Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/10—Transferases (2.)
  • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
  • C12N9/1294—Phosphotransferases with paired acceptors (2.7.9)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
  • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
  • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance

Definitions

• Polypeptide having cold-tolerant pyruvate phosphate dikinase activity DNA encoding the same, and recombinant vectors and transformed plants containing the DNA
• the present invention relates to a polypeptide having a novel cold-tolerant pyruvate phosphate dikinase (hereinafter sometimes referred to as “PPDK”) activity as a means for imparting cold-tolerance to plants, and a clone encoding the same.
• PPDK pyruvate phosphate dikinase
• the present invention relates to a DNA and a recombinant vector containing the DNA. Furthermore, the present invention relates to a plant transformed with the DNA of the present invention.
• PPDK (EC 2.7.9.1, which catalyzes the reaction of ATP, pyruvate and orthophosphate to generate AMP, phosphophenolpyruvate and pyrophosphate) is one of the key enzymes in the pathway but its activity in leaf tissue It is not enough compared to the rate of photosynthesis, and is one of the enzymes that regulates carbon fixation in photosynthesis. It was pointed out at the same time that PPDK was a cold-sensitive enzyme.
• PPDK In the case of corn PPDK, there is an inflection point of the enzyme activity at 11.7 ° C, which is consistent with the critical temperature for corn growth. From these facts, it is thought that P PDK is one of the factors that lowers the photosynthetic rate of C 4 plants at low temperatures.By improving the low-temperature sensitivity of P PDK, P PDK lowers the growth limit temperature of C 4 plants, maize. May be able to reduce it.
• Flaveria browniij Flaveria browniij reticulata
• C A is classified as intermediate type, and its PDK is known to be hardly inactivated even at 0 ° C low temperature treatment (Burnell JN: A comparative study of The cold-sensitivity of pyruvate, Pi dikinase in Flaveria species. Plant Cell Physiol. 31, 295-297 (1990)).
• an object of the present invention is to provide a novel cold-tolerant polypeptide having PPDK activity, a cloned DNA encoding the same, and a recombinant vector containing the DNA, as a means for imparting cold-resistance to plants.
• the purpose is to provide a doctor.
• Still another object of the present invention is to provide a plant transformed with the DNA of the present invention.
• the present inventors have succeeded in cloning the complete P PDK gene of Flavelia bronyii and determining its nucleotide sequence and the amino acid sequence encoded thereby. Among them, the inventors succeeded in identifying a region imparting low-temperature resistance, and completed the present invention.
• the present invention relates to any one of the following (1) and (2), wherein at least one or more amino acid residues in the range from the C-terminus of the amino acid sequence to one sixth of the entire length are replaced with other amino acid residues.
• a polypeptide having a substituted amino acid sequence and having a low-temperature-resistant pyruvate phosphate dikinase activity is provided.
• the present invention also provides a cloned DNA encoding a polypeptide having the cold-resistant PPDK activity of the present invention. Further, the present invention provides a recombinant vector comprising the DNA of the present invention and capable of expressing a polypeptide having a cold-resistant PPDK in a host. Further, the present invention provides a plant transformed with the DNA of the present invention.
• a PDKK gene having low temperature resistance was cloned and its base sequence was determined.
• the region conferring low-temperature tolerance in the gene was determined. Therefore, by transforming a plant having a cold-sensitive PPDK with the gene of the present invention, the cold-sensitive PPDK can be changed to cold-tolerant.
• the low-temperature-sensitive PPDK can be changed to low-temperature-resistance by incorporating the low-temperature-resistant region into the homologous portion of the low-temperature-sensitive PPDK. As a result, Since then, it is possible to grow the plant even in cold regions where the plant could not be grown. Therefore, the present invention is expected to greatly contribute to agriculture.
• FIG. 1 is a schematic diagram showing a method for constructing an expression vector containing one example of the PPDK gene of the present invention.
• FIG. 2 is a diagram showing the time course of the enzyme activity when P.sup.PPDK of Flavelaria 'Brownii, Flavelaria' Paidentis and maize expressed in E. coli was maintained at 0 ° C.
• FIG. 3 is a schematic diagram showing a method for constructing a chimeric gene of corn PPDK and Flavelonia brawnii PPDK.
• the P. plavens of Flavelonia brawnii which has low temperature resistance, was cloned, and its nucleotide sequence and the predicted amino acid sequence encoded thereby were determined.
• the nucleotide sequence and the amino acid sequence are shown in SEQ ID NO: 5 in the sequence listing.
• this sequence is obtained by extracting total RNA from green leaves of Flavelaria 'Brownii, preparing a cDNA library based on a conventional method, and obtaining Flaveleria bidentis (SEQ ID NO: 1) Plaque hybridization using a region with high homology to the nucleotide sequence (SEQ ID NO: 2) of the maize PPDK gene (SEQ ID NO: 2) to select and clone a positive clone and determine the nucleotide sequence by the dideoxy method Determined by The second sequence has high homology to the PPDK gene of the genus Flavelaria 'Bidentis, has relatively high homology to the PPDK of maize, and is further purified directly from the leaves of Flavelaria' Since it completely matches the N-terminal sequence, C-terminal sequence and internal sequence of the PPDK, it is clear that the gene is a PPDK gene of Flavier-Brownii.
• the P PDK gene sequence of Flavelia's bidentis was determined by plaque hybridization using maize cDNA as a probe, selecting and cloning positive clones, and determining the dideoxy method.
• the amino acid sequence shown in SEQ ID NO: 5 is novel and differs by 40 amino acid residues from the amino acid sequence of PPDK of the genus Flavelia pydentis. I have. In addition, about 180 amino acid residues differ from the amino acid sequence of maize PPDK.
• the amino acid sequence of Flaveria brawnii PP DK shown in SEQ ID NO: 5 thus has high homology especially to the amino acid sequence of Flaveria 'Bidentis PPDK' of the same genus, but Flaveria 'Bidentis PP DK is cold sensitive. In contrast, the Flavelaria 'Brownii PPDK is cold-tolerant and slight amino acid sequence differences result in important trait differences.
• the present invention provides a cloned PPDK gene encoding the amino acid sequence shown in SEQ ID NO: 5. As described above, this amino acid sequence is novel and has a remarkable effect of having low temperature resistance.
• the gene of the present invention is not limited to having the nucleotide sequence shown in SEQ ID NO: 5, but may have any nucleotide sequence as long as it encodes this amino acid sequence. .
• the inventors of the present application also attempted to identify a region involved in imparting low-temperature resistance in the Flavella brawnii PPDK gene represented by SEQ ID NO: 5.
• the PPDK gene of Flavelaria bronchii was divided into three parts with restriction enzymes so that the size would be approximately equal, and the divided regions corresponded to those of the maize PPDK gene.
• the quinola PPDK gene was formed in exchange for the region, and it was examined whether the PPDK encoded by the chimeric gene has low temperature resistance. As a result, it was confirmed that there was a region imparting low-temperature resistance in the last one-third of the region of Flaveria 'Brownii.
• the last one-third of the region was roughly equally divided into two by restriction enzymes, and it was confirmed in a similar manner which of the two regions had a region imparting low-temperature resistance.
• the amino acid sequence shown in SEQ ID NO: 5 was downstream of the XhoI site of the Flavelaria 'Brownii PPDK gene, ie, the amino acid sequence shown in SEQ ID NO: 5; It has been confirmed that the amino acid sequence up to (hereinafter, this sequence may be referred to as a “cold-resistance conferring sequence”) has a function of conferring low-temperature resistance.
• SEQ ID NO: 1 in the sequence listing contains the nucleotide sequence and the deduced amino acid sequence of the gene encoding the PPDK of Flavelaria dentis.
• SEQ ID NO: 2 shows the nucleotide sequence and predicted amino acid sequence of a gene encoding corn PPDK (Journal of Biochemistry 263, 11080-11083 (1988)).
• SEQ ID NO: 3 shows that the pacteria Pacteroides symbiosus
• SEQ ID NO: 4 shows the nucleotide sequence and deduced amino acid sequence of the gene encoding PPDK of Entamoeba histolytica, which is a pacteria
• low-temperature resistance means that when the enzyme is left at a temperature of 0 ° C. for 20 minutes, its activity is 60% or more of that before leaving.
• the region from arginine at position 832 to valine at position 955 defines low-temperature tolerance.
• the method for imparting low-temperature resistance to PPDK is limited to the method for producing a quinola gene by exchanging the low-temperature-resistance-imparting sequence in Flavier-Brownii PPDK with the corresponding part of low-temperature-sensitive PPDK, as in the following example.
• the corresponding part of the plant's own cold-sensitive PPDK can be modified by site-directed mutagenesis to have the same sequence as the cold-resistance-conferring sequence of Flavelia'Brownii PPDK. It is.
• any cloned DNA encoding the polypeptide having the above-mentioned low-temperature tolerance imparting sequence and having PPDK activity is included in the scope of the present invention.
• proline was substituted for position 869 of the amino acid sequence shown in SEQ ID NO: 1.
• the PPDK that imparts low-temperature resistance is not limited to those shown in Sequence Listings 1 to 4, but may be any as long as it has a homology of 50% or more to each. Preferably, it should be homologous to the nucleotide sequence of Pflavin 'Brownie's PDK, and should be at least 48.5%, more preferably at least 90%.
• amino acid sequence of a peptide having a physiological activity is slightly changed, that is, one or more amino acids in the amino acid sequence are substituted or deleted, or one or more amino acids are substituted. It is a well-known fact that even when added, the physiological activity of the peptide may be maintained. Therefore, a polypeptide having the amino acid sequence represented by SEQ ID NO: 5 with such a modification and having low-temperature-resistant PDK activity is also included in the scope of the present invention. That is, in the amino acid sequence represented by SEQ ID NO: 5, one or more amino acids are activated! ], Polypeptides that have been deleted or substituted and have cold-tolerant PPDK activity are also included within the scope of the present invention.
• a DNA encoding a polypeptide having one or more nucleotides added, deleted or substituted in the base sequence represented by SEQ ID NO: 5 and having low-temperature-resistant PPDK activity is also included in the present invention. Included in the range.
• DNA that results in the addition, deletion or substitution of amino acids can be performed by, for example, well-known techniques of site-directed mutagenesis (eg, Nucleic Acid Research, Vol. 10, No. 20, p6487-6500, 1982).
• site-directed mutagenesis eg, Nucleic Acid Research, Vol. 10, No. 20, p6487-6500, 1982.
• one or more amino acids refers to a number of amino acids that can be added, deleted or substituted by site-directed mutagenesis.
• Site-directed mutagenesis can be performed, for example, as follows using a synthetic oligonucleotide primer complementary to the single-stranded phage DNA to be mutated, except for the specific mismatch that is the desired mutation. That is, a strand complementary to a phage is synthesized using the above-mentioned synthetic oligonucleotide as a primer, and a phage-carrying host bacterium is transformed with the obtained double-stranded DNA. Plate the transformed bacterial culture on agar and form plaques from single cells containing the phage. You. Then, theoretically, 50% of the new colonies contain the phage with the mutation as a single chain, and the remaining 50% have the original sequence.
• the resulting plaque is hybridized with the DNA completely having the above-mentioned desired mutation at a temperature at which the DNA does not hybridize with the DNA having the original mutation, but does not hybridize with the DNA having the original mutation. Allows hybridization to occur with the synthetic probe that has been treated with the enzyme. Next, a plaque forming a hybrid with the probe is picked up, cultured, and the DNA is recovered.
• One or more amino acid substitutions, deletions or insertions in the amino acid sequence of the enzyme that do not cause loss of the enzyme activity may be performed by treating the gene with a mutagen in addition to the site-directed mutagenesis described above.
• the gene may be selectively cleaved, and then the selected nucleotides may be removed, added, or substituted, and then ligated.
• a low-temperature-tolerant plant can be produced by transforming a plant with the Pflank'Brownii PDK gene or a DNA having the PDK activity and containing the sequence for imparting low-temperature tolerance.
• the transformed plant include corn, sugarcane, millet, hee and sorghum, but are not limited thereto.
• a method for transforming a plant has already been established, and a method using agrobacterium can be preferably employed. Transformation methods of plants using Agrobacterium medfaciens are well known in the art, and thus, dicotyledonous plants (for example, Japanese Patent Application Laid-Open No. Hei 4-330324) and monocotyledonous plants ( 10 94 00977). Alternatively, it can be introduced into a plant protoplast by a conventional method such as electroporation, or it can be transformed by attaching DNA to tungsten particles or the like and driving it into a plant embryo. is there. Specific methods for these transformations are described in the Examples below.
• RNA was isolated from the leaves of F. brownii (60s) by the guanidine hydrochloride / phenol method. This method yielded 26.5 mg of RNA after lithium precipitation.
• 118.9 polyA ( + ) RNA was obtained from 13.2 mg of RNA according to a conventional method.
• the packaging reagents attached to the TimeSaver cDNA Synthesis Kit (Pharmacia), Lambda ZAP11 vector (Stratagene) and cDNA cloning system AgtlO (Amersham) were used.
• a cDNA library was prepared in which the DNA fragment was inserted into the EcoRI site of the Lambda ZAPII vector.
• the size of the prepared cDNA live tally was 4150,000 pfu.
• XU-Blue was used as a host cell.
• Primer 5 near the processing site: GACGGCTAAAAAGAGGGT (designed based on high homology between cDNA of Flavoria and Bidentis PPDK and cDNA of maize PPDK) and R primer—R: TATCGAGAAACCTTCTATAC (Flaveria' Bidentis PCR II vector (commercially available from Invitrogen), which has a fragment amplified from L brownii RNA by reverse transcription PCR using a part of the PPDK sequence (complementary strand), and amplifies the fragment by PCR using the same primer. After electrophoresis, DNA was recovered from the gel by SUPREC-01 (Takara Shuzo).
• a 428 bp DNA fragment starting from 24 bp downstream of the N-terminus of the mature protein can be obtained.
• This fragment was labeled with 32 P using a Multiprime DNA labeling system (Amersham) to prepare a probe.
• the cDNA library was screened by a plaque hybridization method.
• Hybond N + (Amersham) was used as a hybridization filter, and hybridization conditions were 65 in 6xSSC, 5x Denhardt's solution, 0.1DSSDS, 100 g ml denatured salmon testis DNA. C overnight.
• the washing conditions were 2xSSC, 0.13 ⁇ 4SDS for 5 minutes at room temperature, 2xSSC, 0.13 ⁇ 4SDS for 90 minutes at room temperature, and lxSSC, 0.13 ⁇ 4SDS for 68 minutes at 68 ° C. This resulted in 28 independent positive PT / JP95 / 01040
• the library prepared as described above was a library suitable for cDNA screening including a sufficiently long insert. Therefore, it is advantageous to apply the present method to isolation of mRNA from Flavelonia broni, and to obtain a large amount of mRNA at once by treating a large amount of RNA as in this case.
• the full-length can be obtained by preparing a probe using a primer near the processing site of the target protein as described above. It was possible to easily screen cDNA.
• Deletion mutants were prepared to determine the entire base sequence of the inserted cDNA fragment of P631. 0 Deletion mutants were prepared using the Deletion Kit for Kilo-Sequence.
• PPDK was directly purified from Flaveria 'Brownii, and the amino acid sequences of its N-terminal region, C-terminal region and internal region were determined. Purification of PPDK was performed as follows. Grind the green leaves of Flavelia brawnii using 3 volumes of Extraction Buffer ⁇ Centrifuge the supernatant after 30% saturation with ammonium sulfate to remove the protein that precipitates-and recover the protein with 70% saturated ammonium sulfate, and use Sephadex G25 (Pharmacia).
• ⁇ pass through a DEAE-Sepharose column (Pharmacia)-elute proteins adsorbed on the column with a 50-400 mM KC1 concentration gradient-collect active fractions and 70% saturation Concentrate with ammonium sulfate and desalting with Sephadex G25. Apply to a hydroxyapatite column. ⁇ Raise the concentration of phosphate in the phosphate buffer from 10 mM to 40 mM to elute the adsorbed protein. ⁇ Collect active fractions and collect 70% saturation. Concentrate with ammonium sulfate, desalting with Sephadex G25.
• the N-terminal sequence, C-terminal sequence and internal sequence of the obtained purified PPDK were determined. That is, the N-terminal amino acid sequence was obtained by transferring a protein onto a PVDF membrane and using a gas-phase amino acid sequencer. The C-terminal sequence was estimated from the relationship between the amino acid composition released from digestion of purified PPM with carboxypeptidase Y and the digestion time. The internal amino acid sequence was determined by revealing the amino acid sequence from the N-terminal side of the peptide generated when the protein was digested with protease. The detailed method is as follows. First, according to the method for determining the amino acid sequence at the N-terminus. 0
• an overlay solution Tris-HCl pH 6.8 125 mM, EDTA lmM, 0.1 SDS, 0.01 BPB, 20 glycerol
• an enzyme solution Tris-HCl pH 6.8 125 mM
• N-terminal sequence Asn Pro Val Ser Pro Pro Val (72 to 78)
• the amino acid sequence shown in SEQ ID NO: 5 and the partial amino acid sequence determined directly from the above purified PPDK are in good agreement, and the amino acid sequence shown in SEQ ID NO: 5 is the amino acid sequence of PPDK.
• the amino acid sequence was confirmed.
• 40 amino acids (Flavier pidetis) and 180 in the mature protein portion were obtained.
• About one (corn) amino acids were different.
• the 1st to 71st amino acid sequences are not present in the mature protein, and are transit peptides necessary for passage through the membrane. And is understood to be processed after passing through the membrane.
• Table 1 below shows the differences between the amino acid residues in the mature proteins of Flavelaria brawnii and Flavelaria bidentis.
• p631Sac Plasmid lacking p631 after Sacl
• Sacl Sacl
• a primer containing an EcoRV site based on the sequence near the processing site 4 PCR was performed using a combination of GATATCAATCCGGTGTCTCCTCC and a primer M13 RV (Takara Shuzo) complementary to the vector sequence, and the amplified fragment was subcloned into pCR II.
• a fragment containing the N-terminal part was excised from pCR II using EcoRV and Sacl restriction enzymes, cut with the Sacl-Hind III fragment of p631 (including the rest of PPDK cDNA) and Ncol, and blunt-ended with Klenow enzyme. After that, a three-fragment ligation reaction was performed with pKK233-2 digested with Hindi 11 (FIG. 1). This plasmid was transformed into E. coli MV1184 and used for expression experiments. Dilute 1 ml of the preculture into 9 ml of fresh LB medium (containing 50 mg of ampicillin), shake at 37 ° C for 3 hours, and add 1 PTG to 5 mM.
• the cells were recovered by centrifugation.
• the cells were suspended in 0.5 ml of extraction buffer (50 mM Hepes-KOH pH7.5, 10 mM MgSO ImM EDTA, 5 mM DTT), lysozyme was added to about 0.5 mg ral, treated on ice for 5 minutes, and then sonicated. Enzymes were extracted by treating with a crushing device (Cosmo Bio UCD-130T) at intervals of 30 seconds for 5 minutes while cooling on ice.
• PPDK produced in Escherichia coli from PPPDK cDNAs of Flaveria bronyii, Flaveria bidentis and maize (Harvest queen) showed almost the same migration on SDS-PAGE as the plant-derived enzyme.
• the expected molecular weights of the mature enzymes from the cDNAs are all the same, and the apparent molecular weights on SDS-PAGE are quite different. This was due to the difference in the amino acid composition contained in each polypeptide, and was not due to post-translational modifications such as protein truncation processing and glycosylation.
• the cold tolerance of various PPDKs produced in E. coli was consistent with the corresponding plant enzymes.
• FIG. 2 shows the relationship between the elapsed time since the enzyme was placed at a temperature of 0 ° C. and the relative activity of PPDK.
• a cDNA was prepared by removing the transit peptide and incorporated into the expression vector. It was important to match the position exactly to the N-terminal position of the plant-derived enzyme.
• TTKKRVFTF- leaf-derived enzyme
• the EcoRI-Hindi 11 fragment of pKK-brownii is equivalent to pKK-bidentis (plasmid obtained by incorporating cDNA of Flavelaria bidentis into pKK-223-2 by the same method as pKK-brownii).
• ⁇ _011 was exchanged for the corresponding fragment, and conversely, the EcoRI-Hindi ⁇ fragment of pKK-bidentis was exchanged for the corresponding fragment of pKK brownii to produce pKK-100.
• the Ndel-Hindlll fragments were exchanged for each other to produce pKK-001 and pKK-110.
• the first PCR was carried out using a combination of link-FRV and M4 link-R using the Xii-HindiII fragment of brownii or bidentis subcloned in Bluescript SK (-) for type I.
• the obtained fragments (total of 4 types) were purified by gel excision, and the first half of brownii and the latter half of bidentis, or the first half of bidentis and the latter half of brownii were mixed to form type II, and the second PCR was performed using Primer M4 RV.
• the amplified binding fragment was digested with Xhol and HindII, and replaced with the corresponding part of pKK-bidentis to produce pKK-1 inkO1 and pKK-1 ink10.
• Another set of chimeric genes was created using the PstI site between the recombination site of linking PCR and Hindi11.
• the Xhol-Pstl fragment of pKK-linklO and the Pstl-HindiII fragment of ⁇ -bidentis were incorporated into the Xhol-Hindi 11 site of pKK-bidentis (3-fragment ligation reaction) to give pKK-linklOl.
• the Xhol-Pstl fragment of pKK-bidentis and the Pstl-Hindi 11 fragment of pKK-brownii were similarly incorporated into the Xhol-HindiII site of pKK_bidentis to obtain pKK-linkl10.
• the 40 amino acid substitutions found in the mature protein portion of the PPDK of Flavelaria'Brownii and Flaverian bidentis are relatively higher in the N- and C-termini of the enzyme and less near the central active center.
• the cDNA is divided into three parts: the front, middle, and rear, using the EcoRI and Ndel sites, which are common to both genes, and these are interchanged to produce a chimeric gene. It was examined whether it was involved in resistance. As a result, low temperature tolerance was obtained when the latter half of Flaveria'Brownii cDNA was present, and low temperature sensitivity was obtained when the latter half of Flaveria'Bidentis cDNA was present.
• the chimeric enzyme pKK-linkO having the last region containing four substitutions was cold-resistant, and the chimeric enzyme pKK-linkOl having the first half region containing three substitutions was inactivated at low temperature. Therefore, the latter half region was recombined with the restriction enzyme Pstl, and a chimeric gene having two amino acid substitutions was prepared and the low-temperature resistance was measured. It was estimated that there were two or more locations.
• PCR was performed using maize PPM cDNA as type III, and the obtained fragment was subcloned into pCR11. This fragment was excised from pCR II with Sacl and Ndel, and the Sacl-Smal fragment of pKK-PPM (vector fragment) and brownii PPDK cDNA were cut with Hindin, blunt-ended with Klenow enzyme, and cut with Ndel. A three-fragment ligation reaction was performed with the obtained fragments (FIG. 3) to obtain pKK-mz bro (Nde).
• PCR was carried out using the maize PPDK cDNA as a type I using mXhoI: CTCGAGGGATCTCAATCATTG (complementary strand side) containing the primers PPDK-F and Xhol, and the obtained fragment was subcloned into pCR II, followed by Sacl and Xhol. It was excised from pCRII and ligated with pKK-mz bro (Nde) ⁇ Sac I-Xhol fragment (vector fragment) to obtain pKK-mz bro (Xho).
• the corn F._ brownii chimeric PPDK prepared this time can use the transit peptide of corn PPDK as it is, so the transit portion is also a transformant derived from Flavelaria 'Brownii' PPDK and the chloroplast of cold-resistant PPDK If there is a problem in transporting to the cell, it may be resolved by introducing this chimeric gene instead.
• sequences of the primers used for mutagenesis are as shown in Table 2. After confirming the mutated nucleotide sequence with a DNA sequencer, these fragments were inserted into the Xhol-HindiII site of pKK-bidentis.
• the 869Gln-Pro mutation acquired low-temperature tolerance (the activity after the low-temperature treatment was 60-70%), and the 885Ile ⁇ Leu and 95211e-Val mutations It is difficult to inactivate at low temperature, and considering the results of the chimeric enzyme pKK-linkllO in (1) above, it is presumed that low temperature resistance is obtained when these two mutations coexist. From the above results, it was concluded that three residues of 869Pro, 885Leu, and 952Val were involved in cold tolerance. Among these residues involved in low-temperature tolerance of brownii, 869Pro and 885Leu are also brownii-type in corn PPM.
• Transformation methods are not limited to the particle gun method, but include the electroporation method (Rhodes CA et al., Science 240: 204-207, 1988) and the PEG method (Armstrong C. L et al., Plant Cell Reports 9: 335- 339, 1990), tissue-electroporation method (D'Halluin K.
• Seeds are obtained from the obtained plant body, germinated, and PPDK is separated from the leaves of the obtained plant to examine its low-temperature tolerance. The effect of temperature on the rate of photosynthesis is examined for transformed and untransformed plants. Characteristics of corn plants that exhibit higher photosynthetic rates at low temperatures grown over generations and determined by measuring photosynthetic rates at different temperatures and by measuring the cold tolerance of PPDK isolated from the plant Ensure conversion stability.
• An intermediate vector containing the full-length cDNA shown in SEQ ID NO: 5 and containing the reporter gene is introduced into the disarmed Ti plasmid of Agrobacterium umme faciliens 0 This is Draper J et al eds. It can be performed by the method described in Plant Genetic Transfomation and Gene Expression-a laboratory manual, Blackwell Scientific Publications (ISBN 0-632-02172-1).
• the leaf tissue or callus of Flaveria bidentis is infected with the Agrobacterium mme fascient. This can be performed by co-culturing the tissue or callus with Agrobacterium ctemefasciens. Infected cells are selected based on drug resistance. Plants are regenerated from the selected calli in a conventional manner. Seeds are obtained from the obtained plant body, germinated, and PPDK is isolated from the leaves of the obtained plant to examine its low-temperature tolerance. The effect of temperature on the rate of photosynthesis is examined for transformed and untransformed plants. By growing F. verdentis plants that exhibit higher photosynthetic rates at low temperatures for generations and measuring photosynthetic rates at different temperatures and by measuring the cold tolerance of PPDK isolated from the plant. Ensure the stability of the transformation being examined.
• AAA AGC CAT GTG GTA GCA ACC GGT TTG CCA GCA TCC CCC GGG GCA GCT 1498
• Gly Thr Thr Gly Glu Val lie Leu Gly Lys Gin Leu Leu Ala Pro Pro
• Sequence type nucleic acid
• Sequence type nucleic acid Array
• Arg lie Glu Ala Lys Ser Leu Asp Gin Leu Leu His Pro Thr Phe Asn
• ATC AGA AAG ATC ATC CTT TCC GAT TCA GTG GAA GCA AGA GAA GAG GCT 1839 lie Arg Lys Met lie Leu Ser Asp Ser Val Glu Ala Arg Glu Glu Ala
• Val Thr Tyr Pro Glu lie Ala Lys Met Gin Thr Arg Ala Val Met Glu
• GGT ATG ATG GAT ACT ATT CTT AAT CTT GGA CTT AAT GAT AAA ACT GTT 392 Gly Met Met Asp Thr lie Leu Asn Leu Gly Leu Asn Asp Lys Thr Val 100 105 110 115
• Glu lie Met lie Pro Asn Val Thr Glu Val Asn Glu Leu lie Asn Leu
• GGT ATT AAA GTA CCA TTC TCG TAT GGT ACT ATG GTT GAA TGT GTT AGA 2312
• Ala Ala Leu Thr Ala Asp Lys lie Ala Thr Glu Ala Ser Phe Phe Ser
• Sequence type nucleic acid
• AGC CCA AGG GCC AAT AAG TAC AGG AGT ATT AAC CAG ATA ACT GGG TTA 1083 Ser Pro Arg Ala Asn Lys Tyr Arg Ser lie Asn Gin lie Thr Gly Leu
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid Array
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Zoology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Wood Science & Technology (AREA)
• Organic Chemistry (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• Biotechnology (AREA)
• Molecular Biology (AREA)
• Microbiology (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• Cell Biology (AREA)
• Physics & Mathematics (AREA)
• Biophysics (AREA)
• Plant Pathology (AREA)
• Enzymes And Modification Thereof (AREA)
• Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (6)

Applications Claiming Priority (4)

Publications (1)

Family

ID=16380231

Family Applications (1)

Country Status (6)

Cited By (1)

Families Citing this family (1)

• 1995
  • 1995-05-30 UA UA96031191A patent/UA28003C2/uk unknown
  • 1995-05-30 RO RO96-00667A patent/RO118451B1/ro unknown
  • 1995-05-30 CN CNB95190941XA patent/CN1174093C/zh not_active Expired - Fee Related
  • 1995-05-30 BR BR9506291A patent/BR9506291A/pt not_active Application Discontinuation
  • 1995-05-30 RU RU96108242A patent/RU2136748C1/ru not_active IP Right Cessation
  • 1995-05-30 WO PCT/JP1995/001040 patent/WO1996004369A1/ja active Application Filing

Non-Patent Citations (7)

Also Published As

Similar Documents

Legal Events