number of bases.
  • the probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete UCE gene including regulatory and promotor regions, exons, and introns.
  • An example of a screen comprises isolating the coding region of the UCE gene by using the known DNA sequence to synthesize an oligonucleotide probe.
  • Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
  • the present invention further provides a method of screening compounds to identify those which enhance (agonists) or block (antagonists) the activity of the UCE 7, 8 and 9 enzymes.
  • An example of such a method comprises combining reactants in the presence of UCE 7, 8 or 9 and a compound to be screened under conditions where ubiquitin is normally transferred to a protein substrate.
  • the reactants comprise [I 125 ]ubiquitin, ATP, and a protein substrate, for example, histones. Under normal conditions, ubiquitin would be transferred to the protein substrate and this transfer is catalyzed by the UCE 7, 8 or 9 enzymes.
  • the amount of labeled substrate i.e., substrate with labeled ubiquitin attached thereto, could then be measured to determine if the compound to be screened enhanced or blocked the catalysis of this reaction by UCE 7, 8 or 9.
  • UCE 7, 8 and 9 are produced and function intra- cellulary, therefore, any antagonists must be intra-cellular.
  • potential UCE 7, 8 or 9 antagonists include antibodies which are produced intra-cellularly.
  • an antibody identified as antagonizing UCE 7, 8 and 9 may be produced intra-cellularly as a single chain antibody by procedures known in the art, such as transforming the appropriate cells with DNA encoding the sigle chain antibody to prevent the function of UCE 7, 8 or 9.
  • Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide sequence which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix - see Lee et al., Nucl.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the UCE 7, 8 and 9 polypeptide (antisense - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotides as Antisense inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)).
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of UCE 7, 8 and 9.
  • Yet another potential antagonist includes a mutated form, or mutein, of UCE 7, 8 or 9 which recognizes substrate but does not catalyze ubiquitination and, therefore, acts to prevent UCE 7, 8 or 9 from functioning.
  • Potential antagonists also include small molecules which are able to pass through cell membranes and bind to the catalytic site of the polypeptide thereby making the catalytic site inaccessible to substrate such that normal biological activity is prevented.
  • the antagonists may be employed to treat a host of diseases in which UCE 7, 8 and 9 catalyze the transfer of ubiquitin to a substrate and marks that substrate for cell death.
  • UCE 7, 8 and 9 catalyze the transfer of ubiquitin to a substrate and marks that substrate for cell death.
  • An example is Alzheimer's disease, wherein the ubiquitin content is found to be significantly higher in tissue derived from patients with Alzheimer's disease than in normal tissue.
  • the antagonists may also be employed to treat atrophying skeletal muscle, since the atrophying of this muscle occurs due to these cells being marked for cell death with ubiquitin.
  • the antagonists may also be employed to treat a patient infected with the African swine fever virus which proliferates in the host and produces a conjugating enzyme to kill cells in a attempt to overtake the host's regulatory mechanisms. Accordingly, inhibiting UCE 7, 8 and 9 prevents the proliferation of the African swine fever virus.
  • the antagonists may also be employed to treat a blistering skin disease called endemic pemphigus foliaceus (EPF) which is also a type of autoimmune disorder, which is thought to degrade skin through the use of a ubiquitin conjugating enzyme.
  • EPF endemic pemphigus foliaceus
  • the antagonists may also be employed to treat certain malignant transformations, for example, Human papilloma virus (HPV) transformed cervical carcinoma which stimulates the ubiquitin-dependent degradation of p53, a tumor suppressor protein. Further, epidermal tumors in mice have been found to over-express ubiquitin genes.
  • HPV Human papilloma virus
  • the small molecule agonists and antagonists may be employed in combination with a suitable pharmaceutical carrier.
  • a suitable pharmaceutical carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • the formulation should suit the mode of adminis ration.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the pharmaceutical compositions may be employed in conjunction with other therapeutic compounds.
  • the pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes.
  • the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ⁇ g/ k g to about l mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
  • This invention is also related to the use of the UCE genes as a diagnostic. Detection of a mutated form of UCE 7,
  • Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki e ⁇ al . , Nature, 324:163-166 (1986)) prior to analysis.
  • RNA or cDNA may also be used for the same purpose.
  • PCR primers complementary to the nucleic acid encoding UCE 7, 8 or 9 can be used to identify and analyze mutations. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled UCE 7, 8 or 9 RNA or alternatively, radiolabeled UCE 7, 8 or 9 antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al . , Science, 230:1242 (1985) ) .
  • Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and Si protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)).
  • nuclease protection assays such as RNase and Si protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)).
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP) ) and Southern blotting of genomic DNA.
  • restriction enzymes e.g., Restriction Fragment Length Polymorphisms (RFLP)
  • mutations can also be detected by in si tu analysis.
  • the present invention also relates to a diagnostic assay for detecting altered levels of UCE 7, 8 or 9 protein in various tissues since an over-expression of the proteins compared to normal control tissue samples can detect the presence of tumors.
  • Assays used to detect levels of UCE 7, 8 or 9 protein in a sample derived from a host are well-known to those of skill in the art and include radioimmunoassays, competitive-binding assays, Western Blot analysis and preferably an ELISA assay.
  • An Elisa assay initially comprises preparing an antibody specific to the UCE 7, 8 or 9 antigen, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody.
  • a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme.
  • a sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein like BSA.
  • the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any UCE 7, 8 or 9 proteins attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer.
  • the reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to UCE 7, 8 or 9 protein. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of protein present in a given volume of patient sample when compared against a standard curve.
  • a competition assay may be employed wherein antibodies specific to UCE 7, 8 or 9 protein are attached to a solid support and labeled UCE 7, 8 or 9 and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity in the sample.
  • sequences of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner.
  • Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in si tu hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with cDNA as short as 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
  • FISH requires use of the clones from which the EST was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 is probably not necessary to get good results a reasonable percentage of the time.
  • Verma et al. Human Chromosomes : a Manual of Basic Techniques, Pergamon Press, New York (1988) .
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes l megabase mapping resolution and one gene per 20 kb) .
  • polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trio a technique, the human B-cell hybridoma technique (Kozbor et al., 1983, immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
  • Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures.
  • equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
  • “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
  • the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
  • For analytical purposes typically l ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
  • For the purpose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume.
  • buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer, incubation times of about l hour at 37"C are ordinarily used, but may vary in accordance with the supplier's instructions.
  • After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment, as described in Sambrook et al., Molecular Cloning: A laboratory Manual, Second Edition, Cold Spring Harbor, N.Y. (1989) .
  • Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980) .
  • Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated. “Ligation” refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T.
  • ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
  • ligase T4 DNA ligase
  • the forward oligonucleotide primer has the sequence 5' CCCGGATCCGCTTCGAAGAGAATCCACAAG 3' (SEQ ID No. 7) contains a Bam HI restriction enzyme site followed by 21 nucleotides of UCE 7 coding sequence starting from the presumed terminal amino acid of the processed protein codon.
  • the reverse primer 5' GCGCAAGCTTTTACATCGCATACTTCTGAGTCC 3' contains a Hind III site, a stop codon plus 20 nucleotides of UCE 7.
  • the restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA) .
  • pQE-9 encodes antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/O) , a ribosome binding site (RBS) , a 6-His tag and single restriction enzyme sites.
  • pQE-9 was then digested with Bam Hi and Hind III.
  • the amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding for the histidine tag and the RBS.
  • the ligation mixture was then used to transform E. coli strain ml5/pREP4 (Qiagen) by the procedure described in Sambrook, J. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) .
  • M15/pREP4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kan r ) .
  • Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected.
  • Plasmid DNA was isolated and confirmed by restriction analysis. Clones containing the desired constructs were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6. IPTG (“Isopropyl-B-D- thiogalacto pyranoside”) was then added to a final concentration of l mM. IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression.
  • O.D. 600 optical density 600
  • UCE 7 was eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hours the protein was dialyzed to 10 mmolar sodium phosphate.
  • the forward oligonucleotide primer has the sequence 5' CCCGGATCCGCGGCCAGCAGGAGGCTGATG 3' (SEQ ID No. 9) contains a Bam HI restriction enzyme site followed by 21 nucleotides of UCE 8 coding sequence starting from the presumed terminal amino acid of the processed protein codon.
  • the reverse primer 5' GCGCAAGCTTTTAGTCCACAGGTCG 3' contains a Hind III site, a stop codon plus 15 nucleotides of UCE 8 coding sequence.
  • the restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA) .
  • pQE-9 encodes antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/O) , a ribosome binding site (RBS) , a 6-His tag and single restriction enzyme sites.
  • pQE-9 was then digested with Bam Hi and Hind III.
  • the amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding for the histidine tag and the RBS.
  • the ligation mixture was then used to transform E. coli strain mi5/pREP4 (Qiagen) by the procedure described in Sambrook, J. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) .
  • Ml5/pREP4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kan') .
  • Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis.
  • Clones containing the desired constructs were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) .
  • the O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250.
  • the cells were grown to an optical density 600 (O.D. 601 ') of between 0.4 and 0.6.
  • IPTG Isopropyl-B-D- thiogalacto pyranoside
  • IPTG Isopropyl-B-D- thiogalacto pyranoside
  • IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression.
  • Cells were grown an extra 3 to 4 hours. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCl. S95/01250
  • solubilized UCE 8 was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)) .
  • UCE 8 was eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 molar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hours the protein was dialyzed to 10 mmolar sodium phosphate.
  • the DNA sequence encoding UCE 9, ATCC # 75878 is initially amplified using PCR oligonucleotide primers corresponding to the 5' sequences of the processed UCE 9 protein and the vector sequences 3' to the UCE 9 gene. Additional nucleotides corresponding to UCE 9 are added to the 5' and 3' end sequences respectively.
  • the forward oligonucleotide primer has the sequence 5' GCGCGGATCCACAGTCCAAGCACTAGGGC 3' (SEQ ID No. 11) contains a Bam HI restriction enzyme site followed by 19 nucleotides of UCE 9 coding sequence starting from the presumed terminal amino acid of the processed protein codon.
  • the reverse primer 5' GCGCAAGCTTCTATGTGGCGTACCGCTTGG 3' contains complementary sequences to a Hind III site and is followed by 20 nucleotides of UCE 9 including the translational stop codon.
  • the restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311) .
  • pQE-9 encodes antibiotic resistance (Amp') , a bacterial origin of replication (ori) , an IPTG- regulatable promoter operator (P/O) , a ribosome binding site (RBS) , a 6-His tag and restriction enzyme sites.
  • pQE-9 is then digested with Bam Hi and Hind III.
  • the amplified sequences are ligated into pQE-9 and are inserted in frame with the sequence encoding for the histidine tag and the RBS.
  • the ligation mixture is then used to transform E. coli strain ml5/pREP4 (Qiagen) by the procedure described in Sambrook, J. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) .
  • Ml5/pREP4 contains multiple copies of the plasmid pREP4, which expresses the lacl repressor and also confers kanamycin resistance (Kan r ) .
  • Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis.
  • Clones containing the desired constructs are grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) .
  • the O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250.
  • the cells are grown to an optical density 600 (O.D. 60 ") of between 0.4 and 0.6.
  • IPTG Isopropyl-B-D- thiogalacto pyranoside
  • IPTG Isopropyl-B-D- thiogalacto pyranoside
  • IPTG induces by inactivating the lacl repressor, clearing the P/O leading to increased gene expression.
  • Cells are grown an extra 3 to 4 hours. Cells are then harvested by centrifugation.
  • the cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl.
  • solubilized UCE 9 is purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)) .
  • UCE 9 is eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution JS95/01250
  • the protein is dialyzed to 10 mmolar sodium phosphate.
  • the DNA sequence encoding the full length UCE 7 protein, ATCC # 75877, is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
  • the forward primer has the sequence 5' GCGCGGATCCACCAT GGCTCTGAAGAGAATCC 3' (SEQ ID No. 13) and contains a Bam HI restriction enzyme site (in bold) followed by 3 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987) which is just behind the first 15 nucleotides of the UCE 7 gene (the initiation codon for translation "ATG" is underlined) .
  • the reverse primer has the sequence 5' GCGCTCTAGATTACA TCGCATACTTCTGAGTCC 3' (SEQ ID No. 14) and contains the cleavage site for the restriction endonuclease Xbal and 23 nucleotides complementary to the 3' translated sequence of the UCE 7 gene.
  • the amplified sequences are isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.). The fragment is then digested with the endonucleases Bam HI and Xbal and then purified again on a 1% agarose gel. This fragment is designated F2.
  • the vector pRGl (modification of pVL94i vector, discussed below) is used for the expression of the UCE 7 protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) .
  • This expression vector contains the strong polyhedrin promoter of the Autographa califomica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonucleases Bam HI and Xbal.
  • the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
  • the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of cotransfected wild-type viral DNA.
  • Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL94l and pAcIMl (Luckow, V.A. and Summers, M.D. , Virology, 170:31-39).
  • the plasmid is digested with the restriction enzymes Bam HI and Xbal and then dephosphorylated using calf intestinal phosphatase by procedures known in the art.
  • the DNA is then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) . This vector DNA is designated V2.
  • Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase.
  • E.coli DH5 ⁇ cells are then transformed and bacteria identified that contained the plasmid (pBac UCE7) with the UCE 7 gene using the enzymes Bam HI and Xbal. The sequence of the cloned fragment is confirmed by DNA sequencing.
  • the plate is rocke back and forth to mix the newly added solution.
  • the plate i then incubated for 5 hours at 27°C.
  • After 5 hours th transfection solution is removed from the plate and l ml o Grace's insect medium supplemented with 10% fetal calf seru is added.
  • the plate is put back into an incubator an cultivation continued at 27°C for four days.
  • plaque assay After four days the supernatant is collected and plaque assay performed similar as described by Summers an Smith (supra) . As a modification an agarose gel with "Blu Gal” (Life Technologies Inc., Gaithersburg) is used whic allows an easy isolation of blue stained plaques. ( detailed description of a "plaque assay” can also be found i the user's guide for insect cell culture and baculovirolog distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
  • the viruses are added to the cells and blue stained plaques are picked with the tip of an Eppendorf pipette.
  • the agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
  • the agar is removed by a brief centrifugation and the supernatant containing the recombinant baculoviruses is used to infect Sf9 cells seeded in 35 mm dishes.
  • the supernatants of these culture dishes are harvested and then stored at 4°c
  • Sf9 cells are grown in Grace's medium supplemented with 10% hea -inactivated FBS.
  • the cells are infected with the recombinant baculovirus V-UCE-7 at a multiplicity of infection (MOD of 2.
  • MOD multiplicity of infection
  • the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 ⁇ Ci of 35 S-methionine and 5 ⁇ Ci 35 S cysteine (Amersham) are added.
  • the cells are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
  • the DNA sequence encoding the full length UCE 8 protein, ATCC # 75876, is amplified using PCR oligonucleotide primers corresponding to the 5' and 3 ' sequences of the gene:
  • the forward primer has the sequence 5' GCGCGGATCCACCAT GGCGGCCAGCAGGAGGCT 3' (SEQ ID NO. 15) and contains a Bam HI restriction enzyme site (in bold) followed by 3 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M., J. Mol. Biol. , 196:947-950 (1987) and which is just behind the first 17 nucleotides of the UCE 8 gene (the initiation codon for translation "ATG" is underlined) .
  • the reverse primer has the sequence 5' GCGCTCTAGATTAGT CCACAGGTCG 3' (SEQ ID No. 16) and contains the cleavage site for the restriction endonuclease Xbal and 15 nucleotides complementary to the 3' translated sequence of the UCE 8 gene.
  • the amplified sequences are isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) .
  • the fragment is then digested with the endonucleases Bam HI and Xbal and then purified again on a 1% agarose gel. This fragment is designated F2.
  • the vector pRGl (modification of pVL94l vector, discussed below) is used for the expression of the UCE 8 protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) .
  • This expression vector contains the strong polyhedrin promoter of the Autographa califomica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonucleases Bam HI, Smal, Xbal, Bglll and Asp7l8.
  • the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
  • the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of cotransfected wild-type viral DNA.
  • Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL94l and pAcIMl (Luckow, V.A. and Summers, M.D. , Virology, 170:31-39).
  • the plasmid is digested with the restriction enzymes Bam HI and Xbal and then dephosphorylated using calf intestinal phosphatase by procedures known in the art.
  • the DNA is then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated V2.
  • Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase.
  • E.coli HB101 cells are then transformed and bacteria identified that contained the plasmid (pBac UCE 8) with the UCE 8 gene using the enzymes Bam HI and Xbal. The sequence of the cloned fragment is confirmed by DNA sequencing.
  • the plate is rocked back and forth to mix the newly added solution.
  • the plate is then incubated for 5 hours at 27°C.
  • the transfection solution is removed from the plate and l ml of Grace's insect medium supplemented with 10% fetal calf serum is added.
  • the plate is put back into an incubator and cultivation continued at 27°C for four days.
  • plaque assay After four days the supernatant is collected and a plaque assay performed similar as described by Summers and Smith (supra) . As a modification an agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) is used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay” can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
  • the viruses are added to the cells and blue stained plaques are picked with the tip of an Eppendorf pipette.
  • the agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
  • the agar is removed by a brief centrifugation and the supernatant containing the recombinant baculoviruses is used to infect Sf9 cells seeded in 35 mm dishes.
  • the supernatants of these culture dishes are harvested and then stored at 4°C.
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells are infected with the recombinant baculovirus V-UCE 8 at a multiplicity of infection (MOD of 2.
  • MOD multiplicity of infection
  • the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 ⁇ Ci of 35 S-methionine and 5 ⁇ Ci 35 S cysteine (Amersham) are added.
  • the cells are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
  • the DNA sequence encoding the full length UCE 9 protein, ATCC # 75878, is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
  • the forward primer has the sequence 5' GATCGGATCCACCAT GACAGTCCAAGCACTAG 3' (SEQ ID No. 17) and contains a Bam HI restriction enzyme site (in bold) followed by 3 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M. , J. Mol. Biol., 196:947-950 (1987) and just behind the first 15 nucleotides of the UCE 9 gene (the initiation codon for translation "ATG" is underlined) .
  • the reverse primer has the sequence 5' GCGCTCTAGACTATG TGGCGTACCGCTTGG 3' (SEQ ID No. 18) and contains the cleavage site for the restriction endonuclease Xbal and 20 nucleotides complementary to the 3' translated sequence of the UCE 9 gene.
  • the amplified sequences are isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc. , La Jolla, Ca.) .
  • the fragment is then digested with the endonucleases Bam HI and Xbal and then purified again on a 1% agarose gel. This fragment is designated F2.
  • the vector pRGl (modification of pVL94i vector, discussed below) is used for the expression of the UCE 9 protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) .
  • This expression vector contains the strong polyhedrin promoter of the Autographa califomica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonucleases Bam HI and Xbal.
  • the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
  • the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of cotransfected wild-type viral DNA.
  • Many other baculovirus vectors could be used in place of pRGi such as pAc373, pVL94i and pAclMi (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
  • the plasmid is digested with the restriction enzymes Bam HI and Xbal and then dephosphorylated using calf intestinal phosphatase by procedures known in the art.
  • the DNA is then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) . This vector DNA is designated V2.
  • Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase.
  • E.coli DH5 ⁇ cells are then transformed and bacteria identified that contained the plasmid (pBac UCE9 ) with the UCE 9 gene using the enzymes Bam HI and Xbal. The sequence of the cloned fragment is confirmed by DNA sequencing.
  • the plate is rocke back and forth to mix the newly added solution.
  • the plate i then incubated for 5 hours at 27°c.
  • After 5 hours th transfection solution is removed from the plate and l ml o Grace's insect medium supplemented with 10% fetal calf seru is added.
  • the plate is put back into an incubator an cultivation continued at 27°C for four days.
  • plaque assay After four days the supernatant is collected and plaque assay performed similar as described by Summers an Smith (supra) . As a modification an agarose gel with "Blu Gal” (Life Technologies Inc., Gaithersburg) is used whic allows an easy isolation of blue stained plaques. ( detailed description of a "plaque assay” can also be found i the user's guide for insect cell culture and baculovirolog distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
  • the viruses are added to the cells and blue stained plaques are picked wit the tip of an Eppendorf pipette.
  • the agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
  • the agar is removed by a brief centrifugation and the supernatant containing the recombinant baculoviruses is used to infect Sf9 cells seeded in 35 mm dishes.
  • the supernatants of these culture dishes are harvested and then stored at 4°C.
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells are infected with the recombinant baculovirus V-UCE 9 at a multiplicity of infection (MOD of 2.
  • MOD multiplicity of infection
  • the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 ⁇ Ci of 35 S-methionine and 5 ⁇ Ci 35 S cysteine (Amersham) are added.
  • the cells are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
  • UCE 7 HA The expression of plasmid, UCE 7 HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site.
  • a DNA fragment encoding the entire UCE 7 gene and an HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter.
  • the HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R.
  • HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is described as follows:
  • the DNA sequence encoding UCE 7, ATCC # 75877, is constructed by PCR using two primers: the 5' primer 5' GCGCGGATCCACCATGGCTCTGAAGAGAATCC 3' (SEQ ID No. 19) has a Bam HI site followed by 15 nucleotides of UCE 7 coding sequence starting from the initiation codon.
  • the reverse primer 5' GCGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTACATCGCATACTTCTGAG3' contains complementary sequences to an Xbal site, translation stop codon, HA tag and the last 17 nucleotides of the UCE 7 coding sequence (not including the stop codon) .
  • the PCR product contains a Bam HI site, UCE 7 coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xbal site.
  • the PCR amplified DNA fragment an the vector, pcDNAI/Amp are digested with Bam HI and Xba restriction enzyme and ligated.
  • the ligation mixture i transformed into E. coli strain SURE (Stratagene Clonin Systems, La Jolla, CA) the transformed culture is plated o ampicillin media plates and resistant colonies are selected Plasmid DNA is isolated from transformants and examined b restriction analysis for the presence of the correc fragment.
  • UCE 7 For expression of the recombinant UCE 7, COS cell are transfected with the expression vector by DEAE-DEXTRA method (J. Sambrook, E. Fritsch, T. Maniatis, Molecula Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) ) .
  • the expression of the UCE 7-HA protein is detecte by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbo Laboratory Press, (1988)) . Cells are labelled for 8 hour with 35 S-cysteine two days post transfection.
  • Culture medi is then collected and cells are lysed with detergent (RIP buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)) . Both cell lysate and culture media are precipitated with a H specific monoclonal antibody. Proteins precipitated are analyzed on 15% SDS-PAGE gels.
  • RIP buffer 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5
  • UCE 8-HA The expression of plasmid, UCE 8-HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: l) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site.
  • a DNA fragment encoding the entire UCE 8 precursor and a HA tag fused in frame to its 3 ' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter.
  • the HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R.
  • HA tag to our target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is described as follows:
  • the DNA sequence encoding UCE 8, ATCC # 75876, is constructed by PCR using two primers: the 5' primer 5' GCGCGGATCCACCATGGCGGCCAGCAGGAGGC 3' (SEQ ID No. 21) and contains a Bam HI site followed by 3 nucleotides resembling a Kozak sequence plus 19 nucleotides of UCE 8 coding sequence starting from the initiation codon; the 3' sequence 5' GCGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTAGTCCACAGGTCG 3' (SEQ ID No.
  • the PCR product 22 contains complementary sequences to an Xbal site, translation stop codon, HA tag and the last 12 nucleotides of the UCE 8 coding sequence (not including the stop codon) . Therefore, the PCR product contains a Bam HI site, UCE-8 coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xbal site.
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp are digested with Bam HI and Xbal restriction enzyme and ligated. The ligation mixture is transformed into E.
  • UCE 8-HA protein is detected by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbo Laboratory Press, (1988)).
  • Cells are labelled for 8 hour with 35 S-cysteine two days post transfection. Culture medi are then collected and cells are lysed with detergent (RIP buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC 50mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)) Both cell lysate and culture media are precipitated with a H specific monoclonal antibody. Proteins precipitated ar analyzed on 15% SDS-PAGE gels.
  • RIP buffer 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC 50mM Tris, pH 7.5
  • plasmid, pUCE 9-HA is derived from vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin o replication, 2) ampicillin resistance gene, 3) E.col replication origin, 4) CMV promoter followed by a polylinke region, a SV40 intron and polyadenylation site.
  • a DN fragment encoding the entire UCE 9 protein and a HA tag fuse in frame to its 3' end is cloned into the polylinker regio of the vector, therefore, the recombinant protein expressio is directed under the CMV promoter.
  • the HA tag correspond t an epitope derived from the influenza hemagglutinin protei as previously described (I. Wilson, H.
  • HA tag to our target protein allows eas detection of the recombinant protein with an antibody tha recognizes the HA epitope.
  • the plasmid construction strategy is described a follows:
  • the 5' primer 5' GATCGGATCCACCATGACAGTCCAAGCACTAG 3' (SEQ ID No. 23) contain a Bam HI site followed by 3 nucleotides resembling a Koza sequence plus 19 nucleotides of UCE 9 coding sequenc starting from the initiation codon,- the 3' sequence 5' GCGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTATGTGGCGTACCGCTTGG3' (SEQ ID No.
  • the PCR product contains complementary sequences to an Xbal site, translation stop codon, HA tag and the last 17 nucleotides of the UCE 9 coding sequence (not including the stop codon) . Therefore, the PCR product contains a Bam HI site, UCE 9 coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xbal site.
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp are digested with Bam HI and Xbal restriction enzyme and ligated. The ligation mixture is transformed into E.
  • UCE 9 coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture is plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the correct fragment.
  • COS cells are transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) ) .
  • the expression of the UCE 9-HA protein is detected by radiolabelling and immunoprecipitation method (E. Harlow, D.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • CTCTTCAAAC CACCTAAGGT TGCATTTACA ACAAGAATTT ATCATCCAAA TATTAACAGT 240
  • Gin Ser Leu lie Ala Leu Val Asn Asp Pro Gin Pro Glu His Pro
  • ACCTTTTCAC CAGACTATCC GTTTAAACCC CCTAAGGTTA CCTTCCGAAC AAGATTTTTT 360
  • Lys Lys Lys Lys Glu Gly Lys lie Ser Ser Lys Thr Ala Ala Lys Leu
  • MOLECULE TYPE Oligonucleotide
  • MOLECULE TYPE Oligonucleotide
  • MOLECULE TYPE Oligonucleotide

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Neurology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Neurosurgery (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Oncology (AREA)
  • Pain & Pain Management (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Communicable Diseases (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention a pour objet des polypeptides UCE 7, UCE 8 et UCE 9 humains et de l'ADN (ARN) codant ces polypeptides. L'invention concerne également une procédure pour produire ces polypeptides par des techniques de recombinaison. L'invention traite aussi de procédés d'utilisation de ces polypeptides pour le traitement de la prolifération de cellules malignes. Des antagonistes de ces polypeptides et leurs utilisations comme produits thérapeutiques pour traiter la maladie d'Alzheimer, l'atrophie du muscle squelettique, le virus de la peste porcine africaine et la mort cellulaire apoptotique sont également décrits. En outre, l'invention traite de dosages diagnostiques pour détecter les maladies liées aux mutations dans les séquences d'acides nucléiques d'UCE 7, 8 et 9 et la concentration de polypeptides codés par ces séquences.
PCT/US1995/001250 1995-01-31 1995-01-31 Enzymes 7, 8 et 9 de conjugaison d'ubiquitine WO1996023410A1 (fr)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU18690/95A AU1869095A (en) 1995-01-31 1995-01-31 Ubiquitin conjugating enzymes 7, 8 and 9
JP8523484A JPH11501802A (ja) 1995-01-31 1995-01-31 ユビキチン結合酵素７、８および９
PCT/US1995/001250 WO1996023410A1 (fr) 1995-01-31 1995-01-31 Enzymes 7, 8 et 9 de conjugaison d'ubiquitine
EP95910898A EP0814661A4 (fr) 1995-01-31 1995-01-31 Enzymes 7, 8 et 9 de conjugaison d'ubiquitine
US08/875,272 US5945321A (en) 1995-01-31 1995-01-31 Ubiquitin conjugating enzymes 7, 8 and 9
US08/903,396 US5968797A (en) 1995-01-31 1997-07-22 Ubiquitin conjugating enzymes 8 and 9

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1995/001250 WO1996023410A1 (fr) 1995-01-31 1995-01-31 Enzymes 7, 8 et 9 de conjugaison d'ubiquitine

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US08/464,342 Continuation-In-Part US5650313A (en) 1995-01-31 1995-06-05 Ubiquitin conjugating enzymes 8 and 9

Publications (1)

Publication Number Publication Date
WO1996023410A1 true WO1996023410A1 (fr) 1996-08-08

Family

ID=22248591

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1995/001250 WO1996023410A1 (fr) 1995-01-31 1995-01-31 Enzymes 7, 8 et 9 de conjugaison d'ubiquitine

Country Status (4)

Country Link
EP (1) EP0814661A4 (fr)
JP (1) JPH11501802A (fr)
AU (1) AU1869095A (fr)
WO (1) WO1996023410A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998021318A1 (fr) * 1996-11-13 1998-05-22 Incyte Pharmaceuticals, Inc. Enzyme conjuguant une ubiquitine telle que ubch7
WO1999009171A1 (fr) * 1997-08-21 1999-02-25 Incyte Pharmaceuticals, Inc. Enzyme de conjugaison de l'ubiquitine ressemblant a ubc7
WO1999031252A1 (fr) * 1997-12-12 1999-06-24 Incyte Pharmaceuticals, Inc. Proteine de conjugaison du type ubiquitine
WO1999050421A1 (fr) * 1998-03-27 1999-10-07 University Of Leeds Enzyme conjuguant l'ubiquitine
US5976837A (en) * 1997-03-14 1999-11-02 Genetics Institute, Inc. Secreted proteins and polynucleotides encoding them

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5384255A (en) * 1993-06-21 1995-01-24 Rappaport Family Institute For Research In The Medical Sciences Ubiquitin carrier enzyme E2-F1, purification, production, and use

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2179537A1 (fr) * 1994-01-04 1995-07-13 Giulio Draetta Enzymes conjuguant l'ubiquitine

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5384255A (en) * 1993-06-21 1995-01-24 Rappaport Family Institute For Research In The Medical Sciences Ubiquitin carrier enzyme E2-F1, purification, production, and use

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BIOCHEMICAL JOURNAL, Volume 305, Part 1, issued 01 January 1995, S.S. WING et al., "Molecular Cloning, Expression and Characterization of a Ubiquitin Conjugation Enzyme (E2-17kB) Highly Expressed in Rat Testis", pages 125-132. *
See also references of EP0814661A4 *
THE EMBO JOURNAL, Volume 11, Number 1, issued 1992, M. TREIER et al., "Drosophila UbcD1 Encodes a Highly Conserved Ubiquitin-Conjugating Enzyme Involved in Selective Protein Degradation", pages 367-372. *
TRENDS IN BIOCHEMICAL SCIENCES (TIBS), Volume 15, issued May 1990, S. JENTSCH et al., "Ubiquitin-Conjugating Enzymes: Novel Regulators of Eukaryotic Cells", pages 195-198. *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998021318A1 (fr) * 1996-11-13 1998-05-22 Incyte Pharmaceuticals, Inc. Enzyme conjuguant une ubiquitine telle que ubch7
US5976837A (en) * 1997-03-14 1999-11-02 Genetics Institute, Inc. Secreted proteins and polynucleotides encoding them
WO1999009171A1 (fr) * 1997-08-21 1999-02-25 Incyte Pharmaceuticals, Inc. Enzyme de conjugaison de l'ubiquitine ressemblant a ubc7
WO1999031252A1 (fr) * 1997-12-12 1999-06-24 Incyte Pharmaceuticals, Inc. Proteine de conjugaison du type ubiquitine
WO1999050421A1 (fr) * 1998-03-27 1999-10-07 University Of Leeds Enzyme conjuguant l'ubiquitine

Also Published As

Publication number Publication date
EP0814661A4 (fr) 2004-08-11
AU1869095A (en) 1996-08-21
JPH11501802A (ja) 1999-02-16
EP0814661A1 (fr) 1998-01-07

Similar Documents

Publication Publication Date Title
AU708972B2 (en) Tumor necrosis factor-gamma
US7482326B2 (en) Endothelial-monocyte activating polypeptide III
EP0815115B1 (fr) Facteur-2 de croissance des keratinocytes
US20080227110A1 (en) Human Genes, Sequences and Expression Products
US5650313A (en) Ubiquitin conjugating enzymes 8 and 9
US5849286A (en) Ubiquitin conjugating enzymes 7,8 and 9
EP0814661A1 (fr) Enzymes 7, 8 et 9 de conjugaison d'ubiquitine
US6319700B1 (en) Human choline acetyltransferase
US20030073159A1 (en) Human inhibitor of apoptosis gene 1
US6537539B2 (en) Immune cell cytokine
US5945321A (en) Ubiquitin conjugating enzymes 7, 8 and 9
WO1996021736A1 (fr) Geranylgeranyle pyrophosphate synthetase humaine
US5859200A (en) Human amine transporter
US5798223A (en) Polynucleotides encoding human amine transporter and methods of using the same
US20020119487A1 (en) Human stem cell antigen 2
AU753987B2 (en) Keratinocyte growth factor-2
EP0797592A1 (fr) Stanniocalcine-alpha humaine
WO1996027009A1 (fr) Transporteur d'amine humaine
EP0815199A1 (fr) Desoxycytidine kinase 2 humaine
EP1284292A2 (fr) Gène de translocation 3 de cellules B humaines
WO1996040719A1 (fr) Polypeptide de type iii activateur des monocytes et des cellules endotheliales
CA2430223A1 (fr) Facteur-2 de croissance des keratinocytes
JP2002281973A (ja) ユビキチン結合酵素７、８および９

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA CN JP KR MX NZ US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref country code: JP

Ref document number: 1996 523484

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1995910898

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 08875272

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1995910898

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1995910898

Country of ref document: EP