Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi

Definitions

• the present invention relates to host cells useful in the production of recombinant proteins.
• the invention relates to fungal host cells of the genus
• Aspergillus which can be used in the high-level expression of recombinant proteins, especially enzymes.
• filamentous fungi Although mammalian and yeast cells have been the most commonly used eukaryotic hosts, filamentous fungi have now begun to be recognized as very useful as host cells for recombinant protein production.
• filamentous fungi which are currently used or proposed for use in such processes are Neurospora crassa, Acremonium chrysogenum, Tolypocladium geodes, Mucor circinelloides and Trichoderma reesei .
• certain species of the genus Aspergillus have been used effectively as host cells for recombinant protein production.
• Aspergillus is a deuteromycete fungus characterized by an aspergillum consisting of a conidiospore stipe terminating in a vesicle, which in turn bears one or two layers of synchronously formed specialized cells, variously referred to as sterigmata or phialides, and asexually formed spores referred to as conidia.
• the species Aspergillus nidulans has been reported to be transformed with recombinant plasmids (Ballance, et al. Biochem. Biophys. Res. Comm. 112: 284-289, 1983), but transformation was found to occur at fairly low frequency.
• Aspergillus niger and Aspergillus oryzae have also been described as being useful in recombinant production of proteins.
• other species of Aspergillus have not been shown to be useful in expression of heterologous protein, and in fact, because of poor expression, and/or excessive production of proteases or mycotoxins, not all species of Aspergillus are suitable as host cells for this purpose, nor is this ability predictable from one species to the next.
• Aspergillus foetidus has been used for the expression of a hepatitis B antigen (Hongdi, et al.
• An ideal expression system is one which is substantially free of protease and mycotoxin production and large amounts of other endogenously made secreted proteins, and which is capable of higher levels of expression than known host cells.
• the present invention now provides a new Aspergillus expression system which fulfills these requirements, and which is capable of expressing substantial quantities of fungal enzymes.
• the present invention provides an Aspergillus foetidus host cell containing a nucleic acid sequence encoding a heterologous enzyme.
• heterologous enzyme is meant one which is not native to the host cell, or a native enzyme in which modifications have been made to alter the native sequence.
• the protein is a heterologous fungal enzyme.
• the nucleic acid sequence is operably linked to a suitable promoter sequence, which is capable of directing transcription of the nucleic acid sequence in the chosen host cell.
• the invention also relates to a method for recombinant production of enzymes, the method comprising culturing an Aspergillus foetidus host cell containing a nucleic acid sequenced encoding a heterologous enzyme, under conditions conducive to expression of the enzyme, and recovering the enzyme from the culture.
• the enzyme is a fungal enzyme.
• the host cells and methods of the present invention are unexpectedly more efficient in the recombinant production of various fungal enzymes than are other known Aspergillus species, such as A. niger or A. oryzae.
• the species Aspergillus foetidus belongs to the Nigri Section of the genus Aspergillus .
• the members of the section Nigri as exemplified by Aspergillus niger, are characterized by radiate conidial heads and conidial masses in shades of black; globose vesicles; stipes which are smooth and hyaline, or pigmented below the vesicle; metulae present or absent, and often pigmented ("The Genus Aspergillus” , by K.B. Raper and D.I. Fennel, The Williams & Wikins Company, Baltimore, 1965) .
• A. foetidus is generally characterized by sterigmata in two series; conidial heads persistently grayish dark brown or olive brown; conidia globose or nearly so at maturity, irregularly and finely roughened. More specifically, the species is characterized by colonies on Czapek's solution agar growing rather slowly at room temperature (24-26'C), attaining a diameter of 3.5 to 4.5 cm in 10 days to 2 weeks, with vegetative mycelium in white or yellowish shades, largely submerged or forming a rather compact and comparatively tough surface, plane or radially furrowed, azonate or weakly zonate, in some strains bearing abundant olive-brown to brownish black conidial heads throughout except at the growing margin, in others sporulating tardily and less abundantly; exudate lacking or inconspicuous; colony reverse in yellow to orange shades, becoming reddish brown in age odor very strong, penetrating, actinomycete- like.
• A. foetidus var. pallidus (Nakazawa, Simo, and Watanabe, J. Agr. Chem. Soc. Japan 12: 961-962, Fig. 10, 1936) is characterized by colonies on Czapek's solution agar growing rather restrictedly, attaining a diameter of 2.0 to 2.5 cm in 10 days to 2 weeks at room termperature (24-26"C), plane or very lightly furrowed, consisting of a compact basal mycelium, nonsporulating and white or yellowish at the margin but otherwise bearing crowded conidial heads in dull grayish olive to olive-brown shades approximating dark olive to Chactura or olivaceous black; reverse at first colorless, then yellowish, becoming dark yellowish brown in age; odor less pronounced than in the species, not diagnostic.
• Soc. Japan 12: 960-961, Fig. 8, 1936 is characterized by colonies on Czapek's solution agar growing rather slowly, 4.0 to 5.0 cm in 10 to 14 days at room temperature (24-26'C), at first flocculent and near white to pale yellowish, lightly sporulating, later producing relatively few globose to radiate, brownish black conidial heads in marginal and submarginal areas; reverse in yellow shades turning dull yellow-brown in age; odor not pronounced; conidial heads comparatively large, 350-400 ⁇ in diameter, not splitting into distinct columns; conidiophores relatively short and wide, commonly 600 to 800 ⁇ by 20 to 30 ⁇ , rarely 1 mm in length, vesicles globose or nearly so, up to 80 to 85 ⁇ in diameter, fertile over the entire surface; sterigmata biseriate, brownish in color, primaries 20 to 40 ⁇ by 4.6 ⁇ , secondaries 6 to 10 ⁇ by 2.5 to 3.5 ⁇ ; conidia
• This variety differs from the species in its more lightly sporulating colonies on Czapek's and malt agars, its larger conidial heads and structural parts, its relatively short and wider conidiophores, and especially its bright yellow mycelium on malt agar.
• A. foetidus refers not only to those organisms encompassed in the aforementioned three groups, but also includes those species which have previously been or currently are designated as other species in alternate classification schemes, but which possess the same morphological and cultural characteristics defined above, and may be synonyms of A . foetidus and its varieties.
• synonyms include (but are not limited to) A . aureus Nakazawa, A. aureus var. pallidus Nakazawa, Simo and Watanabe, and A. aureus var. acidus Nakazawa, Simo and Watanabe.
• A. citricus Mosseray A. Musallam, Revision of the Black Aspergillus species, Ph.D. thesis. University of Utrecht).
• Initial determination of the utility of A. foetidus as a candidate host cell is made by evaluation of the level of protease produced by the various isolates from over fifteen species in different taxonomic sections of the genus Aspergillus . This is accomplished by testing each isolate on a casein clearing plate assay at acidic, neutral and alkaline pH. Surprisingly, it is found that several members of the Section Nigri perform best in that they produced the smallest quantities of proteases, which could potentially cause degradation of any recombinant proteins produced. Based on this criterion, several species are chosen for further study, including A. foetidus, A. japonicus, A. japonicus var. aculeatus, A. aculeatus, A.
• the transformed species are then observed to determine the level of expression of various heterologous enzymes.
• the heterologous enzymes tested include Humicola lanuginosa lipase (HLL) , Humicola insolens xylanase (xylanase) , Humicola insolens cellulase (cellulase) , and Coprinus cinereus peroxidase (CiP) .
• HLL Humicola lanuginosa lipase
• xylanase Humicola insolens xylanase
• Humicola insolens cellulase cellulase
• Coprinus cinereus peroxidase CiP
• a . foetidus showed unusually good expression for one or more of the enzymes, and in some cases, show equivalent or better yield of enzyme than the control A. oryzae strains.
• one strain of A. foetidus produces quite high levels of HLL (
• ATCC American Type Culture Collection
• NRRL Agricultural Research Service Culture Collection
• FGSC Fungal Genetics Stock Center
• DSM Deutsche Sammlung von Mikroorganismen und Zellkulturen
• IAM Institute of Applied Microbiology
• the successful transformation of the host species described herein is not limited to the use of the vectors, promoters, and selection markers specifically exemplified.
• those techniques which are useful in transformation of A . oryzae, A. niger and A . nidulans are also useful with the host cells of the present invention.
• amdS and hygB selection markers are preferred, other useful selection markers include the argB (A. nidulans or A. niger) , trpC ⁇ A . niger or A . nidulans) , or pyrG ⁇ A. niger or A. nidulans) markers.
• the promoter may be any DNA sequence that shows strong transcriptional activity in these species, and may be derived form genes encoding both extracellular and intracellular proteins, such as amylases, glucoamylases, proteases, lipases, cellulases and glycolytic enzymes. Such suitable promoters may be derived from genes for A. oryzae
• TAKA amylase Rhizomucor miehei aspartic proteinase, A. niger glucoamylase, A. niger neutral ⁇ -amylase, A. niger acid stable ⁇ -amylase, and Rhizomucor miehei lipase.
• promoters from genes for glycolytic enzymes are TPI, ADH, and PGK.
• the promoter may also be a homologous promoter, i.e., the promoter for a native A. foetidus gene.
• a preferred promoter according to the present invention is the A. oryzae TAKA amylase promoter.
• the TAKA amylase is a well-known ⁇ -amylase (Toda et al., Proc.Japan Acad. 5_8 Ser.
• the promoter sequence may also be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the promoter sequence with the gene of choice or with a selected signal peptide or preregion. Terminators and polyadenyla ion sequences may also be derived from the same sources as the promoters. Enhancer sequences may also be inserted into the construct.
• the gene of interest is linked to a preregion such as a signal or leader peptide which can direct the expressed product into the cell's secretory pathway.
• the preregion may be derived from genes for any secreted protein from any organism, or may be the native preregion.
• glucoamylase or an amylase gene from an Aspergillus species, an amylase gene from a Bacillus species, a lipase or proteinase gene from Rhizomucor miehei , the gene for the ⁇ -factor from Saccharomyces cerevisiae, or the calf prochymosin gene.
• the preregion is derived from the gene for A. oryzae TAKA amylase, A. niger neutral ⁇ -amylase, A. niger acid stable ⁇ -amylase, B. licheniformis ⁇ -amylase, the maltogenic amylase from Bacillus NCIB 11837, B.
• An effective signal sequence is the A. oryzae TAKA amylase signal, the Rhizomucor miehei aspartic proteinase signal and the Rhizomucor miehei lipase signal.
• the preregion may also be a homologous preregion present on the protein to be expressed.
• the gene for the desired product functionally linked to promoter and terminator sequences may be incorporated in a vector containing the selection marker or may be placed on a separate vector or plasmid capable of being integrated into the genome of the host strain.
• the vector system may be a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be integrated into the genome.
• Vectors or plasmids may be linear or closed circular molecules.
• the host is transformed with two vectors, one including the selection marker and the other comprising the remaining heterologous DNA to be introduced, including promoter, the gene for the desired protein and transcription terminator and polyadenylation sequences.
• the present host cell species can be used to express any prokaryotic or eukaryotic heterologous enzymes of interest, and is preferably used to express eukaryotic enzymes.
• This species is particularly useful in that it has been approved for use in the food industry.
• Of particular interest for this species is its use in expression of heterologous fungal enzymes (Regulatory Aspects of Microbial Food Enzymes, Third Edition, The Association of Microbial Food Enzyme Producers, Brussels, Belgium) .
• novel expression systems can be used to express enzymes such as catalase, laccase, phenoloxidase, oxidase, oxidoreductases, cellulase, xylanase, peroxidase, lipase, hydrolase, esterase, cutinase, protease and other proteolytic enzymes, aminopeptidase, carboxypeptidase, phytase, lyase, pectinase and other pectinolytic enzymes, amylase, glucoamylase, ⁇ - galactosidase, ⁇ -galactosidase, ⁇ -glucosidase, ⁇ - glucosidase, mannosidase, isomerase, invertase, transferase, ribonuclease, chitinase, and deoxyribonuclease .
• enzymes such as catalase, laccase, phenoloxida
• fungal enzymes includes not only native fungal enzymes, but also those fungal enzymes which have been modified by amino acid substitutions, deletions, additions, or other modifications which may be made to enhance activity, thermostability, pH tolerance and the like.
• the present host cells may also be used in recombinant production of proteins which are native to the host cells.
• examples of such use include, but are not limited to, placing an A. foetidus native protein under the control of a different promoter to enhance expression of the protein, to expedite export of a native protein of interest outside the cell by use of a signal sequence, or to increase copy number of a protein which is normally produced by the subject host cells.
• the present invention also encompasses such recombinant production of homologous proteins, to the extent that such expression involves the use of genetic elements not native to the host cell, or use of native elements which have been manipulated to function in a manner not normally seen in the host cell.
• I.Protease assays More than fifty strains, from at least fifteen different species, are examined to determine the amount of protease produced by each isolate, and also to observe their extracellular protein profile. To prepare culture inoculum, 10 ml of sterile distilled water is added to one 7-10 day old culture of each strain in a 9 cm petri dish, and spores are scraped gently from the mycelia to make a dense suspension.
• ASP04 medium comprises lg/1 CaCl 2 , 2 g/1 yeast extract, 1 g/1 MgS0 4 , 5 g/1 KH 2 P0 , 2 g/1 citric acid, 0.5 ml Trace Metal solution (comprising 14.3 g/1 ZnS0 4 -7 H 2 0, CuS0 4 -5H 2 0, 0.5 g/1 NiCl 2 -6H 2 0, 13.8 g/1
• the casein plate clearing assay is conducted as follows.
• the plate medium is composed of 20 g/1 skim milk, 20 g/1 agarose, and 0.2M citrate-phosphate buffer for tests run at pH 5 and pH 7, and glycine NaOH buffer for tests run at pH 9.
• Milk powder is mixed with 100 ml of buffer and kept at 60 * C.
• Agarose is mixed with 400 ml of buffer and autoclaved 5 minutes. After slight cooling, the warm milk mixture is added, and the mixture inverted gently 2-3 times to mix.
• the medium is poured into 150 mm plates using 50-70 ml per plate and stored at 5'C until use.
• the supernatants of each culture are also used to evaluate the strains' extracellular protein production.
• Novex San Diego, California 8-16% gradient gels, prepared according to manufacturer's instructions, are used to assess the protein profile.
• dissociation buffer 4 ml 1M Tris-HCl,pH 6.8, 1 g SDS, 617 mg dithio
• the gels are silver stained according to the Biorad Silver Stain Plus Protocol (Biorad Laboratories, Hercules, CA) . Those isolates showing large numbers of bands are considered less suitable as potential new hosts, while those showing relatively clean profiles with only 1-4 major bands are considered for further testing.
• the majority of suitable potential candidates are found among the members of the section Nigri. Based on these results, the following isolates are selected for transformation studies: A. foetidus E46, A . foetidus CBS 103.14, A. foetidus var. pallidus(NRRL 356), A. foetidus N0953 (NRRL 337; ATCC 10254) A. japonicus A1438 (CBS 568.65), A. aculeatus N1136 (CBS
• the vectors pJaL77 and pJaLl54 are used in transformation of host cells with the hygromycin B resistance selectable marker. This marker is based on the E. coli hygromycin B phosphotransferase gene, which is under the control of the TAKA promoter in pJaL 77 and the amdS promoter in pJaLl54. Briefly, these vectors are constructed as follows. The gene conferring resistance to hygromycin B is purchased from Boehringer Mannheim as plasmid pHph-1.
• This gene is equipped with an ATG codon as well as with suitable restriction sites at the amino and carboxy termini by PCR, using the primers: 5 ' -GCT CAG AAGCTT CCATCC TAC ACC TCA GCA ATG TCG CCT GAA CTC ACC GCG ACG TCT- 3' (N-terminal) and 3 ' -CGT CCG AGG GCA AAG GAA TAG CTCCAG AGATCT CAT GCT-5 ' (C-terminal) .
• the PCR fragment is cut with the restriction enzymes BamHI and Xhol and cloned into the corresponding sites in the Aspergillus expression vector PT0C68 (as described in WO 91/17243) to produce pJaL77.
• Plasmid pJaLl54 is constructed as follows.
• the amdS promoter mutant Ig + I 666 (Hynes et al. Mol. Cell. Biol. 3(8): 1430-1439, 1983 and Katz et al. Mol Gen Genet. 220: 373-376, 1990) is cloned from plasmid pCaHj406 by PCR with the following primers (underlined regions represent homology to the amdS promoter: CCT GGA TCC TCT GTG TTA GCT TAT AG and CTT GCA TGC CGC CAG GAC CGA GCA AG.
• the 694 bp PCR fragment containing the amdS promoter is cut with BamHI and SphI and cloned into the corresponding site in pJaL77, so that the TAKA promoter in pJaL77 is exchanged with the amdS promoter.
• the plasmid pToC90 containing the amdS marker is constructed by cloning a 2.7 kb Xbal fragment from p3SR2 (Hynes et al., supra) into an bal cut and dephosphorylated PUC19 plasmid.
• the derivative designated pToCl ⁇ is identical to pToC90 except that the promoter region contains two mutations (I 9 and I 666 ) known to enhance expression of the amdS gene (Hynes et al., supra; Corrick et al., Gene 53: 63-71, 1987).
• the vector pHD414 is a derivative of the plasmid p775 (EP 238 023). In contrast to this plasmid, pHD414 has a string of unique restriction sites between the TAKA promoter and the AMG terminator. The plasmid is constructed by removal of an approximately 200 bp long fragment (containing undesirable RE sites) at the 3' end of the terminator, and subsequent removal of an approximately 250 bp long fragment at the 5' end of the promoter, also containing undesirable sites.
• the 200 bp region is removed by cleavage with Narl (positioned in the pUC vector) and Xbal (just 3' to the terminator), subsequent filling in the generated ends with Klenow DNA polymerase + dNTP, purification of the vector fragment on a gel and religation of the vector fragment.
• This plasmid is called pHD413.
• pHD413 is cut with StuI (positioned in the 5' end of the promoter) and PvuII (in the pUC vector) , fractionated on gel and religated, resulting in pHD414.
• DSM 6995 coli containing the approximately 1,100 bp xylanase Malawi/Xbal cDNA fragment in pYES is deposited in DSM as DSM 6995.
• the xylanase cDNA fragment is isolated from one of the clones by cleavage with Hindlll/Xbal. The fragment is purified by agarose gel electrophoresis, electroeluted, and made ready for ligation reactions.
• the cDNA fragment is ligated into pHD414 to produce pAXX40-l-l
• SEQ ID NOS 1 and 2 The sequence of the xylanase gene and protein are provided in SEQ ID NOS 1 and 2, and the gene is deposited as DSM (Deutsche Sammlung Von Mikrooroganismen und Zellkulturen GmbH) 6995. .
• Humicola insolens cellulase Detailed characterization of the Humicola insolens cellulase is found in WO 91/17243.
• the expression vector pCaHj418 used for cellulase expression is constructed by excision of the 926 bp cellulase coding region fragment from pCaHj201 by cleavage with restriction enzymes BamHI and Sail. This fragment is purified by preparative gel electrophoresis using standard techniques and ligated with pHD414 (described above) which has been prepared by treatment with BamHI and Xhol.
• the resulting expression vector, pCaHj418, contains the cellulase gene under the transcriptional control of the A .
• Poly(A) -containing RNA is obtained by two cycles of affinity chromatograp y on oligo (dT) -cellulose as described by Aviv and Leder (PNAS USA 69: 1408-1412, 1972) .
• cDNA is synthesized with the use of methods described by Okayama and Berg (Molec. Cell. Biol. 2: 161-170, 1982), and with the vectors pSP62-K2 and pCDVl-PL described by Noma et al. (Nature 319: 640-646, 1986) .
• the synthesized cDNA is transformed into a hsdR-, M+ derivative of E. coli MC1000
• the filters are hybridized with the 3 2 P -i a belled H. lanuginosa lipase-specific pentadecamer mixture as described by Boel et al. (EMBO J. 3: 1097-1102, 1984). Hybridization and washing of the filters are done at 37'C and 43'C, respectively, followed by autoradiography for 24 hours with an intensifier screen.
• Miniprep plasmid DNA is isolated from two hybridizing colonies, pHLL 702.3 and pHLL 702.4 by standard procedures (Birnboim and Doly, Nucleic Acids Res. 7: 1513-1523, 1979) and the DNA sequence of the DNA insert is established by the procedure of Maxam and Gilbert (Methods Enzymol. 65: 499-560, 1980) .
• DNA sequences containing unique restriction sites are added to the 5' and 3' ends of the cDNA as follows. pHLL 702.3 is digested with Sau961 which digests the cDNA in the 3 ' untranslated region and the resulting ends are filled in with E. coli DNA polymerase (Klenow fragment) and the four dNTPs. This DNA is subsequently digested with Sad which cuts the cDNA once just 3 ' to the initiating methionine codon. The resulting 0.9 kb cDNA fragment is purified by agarose gel electrophoresis; electroeluted and made ready for ligation reactions.
• oligonucleotides 927 and 928 are synthesized.
• This adaptor is designed to add a Hindl l and BamHI site just 5' to the initiating Met codon of the cDNA.
• the two oligos are kinased with ATP and T polynucleotide kinase, annealed to each other and ligated to the purified 0.9 kb cDNA sequence in a pUCl9 vector digested with Hindlll and Hindi and purified on a 0.7% agarose gel.
• the resulting plasmid carries the H. lanuginosa lipase cDNA as a portable 0.9 kb BamHI fragment.
• p960 is modified by replacing 60 basepairs of the 5 'untranslated region of the A. oryzae TAKA promoter just upstream to the Humicola lanuginosa lipase gene by the corresponding region from the A. nidulans tpiA gene (McKnight et al.
• a synthetic oligonucleotide containing the 5 ' untranslated region from the A. nidulans tpiA flanked at each end by 20 bases homologous to p960 sequences just outside the untranslated region is used in a PCR reaction together with another primer covering the BssHII-site in the TAKA promoter region, as the mutagenization primer covers the BamHI site close to the ATG start codon, the PCR fragment is digested with BamHI and BSSHII and recloned into p960 digested with BssHll and partially with BamHI. 200 bases upstream to the ATG in • MHan37 is verified by DNA sequencing analysis. The sequence difference between p960 and pMHan37 is shown below:
• sequence of the primer covering the BamHI site 5 ' GCTCCTCATGGTGGATCCCCAGTTGTGTATATAGACCATTGAGGAAGGAAGA GAAGTGTGGATAGAGGTAAATTGAGTTGGAAACTCCAAGCATGGCATCCCTTGC 3 '
• Coyrinus cinereu ⁇ peroxidase The isolation and cloning of the Coprinus cinereus peroxidase gene is described in WO 92/16634. Briefly, total RNA is extracted from homogenized Coprinus cinereus (IFO 8371) mycelium, collected at the time of maximum peroxidase activity as described by Boel et al. (EMBO J. 3_: 1097-1102, 1984) and Chirgwin et al . (Biochemistry 18: 5294-5299, 1979) .
• Poly (A) -containing RNA is obtained by two cycles of affinity chromatography on oligo (dT) -cellulose as described by Aviv and Leder (PNAS USA 69: 1408-1412, 1972) .
• cDNA is synthesized by means of a cDNA synthesis kit from Invitrogen according to the manufacturer's instructions. About 50,000 E. coli recombinants from the Coprinus cinereus cDNA library are transferred to Whatman 540 paper filters. The colonies are lysed and immobilized as described by Gergen et al. (Nucleic Acids Res. 7: 2115-2135, 1979) .
• the filters are hybridized with the 3 2 P-labelled 430 base pair peroxidase- specific probe in 0.2 X SSC, 0.1% SDS. Hybridization and washing of the filters is conducted at 65"C followed by autoradiography for 24 hours with an intensifier screen. After autoradiography, the filters are washed at increasing temperatures followed by autoradiography for 24 hours with an intensifier screen. In this way, more than 50 positive clones are identified. Miniprep plasmid DNA is isolated from hybridizing colonies by standard procedures (Birnboim and Doly, Nucleic Acids Res.
• the DNA sequence of the cDNA insert is determined by the Sanger dideoxy procedure (Sanger et al., PNAS USA 74: 5463-5467, 1977) .
• the peroxidase cDNA fragment is excised from the vector by cleavage with Hindlll/X ol and is purified by agarose gel electrophoresis, electroeluted and made ready for ligation reactions.
• the cDNA fragment is ligated to Hindlll/Xhol digested HD414 to generated pCip in which the cDNA is under transcriptional control of the TAKA promoter from A . oryzae and the AMG terminator from A . niger.
• pJVi9 is prepared from pCiP in that the restriction sites for
• the cutinase expression vector pCaHj427 contains the Fusarium solani f. pisi cutinase coding region (Soliday et al., J. Bacteriol. 171: 1942-1951, 1989) under the transcriptional control of the A. oryzae T.AKA-amylase promoter and A. niger glucoamylase terminator regions (Christiansen et al., Figure 1, supra) . This is used, with pToC90 as described above, to cotransform A. foetidus strains NRRL 341, NRRL 357, and CBS 103.14.
• Candida antarctica lipase B contains the Candida antarctica lipase B gene under the control of the A. oryzae TAKA amylase promoter and A. glucoamylase terminator regions (Christiansen et al., supra) . This vector is used with pToC90, as described above, to transform A. foetidus strains CBS103.14, NRRL 356, NRRL 357, and NRRL 341.
• YPD Garnier et al. Methods in Yeast Genetics, Cold Spring Harbor Laboratory, 1981
• the mycelium is harvested by filtration through miracloth and washed with 200 ml of 0.6 M MgS0 4 .
• the suspension is cooled on ice and 1ml of buffer containing 120 mg of Novozyme® 234 is added.
• Plasmids pToC90 and pToCl86 contain the A . nidulans amdS gene, and are used for transformation and selection for growth on acetamide as the sole nitrogen source. Plasmids pJaL77 and pJaLl54 are used for transformation and selection of resistance to hygromycin B.
• Cotransformants for lipase activity are cultured in a M400Da medium consisting of 50 g/1 altodextrin, 2g/l MgS0 -7H 2 0, 2g/l KH 2 P0 4 , 3g/l K 2 S0 , 4g/l citric acid, 8g/l yeast extract, 3g/l (NH 4 ) 2 S0 4/ 0.5 ml
• Lipase activity in culture filtrates is measured using p-nitrophenylbutyrate (pNB) as a substrate.
• pNB p-nitrophenylbutyrate
• a stock solution of pNB is prepared by adding 104.6 ⁇ l of pNB to 5 ml of DMSO.
• To each well of a microtiter plate is added 90 ⁇ l of 50mM Tris, pH 7.
• Ten ⁇ l of sample is added to each well, and mixed by shaking the microtiter plate for about one minute.
• 20 ⁇ l of pNB stock is combined with 970 ⁇ l of 50 mM Tris buffer, pH 7 and mixed.
• the pNB-Tris mixture are added to each sample well and absorbance measured at 405 nm over a 3 minute time period.
• the assay is temperature sensitive, so an internal standard is used with each sample set.
• the slope determined for each sample directly correlates to lipase activity; the linear range of the assay is from about 0.005 to 5 ⁇ g lipase per milliliter.
• the specific activity of H. lanuginosa lipase is determined to be approximately 4000 LU/mg, whereas the specific activity of Candida lipase A is about 400 LU/mg.
• All xylanase transformants are grown in medium with the following composition, in g/1: maltodextrin, 50; MgSo 4 -7H 2 0,
• Cellulase transformants are grown in MY50 medium (50 g/1 maltodextrin, 2g/l MgS0 -7H 2 0, lOg/1 KH 2 P0 , 2g/l K 2 S0 , 2g/l citric acid, 10 g/1 yeast extract, 0.5 ml trace metals, 2.0 g urea, at 34 * C as submerged cultures.
• MY50 medium 50 g/1 maltodextrin, 2g/l MgS0 -7H 2 0, lOg/1 KH 2 P0 , 2g/l K 2 S0 , 2g/l citric acid, 10 g/1 yeast extract, 0.5 ml trace metals, 2.0 g urea, at 34 * C as submerged cultures.
• Cellulase activity is measured using 0.2% AZCL-HE- cellulose (Megazyme) as a substrate suspended in 0.1M citrate-phosphate buffer at pH 6.5.
• the culture is diluted in 0.1M citrate buffer, pH 6.5, and 10 ⁇ l of diluted culture fluid is mixed with 1 ml of 0.2% AZCL-HE-cellulose.
• the mixture is incubated at 42'C for 30 minutes with shaking every 5 minutes. After incubation, the undigested substrate is pelleted by centrifugation at 10,000 rpm for 5 minutes.
• the blue color in the supernatant is quantified spectrophotometrically at 595 run, and the amount of enzyme activity is determined from a standard curve made with a known cellulase standard.
• Endocellulase units ECU are determined relative to an enzyme standard prepared under identical conditions.
• Cotransformants for CiP are cultured in a M400Da medium consisting of 50 g/1 maltodextrin, 2g/l MgS0 4 -7H 2 0, 2g/l KH 2 P0 4 , 3g/l K 2 S0 , 4g/l citric acid, 8g/l yeast extract,
• Peroxidase expression is monitored using ABTS as a substrate or by rocket immunoelectrophoresis compared to a standard of known concentration.
• 1% agarose in TM buffer 1.3g/l Tris base, 0.6 g/1 maleic acid, pH 7
• TM buffer 1.3g/l Tris base, 0.6 g/1 maleic acid, pH 7
• 400 ⁇ l of rabbit antiserum against CiP is mixed with 15 ml of agarose, spread and solidified on a 10cm x 10 cm plate.
• E. Cutinase Selected transformants are screened on tributyrin agar(13% maltodextrin, 0.3% MgS0 4 -7H 2 0, 0.5% KH 2 P0 4 , 0.4% citric acid, 0.6% K 2 S0 4 , 0.5% yeast extract, 1% tributyrin, 1% urea, 0.3% NaN0 3 , 0.5ml trace metals, 2% agar, pH 4.5) for the ability to produce extracellular cutinase, as detected by the clearing of tributyrin.
• the strains producing the largest clearing zones are evaluated in shake flask cultures using M400Da medium(described above) at 37'C.
• Extracellular cutinase activity is determined using p-nitrophenylbutyrate as described above.
• the highest cutinase producer is an A. foetidus CBS 103.14 transformant designated CBS 103.14/CaHj427.1. Over the course of three days in shake flask culture, this transformant produces extracellulsar cutinase at leveles that are roughly eequal to the amount produced by an A. oryzae control transformant Qu-1-1. In small scale (2 liters) fermentation, this transformant produces approximately one gram per liter of extracellular cutinase.
• Table 2 summarizes the expression levels of various heterologous fungal enzymes produced by the alternative host of the present invention. It can be seen from the table that all strains were successful in expression of at least one of the genes of interest. In several cases, the new host strains give unexpectedly high levels of enzyme. For example, at least one strain of A. foetidus yields surprisingly high levels of HLL in shake flask cultures (approximately one gram per liter) , demonstrating that these species are capable of expressing large quantities of heterologous protein. In fact, the levels of production of HLL produced by these transformants appears to be as good as or better than the best primary transformants of A. oryzae, such as HL-23. Similarly, two strains exhibit similar high levels of expression of lipase B.
• A. foetidus also is shown to be an excellent host for the production of xylanase compared with A. oryzae .
• the shake flask yields for this enzyme are approximately twice the levels seen for the best A. oryzae transformants.
• MOLECULE TYPE DNA (genomic)
• ATC AAC TAC GGC GGC TAC TTC AAC CCC CAG GGC AAC GGC TAC CTG GCC 455 lie Asn Tyr Gly Gly Tyr Phe Asn Pro Gin Gly Asn Gly Tyr Leu Ala 95 100 105 110
• ATC CGC AAG AAC AAG CGT GTC GGA GGC TCG GTC AAC ATG CAG AAC CAC 695 lie Arg Lys Asn Lys Arg Val Gly Gly Ser Val Asn Met Gin Asn His 175 180 185 190
• Ala lie Ala Ala Pro Phe Asp Phe Val Pro Arg Asp Asn Ser Thr Ala 20 25 30
• Gly Ser lie lie Ala His Ser Asn lie Glu Leu Ala Phe Pro Ala Asn 100 105 110

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biomedical Technology (AREA)
• Organic Chemistry (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Wood Science & Technology (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Plant Pathology (AREA)
• Mycology (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Biophysics (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Enzymes And Modification Thereof (AREA)

Priority Applications (5)

Applications Claiming Priority (2)

Publications (1)

Family

ID=22577518

Family Applications (1)

Country Status (8)

Cited By (7)

Citations (2)

• 1994
  • 1994-11-29 AU AU12609/95A patent/AU690617B2/en not_active Ceased
  • 1994-11-29 CA CA002178008A patent/CA2178008A1/en not_active Abandoned
  • 1994-11-29 DE DE0730656T patent/DE730656T1/de active Pending
  • 1994-11-29 JP JP07515687A patent/JP3113284B2/ja not_active Expired - Fee Related
  • 1994-11-29 CN CN 94194682 patent/CN1139456A/zh active Pending
  • 1994-11-29 WO PCT/US1994/013612 patent/WO1995015390A1/en not_active Application Discontinuation
  • 1994-11-29 EP EP95903612A patent/EP0730656A1/en not_active Withdrawn
• 1996
  • 1996-05-31 FI FI962287A patent/FI962287A/fi unknown

Patent Citations (2)

Also Published As

Similar Documents

Legal Events