AU690617B2 - (Aspergillus foetidus) expression system - Google Patents

Description

I

WO 95/15390 PCT/US94/13612 ASPERGILLUS FOETIDUS EXPRESSION SYSTEM Field of the Invention The present invention relates to host cells useful in the production of recombinant proteins. In particular, the invention relates to fungal host cells of the genus Aspergillus, which can be used in the high-level expression of recombinant proteins, especially enzymes.

Backaround of the Invention The use of recombinant host cells in the expression of heterologous proteins has in recent years greatly simplified the production of large quantities of commercially valuable proteins, which otherwise are obtainable only by purification from their native sources. Currently, there is a varied selection of expression systems from which to choose for the production of any given protein, including prokaryotic and eukaryotic hosts. The selection of an appropriate expression system will often depend not only on the ability of the host cell to produce adequate yields of the protein in an active state, but also to a large extent may be governed by the intended end use of the protein.

Although mammalian and yeast cells have been the most commonly used euLaryotic hosts, filamentous fungi have now begun to be recognized as very useful as host cells for recombinant protein production. Among the filamentous fungi which are currently used or proposed for use in such processes are Neurospora crassa, Acremonium chrysogenum, -1- WO 95/15390 PCT/US94/13612 Tolypocladium geodes, Mucor circinelloides and Trichoderma reesei. In addition, certain species of the genus Aspergillus have been used effectively as host cells for recombinant protein production. Aspergillus is a deuteromycete fungus characterized by an aspergillum consisting of a conidiospore stipe terminating in a vesicle, which in turn bears one or two layers of synchronously formed specialized cells, variously referred to as sterigmata or phialides, and asexually formed spores referred to as conidia. The species Aspergillus nidulans has been reported to be transformed with recombinant plasmids (Ballance, et al. Biochem. Biophys. Res. Comm. 112: 284-289, 1983), but transformation was found to occur at fairly low frequency. Both Aspergillus niger and Aspergillus oryzae have also been described as being useful in recombinant production of proteins. However, other species of Aspergillus have not been shown to be useful in expression of heterologous protein, and in fact, because of poor expression, and/or excessive production of proteases or mycotoxins, not all species of Aspergillus are suitable as host cells for this purpose, nor is this ability predictable from one species to the next. Aspergillus foetidus has been used for the expression of a hepatitis B antigen (Hongdi, et al. Acta Microbiologica Sinica 30: 98-104, 1990), but has not been reported in being useful in expression of any other types of protein, and has not been reported as capable of producing protein in high yields. An ideal expression system is one which is substantially free of protease and mycotoxin production and large amounts of other endogenously made secreted proteins, and which is capable of higher levels of expression than known host cells. The present invention now provides a new Aspergillus expression system 3 which fulfils these requirements, and which is capable of expressing substantial quantities of fungal enzymes.

Summary of the Invention The present invention provides an Aspergillus foetidus host cell containing a nucleic acid sequence encoding a heterologous enzyme. By "heterologous enzyme" is meant one which is not native to the host cell, or a native enzyme in which modifications have been made to alter the native sequence. In a preferred embodiment the protein is a heterologous fungal enzyme. The nucleic acid sequence is operably linked to a suitable promoter sequence, which is capable of directing transcription of the nucleic acid sequence in the chosen host cell.

The invention also relates to a method for recombinant production of enzymes, the method comprising culturing an Aspergillus foetidus host cll containing a nucleic acid sequence encoding a heterologous enzyme, under conditions conducive to expression of .o the enzyme, and recovering the enzyme from the culture. In a preferred embodiment, the 15 enzyme is a fungal enzyme.

The host cells and methods of the present invention are unexpectedly more efficient in the recombinant production of various fungal enzymes than are other known Aspergillus species, such as A. niger or A. oryzae.

According to a first embodiment of the invention, there is provided an Aspergillus 20 foetidus host cell comprising a nucleic acid sequence encoding a heterologous enzyme operably linked to a promoter.

According to a second embodiment of the invention, there is provided a method for producing an enzyme of interest which comprises culturing an Aspergillus foetidus host cell comprising a nicleic acid sequence encoding a heterologous protein operably 25 linked to a promoter under conditions which permit expression of the protein and recovering the protein from culture.

Detailed Description of the Invention The species Aspergillus foetidus belongs to the Nigri Section of the genus Aspergillus. The members of the section Nigri, as exemplified by Aspergillus niger, are characterised by radiate conidial heads and conidial masses in shades of black; globose vesicles; stipes which are IN:\LIBFFO02B4:8AIK WO 95/15390 PCT/US94/13612 smooth and hyaline, or pigmented below the vesicle; metulae present or absent, and often pigmented ("The Genus Aspergillus", by K.B. Raper and D.I. Fennel, The Williams Wikins Company, Baltimore, 1965). Mutants of these strains differing in spore color and ornamentation, or other micromorphological characters also would be included in this section. Within the Nigri section of the genus Aspergillus, the delimitation of taxa is subject to debate, due to variation in colony color and conidiogenous structures on which the major classification schemes are primarily based Raper and Fennel, supra). The A. foetidus-related taxa recognized by Raper and Fennel are A. foetidus, A.

foetidus var. acidus, and A. foetidus var. pallidus.

A.foetidus is generally characterized by sterigmata in two series; conidial heads persistently grayish dark brown or olive brown; conidia globose or nearly so at maturity, irregularly and finely roughened. More specifically, the species is characterized by colonies on Czapek's solution agar growing rather slowly at room temperature (24-26'C), attaining a diameter of 3.5 to 4.5 cm in 10 days to 2 weeks, with vegetative mycelium in white or yellowish shades, largely submerged or forming a rather compact and comparatively tough surface, plane or radially furrowed, azonate or weakly zonate, in some strains bearing abundant olive-brown to brownish black conidial heads throughout except at the growing margin, in others sporulating tardily and less abundantly; exudate lacking or inconspicuous; colony reverse in yellow to orange shades, becoming reddish brown in age odor very strong, penetrating, actinomycetelike. Conidial heads at first small, globose to radiate, remaining so in crowded central colony areas, others near colony margin becoming irregularly split into several rather -4- WO 95/15390 PCT/US94/13612 well-defined columns, commonly 200 to 30V g in overall diameter but in some strains reaching 500(; conidiophores mostly 25 to 35 p in diameter but reaching 40-50 p in some strains, fertile over the entire surface in larger heads or the upper three-fourths on smaller vesicles; sterigmata in two series, pigmented in brown shades, primaries somewhat variable, mostly 7 to 12 l by 3.0 to 5.0 p, occasionally longer, secondaries mostly 7 to 8 p by 2.5 to 3.0 l; conidia globose or nearly so, with walls brown, often appearing almost smooth but when mature irregularly and finely roughened, mostly 4.0 to 4.5 [1 in diameter, borne in chains without obvious disjunctors.

Colonies on malt agar growing somewhat more rapidly, to 6 cm in 2 weeks, plane, velvety, with vegetative mycelium submerged and colorless or only slightly yellow, heavily sporing throughout, blackish brown shades, azonate or inconspicuously so; reverse in light yellow shades to almost colorless; odor not pronounced. Conidial heads usually splitting into numerous conspicuously divergent and compact columns and reaching 300 to 350p in diameter in most strains but up to 600 to 800 1 in others; conidia more uniformly echinulate than on Czapek agar. Structural details of conidial heads as described above. The species was first described by Thom and Raper, A Manual of the Aspergilli, 219-220, Fig. 61C, 1945).

A. foetidus var. pallidus (Nakazawa, Simo, and Watanabe, J. Agr. Chem. Soc. Japan 12: 961-962, Fig. 1936) is characterized by colonies on Czapek's solution agar growing rather restrictedly, attaining a diameter of 2.0 to 2.5 cm in 10 days to 2 weeks at room termperature (24-26'C), plane or very lightly furrowed, consisting of a compact basal mycelium, nonsporulating and white or yellowish at the r WO 95/15390 PCT/US94/13612 margin but otherwise bearing crowded conidial heads in dull grayish olive to olive-brown shades approximating dark olive to Chactura or olivaceous black; reverse at first colorless, then yellowish, becoming dark yellowish brown in age; odor less pronounced than in the species, not diagnostic.

Conidial heads globose to radiate, up to 500 to 600 pL in diameter, usually splitting into few and ill-defined columns;conidiophores smooth, colorless or in brownish tints, commonly about 1 mm long by 8 to 16 g in width, occasionally longer; vesicles globose or nearly so, up to to 60 pl in diameter in largest heads, fertile over the entire surface; sterigmata in two series, brownish, primaries commonly 10 to 15 p by 3.5 to 5.0 p when young, but up to 30 to 40 p in older heads, secondaries mostly 7 to 10 R by 3.0 to 4.0 l; conidia at first elliptical to ovate and smooth or nearly so, becoming globose or subglobose, to 4.5 in diameter and delicately roughened, adherent in fluid mounts but with connectives not evident.

Colonies on malt growing somewhat more rapidly, plane, usually velvety and heavily sporing throughout, in dark olive-black shades. Conidial structures up to 700 to 800 p in diameter, essentially as on Czapek's agar, but with mature conidia 3.0 to 3.5 p, globose echinulate and with a suggestion of longitudinal orientation of surface markings.

This variety differs from the species primarily in its more restricted growth on Czapek's agar, the larger dimensions and more olive pigmentation of its conidial structures, and the absence of definite divergent columns of conidia in mature heads on malt agar.

A. foetidus var. acidus (Nakazawa, Simo and Watanabe, J. Agr. Chem. Soc. Japan 12: 960-961, Fig. 8, 1936) is characterized by colonies on Czapek's solution agar growing WO 95/15390 PCT/US94/13612 rather slowly, 4.0 to 5.0 cm in 10 to 14 days at room temperature (24-26'C), at first flocculent and near white to pale yellowish, lightly sporulating, later producing relatively few globose to radiate, brownish black conidial heads in marginal and submarginal areas; reverse in yellow shader turning dull yellow-brown in age; odor not pronounced; conidial heads comparatively large, 350-400 p in diameter, not splitting into distinct columns; conidiophores relatively short and wide, commonly 600 to 800 4 by 20 to p, rarely 1 mm in length, vesicles globose or nearly so, up to 80 to 85 L in diameter, fertile over the entire surface; sterigmata biseriate, brownish in color, primaries 20 to p by 4.6 g, secondaries 6 to 10 p by 2.5 to 3.5 pl; conidia globose to somewhat flattened, brown, 4.0 to 4.5 g in diameter, comparatively heavy walled, appearing smooth or with surface slightly irregular but not echinulate or rugulose.

Colonies on malt growing more rapidly and sporulating irregularly within 10 days, broadly zonate, plane or closely wrinkled, with vegetative mycelium largely submerged and bright golden yellow; conidial heads borne on short conidiophores as above but somewhat larger than on Czapek's, reaching diameters of 500 to 600 p and showing numerous illdefined columns of conidia. This variety differs from the species in its mc, lightly sporulating colonies on Czapek's and malt agars, at larger conidial heads and structural parts, its relatively short and wider conidiophores, and especially its bright yellow mycelium on malt agar.

It will be understood that throughout the specification and claims the use of the term A. foetidus refers not only to those organisms encompassed in the aforementioned three groups, but also includes those species which have WO 95/15390 PCT/US94/13612 previously been or currently are designated as other species in alternate classification schemes, but which possess the same morphological and cultural characteristics defined above, and may be synonyms of A. foetidus and its varieties.

For example, synonyms include (but are not limited to) A.

aureus Nakazawa, A. aureus var. pallidus Nakazawa, Simo and Watanabe, and A. aureus var. acidus Nakazawa, Simo and Watanabe. Also a probable synonym is A. citricus Mosseray Musallam, Revision of the Black Aspergillus species, Ph.D. thesis, University of Utrecht).

Initial determination of the utility of A. foetidus as a candidate host cell is made by evaluation of the level of protease produced by the various isolates from over fifteen species in different taxonomic sections of the genus Aspergillus. This is accomplished by t-esting each isolate on a casein clearing plate assay at acidic, neutral and alkaline pH. Surprisingly, it is found that several members of the Section Nigri perform best in that they produced the smallest quantities of proteases, which could potentially cause degradation of any recombinant proteins produced.

Based on this criterion, several species are chosen for further study, including A. foetidus, A. japonicus, A.

japonicus var. aculeatus, A. aculeatus, A. tamarii, A.

carbonarius, and A. phoenicis.

Attempts to transform the selected species are then conducted. Initial efforts focus on use of standard A.

oryzae transformation techniques (Christensen et al., Bio/Technology 6: 1419-1422, 1988; EP Appln. No. 87 103 806.3). In brief, cotransformants are obtained using the A.

oryzae protocol for protoplasting, transformation and selection for amdS or hygromycin B (hygB) marker genes.

Expression vectors contain the A. oryzae TAKA-amylase gene, -8- WO 95/15390 PCT/US94/13612 and the transcription termination signals from the A. niger glucoamylase gene, in addition to a heterologous coding sequence. Transformation frequencies vary from less than one to approximately 10 per microgram of DNA. In cotransformation experiments with the expression vectors detailed in the following examples, the frequency of cotransformation ranges from 0-60%.

The transformed species are then observed to determine the level of expression of various heterologous enzymes.

The heterologous enzymes tested include Humicola lanuginosa lipase (HLL), Humicola insolens xylanase (xylanase), Humicola insolens cellulase (cellulase), and Coprinus cinereus peroxidase (CiP). Surprisingly, A. foetidus showed unusually good expression for one or more of the enzymes, and in some cases, show equivalent or better yield of enzyme than the control A. oryzae strains. In particular, one strain of A. foetidus produces quite high levels of HLL (about one gram per liter) in shake flask culture. A summary of the results of these tests is provided in Table 2.

As the results clearly show, several isolates of this species are capable of expressing heterologous protein.

Thus, it is understood that this ability is not limited to a single isolate or strain, but rather is a characteristic of this species as a whole. Those skilled in the art will recognize that other strains or isolates of these species can also be used in expression of heterologous expression.

Many strains of each species are publicly available in the collections of the American Type Culture Collection (ATCC) 12301 Parklawn Drive, Rockville Maryland 20852; Agricultural Research Service Culture Collection (NRRL) 1815 North University Street, Peoria, Illinois 61604; Fungal Genetics 00i WO 95/15390 PCT/US94/13612 Stock Center (FGSC), Kansas; Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSM), Mascheroder Weg 1B, D-3300 Braunschweig, Germany; Institute of Applied Microbiology (IAM), Tokyo University 1-1,1-Chome, Yayoi, Bunkyo-ku, Tokyo 113, Japan; Institute for Fermentation (IFO), 17-85 Juso-honmachi 2-chome, Yodogawa-ku, Osaka 532, Japan; and Centraal Bureau voor Schimmelcultures (CBS), Oosterstraat 1, 3740 AG Baarn, Netherlands.

The skilled artisan will also recognize that the successful transformation of the host species described herein is not limited to the use of the vectors, promoters, and selection markers specifically exemplified. Generally speaking, those techniques-which are useful in transformation of A. oryzae, A. niger and A. nidulans are also useful with the host cells of the present invention.

For example, although the amdS and hygB selection markers are preferred, other useful selection markers include the argB nidulans or A. niger), trpC niger or A.

nidulans), or pyrG niger or A. nidulans) markers. The promoter may be any DNA sequence that shows strong transcriptional activity in these species, and may be derived form genes encoding both extracellular and intracellular proteins, such as amylases, glucoamylases, proteases, lipases, cellulases and glycolytic enzymes. Such suitable promoters may be derived from genes for A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A.

niger glucoamylase, A. niger neutral a-amylase, A. niger acid stable a-amylase, and Rhizomucor miehei lipase.

Examples of promoters from genes for glycolytic enzymes are TPI, ADH, and PGK. The promoter may also be a homologous promoter, the promoter for a native A.foetidus gene.

I I i WO 95/15390 PCTUS94/13612 A preferred promoter according to the present invention is the A. oryzae TAKA amylase promoter. The TAKA amylase is a well-known a-amylase (Toda et al., Proc.Japan Acad. 58 Ser.

208-212, 1982). The promoter sequence may also be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the promoter sequence with the gene of choice or with a selected signal peptide or preregion. Terminators and polyadenylation sequences may also be derived from the same sources as the promoters. Enhancer sequences may also be inserted into the construct.

To avoid the necessity of disrupting the cell to obtain the expressed product, and to minimize the amount of possible degradation of the expressed product within the cell, it is preferred that the product be secreted outside the cell. To this end, in a preferred embodiment, the gene of interest is linked to a preregion such as a signal or leader peptide which can direct the expressed product into the cell's secretory pathway. The preregion may be derived from genes for any secreted protein from any organism, or may be the native preregion. Among useful available sources for such a preregion are a glucoamylese or an amylase gene from an Aspergillus species, an amylase gene from a Bacillus species, a lipase or proteinase gene from Rhizomucor miehei, the gene for the a-factor from Saccharomyces cerevisiae, cr the calf prochymosin gene. Most preferably the preregion is derived from the gene for A. orvzae TAKA amylase, A. niger neutral a-amylase, A. niger acid stable a-amylase, B.

licheniformis a-amylase, the maltogenic amylase from Bacillus NCIB 11837, B. stearothermophilus a-amylase, or B.

-11- L a- WO 95/15390 PCT/US94/13612 licheniformis subtilisin. An effective signal sequence is the A. oryzae TAKA amylase signal, the Rhizomucor miehei aspartic proteinase signal and the Rhizomucor miehei lipase signal. The preregion may also be a homologous preregion present on the protein to be expressed.

The gene for the desired product functionally linked to promoter and terminator sequences may be incorporated in a vector containing the selection marker or may be placed on a separate vector or plasmid capable of being integrated into the genome of the host strain. The vector system may be a single vector or plasmid or cwo or more vectors or plasmids which together contain the total DNA to be integrated into the genome. Vectors or plasmids may be linear or closed circular molecules. According to a preferred embodiment of the present invention, the host is transformed with two vectors, one including the selection marker and the other zomprising the remaining heterologous DNA to be introduced, including promoter, the gene for the desired protein and transcription terminator and polyadenylation sequences.

The present host cell species can be used to express any prokaryotic or eukaryotic heterologous enzymes of interest, and is preferably used to express eukaryotic enzymes. This species is particularly useful in that it has been approved for use in the food industry. Of particular interest for this species is its use in expression of heterologous fungal enzymes (Regulatory Aspects of Microbial Food Enzymes, Third Edition, The Association of Microbial Food Enzyme Producers, Brussels, Belgium). Tne novel expression systems can be used to express enzymes such as catalase, laccase, phenoloxidase, oxidase, oxidoreductases, cellulase, xylanase, peroxidase, lipase, hydrolase, esterase, cutinase protease and other proteolytic enzymes, -12- WO 95/15390 PCT/US94/13612 aminopeptidase, carboxypeptidase, phytase, lyase, pectinase and other pectinolytic enzymes, amylase, glucoamylase, agalactosidase, -galactosidase, a-glucosidase, Pglucosidase, mannosidase, isomerase, invertase, transferase, ribonuclease, chitinase, and deoxyribonuclease It will be understood by those skilled in the art that the term "fungal enzymes" includes not only native fungal enzymes, but also those fungal enzymes which have been modified by amino acid substitutions, deletions, additions, or other modifications which may be made to enhance activity, thermostability, pH tolerance and the like.

The present host cells may also be used in recombinant production of proteins which are native to the host cells.

Examples of such use include, but are not limited to, placing an A. foetidus native protein under the control of a different promoter to enhance expression of the protein, to expedite export of a native protein of interest outside the cell by use of a signal sequence, or to increase copy number of a protein which is normally produced by the subject host cells. Thus, the present invention also encompasses such recombinant production of homologous proteins, to the extent that such expression involves the use of genetic elements not native to the host cell, or use of native elements which have been manipulated to function in a manner not normally seen in the host cell.

The invention is further illustrated by the following non-limiting examples.

I.Protease assays More than fifty strains, from at least fifteen different species, are examined to determine the amount of -13-

I

I

WO 95/15390 PCT/US94/13612 protease produced b" each isolate, and also to observe their extracellular protein profile. To prepare culture inoculum, ml of sterile distilled water is added to one 7-10 day old culture of each strain in a 9 cm petri dish, and spores are scraped gently from the mycelia to make a dense suspension. 2.5 ml of the suspension is used to inoculate 100 ml of ASPO4 medium[ASPO4 medium comprises lg/l CaC1 2 2 g/l yeast extract, 1 g/l MgSO 4 5 g/l KH 2

PO

4 2 g/1 citric acid, 0.5 ml Trace Metal solution (comprising 14.3 g/l ZnSO4-7 H 2 0, CuS04-5H 2 0, 0.5 g/l NiC12-6H 2 0, 13.8 g/l FeSO 4 -7H 2 0, 8.5 g/l MnSO 4

.H

2 0, and 3 g/l citric acid), 1 g/l urea, 2 g/1 (NH 4 2

SO

4 20 g/1 maltodextrin (8 ml of a stock, added after autoclaving) in tap water, pH adjusted to or 6.5 before autoclaving, then pH 4.5 adjusted with 8 ml 0.1M citric acid per 100 ml after autoclaving]. Flasks are incubated at 30 and/or 37'C, shaking on an orbital shaker at 200 rpm, for 5 days, in continuous light.

Supernatant from the culture broth of each is spun at 2500 rpm for 5 minutes, and used in the casein clearing plate assay, which determines the levels of proteases produced by various fungal species being evaluated as potential candidates for recombinant protein expression.

The casein plate clearing assay is conducted as follows. The plate medium is composed of 20 g/l skim milk, 20 g/l agarose, and 0.2M citrate-phosphate buffer for tests run at pH 5 and pH 7, and glycine NaOH buffer for tests run at pH 9. Milk powder is mixed with 100 ml of buffer and kept at 60'C. Agarose is mixed with 400 ml of buffer and autoclaved 5 minutes. After slight cooling, the warm milk mixture is added, and the mixture inverted gently 2-3 times -14- WO 95/15390 PCT/US94/13612 to mix. The medium is poured into 150 mm plates using 50-70 ml per plate and stored at 5'C until use.

Just prior to use, twelve holes per plate are made in the agar. 25 .p of supernatant from fermentation of each strain is added to one plate of each pH and incubated overnight at 37'C. To pH 9 plates, 0.5M glacial acetic acid is added to precipitate casein and allow visualization of any clear zones. Each plate is then evaluated on clear zone size from no zone to >2 cm in diameter) and zone type clear, opaque or both types).

The supernatants of each culture are also used to evaluate the strains' extracellular protein production.

Novex (San Diego, California) 8-16% gradient gels, prepared according to manufacturer's instructions, are used to assess the protein profile. A 75 gl (3 and 5 day) sample of culture supernatant is mixed with 20.l of 5X dissociation buffer (dissociation buffer 4 ml 1M Tris-HCl,pH 6.8, 1 g SDS, 617 mg dithiothreitol, and sterile distilled water to ml), and glycerol/bromophenol blue (10-20 mg added to about 10 ml of 80-90% glycerol, and placed in boiling water for 1-2 hours to dissolve), boiled for 5 minutes, cooled, loaded and run at 60-200 V until the bromphenol blue tracking dye reaches the bottom of the gel. The gels are silver stained according to the Biorad Silver Stain Plus Protocol (Biorad Laboratories, Hercules, CA). Those isolates showing large numbers of bands are considered less suitable as potential new hosts, while those showing relatively clean profiles with only 1-4 major bands are considered for further testing.

When the combined results of the protease assay and protein profile are reviewed, the majority of suitable potential candidates are found among the members of the WO 95/15390 PCT/US94/13612 section Nigri. Based on these results, the following isolates are selected for transformation studies: A.

foetidus E46, A. foetidus CBS 103.14, A. foetidus var.

pallidus(NRRL 356), A. foetidus N0953 (NRRL 337; ATCC 10254) A. japonicus A1438 (CBS 568.65), A. aculeatus N1136 (CBS 101.43), A. aculeatus A1454 (CBS 172.66), A. aculeptus A1455 (CBS 186.67), A. japonicus var. aculeatus N0956 (IAM 13871), A. phoenicis A528 (CBS 139.48), A. phoenicis A530 (CBS 137.52), A. phoenicis E419 (CBS 137.52), A. carbonarius A3993 (IBT 4977), A. carbonarius ATCC 1025, A. tamarii E112 (ATCC 10836), A. tamarii N2266 (IFO 4358), and A. tamarii N2267(IFO 4142). These cultures are also maintained as part of the Novo Nordisk Biotech Culture Collection, Davis, California.

II.Vector construction A. Selectable marker vectors. The vectors pJaL77 and pJaL154 are used in transformation of host cells with the hygromycin B resistance selectable marker. This marker is based on the E. coli hygromycin B phosphotransferase gene, which is under the control of the TAKA promoter in pJaL 77 and the amdS promoter in pJaL154. Briefly, these vectors are constructed as follows. The gene conferring resistance to hygromycin B is purchased from Boehringer Mannheim as plasmid pHph-l. This gene is equipped with an ATG codon as well as with suitable restriction sites at the amino and carboxy termini by PCR, using the primers: 5'-GCT CAG AAGCTT CCATCC TAC ACC TCA GCA ATG TCG CCT GAA CTC ACC GCG ACG TCT- 3' (N-terminal) and 3'-CGT CCG AGG GCA AAG GAA TAG CTCCAG AGATCT CAT GCT-5'(C-terminal). The PCR fragment is cut with the restriction enzymes BamHI and XhoI and cloned into the -16- 7 WO 95/15390 PCT/US94/13612 corresponding sites in the Aspergillus expression vector pToC68 (as described in WO 91/17243) to produce pJaL77.

Plasmid pJaL154 is constructed as follows. The amdS promoter mutant I9 1666 (Hynes et al. Mol. Cell. Biol.

1430-1439, 1983 and Katz et al. Mol Gen Genet. 220: 373-376, 1990) is cloned from plasmid pCaHj406 by PCR with the following primers (underlined regions represent homology to the amdS promoter: CCT GGA TCC TCT GTG TTA GCT TAT AG and CTT GCA TGC CGC CAG GAC CGA GCA AG. The 694 bp PCR fragment containing the amdS promoter is cuc with BamHI and SphI and cloned into the corresponding site in pJaL77, so that the TAKA promoter in pJaL77 is exchanged with the amdS promoter.

The plasmid pToC90 cbntaining the amdS marker is constructed by cloning a 2.7 kb XbaI fragment from p3SR2 (Hynes et al., supra) into an XbaI cut and dephosphorylated pUC19 plasmid. The derivative designated pToCl86 is identical to pToC90 except that the promoter region contains two mutations (19 and I666) known to enhance expression of the amdS gene (Hynes et al., supra; Corrick et al., Gene 53: 63-71, 1987).

B, Expression vectors.

l.Humicola insolens xvlanase. The vector pHD414 is a derivative of the plasmid p775(EP 238 023). In contrast to this plasmid, pHD414 has a string of unique restriction sites between the TAKA promoter and the AMG terminator. The plasmid is constructed by removal of an approximately 200 bp long fragment (containing undesirable RE sites) at the 3' end of the terminator, and subsequent removal of an approximately 250 bp long fragment at the 5' end of the promoter, also containing undesirable sites. The 200 bp region is removed by cleavage with Narl (positioned in the -17- WO 95/15390 PCT/US94/13612 pUC vector) and XbaI (just 3' to the terminator), subsequent filling in the generated ends with Klenow DNA polymerase dNTP, purification of the vector fragment on a gel and religation of the vector fragment. This plasmid is called pHD413. pHD413 is cut with StuI (positioned in the 5' end of the promoter) and PvuII (in the pUC vector), fractionated on gel and religated, resulting in pHD414. A strain of E.

coli containing the approximately 1,100 bp xylanase HindII/XbaI cDNA fragment in pYES is deposited in DSM as DSM 6995. The xylanase cDNA fragment is isolated from one of the clones by cleavage with HindIII/XbaI. The fragment is purified by agarose gel electrophoresis, electroeluted, and made ready for ligation reactions. The cDNA fragment is ligated into pHD414 to produce pAXX40-1-1 The sequence of the xylanase gene and protein are provided in SEQ ID NOS 1 and 2, and the gene is deposited as DSM (Deutsche Sammlung Von Mikrooroganismen und Zellkulturen GmbH) 6995.

2.Humicola insolens cellulase. Detailed characterization of the Humicola insolens cellulase is found in WO 91/17243. The expression vector pCaHj418 used for cellulase expression is constructed by excision of the 925 bp cellulase coding region fragment from pCaHj201 by cleavage with restriction enzymes BamHI and SalI. This fragment is purified by preparative gel electrophoresis using standard techniques and ligated with pHD414 (described above) which has been prepared by treatment with BamHI and Xhol. The resulting expression vector, pCaHj418, contains the cellulase gene under the transcriptional control of the A. oryzae taka-amylase promoter and the A. niger glucoamylase terminator region.

-18- WO 95/15390 PCT/US94/13612 3.Humicola lanucinosa liDase. Isolation and expression of the H. lanuginosa lipase gene is reported in EP 305 216, and in US Serial No. 07/236,605, the contents of which are incorporated herein,by reference. Briefly, Total RNA is extracted from homogenized H. lanuginosa mycelium using methods as described by Boel et al. (EMBO J. 3: 1097-1102, 1984) and Chirgwin et al. (Biochemistry 18: 5294-5299, 1979). Poly(A)-containing RNA is obtained by two cycles of affinity chromatography on oligo(dT)-cellulose as described by Aviv and Leder (PNAS USA 69: 1408-1412, 1972). cDNA is synthesized with the use of methods described by Okayama and Berg (Molec. Cell. Biol. 2: 161-170, 1982), and with the vectors pSP62-K2 and pCDVI-PL described by Noma et al.

(Nature 319: 640-646, 1986). The synthesized cDNA is transformed into a hsdR-, M+ derivative of E. coli MC1000 (Casadaban and Cohen, J.Mol. Biol. 138: 179-207, 1980) to generate recombinant clones.

A mixture of 32 pentadecamer oligodeoxyribonucleotides A A A A A d( TT AA TG TT AA), G G G G G one of which is complementary to H. lanuginosa lipase mRNA in the region coding for Phe-Asn-Gln-Phe-Asn is synthesized on an Applied Biosystems, Inc. DNA synthesizer and purified by PAGE. Approximately 10,000 E. coli recombinants from the H. lanuginosa cDNA library are transferred to Whatman 540 paper filters. The colonies are lysed and immobilized as described by Gergen et al. (Nucleic Acids Res. 7: 2115-2135, 1979). The filters are hybridized with the 32p-labelled H.lanuginosa lipase-specific pentadecamer mixture as described by Boel et al.(EMBO J. 3: 1097-1102, 1984).

Hybridization and washing of the filters are done at 37'C -19- WO 95/15390 PCT/US94/13612 and 43'C, respectively, followed by autoradiography for 24 hours with an intensifier screen. Miniprep plasmid DNA is isolated from two hybridizing colonies, pHLL 702.3 and pHLL 702.4 by standard procedures (Birnboim and Doly, Nucleic Acids Res. 7: 1513-1523, 1979) and the DNA sequence of the DNA insert is established by the procedure of Maxam and Gilbert (Methods Enzymol. 65: 499-560, 1980).

To facilitate further construction work with the cDNA, DNA sequences containing unique restriction sites are added to the 5' and 3' ends of the cDNA as follows. pHLL 702.3 is digested with Sau961 which digests the cDNA in the 3' untranslated region and the resulting ends are filled in with E. coli DNA polymerase(Klenow fragment) and the four dNTPs. This DNA is subsequently digested with SacI which cuts the cDNA once just 3' to the initiating methionine codon. The resulting 0.9 kb cDNA fragment is purified by agarose gel electrophoresis; electroeluted and made ready for ligation reactions. As a 5' adaptor two oligonucleotides, 927 and 928, are synthesized. This adaptor is designed to add a HindIII and BamHI site just to the initiating Met codon of the cDNA. The to oligos are kinased with ATP and T 4 polynucleotide kinase, annealed to each other and ligated to the purified 0.9 kb cDNA sequence in a pUC19 vector digested with HindIII and HincII and purified on a 0.7% agarose gel. The resulting plasmid carries the H. lanuginosa lipase cDNA as a portable 0.9 kb BamHI fragment. After BamHI digestion and purification of the 0.9 kb cDNA fragment on an agarose gel, it is ligated to BamHI and phosphatased p775 to generate p960 in which the lipase cDNA is under transcriptional control of the TAKA promoter from A. oryzae and the AMG terminator from A.

niger.

I I WO 95/15390 PCT/US94/13612 To prepare pMHan37, p960 is modified by replacing basepairs of the 5'untranslated region of the A. oryzae TAKA promoter just upstream to the Humicola lanuginosa lipase gene by the corresponding region from the A. nidulans tpiA gene (McKnight et al. Cell 46: 143-147, 1986). A synthetic oligonucleotide containing the 5' untranslated region from the A. nidulans tpiA flanked at each end by 20 bases homologous to p960 sequences just outside the untranslated region is used 'in a PCR reaction together with another primer covering the BssHII-site in the TAKA promoter region.

as the mutagenization primer covers the BamHI site close to the ATG start codon, the PCR fragment is digested with BamHI and BSSHII and recloned into p960 digested with BssHII and partially with BamHI. 200 bases upstream to the ATG in -MHan37 is verified by DNA sequencing analysis. The sequence difference between p960 and pMHan37 is shown below: pMHan37 CATGCTTGGAGTTTCCAACTCAATTTACCTCTATCCACACTTCTCTT P960 CATGCTTGGAG...GATAGCAACCGACAACATCACATCAAGCTCTCC pMHan37 CCTTCCTCAACAATAAACCCCACAGGGG..GGATCC p 9 60 CTTCTCTGAATCCTCTATATACACAACTGGGGATCC The sequence of the primer covering the BamHI site:

GCTCCTCATGGTGGATCCCCAGTTGTGTATATAGACCATTGAGGAAGGAAGA

GAAGTGTGGATAGAGGTAAATTGAGTTGGAAACTCCAAGCATGGCATCCCTTGC 3' Coprinus cinereus Deroxidase. The isolation and cloning of the Coprinus cinereus peroxidase gene is described in WO 92/16634. Briefly, total RNA is extracted from homogenized Coprinus cinereus (IFO 8371) mycelium, collected at the time of maximum peroxidase activity as described by Boel et al. (EMBO J. 3: 1097-1102, 1984) and -21- :i: WO 95/15390 PCT/US94/13612 Chirgwin et al. (Biochemistry 18: 5294-5299, 1979).

Poly(A)-containing RNA is obtained by two cycles of affinity chromatography on oligo(dT)-cellulose as described by Aviv and Leder (PNAS USA 69: 1408-1412, 1972). cDNA is synthesized by means of a cDNA synthesis kit from Invitrogen according to the manufacturer's :-structions. About 50,000 E. coli recombinants from the Coprinus cinereus cDNA library are transferred to Whatman 540 paper filters. The colonies are lysed and immobilized as described by Gergen et al.

(Nucleic Acids Res. 7: 2115-2135, 1979). The filters are hybridized with the 32 p-labelled 430 base pair peroxidasespecific probe in 0.2 X SSC, 0.1% SDS. Hybridization and washing of the filters is' conducted at 65'C followed by autoradiography for 24 hours with an intensifier screen.

After autoradiography, the filters are washed at increasing temperatures followed by autoradiography for 24 hours with an intensifier screen. In this way, more than 50 positive clones are identified. Miniprep plasmid DNA is isolated from hybridizing colonies by standard procedures (Birnboim and Doly, Nucleic Acids Res. 7: 1513-1523, 1979) and the DNA sequence of the cDNA insert is determined by the Sanger dideoxy procedure (Sanger et al., PNAS USA 74: 5463-5467, 1977). The peroxidase cDNA fragment is excised from the vector by cleavage with HindIII/XhoI and is purified by agarose gel electrophoresis, electroeluted and made ready for ligation reactions. The cDNA fragment is ligated to HindIII/XhoI digested HD414 to generated pCip in which the cDNA is under transcriptional control of the TAKA promoter from A. oryzae and the AMG terminator from A. niger. pJVi9 is prepared from pCiP in that the restriction sites for SacI, KpnI, HindIII, PstI, SalI, and BamHI immediately preceding the peroxidase start codon are deleted.

-22- WO 95/15390 WO 95/5390 CT]/IJS94/1361 2 The cDNA sequence encoding the Coprinus cinereus peroxidase is shown in SEQ ID NO. 3 and 4.

6. Fuaariun solani cutinase. The cutinase expression vector pCaHj427 contains the Fusarium solani f. pisi cutinase coding region (Soliday et al., J. teriol. 171: 1942-1951, 1989) under the transcriptional r...ntrol of the A.

oryzae TAKA-amylase promoter and A. niger glucoamylase terminator regions(Christiansen et al.,Figure 1, supra).

This is used, with pToC9O as described above, to cotransform.

A. foetidus strains NRRL 341, NRRL 357, and CBS 103.14.

7. Candida antarctica lipase B. The exptession vector pMT1335 contains the Candida antarctica lipase B gene under the control of the A. oryzae TAKA amylase promoter and A.

glucoarnylase terminator regions(Christiansen et al., supra).

This vector is used with pToC90, as described above, to transform A. foetidus strains CBS103.14, NRRL 356, NRRL 357, and NFRRL 341.

A summary of the expression vectors prepared is provided in Table 1.

-23- WO 95/15390 WO 95/5390 CT/US94/13612 Table 1. Expression vectors used new host candidates for co-transformation of Vector Gene Promoter Terminator encoded pMHan37 H. lanuginosa TAKA-amylase AMG lipase

(HILL)

pAXX4O-1-1 H. insolens TAKA-amylase AMG xylanase pCaHj 418 H. inseZens TAKA-amylase M cellulase pi9Coprinus TAKA-amylase AMG cinereus peroxidase (CiP) pMT1229 Candida TAKA-amylase ANG antarctica lipase A pCaHj 427 Fusariun TAKA-amylase M solani cutinase pMT1335 Candida TAKA-amylase M antarctica lipase B III. Transformation of Aaperarillus hosts -24- WO 95/15390 WO 9$11390 PC /131612 The following general procedures are used in transformation of all the strains tested, with exceptions noted expressly: 100 ml of YPD (Sherman et al. Methods in Yeast Genetics, Cold Spring Harbor Laboratory, 1981) is inoculated with spores of the strain to be transformed and incubated with shaking at 34' C for 1-2 days. The mycelium is harvested by filtration through miracloth and washed with 200 ml of 0.6 M MgSO 4 The mycelium is suspended in 15 ml of 1.2 M MgS04, 10 mM NaH 2 POI, pH 5.8. The suspension is cooled on ice and 1ml of buffer containing 120 mg of Novozyme® 234 is added. After 5 minutes, 1 ml of 12 mg/ml BSA (Sigma type H25) is added and incubation with gentle agitation continued for 1.5-2.5 hours at 34' C until a large number of protoplasts is visible in a sample inspected under the microscope.

The suspension is filtered through miracloth, the filtrate is transferred to a sterile tube and overlaid with ml of 0.6 M sorbitol, 100 mM Tris-HC1, pH Centrifugation is performed for 15 minutes at 2500 rpm and the protoplasts are collected from th of the MgSO 4 cushion. Two volumes of STC (1.2 M sJrbitol, 10mM Tris-HCl pH 7.5, 10 mM CaCl 2 are added to the protoplast suspension and the mixture is centrifuged for five minutes at 1000 X g. The protoplast pellet is resuspended in 3 ml of STC and repelleted. This is repeated, and then the protoplasts are resuspended in 0.2-1 ml of STC.

100 .l of protoplast suspension is mixed with 5-25 ig of the appropriate DNA in 10 .l of STC. Each strain is cotransformed with an expression vector containing the structural gene of interest (see Table and a plasmid containing a selectable marker. Plasmids pToC90 and pToC186

M

WO 95/15390 PCT/US94/13612 contain the A. nidulans amdS gene, and are used for transformation and selection for growth on acetamide as the sole nitrogen source. Plasmids pJaL77 and pJaL154 are used for transformation and selection of resistance to hygromycin

B.

The mixtures are left at room temperature for minutes. 0.2 ml of 60% PEG 4000 (BDH 29576), 10 mM CaCl 2 and 10 mM Tris-HCl pH 7.5 is added and carefully mixed twice and finally 0.85 ml of the same solution is added and carefully mixed. The mixture is left at room temperature for 25 minutes, spun at 2500 X g for 15 minutes and the pellet resuspended in 2 ml of 1.2 M sorbitol. After one more sedimentation the protoplasts are spread on the appropriate plates. Protoplasts are spread on minimal plates (Cove, Biochem. Biophys. Acta 113: 51-56, 1966) containing 1.0 M sucrose, pH 7.0, 10 mM acetamide as nitrogan source (when amdS is the selection marker) and mM CsCl to inhibit background growth. The medium differs when hygB is the selection marker in the use of 10 mM sodium nitrate as nitrogen source, and the presence of 150 gg/ml hygromycin B. As an alternate to the final centrifugation step, resuspending and spreading, 8 ml of STC can be added and mixed with the protoplasts, and 3 ml are added to each of 3 selection plates, which are then swirled to cover the plate. After incubation for 4-7 days at 37'C colonies with conidia are picked, suspended in sterile water and spread for isolation of single colonies. This procedure is repeaced and spores of a single colony after the second reisolation are stored as a defined transformant.

IV. Evaluation of recombinant protein expression -26-

I

I Fl WO 95/15390 PCT/US94/13612 Following the above procedure, individual isolates of the selected strains are co-transformed with one of the expression vectors noted in Table 1, and one of the plasmids containing a selectable marker mentioned in the preceding example. Each of the co-tranformants is then tested in the appropriate assay to determine expression of the gene of interest.

A. Lipase Cotransformants for lipase activity(Candida antarctica lipase A and lipase B, and H. lanuginosa lipase) are cultured in a M400Da medium consisting of 50 g/l maltodextrin, 2g/l MgSO 4 .7H 2 0, 2g/l KH 2

PO

4 3g/l K 2 S0 4 4g/l citric acid, 8g/l yeast extract, 3g/l (NH 4 2 S0 4 0.5 ml Trace metal solution, 4 ml 50% urea solution (autoclaved separately), in 1 liter of distilled water, pH 6.0, and yeast extract made up in tap water to 800 ml. pH is adjusted to 4.5 before autoclaving. After autoclaving, 166 ml filter sterilized 1M urea (to give a final concentration of 10g/l) and 35.3 ml of filter sterilized 1M NaNO 3 (to give a final concentration of are added.

Lipase activity in culture filtrates is measured using p-nitrophenylbutyrate (pNB) as a substrate. A stock solution of pNB is prepared by adding 104.6 .1 of pNB to ml of DMSO. To each well of a microtiter plate is added p1 of 50mM Tris, pH 7. Ten pl of sample is added to each well, and mixed by shaking the microtiter plate for about one minute. Just prior to the assay, 20 .l o. pNB stock is combined with 970 .1 of 50 mM Tris buffer, pH 7 and mixed.

Immediately prior to assaying for lipase activity using a commercial plate reader, 100 pl of the pNB-Tris mixture are added to each sample well and absorbance measured at 405 nm over a 3 minute time period. The assay is temperature -27- I I WO 95/15390 PCT/US94/13612 sensitive, so an internal standard is used with each sample set. The slope determined for each sample directly correlates to lipase activity; the linear range of the assay is from about 0.005 to 5 gg lipase per milliliter. In this type of assay, the specific activity of H. lanuginosa lipase is determined to be approximately 4000 LU/mg, whereas the specific activity of Candida lipase A is about 400 LU/mg.

B, Xvlanase All xylanase transformants are grown in medium with the following composition, in g/l: maltodextrin, 50; MgSo 4 .7H 2 0,

KH

2

PO

4 10.0; K 2 S0 4 2.0; citric acid 2.0; yeast extract, 10.0; AMG trace metal solution, 0.5ml; urea, All the transformants are grown as submerged, agitiated cultures at 34'C.

Xylanase activity in culture broths is determined using 0.2% AZCL-xylan (Megazyme Co. Australia) suspended in a citrate phosphate buffer, pH 6.5. The culture fluid is diluted, usually 100-fold, and 10 pg of diluted culture fluid is mixed with 1 ml of 0.2% AZCL-xylan substrate. The mixture is incubated at 42'C for 30 minutes. The reaction mixture is mixed well every 5 minutes. At the end of incubation, the undigested substrate is precipitated by cer rifugation at 10,000 rpm for 5 minutes. The blue dye released from this substrate is quantified by absorbance at 595 nm and the amount of enzyme activity in the culture broths is calculated from a standard made with an enzyme preparation with known activity. An endoxylanase unit (EXU) is determined relative to an enzyme standard prepared under identical conditions.

C. Cellulase Cellulase transformants are grown in MY50 medium g/1 maltodextrin, 2g/l MgSO 4 .7H 2 0, 10g/l KH 2

PO

4 2g/l K 2 S0 4 -28- WO 95/15390 PCTIUS94/13612 2g/l citric acid, 10 g/l yeast extract, 0.5 ml trace metals, g urea, at 34'C as submerged cultures.

Cellulase activity is measured using 0.2% AZCL-HEcellulose (Megazyme) as a substrate suspended in 0.1M citrate-phosphate buffer at pH 6.5. The culture is diluted in 0.1M citrate buffer, pH 6.5, and 10 Rl of diluted culture fluid is mixed with 1 ml of 0.2% AZCL-HE-cellulose. The mixture is incubated at 42'C for 30 minutes with shaking every 5 minutes. After incubation, the undigested substrate is pelleted by centrifugation at 10,000 rpm for 5 minutes.

The blue color in the supernatant is quantified spectrophotometrically at 595 nm, and the amount of enzyme activity is determined from a standard curve made with a known cellulase standard. Endocellulase units (ECU) are determined relative to an enzyme standard prepared under identical conditions.

D.Peroxidase Cotransformants for CiP are cultured in a M400Da medium consisting of 50 g/l maltodextrin, 2g/l MgSO 4 .7H 2 0, 2g/l

KH

2

PO

4 3g/l K 2

SO

4 4g/l citric acid, 8g/l yeast extract, 3g/l (NH 4 2 S0 4 0.5 ml Trace metal solution, 4 ml 50% urea solution (autoclaved separately), in 1 liter of distilled water, pH Peroxidase expression is monitored using ABTS as a substrate or by rocket immunoelectrophoresis compared to a standard of known concentration. For immunodiffusion, 1% agarose in TM buffer (1.3g/l Tris base, 0.6 g/l maleic acid, pH 7) is melted and cooled to 55'C. 400 il of rabbit antiserum against CiP is mixed with 15 ml of agarose, spread and solidified on a 10cm x 10 cm plate. CDM agar(lg/l K 2

PO

4 g/l sucrose, 0.3g/1 NaNO 3 0.05g/l KCl, 0.05g.1 -29- WO 95/15390 PCT/US94/13612 MgSO 4 .7H 2 0, 0.001g/l FeSO 4 -7H 2 0, 0.001g/l ZnSO 4 .7H 2 0, 0.0005g/l CuSO 4 .5H 2 0, 20g/l maltrodextrin, 15g/l agarose) culture samples of CiP transformants grown for 7 days at 37'C in CDM are applied to 5 mm holes made in the agar plate. The protein is allowed to diffuse for 48 hours. The plate is stained with coomassie blue R to visualize the protein-antibody precipitation zone. As a standard solution, purified is used at the concentrations of 500, 1000, and 2000 peroxidase units (PODU)/ml; 1 PODU is the amount of enzyme which under the standard conditions catalyzes the conversion of 1 imol hydrogen peroxide per minute.

To determine peroxidase by the ABTS (2,2'-azinobis(3ethylbenzothiazoline-6-sulfonate) method, 2 ml of 2mM ABTS[0.110 g ABTS, Boehringer Mannheim No. 102946 in 0.1 M phosphate buffer (10.63 g disodium hydrogen phosphate dihydrate p.a. M6580, 5.49 potassium dihydrogenphosphate p.a. M4873 in demineralized water up to 1 liter) is preheated for 10 minutes at 30'C. To this is added 10.6 mM

H

2 0 2 solution(1.0 g Perhydrol Suprapur® 30% H 2 0 2 Merck 7298 in demineralized water up to 25 ml), and 0.2 ml of sample or standard (standard 5.0 mg Kem-En-Tec, grade 1, No. 4140A in phosphate buffer up to 25 ml, diluted 400 times) in a glass tube. The reaction is conducted at 30'C for three minutes. The absorbance of the sample is measured at 418 nm against milli Q demineralized water and followed for three minutes. The best reflection of peroxidase activity is given by the absorbance difference: AA A( 75 sec)-A(15 sec). The absorbance difference should lie between 0.15-0.30 corresponding to 0.05-0.1 PODU/ml in the sample.

E. Cutinase. Selected transformants are screened on tributyrin agar(13% maltodextrin, 0.3% MgSO 4 .7H 2 0, WO 95/15390 PCT/US94/13612

KH

2

PO

4 0.4% citric acid, 0.6% K 2 S0 4 0.5% yeast extract, 1% tributyrin, 1% urea, 0.3% NaNO3, 0.5ml trace metals, 2% agar, pH 4.5) for the ability to produce extracellular cutinase, as detected by the clearing of tributyrin.

The strains producing the largest clearing zones are evaluated in shake flask cultures using M400Da medium(described above) at 37'C. Extracellular cutinase activity is determined using p-nitrophenylbutyrate as described above. Among all the transformants, the highest cutinase producer is an A. foetidus CBS 103.14 transformant designated CBS 103.14/CaHj427.1. Over the course of three days in shake flask culture, this transformant produces extracellulsar cutinase at leveles that are roughly eequal to the amount produced by an A. oryzae control transformant Qu-1-l. In small scale(2 liters) fermentation, this transformant produces approximately one gram per liter of extracellular cutinase.

VI. Results and Discussion Table 2 summarizes the expression levels of various heterologous fungal enzymes produced by the alternative host of the present invention. It can be seen from the table that all strains were successful in expression of at least one of the genes of interest. In several cases, the new host strains give unexpectedly high levels of enzyme. For example, at least one strain of A. foetidus yields surprisingly high levels of HLL in shake flask cultures (approximately one gram per liter), demonstrating that these species are capable of expressing large quantities of heterologous protein. In fact, the levels of production of HLL produced by these transformants appears to be as good as or better than the best primary transformants of A. oryzae, -31- WO 95/15390 WO 9515390PCT/US94/13612 such as HL-23. Similarly, two strains exhibit similar high levels of expression of lipase B.

A. foetidus also is shown to be an excellent host for the production of xylanase compared with A. oryzae .The shake flask yields for this enzyme are approximately twice the levels seen for the best A. oryzae transformants.

Table 2.

strain Expression of selection fungal enzymes in A. .foetidus Gene No. Expression expressed transform, yield (No. (shake positive) flask) A. foetidus amdS jCiP 42(1) 0.1 g/l E46 amdS JHLL 42(22) 0.06-0.1011 A. foetidus amdS HLL 25(11) 0.4g11 CBS 103.14 amdS lipase B 58(35) A.foetidus amdS EiLL 12(1) 0.5 g/I var pallidus amdS lipase B 151(60) 1.25g/l NRRL 356 A. foetidus amdS HLL 34(26) 1.0-1.5g/1 N0953 arndS xylanase 28(16) 0.08g/1 hygB Xylanase 17(6) 0.12g/l amdS Cellulase 39(16) 0.4g/1 A. oxyzae amdS CiP control 0.25g/l A 1560 control amdS HLL control lg/1 (best primary amdS Cellulase control 0.75-lg/l transformant amdS xylanase control 0.lg/1 from over 20 amdS lipase A control 0.3g/1 screened) -32- 33 As can be seen from the data presented, a number of strains of A. foetidus species can produce substantial quantities of a variety of heterologous proteins, and therefore are established as being useful as alternatives to the standard A. niger and A. oryzae host systems, and in some cases may be preferable to the use of these known hosts.

Deposit of Biological Materials The following biological materials have been deposited in Agricultural Research Service Culture Collection (NRRL) 1815 North University Street, Peoria, Illinois 61604 on 26 November 1993.

Cell line Accession No.

E. coli DH5a containing pJVi9 NRRL B-21161 E. coli DH5a containing pCaHk418 NRRL B-21162 E. coli DH5a containing pMT1229 NRRL B-21163 h E. coli DH5a containing pAXX40-1-1 NRRL B-21164 E. coli DH5oa containing pMHan37 NRRL B-21165 15 The following biological material has been deposited in Agricultural Research Service Culture Collection (NRRL) 1815 North University Street, Peoria, Illinois 61604 on 2 December 1993.

A. foetidus E46 NRRL B-21167 A new deposit of NRRL B-21167 was made on 25 January 1994 under number 20 NRRL B-21167N.

[N:\L1BFF10284:SAK WO 95/15390 PCT/US94/13612 SEQUENCE LISTING GENERAL INFORMATION:

APPLICANT:

NAME: Novo Nordisk Biotech, Inc.

STREET: 1445 Drew Avenue CITY: Davis, California COUNTRY: United States of America POSTAL CODE (ZIP): 95616-4880 TELEPHONE: (916) 757-8100 TELEFAX: (916) 757-0317 (ii) TITLE OF INVENTION: ASPERGILLUS FOETIDUS EXPRESSION SYSTEM (iii) NUMBER OF SEQUENCES: 4 (iv) CORRESPONDENCE ADDRESS: ADDRESSEE: Novo Nordisk of North America, Inc.

STREET: 405 Lexington Avenue, Suite 6400 CITY: New York STATE: New York COUNTRY: USA ZIP: 10174-6201 COMPUTER READABLE FORM: MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM: PC-DOS/MS-DOS SOFTWARE: PatentIn Release Version #1.25 (vi) CURRENT APPLICATION DATA: APPLICATION NUMBER: US FILING DATE: 29-NOV-1994

CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION: NAME: Lowney Dr., Karen A.

REGISTRATION NUMBER: 31,274 REFERENCE/DOCKET NUMBER: 4119.204-WO (ix) TELECOMMUNICATION INFORMATION: TELEPHONE: 212-867-0123 TELEFAX: 212-867-0298 INFORMATION FOR SEQ ID NO:1: SEQUENCE CHARACTERISTICS: LENGTH: 1123 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: ORGANISM: Humicola insolens INDIVIDUAL ISOLATE: DSM 6995 -34- I I

I

WO 95115390) PCT/US94/13612 (ix) FEATURE: NAME/KEY: CDS LOCATION: 126. .806 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: AATACGACTC ACTATAGOGA ATATTAAGCT TOOTACCGAG CTCOGATCCA CTAGTAACGG CCGCCAGTGT GCTCTAAAGC GCCGCTTCTT CAGTTGTA CGATCATCCA GCAACTCGCA 120 GCACC ATO GTC TCG CTC AAG TCT GTC CTC GCG GCC GCC ACO GOT GTG 167 Met Vai Ser Leu Lys Ser Val Leu Ala Ala Ala Thr Ala Val 1 5 AOC TCT GCC ATT GCT GCC CCT TTT GAC TTC GTT CCT COG GAC AAC TCG 215 Ser Ser Ala Ile Ala Ala Pro Phe Asp Phe Val Pro Arg Asp Asn Ser 20 25 ACG GCO CTT CAG OCT CGA CAG OTO ACC CCC AAC GOC GAO GOC TOG CAC 263 Thr Ala Leu Gln Ala Arg Gin Val Thr Pro Asn Gly Glu Gly Trp His 40 AAO 000 TAC TTC TAC TCG TOG TOG TCC GAC GOC OGA 000 CAG OTT CAG 311 Asn Oly Tyr Phe Tyr Ser Trp Trp Ser Asp Gly Gly Gly Gin Val Gin 55 TAO ACC AAC CTC GAG 000 AGC CGC TAO CAG OTC AGA TOO OGT AAC ACC 359 Tyr Thr Asn Leu Glu Gly Ser Arg Tyr Gin Val Arg Trp Arg Asn Thr 70 000 AAO TTO OTO GOT GOT AAG GOT TOG AAO CO OGA ACC GOC COO ACO 407 Gly Asn Phe Val Gly Oly Lys Gly Trp Asn Pro Gly Thr Gly Arg Thr 85 ATO AAO TAO 000 000 TAO TTO AAO CCC CAG 000 AAO 000 TAO OTOG 000 455 Ile Asn Tyr Gly Gly Tyr Phe Asn Pro Gin Giy Asn Gly Tyr Leu Ala 100 105 110 OTO TAO 0CC TOG ACC 000 AAC COG OTO OTO GAG TAO TAT OTO ATO GAO 503 Val Tyr Gly Trp Thr Arg Asn Pro Leu Val Giu Tyr Tyr Vai Ile Giu 115 120 125 TOG TAO 000 ACO TAO AAT 000 000 AGO CAG OCT CAG TAO AAG 000 ACA 551 Ser Tyr Gly Thr Tyr Asn Pro Gly Ser Gin Ala Gin Tyr Lys Gly Thr 130 135 140 TTO TAT ACC GAO 000 OAT CAG TAT GAO ATO TPIT OTO AGO ACC 000 TAO 599 Phe Tyr Thr Asp Gly Asp Gin Tyr Asp Ile Phe Val Ser Thr Arg Tyr 145 150 155 AAC CAG COO AGO ATO GAO 000 ACC 000 ACO TTC CAG CAG TAO TOG TOT 647 Asn Gin Pro Ser Ile Asp Giy Thr Arg Thr Phe Gin Gin Tyr Trp Ser 160 165 170 ATO COO AAG AAO AAG COT OTO GGA 000 TOG OTO AAO ATO CAG AAC CAC 695 Ile Arg Lys Asn Lys Arg Val Gly Gly Ser Val Asn Met Gin Asn His 175 180 185 190 TTO AAO 000 TOG CAG CAG CAC GGA ATO COG OTO 000 CAG CAC TAO TAO 743 Phe Asn Ala Trp Gin Gin His Gly Met Pro Leu Gly Gin His Tyr Tyr 195 200 205 CAG OTO OTO 000 AGO GAG 000 TAO CAG AGO AGT 000 GAG TOO GAO ATO 791 Gin Val Val Ala Thr Giu Gly Tyr Gin Ser Ser Gly Giu Ser Asp Ile 210 215 220 WO 95/15390 PCT/US94/i3612 TAT GTT CAG ACA CAC TAAGCGACGC ACCCCGCAT ACAAAAGTCC GTTAGTTACA 846 Tyr Val Gin Thr His 225 TGCCGGGTGA AAAGGAGCTA TGCTATGGGC GCGGCAAGAC AGTCACTGCC ATCATGTCAG 906 TCGGAAAAAC ATCGCAGAAT GGTGTTCTTC CGCATGGGAA TTGCCTGAGA CATCTCTCTG 966 GCCATGCATT TTCTTGTTCA TACTTGTTGG GCAGTCGCTT GGTTGCCTAC CTCTGTTTAT 1026 AGTCATTCTT TTTCTGTACA TACTTCTTCC TCAACTTTAG AGCACACTGG CGGCCGCTCG 1086 AGCATGCATC TAGAGGGCCG CATCATGTAA TTAGTTA 1123 INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS: LENGTH: 227 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ Met Val Ser Leu Ala Ile Leu Glh Tyr Phe Asn Leu Phe Vai Tyr Gly Gly Trp Gly Thr 130 Thr Asp 145 Pro Ser Lys Asn Ala Trp Val Ala 210 Lys Pro Gin Trp Ser Lys Phe Asn Pro Gln Gly 165 Val His Ser Val Leu Ala Asp Thr Ser 55 Tyr Trp Pro Leu Ser 135 Asp Arg Gly Met ID NO:2: Ala Ala Thr 10 Pro Arg Asp Gly Giu Gly Gly Gly Gin Arg Trp Arg 75 Gly Thr Gly 90 Asn Gly Tyr Tyr Tyr Val Gin Tyr Lys 140 Vai Ser Thr 155 Gln Gin Tyr 170 Asn Met Gin Gly Gln His Gly Giu Ser 220 Val Ser His Gin Thr Thr Ala 110 Glu Thr Tyr Ser His 190 Tyr Ser Thr Asn Tyr Gly Ile Val Ser Phe Asn Ile 175 Phe Gin Ser Ala Gly Thr Asn Asn Tyr Tyr Tyr Gin 160 Arg Asn Val Thr Giu Gly Tyr Gin Ser Ser 215 Asp Lie Tyr Val -36i I -~i WO 95/15390 ]PCT/l)S94/13612 Gln Thr His 225 INFORMATION FOR SEQ ID NO:3: SEQUENCE CHARACTERISTICS: LENGTH: 1307 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: GRGANISM: Coprinus cinereus (ix) FEATURE: NAME/KEY: CDS LOCATION: 5..1096 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: TACT ATG AAG CTC TCG CTT TTG TCC ACC TTC GCT GCT GTC ATC ATC GGT 49 Met Lys Leu Ser Leu Leu Ser Thr Phe Ala Ala Val Ile Ile Gly 1 5 10 GCC CTC GCT CTA CCC CAG GGT CCT Ala

CCC

Pro

GTT

Val

AGC

Ser

TTT

Phe

GAT

Asp

AAT

Asn

AAC

Asn

GGC

Gly Leu

CAG

Gin

GAT

Asp

CGC

Arg

GCG

Ala

ATC

Ile

CTC

Leu 115

GTC

Val

AAC

Asn GGA GGA GGC Gly Gly Gly AGC CAG TGC Ser Gin Cys 40 TTC TAC CAA Phe Tyr Gin ATT GTT TTC Ile Val Phe GGT CAA TTC Gly Gin Phe 90 AAC ATC GAA Asn Ile Glu 105 GAA GCC CTC Glu Ala Leu 120 CTC ATC CAA Leu Ile Gin CCC CGA CTT Pro Arg Leu

GGG

Gly

TGC

Cys

GGG

Gly

CAT

His

GGT

Gly

TTG

Leu

CGC

Arg

TTC

Phe

GAG

Glu 155 TCA GTC Ser Val GTC TGG Val Trp TCC AAG Ser Lys GAC GCG Asp Ala GGT GGA Gly Gly GCC TTC Ala Phe GCG GTC Ala Val 125 GCC ACT Ala Thr 140 TTC TTG Phe Leu ACT TGC Thr Cys TTC GAC Phe Asp TGT GAG Cys Glu ATC GGA Ile Gly GGA GCT Gly Ala CCG GCT Pro Ala 110 GGT ATC Gly Ile GCC GTC Ala Val ACG GGC Thr Gly -37m WO 95/15390 WO 9511539 C'IWS9413612

AGG

Arg 160

GGA

G

2 .y

AGC

Ser

CAG

Gin

CCT

Pro

ACC

Thr 240

TTC

Phe

TCC

Ser

ATG

Met

TTC

Ph~e

GTG

Val 320

GAT

Asp

GC

AGC

Ser

AAC

Asn

OCT

Pro

GAG

Giu

CAA

Gin 225

ACT

Thr

OCT

Pro

CGA

Arg

GC

Gly

GAC

Asp 305

TC

Ser

ATC

Ile

TCA

17.AC Asn

ACT

Thr

GAT

Asp

GGT

Gly 210

GTT

Val

CAG

Gln

GGC

Gly

ACC

Thr

CAG

Gin 290

AGG

Arg

AAC

Asn

GAG

Giu

GGC

AGT TCC CAA Ser Ser Gin 165 CCC TCC CCT OCT Pro Ser Pro Pro

GTC

Val

GAA

Giu 195

TTG

Leu

TTC

Phe

CCT

Pro

GAA

Giu

GCC

Ala 275

OGA

Arg

AAO

Asn

AAC

Asn

GTT

Val

CCT

ACT

Thr 180

GTA

Vai Asn

GAT

Asp

GGC

Gly Phe 260

TGO

Cys

TAC

Tyr

GC

Ala

GCT

Ala

TCG

Ser 340

CTC

GCT

Ala

GTT

Val

TCG

Ser

ACC

Thr

OCT

Pro 245

CGC

Arg

OGA

Arg Xaa

OTO

Leu

GOT

Ala 325

TGC

Cys

CCC

ATO

Ile

GAO

Asp

CO

Ala

CAG

Gin 230

TOT

Ser

ATG

Met

TG

Trp Xaa

ACC

Thr 310

OCT

Pro

CG

Pro

TOO

GAT

Asp

OTT

Leu 200 Phe

TAO

Tyr

CO

Gly

TOO

Ser

TOO

Ser 280

ATG

Net

TGC

Cys

ATO

Ile

GAG

Giu

GOT

OGT

Arg 185

GOT

Ala

AGG

Arg

ATT

Ile

TTT

Phe

GAT

Asp 265

ATG

Met

GC

Ala

TOT

Ser

OCT

Pro

OCT

Pro 345

OCT

TOG

Ser 170

ATG

Met

CG

Ala

TOT

Ser

GAG

Giu

GCA

Ala 250

GOT

Ala

ACC

Thr

AAG

Lys

GAO

Asp

GGT

Gly 330

TTC

Phe

GOT

TTG ATO COO GGT Leu Ile Pro Giy

GCC

Gly

OAT

His

COT

Pro

ACC

Thr 235

GAG

Glu

OTO

Leu

AGO

Ser

ATG

Met

GTT

Va 1 315

GGO

Gly

OCT

Pro

OCT

GAT

Asp AG'r Ser

TTG

Leu 220

TTG

Leu

GAG

Glu

COO

Pro 175

TTC

Phe

TOT

Ser

ACC

Thr

GGT

Gly

COO

Pro 255

GAO

Asp

OIT

Val

GGO

Gly

GOT

Ala

CAT

Asp 335

ACC

Thr TTG GOT OGO Leu Ala Arg 270 AGO AAT GAA Ser Asn Clu 285 TOT CTT OTO Ser Val Leu 300 ATT OCT TOT Ile Pro Ser OTT ACT GTC Leu Thr Val GAA ATT GOT Glu Ile Ala 350

TGATCTCCTC

529 577 625 673 721 769 817 865 913 961 1009 1057 1103 1163 1223 1283 1307 Ala Ser Gly Pro Leu Pro Se,: Leu Ala Pro Ala Pro AAGATGGTAO ATCCTGOTCT OTCATCATCO OTOTTAGOTA ATCTATGCAG TTTCTGTTCT ATOACCACAG GAAGCAAGAA TGAGCAGAAA TCAGCAAAAA AATAAATCAG TATACTACAG GTGTCAGAAG TAAGTACGAC TCGG INFORMATION FOR SEQ ID NO:4: Wi SEQUENCE CHARACTERISTICS: LENGTH: 363 amino acids TYPE: amino acid TOPOLOGY: linear TTTATCCAAT OTATOTACOT AGAA.AAACAA CAATGCAACG TAATGAGGCC AGTTTGCGTG -38-

I

WO 9VI1539()P /$9/31 VCVUS94/13612 (ii) MOLECULE (xi) SEQfT1NCE TYPE: protein DESCRIPTION% SEQ ID NO:4: Met Leu Gly Leu Pro Ser Gly Gj-y His Met 145 Ser Asn Pro G1u Gin '125 Thr Pro Arg Gly Asp 305 Leu Ser Thr Phe Ala Ala Val Ile Ile Gly Pro Ser Asn Thr Asn Leu Arg 70 Ala Ala His Ser Thr Val Gly Asp 135 Gly Ser 150 Pro Ser Ile Leu Asp Leu Ala Ile 215 Gin Phe 230 Ser Leu Met %Arg Trp Gin Xaa Xaa 295 Thr Asp 310 Gly Ser Phe Ile Gly Asn Giu Leu Pro Pro Asp Leu 200 Phe Tyr Gly Ser Ser 280 Yet CyS Gly Cys Gly H is 75 G.1y Leu Arg Phe Glu 155 Leu Gly His Pro hr -3 5 Giu Leu Ser Met Val 315 Thr Phe Cys Ile Gly Pro 110 Gly Ala Thr Gly Gly 190 Ala Ser Lys Ser Arg 270 Glu Leu Ser Gly Ala Cys Pro Asp Val Glu Ser Gly Phe Ala Asp Ala Asn Ile Asn Val Gly Gly Arg 160 Pro Gly 175 Phe Ser Ser Gin Thr Pro Gly Thr 240 Pro Phe 255 Asp Ser Val Met Gly Phe Ala Val 320 -39- WO 95/15390 PCr/US94/I 3612 Ser Asn Asn Ala Ala Pro Val. Ile Pro Gly Gly Leu Thr Val Asp Asp 325 330 335 Ile Glu Val Ser Cys Pro Ser Glu Pro Phe Pro Glu Ile Ala Thr Ala 340 345 350 Ser Gly Pro Leu Pro Ser Leu Ala Pro Ala Pro 355 360

Claims (22)

1. An Aspergillus foetidus host cell comprising a nucleic acid sequence encoding a heterologous enzyme operably linked to a promoter.

2. The host cell of Claim I in which the enzyme is selected from the group consisting of a catalase, laccase, oxidase, phenoloxidase, oxidoreductases, cellulase, xylanase, peroxidase, lipase, esterase, cutinase, protease, aminopeptidase, carboxypeptidase, phytase, pectinase, pectin lyase, amylase, glucoamylase, alpha- galactosidase, beta-galactosidase, alpha-glucosidase, beta-glucosidase, mannosidase, isomerase, invertase, ribonuclease, chitinase, and deoxyribonuclease.

3. The host cell of Claim 1 in which the promoter is a fungal promoter.

4. The host cell of Claim I in which the enzyme is a fungal enzyme. The host cell of Claim I which also comprises a selectable marker.

6. The host cell of Claim 5 in which the marker is a selected from the group 0* consisting of argB, trpC, pyrG, andS, and hygB.

7. The host cell of Claim 3 in which the promoter is selected from the group consisting of the promoters from A. oryzae TAKA amylase, Rhizomucor miehei aspartic Sproteinase, A. niger glucoamylase, A. niger neutral ox-amylase, A. niger IN:\LI1FF10284:SAK I WO 95/15390 PCT/US94/13612 acid stable a-amylase, Rhizomucor miehei lipase and a native A foetidus promoter.

8. An Aspergillus foetidus host cell comprising a nucleic acid sequence encoding a heterologous fungal enzyme operably linked to a fungal promoter, and a selectable marker.

9. The cell of Claim 8 in which the enzyme is selected from the group consisting of a catalase, laccase, phenoloxidase, oxidase, oxidoreductases, cellulase, xylanase, peroxidase, lipase, hydrolase, esterase, cutinase, protease and other proteolytic enzymes, aminopeptidase, carboxypeptidase, phytase, lyase, pectinase and other pectinolytic enzymes, amylase, glucoamylase, a- galactosidase, P-galactosidase, a-glucosidase, 3- glucosidase, mannosidase, isomerase, invertase, transferase, ribonuclease, chitinase, and deoxyribonuclease. The host cell of Claim 9 which comprises a fungal enzyme selected from the group consisting of a lipase, a xylanase and a cellulase.

11. The host cell of Claim 8 in which the promoter is selected from the group consisting of the promoters from A. oryzae TAKA amylase, Rhizomucor mniehei aspartic proteinase, A. niger glucoamylase, A. niger neutral a-amylase, A. niger acid stable a-amylase, Rhizomucor miehei lipase, and a native A. foetidus promoter.

12. The host cell of Claim 8 in which the selectable marker is selected from the group consisting of argB, trpC, pyrG, amdS, and hygB. 42 I IC l- rrrrrrrm*-- WO 95/15390 PCT/US94/13612

13. The host cell of Claim 8 which comprises a nucleic acid sequence encoding a fungal lipase, operably linked to a TAKA-Pmylase promoter, and further comprising an amdS marker.

14. The host cell of Claim 8 which comprises sequence encoding a fungal xylanase, operably TAKA-amylase promoter or an AMG promoter, and comprising an amdS or hygB marker. a nucleic linked to further acid a A method for producing an enzyme of interest which comprises culturing an Aspergillus foetidus host cell comprising a nucleic acid sequence encoding a heterologous protein operably linked to a promoter, under conditions which permit expression of the protein, and recovering the protein from culture.

16. The method of Claim eukaryotic enzyme.

17. The method of Claim fungal promoter.

18. The method of Claim enzyme. 15 in which the protein is a 15 in which the promoter is a 16 in which the protein is a fungal

19. The method of Claim 16 in from the group consisting of a which the catalase, enzyme is selected laccase, cellulase, esterase, cutinase, phenoloxidase, oxidase, oxidoreductases, xylanase, peroxidase, lipase, hydrolase, protease and other proteolytic enzymes, aminopeptidase, carboxypeptidase, phytase, lyase, pectinase and other 43 M pectinolytic enzymes, amylase, glucoamylase, a-galactosidase, p-galactosidase, a-glucosidase, p-glucosidase, mannosidase, isomerase, invertase, transferase, ribonuclease, chitinase, and deoxyribonucl.,se. The method of Claim 15 which also comprises a selectable marker.

21. The method of Claim 20 in which the marker is selected from the group consisting of argB, trpC, pyrG, amdS, and hygB.

22. The method of Claim 15 in which the promoter is selected from the group consisting of the promoters from A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger glucoamylase, A. niger neutral a-amylase, A. niger acid stable a-amylase, and Rhizomucor miehei lipase.

23. An Aspergillus foetidus host cell comprising a recombinant nucleic acid sequLence encoding a homologous enzyme operably linked to a promoter.

24. A method for producing an eniyme of interest which comprises culturing an Aspergillusfoetidus host cell comprising a recombinant nucleic acid sequence encoding a homologous enzyme operably linked to a promoter, under conditions which permit S expression of the enzyme, and recovering the enzyme from culture.

25. An Aspergillus foetidus host cell, substantially as hereinbefore described with reference to any one of the Examples.

26. A method for producing an enzyme of interest which comprises culturing 20 an Aspergillus foetidus host cell comprising a nucleic acid sequence encoding a heterologous protein operably linked to a promoter, substantially as hereinbefore described with reference to any one of the F- u iples. Dated 26 February, 1998 *o Novo Nordisk Biotech, Inc. Patent Attorneys for the Applicant/Nominated Person SPRUSON FERGUSON IN:\LIBFF10284:SAK