CA2178008A1 - Aspergillus foetidus expression system - Google Patents

Abstract

The present invention relates to a novel expression system in which Aspergillus foetidus host cells are used to express heterologous enzymes.

Description

~ WO95~15390 21 78008 PCI/US94113612 .
ASP13RGI~LrrS FO~L1L~US EXPRES~ION 8YSTEM

Field of ~hP TnvPnt ion The present invention relates to host cells useful in the production of re~- ~ ;n~nt proteins. In particular, the 10 invention relates to fungal host cells of the genus A6per~illus, which can be used in the high-level expression of rrrr,mh; n;int proteins, especially enzymes .
3~rkrrQlln~ of th~o Jnv~ntion The use of rer~ '- ; n~nt host cells in the expression of heterologous proteins has in recent years greatly simplified the production of large quantities of commercially valuable proteins, which otherwise are obtainable only by purification from their native sources. Currently, there is 20 a varied selection of expression systems from which to choose for the production of any given protein, ino~ in~
prokaryotic and eukaryotic hosts. The selection of an appropriate expression system will often depend not only on the ability of the hQst cell to produce adequate yields of 25 the protein in an active state, but also to a large extent may be governed by the intended end use of the protein.
Although ~ n and yeast cells have been the most commonly used eukaryotic hosts, filamentous fungi have now begun to be recognized as very useful as host cells for 30 rr,: l-;n~nt protein production. Among the filamentous fungi which are currently used or proposed for use in such processes are l~ 1LU~ UUla ~ ssa, A~ m chrysogenum,

2 1 7 8 0 0 8 Pcr/USs4/13612 ~
Tolypocladium geodes, Mucor circinelloides and Trichoderma reesei. In addition, certain species of the genus Aspergillus have been used effectively as host cells for re~ l n~nt protein production. Asper~illus is a 5 deuteromycete fungus characterlzed by an aspergillum consisting of a ~rni~irlsrore stipe t~rmin~tinrJ in a vesicle, which in turn bears one or two layers of synchronously formed sp~ i7ed cells, variously referred to as sterigmata or r~ q, and asexually formed spores 10 referred to as conidia. The species Asperç1illus nidulans has been reported to be transformed with recombinant ~l ~rn~i ~lr. (sallance, et al . siochem. siOphys . Res . Com-m-~ 112:
284-289, 1983), but transfnrr~t; r,n was found to occur at fairly low fre~uency. soth Asper~illus niger and 15 Asper~illus oryzae have also been described as being useful in rerr,mhi ni~nt production of proteins . However, other species of Aspergillus have not been shown to be useful in expression of heterologous protein, and in fact, because of poor expression, and/or excessive prr~ rtinn of proteases or=
2 O mycotoxins, not all :species of Asper~illus are suitable as host cells for this purpose, nor is this ability predictable from one species to the next. Asper~illus foetidus has been used for the expression of a hepatitis B antigen IHongdi, et al. Acta Microbiologica Sinica 30: 98=104, 1990), but has 2 5 not been reported in being useful in expression of any other types of protein, and has not been reported as capable of producing protein in high yields. An ideal expression system is one which is substantially free of protease and mycotoxin prr~lt1rt i ~n and large amounts of other endogenously 30 made secreted proteins, and which is capable of higher levels of expression than known host cells. The present inveDeion r~ow provi~es ~ ~ew A6pergi11u~s e7cpres~ion sy 95/15390 ~ PCTIUS9~113612 which fulfills thesè rerluirements, and which is capable of expressing substantial r~uantities of fungal enzymes.
S f of th~ Invent; on The present invention provides an Aspergillus foetidus host cell rr,nt~;n;nr a nucleic acid ser~,uence encoding a heterologous enzyme. By ~heterologous enzyme~ is meant one which is not native to the host cell, or a native enzyme in which modifications have been~made to alter the native sequence . In a pref erred embodiment the protein is a heterologous fungal enzyme. The nucleic acid se~uence is operably linked to a suita~le promoter ser~uence, which is capable of directing transcription of the nucleic acid se~uence in the chosen host cell.
The invention also relates to a method for rec, ' in~nt production of enzymes, the method comprising culturing an Aspergillus foetidus host cell rr,nt~;nlnr a nucleic acid sequenced encoding a heterologous enzyme, under conditions conducive to expression of the enzyme, and recovering the enzyme from the culture. In a preferred embodiment, the enzyme is a fungal enzyme.
The host cells and methods of ~he present invention are unexpectedly more efficient In the rec '-;n~nt production of various fungal enzymes than are other known Aspergillus species, such as fi. niger or ~. o~zae.
Det~; 1 ed Descri~tion of th-~ Inv,-nt; on The species Aspergillus foetidus belongs to the Nigri Secti4n of the genus Aspergillus~ The members of the

3 0 section Nigri, as ~ ,1; ~; ~(1 by Aspergillus niger, are characterized by radiate conidial heads and conidial masses in shades of black; globose vesicles; stipes which are WO 95~15390 2 1 7 8 0 0 8 PCT/US94J13612--smooth and hyaline, or pigmented below the vesicle; metulae present or absent, and often Figme~ted (~The Genus Aspergillus", by K.B. Raper and D.I. Fennel, The Williams &
Wikins Company, Baltimore, 1965). Mutants of these strains 5 differing in spore color and ornAm~ntAt;r~n, or other micromorphological characters also would be inf~lllfl~fl i~ this section. Within the Nigri section of the genus AsE)ergillus, the delimitation of taxa is subject to debate, due to variation in colony color and conidiogenous structures on 10 which the major classification schemes are primarily based (i.e., Raper and Fennel, supral. The A. foetidus-related taxa recognized by Raper and Fennel are A. foetidus, A.
foetidus var. acidus, and A. foetidus var. ~allidus.
A. foetidus is generally characterized by sterigmata in 15 two series; conidiaI heads persistently grayish dark brown or olive brown; conidia globose or nearly so at maturity, irregularly and finely roughened. More specifically, the species is characterized by colonies on Czapek ~ s solution agar growing rather slowly at room temperature ~24-26 C), 20 attaining a diameter of 3.5 to~.5 cm in 10 days to 2 weeks, with vegetative mycelium in white or yellowish shades, largely submerged or forming a rather compact and comparatively tough surface, plane or radially f~lrrowed, azonate or weakly zonate, in some strains bearing abundant 2 5 olive-brown to brownish black conidial heads throughout except at the growing margin, in others sporulating tardily and less ~hlln~lAntly; exudate lacking or inconspicuous;
colony reverse in yellow to orange shades, becoming reddish brown in age odor very strong, penetrating, actinomycete-30 like. rnn;fl;Al heads at first small, globose to radiate,1, ; n; n~ SO in crowded centraI colony areas, others near colony margin becoming irregularly split into several rather --a~

~ Wo 95/15390 2 1 7 8 0 0 8 PCr/USs4/l36l2 well-defined columns, commonly 200 to 300 11 in overall diameter but in some strains reachiny 50011; conidiophores mostly 25 to 35 11 in diameter but reaching 40-50 ~L in some strains, fertile over the entire surface in larger heads or the up~?er three-fourths on smaller vesicles; sterigmata in two series, pigmented in brown shades, primaries somewhat variable, mostly 7 to 12 11 by 3 . O to 5 . O 11, occasionally longer, secondaries mostly 7 to 8 ~L by 2 . 5 to 3 O 1l; conidia globose or nearly 80, with walls brown, often appearing almost smooth but when mature irregularly and f inely roughened, mostly 4 . O to 4 . 5 ~1 in diameter, borne in chains without obvious disjunctors.
Colonies on malt agar growing somewhat more rapidly, 5 to 6 cm in 2 weeks, plane, velvety, with vegetative mycelium submerged and colorless or only slightly yellow, heavily sporing throughout, hlA,ki~ll brown shades, azonate or inconspicuously so; reverse in light yellow shades to almost colorless; odor not pronounced. ~'nni~iAl heads usually splitting into numerous conspicuously divergent and compact columns and reaching 300 t~ 350~ in diameter in most strains but up to 600 to 800 11 in others; conidia more uniformly enl~;n~llAtP than on Czapek agar. Structural details of cnn;tl;Al heads as described above. The species was first described by Thom and Raper, A Manual of the Aspergilli, 219-220, Fig. 61C, 1945) .
A. foetidus var. pallidus (MAkA7Al~a., Simo, and Watanabe, J. Agr. Chem. Soc. Japan 12: 961-962, Fig. 10, 1936) is characterized by colonies on Czapek' s solution agar growing rather restrictedly, attaining a diameter of 2 . 0 to 2.5 cm in 10 days to 2 weeks at room termperature (24-26'C), - plane or very lightly furrowed, consisting of a compact basal mycelium, nonsporulating and white or yellowish at the WO 95/15390 ~ ; 2 1 7 8 0 0 8 PCT~S94113612 ~
margin but otherwise bearing crowded f-r~n;t~ heads in dull grayish olive to olive-brown shades approximating dark olive to Chactura or olivaceous black; reverse at first colorless, then yellowish, becoming dark yellowish brown in age; odor less pronounced than in the species, not diagnostic.
Conidial heads globose to radiate, up to 500 to 600 11 in diameter, usual ly splitting into few and ill-defined columns; conidiophores smooth, colorless or in brownish tints, commonly about 1 mm long by 8 to 16 11 in width, ocrAq;~-n;~lly longer; vesicles globose or nearly so, up to 50 to 60 ,U in diameter in largest heads, fertile over the entire surface; sterigmata in two series, brownish, primaries commonly 10 to 15 11 by 3.5 to 5.0 11 when young, but up to 30 to ~0 '~1 in older heads, secondaries mostly 7 to 10 ~1 by 3 . O to 4 . O ,U; conidia at fi~st elliptical to ovate and smooth or nearly so, becoming globose or subglobose, 3 . 5 to 4 . 5 in diameter and delicately rougherled, adherent in fluid mounts but with connectives not evident.
Colonies on mal~ growing somewhat more rapidly, plane, usually velvety and heavily sporing throughout, in dark olive-black shades . ~ l structures up to 700 to 800 1 in diameter, essentially as on Czapek ' s agar, but with mature conidia 3.0 to 3.5 ,U, globose ~ ;mll~te and with a suggeetion of longitudinal orientation of surface markings.
This variety differs from the species primarily in its more restricted growth on Czapek~s agar, the larger ~;- q;f~nq and more olive pigmentation of its conidial structures, and the absence of def inite divergent columns of conidia in mature heads on malt agar.
A. foetidus var. acid~s (Nakazawa, Simo and Watanabe, J. Agr. Chem. Soc. Japan 12: 960-961, Fig. 8, 1936) is characterized by colonies on Czapekl s solution agar growing ~ wo 95115390 2 1 7 8 0 0 8 PCT/US94113612 rather slowly, 4.0 to 5.0 cm in lO to 14 days at room temperature (24-26 C), at first flocculent and near white to pale yellowish, lightly sporulating, later producing relatively few globose to radiate, brownish black conidial 5 heads in marginal and submarginal areas: reverse in yellow shades turning dull yellow-brown in age; odor not prrnr1mr~; r--n;~ l heads comparatively large, 350-400 ,u in diameter, not splitting into distinct columns; conidiophores relatively short and wide, commonly 600 to 800 '~1 by 20 to 30 10 ,U, rarely l mm in length, vesicles globose or nearly so, up to 80 to 85 11 in diameter, fertile over the entire surface;
sterigmata biseriate, brownish in color, primaries 20 to 40 by 4 . 6 Il, secondaries 6 to lO 11 by 2 . 5 to 3 . 5 ,u; conidia globose to somewhat flattened, brown, 4.0 to 4.5 ,u in 15 diameter, comparatively heavy walled, appearing smooth or with sur~ace slightly irregular but not ~rh;n~ te or rugulose .
Colonies on malt growing more rapidly and sporulating irregularly within lO days, broadly zonate, plane or closely 20 wrinkled, with vegetative mycelium largely submerged and bright golden yellow; conidial heads borne on short conidiophores as above but somewhat larger than on Czapek~ s, reaching diameters of 500 to 600 ~ and showing numerous ill-de~ined columns of conidia. ~his variety differs from the 2 6 specles in its more lightly sporulating colonies on Czapek' s and malt agars, its larger conidial heads and structural parts, its relatively short and wider conidiophores, and especially its bright yellow mycelium on malt agar.
It will be understood that throughout the specification 30 and claims the use of the term A. foetidus refers not only to those organisms encompassed in the a~orementioned three groups, but also ;nrl~ those species which have .

Wo 95/1~390 PCT/US94113612--previously been or currently are designated as other species in alternate classification schemes, but which possess the same morphological and cultural characteristics defined above, and may be synonyms of A. foetidus and its varieties.
5 For example, synonyms include (but are not limited to) A.
aureus Nakazawa, A. aureus var. pallidus N~k~7~Ta ~ Simo and Watanabe, and A. aureus var. acidus Nakazawa, Simo and Watanabe. Also a probable synonym is A. citricus Nosseray (A. Mllr~ m, Revision of the Black Aspergillus species, 10 Ph.D. thesis, University of Utrecht).
Initial determination of the utility of A. foetidus as a candidate host cell is made by ev~ t i r,n of the level of protease produced by the various isolates from over fifteen species in different taxonomic sections of the genus 15 Aspergillus. This is ~rc~ ~1 i che~l by testing each isolate on a casein clearing plate assay at acidic, neutral and ~lk~1;n~ p~. Surprisingly, it is found that several members of the Section Nigri perform best in that they produced the smallest quantities of proteases, which could pot~nt;;llly cause degradation of any rPr~ ~ ;n;~nt proteins produced.
Based on this criterion, several species are chosen for further study, inr111t9;nr A. ~oetidus, A. japonicus, A.
~aponicus Yar. aculeatus, A. aculeatus, A. tamarii, A.
carbonarius, and A. phoenicis.
Attempts to transform the selected species are then conducted. Initial efforts focus on use of standard A.
oryzae transfr,rTn~t;r,n technir~ues (Christensen et al., Bio/Technology 6: I419-1422, 1988; EP Appln. No. 87 103 806 . 3 ) . In brief, cotransformants are obtained using the A.
oryzae protocol for protoplasting, transformation and selection for amdS or hygromycin B (hygB) marker genes.
Expression vectors contai~ hTe A. oryzae TAE~A-amylase gene, 9~ 390 PCTIUS94113612 and the transcription tPrmin~t;orl signals from the A. niger glucoamylase gene, in addition to a heterologous coding sequence. Transformation frequencies vary from less than one to approximately lO per microgram of DNA. In co-5 transformation experiments with the expression vectorsdetailed in the following examples, the fre~uency of co-transformation rani~es from 0-60%.
The transformed species are then observed to determine the levQl of expression of various heterologous enzymes.
10 The ~eterologous enzymes tested include Humicola lanu~inosa lipase (HLL), Humicola insolens xylanase (xylanase), Humicola insolens cellulase (cellulase), and Coprinus cinereus peroxidase (CiP). Surprisingly, A. I'oetidus showed 11n~ 1 ly good expression ~or one or more of the enzymes, 1 5 and in some cases, show equivalent or better yield of enzyme than the control A. oryzae strains. In particular, one strain of A. foetidus produces quite high levels of HLL
(about one gram per liter) in shake flask culture. A
summary of the results of these tests is provided in Table 20 2.
As the results clearly show, several isolates of this species are capable of expressing heterologous protein.
Thus, it is understood that this ability is not limited to a single isolate or strain, but rather is a characteristic of 2 5 this species as a whole . Those skilled in the art will recognize that other strains or isolates of these species can also be used in expression of heterologous expression.
2~any strains of each species are publicly available in the collections of the Amerlcan Type Culture Collection (ATCC) 30 12301 Parklawn Drive, Rockville Maryland 20852; Agricultural Research Service Culture Collection (NRRL) 1815 North University Street, Peoria llinois 61604; Fungal Genetics WO 95/1~390 2 1 7 8 0 3 8 PCTNS94/13612~
Stock Center (FGSC), Kansas, Dèutsche Sammlung von Mikroorganismen und Zellkulturen (DSM), Mascheroder Weg ls, D-3300 Braunschweig, Germany; Institute of Applied Microbiology (IAM), Tokyo University l-1, 1-Chome, Yayoi, 5 Bunkyo-ku, Tokyo 113, Japan; Institute for Fermentation (IFO), 17-85 Juso-honmachi 2-chome, Yodogawa-ku, Osaka 532, Japan; and Centraal Bureau voor Schimmelcultures (CBS), Oosterstraat 1, 3740 AG Baarn, Netherlands.
The skilled artisan will also recognize that the 10 successful transfnrr-~inn of the host species described herein is not limited to the use of the vectors, promoters, and selection markers specifically exemplified. Generally speaking, those techni~ues which are useful in transfr,rr-~inn of A. :oryzae, A. niger and A. nidul~ns are 15 also useful with the~host cells of the present inveution.
For example, although the amdS and hygB selection markers are preferred, other useful selection markers include the argB (A. nidulans or A. niger), trpC (A. niger or A.
nidulans), or pyrG (A. niger or A. n;r7l7~nq) markers. The 20 promoter may be any DNA seg,uence that shows strong transcriptional activity in these species, and may be derived form genes encoding both extracellular and intr~r~ r proteins, such as amylases, glucoamylases, proteases, lipases, c~ q~ and glycolytic enzymes. Such 25 suitable promoters may be derived from genes for A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A.
ni~er glucoamylase, A. niger neu~ral a-amylase, A. niger acid stable a-amylase, and Rhi~omucor miehei lipase.
Examples of promoters from genes for glycolytic enzymes are 30 TPI, ADE, and PGK. The promoter may also be a homologous promoter, i.e., the promoter for a native A.foetidus gene.

-~ Wo 95/1~390 2 1 7 8 0 0 8 PCTI17594/l36lZ
A preferred promoter according to the present invention is the A. oryzae TAKA amylase promoter. The TAKA a~,ylase is a well-known a-amylase ~Toda et al., Proc.Japan Acad 58 Ser.
s.: 208-212, 1982). The promoter sequence may also be 5 provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the promoter sequence with the gene of choice or with a selected signal peptide or preregion. Terminators and polyadenylation seguences may also be derived from the same sources as the 10 promoters. Enhancer sequences may also be inserted into the construct .
To avoid the necessity of disrupting the cell to obtain the expressed product, and to minimize the amount of possible degradation of the expressed product within the 15 cell, it is preferred that the product be secreted outside the cell. To this end, in a preferred '~ , the gene of interest is linked to a preregion such as a signal or leader peptide which can direct the expressed product into the cell ~ s secretory pathway . The preregion may be derived 20 from genes for any secreted protein from any organism, or may be the native preregion. Among useful available sources for such a preregion are a glucoamylase or an amylase gene from an Aspergïllus species, an amylase gene from a 7~ i7777s species, a lipase or proteinase gene from Rhizomucor miehei, 25 the gene for the o~-factor from Saccharomyces cerevisiae, or the calf prochymosin gene. Most preferably the preregion is derived from the gene for A. oryzae TAKA amylase, A. niger neutral c~-amylase, A. ni~er acid stable oc-amylase, B.
lichenifor~7is o~-amylase, the maltogenic amylase from 30 Bacillus NCIs 11837, B. stearothermo~7hilus c~-amylase, or s.

licheni~ormis subtilisin. An effective signal sequence is the A. oryzae TAl~A amylase signal, the Rhizomucor miehei aspartic proteinase signal and the Rhizomucor miehei lipase signal. The preregion may also be a homologous preregion present on the protein to be expressed.
The gene or the desired product functionally linked to promoter and terminator sequences may be incorporated in a vector c~ ;n;n~ the selection marker or may be placed on a separate vector or plasmid capable of being integrated into the genome of the host strain. The vector system may be a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be integrated into the genome. Vectors or plasmids may be linear or closed circular molecules. Accordlng to a preferred embodiment of the present invention, the host is transformed with two vectors, one ; n~ ; n~ the selection marker and the other comprising the ~ ; ng heterologous DNA to be introduced, including promoter, the gene for the desired protein and transcription terminator and polyadenylation sequences.
The present host cell species can be used to e~press any prokaryotic or eukaryotic heterologous enzymes of interest, and is preferably used to express eukaryotic enzymes. This species is particularly useful in that it has been approved or use in the food industry. Of particular interest for this species is its use in expression of heterologous fungal enzymes (Regulatory Aspects of Microbia Food Enzymes, Third Edition, The Association o Microbial Food Enzyme Producers, Brussels, Belgium). The novel expression systems can be used to express enzymes such as 3 0 catalase, laccase, phenoloxidase, oxidase, oxidoreductases, c~ qe, xylanase, peroxidase, lipase, hydrolase, esterase, c~l~;n~e, protease and other proteolytic enzymes, ~ Wo 9R15390 21 7 8 0 0 8 PCT/US9~/13612 aminopeptidase, carboxypeptidase, phytase, lyase, pectinase and other pectinolytic enzymes, amylase, glucoamylase, c~-galactosidase, ,l~-galactosidase~ o~-glucosidase, ,~-glucosidase, mannosidase, isomerase, invertase, transferase, ribonuclease, chitinase, and deoxyribonuclease . It will be understood by those skilled in the art that the term ~ fungal enzymes" ;nrlllfli~ not only native fungal enzymes, but also those fungal enzymes which have been modified by amino acid substitutions, deletions, additions, or other fli f; r~t; ~nc which may be made to enhance activity, thermostability, pH
tolerance and the like.
The present host cells may also be used in r~cnmhin~nt production of proteins which are native to the host cells.
Examples of such use include, but are not limited to, 16 placing an A. foetidus native protein under the control of a different promoter to enhance expression of the protein, to expedite export of a native protein of interest outside the cell by use of a signal se~uence, or to increase copy number of a protein which is normally produced by the subject host 2 0 cells . ThuS, the present invention also rnrt _ ~es such re~ ' ;n~nt production of homologous proteins, to the extent that such expression involves the use of genetic elements not native to the host cell, or use of native elements which have been manipulated to function in a manner not normally 2 5 seen in the host cell .
The invention is further illustrated by the following non-limiting examples.
I . Prot~ce assavs More than fifty strains, from at least fifteen different species, are Px~m;n~fl to determine the amount of Wo 95/15390 2 1 7 8 0 0 8 PCr/USsl/l3612~
protease produced by each isolate, and also to observe their extr~ r protein prof ile . To prepare culture inoculum, 10 ml of sterile distilled water is added to one 7-10 day old culture of each strain in a g cm petri dish, and spores 5 are scraped gently f rom the mycelia to make a dense suspension. 2 . 5 ml of the suspension is used to inoculate 100 ml of ASPO4 medium[ASPO4 medium comprises lg/l CaCl2, 2 g/l yeast extract, 1 g/l MgSO4, 5 g/l KH2PO4, 2 g/l citric acid, 0 . 5 ml Trace Metal solution (comprising 14 . 3 g/l 10 ZnS04-7 H2O, CuSO4 5H2O, 0.5 g/l NiC12-6H2O, 13.8 g/l FeSO4 7H~O, 8 . 5 g/l MnSO4 H2O, and 3 g/l citric acid~, 1 g/l urea, 2 g/l (NH4)2SO4, 20 g/l maltodextrin (8 ml of a 25%
stock, added after autoclaving) in tap water, pH adjusted to

4 . 5 or 6 . 5 before autoclaving, then pH 4 . 5 adjusted with 8 ~5 ml 0.1M citric acid per 100 ml after autoclaving]. Flasks are incubated at 30 and/or 37 C, shaking on an orbital shaker at 200 rpm, for 5 days, in continuous light.
Supernatant from the culture broth of each is spun at 2500 rpm for 5 minutes, and used in the casein clearing plate 20 assay, which determines the levels of proteases produced by various fungal species being evaluated a~ potential ~n~ tes for rc~ nt protein expression.
The casein plate clearing assay is conducted as follows. The plate medium is composed of 20 g/l skim milk, 25 20 g/l agarose, and 0.2M citrate-phosphate buffer for te~ts run at pH 5 and pH 7, and glycine NaO~ buffer for tests run at pH 9. Milk powder is mixed with 100 ml of buffer and kept at 60 C. Agarose is mixed with 400 ml of buffer and autoclaved 5 minutes. After sright cQoling, the warm milk 30 mixture is added, ana the mixture inverted gently 2-3 times ~ WO95/15390 2 1 78008 PCI/US9.J/13612 to mi7c. The medium is poured into 150 mm plates using 50-70 ml per plate and stored at 5 C until use.
Just prior to use' twelve holes per plate are made in the agar. 25 ,Ul of supernatant from ferml~nt~tion of each 6 strain is added to one plate of each pH and incubated overnight at 37 C. To pH 9 plates, 0.5M glacial acetic acid is added to precipitate casein and allow v; .C~ i 7~tion of any clear zones. Each plate is then evaluated on clear zone size (i.e., from no zone to >2 cm in diameter) and zone type 10 (i.e., clear, opaque or both types).
The supernatants of each cu~ture are also used to evaluate the strains ' extracellular protein production.
Novex (San Diego, t~s~l;f~)rn;A) 8-16% gradient gels, prepared according to manufacturer's instructions, are used to assess 15 the protein profile. A 75 ~Ll (3 and 5 day) sample of culture s~-p~rn~t~nt is mixed with 20,Ul of 5X dissociation buffer (dissoclation buffer = 4 ml 1~ Tris-Hcl,pH 6.8, 1 g SDS, 617 mg dithiothreitol, and sterile distilled water to 10 ml), and glycerol/bromophenol blue (10-20 mg added to 20 about 10 ml of 80-gO% glycerol, and placed in boiling water for 1-2 hours to dissolve), boiled for 5 minutes, cooled, loaded and run at 60-200 V until the 1JLI ,h~n~l blue tracking dye reaches the bottom of the gel. The gels are silver stained according to the Biorad Silver Stain Plus 25 Protocol (siorad Laboratories, Hercules, CA). Those isolates showing large numbers of bands are considered less suitable as potential new hosts, while those showing relatively clean profiles with only 1-4 major bands are considered for further testing.
30 When the ' h;n~l results of the protease-assay and protein profile are reviewed, the majority of suitable potential candidates are found among the members of the Wo 95/15390 2 l 7 8 0 0 8 PCr/Uss4ll36l7~
section Nigri. Based on these results, the following isolates are selected for transformation studies: A.
foetidus E46, A. foetidus CBS 103.14, A. foetidus var.
pallidus(NRR~ 356), A. foetidus N0953 (NRRL 337; ATCC 10254 A. japonicus A1438 (CBS 568.65), A. aculeatus N1136 (CBS
101.43), A. aculeatus A1454 (CBS 172.66), A. aculeatus A1455 (CBS 186.67), A. japonicus var. aculeatus N0956 (IAM 13871), A. phoenicis A528 (CBS 139.~8), A. phoenicis A530 (CBS
137.52), A. phoenicis E419 (CBS 137.52), A. carbonarius 0 A3993 (IBT 4977 ), A. carbonarius ATCC 1025 , A. tamari ~ E112 (ATCC 10836), A. tamarii N2266 (IF0 4358), and A. tamarii N2267(IFO 4142). These cultures are also maintained as part of the Novo Nordisk Biotech Culture Collection, Davis, California .
II . Vector o ~n ~truction A. Selec~;l~l e ~rk~r vectors . The vectors pJaL77 and pJaL154 are used in transformation of host cells with the hygromycin B resistance selectable marker. This marker is 20 based on the E. coli hygromyc1n B phosphotransferase gene, which is under the control of the TAE~A promoter in pJaL 77 and the a~mdS promoter in pJaLI54. Brieîly, these vectors are constructed as follows. The gene conferring resistance to hygromycin B is purchased from Boehringer M~nnl~;m as 25 plasmid pHph-1. This gene is~equipped with an ATG codon as well as with suitable restriction sites at the amino and carboxy termini by PCR, using the primers- 5 ' -GCT CAG AAGCTT
CCATCC TAC ACC TCA GCA ATG TCG CCT GAA CTC ACC GCG ACG TCT-3 ' (N-terminal) and 3 ' -CGT CCG AGG GCA AAG GAA TAG CTCCAG
30 AGATCT CAT GCT-5' (C-terminal). The PCR fragment is cut with the restriction enzymes BamHI ana XhoI and cloned into the Wo 95/15390 2 1 7 8 0 0 8 PCT/US94/13612 corresponding sites in the Aspergillus expression vector pToC68 ~as described in WO 91/17243 ) to produce pJaL77 .
Plasmid pJaL154 is constructed as follows. The amdS
promoter mutant Ig + I666 (Hynes et al. Mol. Cell. Biol.

5 3 (8): 1430-1~39, 1983 and Katz et al. Mol Gen Genet. 220:
373-376, 1990) is cloned from plasmid pCaHj406 by PCR with the following primers ~underlined re~ions represent homology to the amdS promoter: CCT GGA TCC TCT GTG TTA GCT ~ AG and CTT GCA TGC CGC t'~ CGA GC~ AG. The 694 bp PCR fragment 10 -nnt~inin~ the amdS promoter is cut with samHI and SphI and cloned into the corresponding site in p-JaL77, so that the TAKA promoter in pJaL77 is exchanged wlth the amdS promoter.
The plasmid pToC90 cnntil;nin~ the amdS marker is constructed by cloning a 2.7 kb XbaI fragment from p3SR2 15 (~ynes et al., supra) into an XbaI cut and dephosphorylated pUCl9 plasmid. The derivative desi~nated pToC186 is identical to pTOC90 except that the promoter region contains two ~tinnc (Ig and I666) known to enhance expression of the amdS gene (Hyne~ et al., supra; Corrick et al., Gene 53:
20 63-71, 1987).
g. F~rP~inn vectors.
l.~-micola incolPn.~ xv~n;~:e. The vector pHD414 is a derivative of the plasmid p775 (EP 238 023 ) . In contrast to 25 this plasmid, pHD414 has a string of uni~Iue restriction sites between the TAKA promoter and the AMG tprmin~tnr. The plasmid is constructed by removal of an apprn~ tPly 200 bp long fragment (c~nt~;n;n~ undesirable RE sites) at the 3' end of the terminator, and subsequent removal of an 30 approximately 250 bp long fragment at the 5~ end of the promoter, also ,nnt~inin~ undesirable sites. The 200 bp region is removed by cleavage with NarI (positioned in the wo 95/1~390 2 ~ 7 8 0 0 8 PcTlUSs4/l36l2~
pUC vector) and XbaI ( just 3 ' to the terminator), subsequent filling in the generated ends :with Klenow DNA polymerase +
dNTP, purification of the vector fragment on a gel and religation of the vector fragment. This plasmid is called 5 pHD413. pHD413 is cut with StuI (positioned in the 5~ end of the promoter) and PvuII (in the pUC vector), fractionated on gel and religated, resulting in pHD414. A strain of E.
coli ~ nt~in;n~ the approximately 1,100 bp xylanase HindII/XbaI cDNA ragment in pYES is deposlted in DSM as DSM
10 6995. The xylanase cDNA fragment is isolatea from one of the clones by cleavage with HindIII/XbaI. The fragment is purified by agarose gel electrophoresis, electroeluted, and made ready for ligation reactions. The cDNA fragment is ligated into pHD414 to produce pAXX40-l-1 The sequence of 15 the xylanase gene and protein are provided in SEQ ID ~oS 1 and 2, and the gene is deposited as DSM (Deutsche Sammlung Von Mikroorcg~n; ! und Zellkulturen GmbH) 6995.
2.~1~m;cola ~n.qn~,~n.q cellul;~:e. Detailed 20 characterization of the H~micola insolens cellulase is found in WO 91~17243. The expression vector pCaHj418 used for cellulase expression is constructed by excision of the 92 bp cellulase coding region fr~s t from pCaHj201 by cleavage with restriction en~ymes BamHI and SalI. This 25 fragment is purified by preparative gel electrophores~s using standard tech~iques and ligated with pHD414 (described above) which has been prepared by treatment with BamHI and XhoI. The resulting expression vector, pCaHj418, ,-"nt~inc the cellulase gene under the transcriptional control of the 3 0 A. o~yzae taka-amylase promoter and the A. niger glucoamylase tc~rmi n~tmr region.
.

WO 95115390 2 1 7 8 0 0 8 PCI~/[TS94/13612 3 ~l1micola ]~n71ç7innsa 1 ir~ce Isolation and ex~oression of the H. lanuginosa lipase gene is reported in EP 305 216, and in US Serial No . 07 /23 6, 605, the contents of which are incorporated herein by reference. sriefly, Total RNA is extracted from homogenized H. lanuginosa mycelium using methods as descrihed by soel et al. (E~BO J. 3: 1097-1102, 1984) and Chirgwin et al. (siochemistry 18: 5294-5299, 1979). Poly(A~ nn~;~;n;n~ RNA is obtained by two cycles of affinity chromatography on oligo (dT) -cellulose as described by Aviv and Leder (PNAS USA 69: 1408-1412, 1972) . cDNA is synthesized with the use of methods described by Okayama and Berg (Molec. Cell. siol. 2: 161-170, 1982), and with the vectors pSP62-K2 and pCDVI-PL described by Noma et al.
(Nature 319: 640-646, 1986). The synthesized cDNA is transformed into a hsdR-, Mr derivative of E. coli MC1000 A~l~h~n and Cohen, J.Mol. giol. 138: 179-207, 1980) to generate r~ i n~nt clones .
A mixture of 32 ~Pnt~ r;lml~r oligodeoxyribonucleotides A A A A A
d ( TT AA TG TT AA), G G G G G
one of which is complementary to H. la~uginosa lipase mRNA
25 in the region coding for Phe-Asn-Gln-Phe-Asn is synthesized on an Applied siosystems, Inc. DNA synthesizer and purified by PAGE. Arproximately 10,000 E. coli r~ hin~nts from the H. lanuginosa cDNA library are transferred to Whatman 540 paper filters. The colonies are lysed and i -bi l i zed as 30 described by Gergen et al. (Nucleic Acids Res. 7: 2115-2135, 1979). The filters are hybridized with the 32P-labelled H. lanuginosa lipase-specific pPnt~ mixture as described by Boel et al. (EMBO J. 3: 1097-1102, 1984) .
Hybri~1i7~t;nn and washing of the filters are done at 37 C

Wo 95115390 2 1 7 8 0 0 8 PCTIUS9 ~113612 ~
and 43 C, respectively, followed by autoradiography for 24 hours with an intensifier screen. Miniprep plasmid DNA is isolated from two hybridizing colonies, pHL~ 702.3 and pHl.L
702 . 4 by standard procedures (sirnboim and Doly, Nucleic 5 Acids Res . 7: 1513-1523, 1979 ) and the DNA sequence of the DNA insert is est~hl i Ch.~tl by the procedure of Maxam and Gilbert ~Methods Enzymol. 65: 499-560, 1980).
To facilitate further construction work with the cDNA, DNA sequences ~ nt;~;n;n~ unique restriction sites are added 10 to the 5 ' and 3 ~ ends of the cDNA as follows. pHLl: 702 .3 is digested with Sau961 which digests the cDNA in the 3' untranslated region and the resulting ends are filled in with E. coli D~A polymeraSe(Klenow fragment) and the four dNTPs. This DNA is subsequently digested with SacI which 15 cuts the cDNA once just 3 ' to the initiating methionine codon. The resulting 0 . 9 kb cDNA fragment is purif ied by agarose gel electrophoresis, electroeluted and made ready for ligation reactions. AS a 5~ adaptor two oligonucleotides, 927 and 928, are synthesized. This 20 adaptor is designed- to add a HindIII and BamHI site just 5 ~
to the initiating Met codon of the cDNA. The two oligos are kinased with ATP and T4 polynucleotide kinase, annealed to each other and ligated to the purified 0 . 9 kb cDNA sequence in a pUC19 vector digested with HindIII and HincII and 25 purified on a 0.796 agarose gel. The resulting plasmid carries the ~. lanuginosa lipase cDNA as a portable 0 . 9 kb BamHI fragment. After BamHI digestion and purification of the 0 . 9 kb cDNA fragment on an agarose gel, it is ligated to BamHI and phosphatased p775 to generate p960 in which the 3 0 lipase cDNA is under transcriptional control of the TAKA
promoter from A. ozyzae and the A~G terminator from A.
niger.

~ WO95/15390 2 1 7 8 0 0 8 PCTIUS94113612 To prepare pMHan37, p960 is moaified by replacing 60 basepairs of the 5 'untranslated region of the A. oryz~e TAKA
promoter just upstream to the ~umicola lanu~inosa lipase gene by the corresponding region from the A. nidulans tpiA
5 gene (M~P~n;~ht et al. Cell 46: 1~3-147, 1986). A synthetic oligonucleotide cnnt~ n~ the 5~ untranslated region from the A. ni~ulans tpiA flanked at each end by 20 bases homologous to p960 se~uences just outside the untranslated region is used in a PCR reaction together with another 10 primer covering the BssHII-site in the TAKA promoter region.
as the mutagenization primer covers the samHI site close to the ATG start codon, the PCR fr~5 t iS digested with BamHI
and sSSHII and recloned into p960 digested with BssHII and partially with BamHI. 200 bases upstream to the ATG in 15 MHan37 is verified by DNA sequencing analysis. The sequence difference between p960 and pM~an37 is shown below:
pMHan3 7 CATGCTTGGAGTTTCCAACTCAATTTACCTCTATCCACA~: L L C L C. L L
P960 cAT~sLl~ AG~ GATAGrA~rr-r~ArAAr~cAcATcAAGcTcTcc 20 pMHan37 ~ LL.~ rAATAAArCrrArAr.rr~r.. .GGATCC
p960 ~ ll~L~l~iAATccTc~ATATArArAArTGGGGATcc The se~uence of the primer covering the BamHI site:
5~ GCTCCTCATGGTGGATccccAGTTGTr.TA~ r.ArrA~T~Ar.r.~Ar.r.AAr.A
25 GAAGTGTGr~A~Ar~r~r~ A~TGAGTTGGAp~AcTccAAGcATGGcATcccTTGc 3 ' 5. Co7~rin~c cinP~e~.q ~ero~ ce~ The isolation and cloning of the Coprinus cinereus peroxidase gene is described in WO 92/16634. Briefly, total RNA is extracted0 from homogenized Coprinus cinereus (IFO 8371) mycelium, t~l at the time of maximum peroxidase activity as described by Boel et al. (EMBO J. 3: 10~7-1102, 1984) and WO 9~i/15390 2 1 7 8 0 0 8 PCT/US9~/13612~
Chirgwin et al . (Biochemistry 18: 5294-5299, 1979 ) .
Poly(A)-c--nt~;n;n~ RNA is obtained by two cycles of affinity chromatography on oligo (dT) -cellulose as described by Aviv and ~eder (PNAS USA 69: 1408-1412, 1972 ) . cDNA is 5 synthesized by means of a cDNA synthesis kit from Invitrogen according to the manufacturer~ s instructions. Ah-out 50, 000 E. coli r~ h;n~ntc from the Coprinus cinereL~s cDNA library are transferred to Whatman 540 paper filters. The colonies are lysed and; h; l i ~ed as descrlbed by Gergen et al.
(Nucleic Acids Res. 7: 2115-2I35, 1979). The filters are hybridized with the 32P-labelled 430 base pair peroxidase-specific probe in 0.2 X SSC, 0.1~ SDS. Hybridization and washing of the filters is conducted at 65 C followed by autoradiography for 24 hours with an 1nt~nqif;er screen.
15 After autoradiography, the filters are washed at increasing temperatures followed by autoradiography for 24 hours with an int~ncifier screen. In this way, more than 50 positive clones are ; ti~nt; f i ed. ~iniprep plasmid DNA is isolated from hybridizing colonies ~y standard procedures (Birnboim 20 and Doly, Nucleic Acids Res. 7: 1513-1523, 1979) and the DNA
sequence of the cDNA insert is determined by the Sanger dideoxy procedure ~Sanger et al., PNAS USA 74: 5463-5467, 1977 ) . The peroxidase cDNA fragment is excised from the vector by cleavage with HindIII/XhoI and is purified by 25 agarose gel electrophoresis, electroeluted and made ready for ligation reactions. The cDNA fragment is ligated to HindIII/xhoI digested HD414 to generated pCip in which the cDNA is under transcriptional control of the TAKA promoter from A. o~rzae and the Ar~G t~rm;n~tor from A. niger. p~Vi9 3 0 is prepared from pCiP in that the restriction sites for SacI, KpnI, HindIII, PstI, SalI, and Bam7~I immediately preceding the peroxidase start codon are deleted.

WO 95115390 ~ ~ 2 1 7 8 0 0 8 PCT/17S9 1/1:1612 The cDNA sequence encoding the coprinus cinereus peroxidase is shown in SEQ ID NO. 3 and 4.

6. Fu~;7rii7m sol;7ni cutin~e~ The cutinase expression vector pCa~j427 contains the Fusarium solani f. pisi 5 cutinase coding region (Soliday et al., J. Bacteriol. L~:
1942-1951, 1989) under the transcriptional control of the A.
oryzae TAKA-amylase promoter= and A. niger glucoamylase tf~rm;n;ltnr re~ions(Christiansen et al.,Figure 1, supra).
This is used, with pToC90 as described above, to cotransform 10 A. ~oetidus strains NRRL 341, MRRL 357, and CBS 103.14.

7, ~';7n~,7i~ ;7ntc7rctica l; n~f:e B. The exptession vector pMT1335 contains the Candida antarctica lipase B gene under the control of the A. oryzae TAKA amylase promoter and A.
glucoc7mylase terminator regions (Chris~iansen et al., supra) .
15 This vector is used with pToC90, as described above, to transform A. foetidus strains csS103.14, NRRL 356, NRRL 357, and NFRL 3 41.
A summary of the expression vectors prepared is provided in 2 0 Table 1.

WO 95/15390 ; 2 1 7 8 0 0 8 PCI/US94/13612~
Table l Expression vectors used for co-transformation of new host candidates vector Gene Promoter Terminator encoded pMHan37 H. 1,7n77~7 n,~,q~ TAKA-anylase AMG
lipase ( HLL ~
pAXX40-l-l H. insolens TAKA-amylase AMG
xylanase pCaHj 418 H. insolens TA~A-amylase AMG
cellulase 10 p~Vi9 coprinus TAKA-amylase AMG
cinereus peroxidase ~CiP) pMTl229 Candida TAK~-amylase A7.~G
an~arcti ca lipase A
pCa~j427 Fusariun TAKA-anylase AMG
solani cutinase p.~Tl335 Candida TAKA-amylase AMG
ar tarctica , lipase B

III. Tr;~nqforr-tion of A.qPercill~7.q hosts ~ Wo 95/15390 2 1 7 8 0 0 8 PCr/US94113612 The following general procedures are used in transformation of all the strains tested, with exceptions noted expressly:
100 ml of YPD ~Sherman et al. Methods in Yeast 5 Genetics, Cold Spring Harbor Laboratory, 1981) is inoculated with spores of the strain to be trangformed and ;nrllh;~tP~l with shaking at 34- C for 1-2 days. The mycelium is harvested by filtration through miracloth and washed with 200 ml of 0.6 M MgSO4 The mycelium is suspended in 15 ml of 10 1. 2 M MgSO0" 10 mM NaH~PO~ pH = 5 . 8 . The suspension is cooled on ice and lml of buffer cnnt~;nln~ 120 mg of Novozyme;lD 234 is added. After 5 minutes, 1 ml of 12 mg/ml sSA ~Sigma type H25) is added and inrllh~t;on with gentle agitation crntin~ for 1.5-2.5 hours at 3~' C until a large 15 number of protoplagtg ig visible in a sample inspected under the microscope.
The suspension is filtered through miracloth, the filtrate is transferred to a sterile tu-he and overlaid with 5 ml of 0.6 M sorbitol, 100 mM Tris-HCl, pH = 7Ø
20 Centrifugation is performed for 15 minutes at 2500 rpm and the protoplasts are collected f~rom the top of the MgS04 cushion . Two volumes of STC ( 1. 2 M sorbitol, 10mM Tris-HCl pH = 7 . 5, 10 mM CaCl~ ) are added to the protoplast suspension and the mixture is centrifuged for five minutes 25 at 1000 X g. The protoplast pellet is resu~pended in 3 ml of STC and repelleted. This is repeated, and then the protoplasts are resuspended in 0 . 2-1 ml of STC .
100 111 of protoplast suspension is mixed with 5-25 llg of the appropriate DNA in 10 111 of STC. Each strain is 30 cotransformed with an expression vector rnnt;3ining the structural gene of interest (see Table 1), and a plasmid rrnt;i; n; n~ a seleCtahle marker. Plasmids pToC90 and pToC186 WO 95/15390 2 1 7 8 0 0 8 PCT/US9J,/13612~
contain the A. nidulans amdS gene, and are used for transformation and 8f'1 ~t~t; t)n for growth on acetamide as the sole nitrogen source. Plasmias pJaL77 and p.JaL154 are used for transformation and selection of resistance to hygromycin 5 B.
The mixtures are left at room temperature for 25 minutes. 0.2 ml of 6096 PEG 4000 (BDH 2g576), 10 mM CaC12 and 10 mM Tris-HCl pH = 7 . 5 is added and carefully mixed twice and finally 0 . 85 ml of the same solution is added and 10 carefully mixed. The mixture=is left at room temperature for 25 minutes, spun at 2500 X g for 15 minutes and the pellet resuspended in 2 ml of 1.2 ~q sorbitol. After-one more s~fl; ;ltion the protoplasts are spread on the appropriate plates. Protoplasts are spread on minimal 15 plates (Cove, siochem. Biophys. Acta LL~: 51-56, 1966) t-~nt~in;nS 1.0 M sucrose, pH = 7.0, 10 mM acetamide as nitrogen source (when amdS is the selection marker) and 20 mM CsCl to inhibit background growth. The medium differs when hygB is the selection marker in the use of 10 ~ sodium 20 nitrate as nitrogen source, and the presence of 150 ,ug/ml hygromycin B. As an alternate to the final centrifugation step, resllqp~n~l;ng and spreading, 8 ml of STC can ~e added and mixed with the protoplasts, and 3 ml are added to each of 3 selection plates, which are then swirled to cover t~e 25 plate. After ;n-llh~t;on for 4-7 days at 37 C colonies with conidia are picked, suspended in sterile water and spread for isolation of single colonies. This procedure is repeated and spores of a single colony after the second relsolation are stored as a de~ined transformant.
IV. ~v~ tion of rel ' ;n~nt ~rote;n e~ression ~ Wo 95/15390 2 1 7 8 0 0 8 PCr/Uss4ll36l2 Following the ahove procedure, individual isolates of the selected strains are co-transformed with one of the expression vectors noted in Table 1, and one of the plasmids rnnt~;n;ng a selectable marker mentioned in the preceding 5 example. Each of the co-tr~n~fr~ ntq is then tested in the appropriate assay to determine expression of the gene of interest .
A. L;~ce Cotransformants for lipase activity(Candida a~tarctica 10 lipase A and lipase B, and H. lanuginosa lipase) are cultured in a M400Da medium consisting of 50 g/l maltodextrin, 2g~1 NgSO4-7H2O, 2g/1 KH2PO4, 3g~1 K2SO4, 4g~1 citric acid, 8g~1 yeast extract, 3g~1 (NH4)2SO4, 0.5 ml Trace metal solution, 4 ml 50% urea solution (autoclaved 15 separately), in 1 liter of distilled water, pH 6.0, and 5g~1 yeast extract made up in tap water to 800 ml. p~ is adjusted to 4.5 before autoclaving. After autoclaving, 166 ml filter sterilized lM urea (to give a final concentration of lOg/l) and 35.3 ml of filter sterilized lM NaNO3 (to give 20 a final concentration of 0.3%) are added.
Lipase activity in culture filtrates is measured using p-nitrophenylbutyrate (pNB) as a substrate. A stock solution of pNB is prepared by adding 104 . 6 1ll of pNB to 5 ml of DMSO. To each well of a microtiter plate is added 90 25 1ll of 50mM Tris, pH 7. Ten ~Ll of sample is added to each well, and mixed by shaking the microtiter plate for ahout one minute. Just prior to the assay, 20 1ll of pNB stock is ,~ -;nP(l with 970 ~Ll of 50 mM Tris buffer, pH 7 and mixed.
T ~ tely prior to assaying for lipase activity using a 30 commercial plate reader, 100 1ll of the pNB-Tris mixture are added to each sample well and ;~h~rh;ln~e measured at 405 nm over a 3 minute time period. The assay is temperature .

WO 95/15390 2 1 7 8 0 0 8 PCT/US94/1361~
sensitive, so an internal standard is used with each sample set. The slope determined for each sample directly correlates to lipase activity; the linear range of the assay is from about 0 . 005 to 5 ,ug lipase per milliliter. In this 5 type of assay, the specific activity of H. lanuginosa lipase i8 determined to be approximately ~000 LU/mg, whereas the specific activity of Candida lipase A is about 400 LU/mg.
B . Xv l i l n ;~
All xylanase transformants are grown in medium with the 10 following composition, in g/l: maltodextrin, 50; MgSo4-7H20, 2 . 0; KH2PO4, lO . 0; K2SO4, 2 . 0; citric acid 2 . 0; yeast extract, lO.0; AMG trace metal solution, 0.5ml; urea, 2.0;pH
6 . 0 . All the transformants are grown as submerged, agitiated cultures at 3 4 C .
Xylanase activity in culture broths is determined using O . 296 AZCL-xylan ~Negazyme Co. Australia1 suspended in a citrate phosphate buffer, pH 6.5. The culture fluid is diluted, usually lO0-fold, and lO Ill of diluted culture fluid is mixed with l ml of 0.2% AZCL-xylan substrate. The mixture is incubated at 42 C for 30 minutes. The reaction mixture is mixed well every 5 minutes. At the end of incubation, the undigested substrate is precipitated by centrifugation at lO,000 rpm for 5 minutes. The blue dye released from this substrate is ~l;~nti fi~fl by absorbance at 595 nm and the amount of enzyme activity in the culture broths is calculated from a standard made with an enzyme preparation with known activity. An endoxylanase unit (EXU) i~ determined relative to an enzyme standard prepared under identical conditions.
C. C~ C~
Cellulase transformants are grown in Ms~50 medium (50 g/l maltodextrin, 2g~1 MgSOq-7H2O, lOg~l KH2PO4, 2g/l K2SO4, ~ wo 9SI15390 2 1 7 8 0 0 8 PCT/U594/13612 2g/1 citric acid, 10 g~l yeast extract, 0.5 ml trace metals, 2 . 0 g urea, at 34 C as submerged cultures.
Cellulase activity is measured using 0.2% AZCL-HE-cellulose (Megazyme) as a substrate suspended in 0 . lM
5 citrate-phosohate buffer at pH 6.5. The culture is dilutea in O.1M citrate buffer, pH 6.5, and 10 ~Ll of diluted culture fluid is mixed with 1 ml of 0.2% AZCL-HE-cellulose. The mixture is incubated at 42 C for 30 minutes with shaking every 5 minutes. After in~llh~ti~m, the undigested substrate 10 is pelleted by centrifugation at 10, 000 rpm for 5 minutes .
The blue color in the supernatant is ~Iuantified spectrophotometrically at 595 nm, and the amount of enzyme activity is determined from a standard curve made with a known cellulase standard. Endocellulase units (ECU) are5 determined relative to an enzyme standard prepared under nt;~ conditions.
D. Perosr~ qe Cotransformants for Ci~ are cultured in a M400Da medium consisting of 50 g/l maltodextrin, 2g/1 MgSO4-7H2O, 2g~1 20 KH2PO~, 3g/1 K2SO4, 4g/1 citric acid, 8g/1 yeast extract, 3g/1 (NH~)2SO~" 0.5 ml Trace metal solution, 4 ml 50% urea solution (autoclaved separately), in 1 liter of distilled water, pH 6 . 0 .
Peroxidase expression is monitored using ABTS as a 25 substrate or by rocket immunoelectrophoresis compared to a standard of known concentration. For immunodiffusion, 1%
agarose in TM buffer (1.3g/1 Tris base, 0.6 g/l maleic acid, pH 7) is melted and cooled to 55'C. 400 1ll of rabbit antiserum against CiP is mixed with 15 ml of agarose, spread 30 and solidified on a lOcm x 10 cm plate. CDD~ agar(lg/l K2P04, 30 g/l sucrose, 0.3g/1 NaNO3, 0.05g/1 KCl, 0.05g.1 WO 9S/15390 ~ 2 1 7 8 0 0 8 PCT/US94/13612~
MgSO4 7H2O, 0 . 001g/l FeSO~ 7H2O, 0 . 001g/1 ZnSO4 - 7H2O, 0.0005g/l CuSO4-5H2O, 20g/l ma~ltrodextrin, 15g/1 agarose) culture samples of .(:iP transformantg grown for 7 days at 37'C in CDM are applied to 5 mm holes made in the agar 5 plate. The protein is allowed to diffuse for g8 hours. The plate i8 stained with coomassie blue R to visualize the protein-antibody precipitation zone. As a standard solution, purified is used at the rf~n~ Pntr~t; ~nq Of 500, 1000, and 2000 peroxidase units (PODU) /ml; 1 PODU is the 10 amount of enzyme which under the standard rnn~1;ti~nq catalyzes the conversion of 1 ~nol hydrogen peroxide per minute .
To determine peroxidase by the ABTS (2,2'-~7;n--hic:(3-ethylbenzothiazoline-6-sulfonate) method, 2 ml of 2mM
15 ABTS[0.110 g ABTS, Boehringer M~nnhPim No. 102946 in 0.1 M
phosphate buffer (10.63 g disodium hydrogen phosphate dihydrate p.a. M6580, 5.49 potassium dih~Luy~ "hosphate p.a. M4873 in demineralized water up to 1 liter) is preheated for 10 minutes at 30 'C. To this is added 10 . 6 mM
20 H22 solution(l.0 g Perhydrol Suprapur~19 30% H22 Merck 7298 in demineralized water up ~o 25 ml), and 0.2 ml of sample or standard (standard = 5.0 mg Kem-En-Tec, grade 1, No. 4140A
in ~h~s~h~t~ bufier;up to 25 ml, diluted 400 times) in a glass tube. The reaction is conducted at 30'C for three 25 minutes. The i~hq~rh~nl-e of the sample is measured at 418 nm agalnst milli Q demineralized water and followed for three minutes . The best ref lection of peroxidase activity is ~iven by the absorbance ~l;ff~r~n~P: ~A = A~7s BeC~-A(15 8eC) The absorbance difference should lie between 0.15-0.30 30 corresponding to 0.05-0.1 PODU/ml in the sample.
E. Cu~;n~e. Selected transformants are screened on tributyrin agar(l396 maltodextrin, 0.396 MgSO4-7H20, 0.5%

Wo 95/15390 2 1 7 8 0 0 8 PCTIUS94/136~2 KH2P04, 0.49ti citric acid, 0.6% K2S04, 0.5% yeast extract, l96 tributyrin, l96 urea, 0.3% NaNO3, 0.5ml trace metals, 2%
agar, p~ 4.5) for the ability to produce extr~r~ r cutinase, as detected by the clearing of tributyrin.
The strains producing the largest clearing zones are evaluated in shake flask cultureæ using M400Da medium~described above) at 37 C. Extracellular cutinase activity is determined using p-nitrophenylbutyrate as described above. Among all the transformants, the highest cutinase producer is an A. ~oetidus CsS 103.14 transformant designated CsS lo3~l4/caHj427~l~ Over the course of three days in shake flask culture, this transformant pr~duces extr~r~ qr cutinase at leveles that are roughly ee(lual to the amount produced by an A. oryzae control transformant Qu-l-l. In small scale(2 liters) f, ~t;nn, this transformant produces approximately one gram per liter of extracellular cutinase.
VI . RPf:nl1 ts an~l D; qrll~cion 2 O Table 2 summarizes the expression levels of various heterologous fungal enzymes produced by the alternative host of the present invention. It can be seen from the table that all strains were successful in expression of at least one of the geneæ of interest. In several cases, the new host strains give unexpectedly high levels of enzyme. For example, at least one strain of A. foetidlls yield8 surprisingly high levels of ~LL in shake flask cultures (appr~;r~t~ly one gram per liter), demonstrating that these species are capable of expressing large ~uantities of heterologous protein. In fact, the levels of production of HLL produced by these transformants appears to be as good as or better ~ the best primary transformants of A. o~fzae, Wo 95/15390 2 1 7 8 0 0 8 PCT/US94/13612~
such as HI-23. Similarly, two strains exhibit similar high levels of expression o~ lipase B.
A. foetidus also is shown to be an f~oerrl 1 Pnt host for the production of xylanase compared with A. oryzae . The 5 shake flask yields for this enzyme are appro~ir~t~ly twice the levels seen for the ~est A. o~yzae trarsformants.
Table 2. Expression of fungal enzymes in A. foetidus S~-ui--/ S-lu~tio~ n- No Expr~Dio3 1 0 Dtr~ir, xpr-s~-lS tr~r~form yi-l~
(No (sh~l~e I) o ~ i t i v~
A eo~idus amdS CiP 42 (1) 0 1 g~l E46 amdS HLL 42(22~ 0 06-O lg/l A foetidus amds HLL 25(11~ 0 4~7/1 CBS 103 1g amdS lipase B 58(35) l Og l 1 5 A.~oe~idus amdS HLL 12(1~ 0 5 ~/1 var p~llidus amdS lipase B 151(60) 1 25g/1 A. ~oæ~idus amdS BLL 34(26) l 0-l Sg~l N0953 amdS xylanase 28(16) 0 08g/1 hYgB xylanase 17 (6~ 0 12g/1 amdS Cellulase 39(16) 0 4g/1 2 0 A. oryz~ amdS CiP control 0 25g/1 A 1560 control amdS BLL control lq/l (be~t primary amdS Cellulaoc control 0 75-1~/1 transiormant amdS xylanase control 0 lg/l ~rom over 20 ~mdS lipa~e A control 0 3g/1 2 5 8creen~d) As can be seen from the data presented, a numoer of strains of A. foetidus species can produce substantial quantities of a variety of heterologous proteins, and there~ore are est~hl i~1~P~ as being useful as alternatives to 5 the standard A. ~iger and A. o~zae host systems, and in some cases may be preferable to t~e use of these known hosts .
Deoosit of Biolocic~ tPri ~ l q 10 The following biological materials have been deposited in Agricultural Research Service Culture CDllection (NRRL~ 1815 North Uuiversity Street, Peoria, Illinois 61604.
Cell lin~ }u~cpr~s;~m No.
1 6 E. coli DH5a cnnt;~i n; n~J p~Vi9 NRRL B-21161 E. coli DH5a cr)nt~;nin~ pCa~413 NRR~ B-21162 E. coli DH5a ~-nnt~in;n~ pMT122g NRR~ B-21163 E. coli DH5a ~ntAining pAXX40-1-1 NRRL B-21164 E. coli DH5a f~nt;~in;n(J pMHan3~ NRRL B-21165 A. foetiduo ~:~6 ~RL B :Z1167 WO 95/1~390 ' 2 1 7 8 0 0 8 PCI/IJS94/13612~

( 1~ GENERAL INFORMATION:
(i) APP_ICANT:
A NAME: Novo Nordisk Biotech, Inc .
B STREET: 1~45 Drew Avenue C CITY: D~vis, rA l; f~7rn i 'D ~ COUNTRY: United Stctes of AT~eric~
'E POSTAL CODE ~ZIP) 95616-4880 ~F, TELEPMONE: (916) is7-8100 G) TELEFAX: (916) 757-0317 (ii) TITLE OF INVENTION: ASPERGILLUS FOETIDUS ~;551UN SYSTEM
(iii) Nt~MBER OF SEQl~ENCES: 4 ('v) UU~5~iNI)~;N~: ADDRESS:
A ~nnRRcqRT~ Novo Nordisl~ of North ATneric~, Inc.
'B STREET: 405 Lexington Avenue, Suite 6400 C CITY: New York D STATE: New York B ~ COT~NTRY USA
IFI ZIP: 10i74-6201 (v) CO~'UTER READABLE PO~M:
A I MEDIUM TYPE: Floppy disk B' COMPUTER: IBM PC _ t i hl c.
C, OPERATING SYSTEM: PC-DOS/~S-DOS
D SOFTWARE: P~tentIn Release #1.0, Version #1.25 (Vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: US
(B) FILING DATE: 29-NOV-1994 ( C ) CLASS IFICATION
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Lowney Dr., ~aren A.
(B) REGISTRATION NUMBER: 31,274 (C) ~N~K~;N~h/DOCRET N[~MBER: 4119.204-WO
(iX) TRTRr~ Tr~rrTrM INFORMATION:
(A) TELEPMONE: 212-867-0123 (B) TELEFAX: 212-867-0298 (2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE rM2~Rz~rTRR TCTICS:
(A) LENGTM: 1123 brse p~irs (B) TYPE: nucl~ic ~cid (C) SrR~MnT~nMRc~ aingle (D) TOPOLOGY: line~r (ii) MOLECULE TYPE: DNA (genomic) (iii) IlYrO n~~ AL: NO
( iv) ANTI-SENSE: NO
(v) FRAGM~NT TY'PE: intern~l (vi) ORIGINAL SOURCE:
(A) ORGANISM: llumicol~ insolens (C) INDIVIDUAL ISOI,ATE: DSM 6995 ~ WO95115390 2 1 7 8 0 0 8 PCTIUS94113612 ( ix ) FEATURE:
(A) NAME/~ CDS
(B) LOQTION: 126..806 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:I:
AATACGACTC ACTATl~GGA ATATTAAGCT TGGTACCGAG CTCGGATCCA CTAGTAACGG 60 ~w~ r GCTCTAAAGC ~i~W~I L~_11 QGTTGTGTA CGATCATCCA GQaCTCGCA 120 Met Val Ser Leu Lys Ser V21 Leu Ala Ala Al4 Thr Ala Val Ser Ser Al2 Ile Al4 Ala Pro Phe Asp Phe V41 Pro Arg Asp Asn Ser Thr Al~ Leu Gln Al4 Arg Gln V41 Thr Pro Asn Gly Glu Gly Trp His Asn Gly Tyr Phe Tyr Ser Trp Trp Ser Asp Gly Gly Gly Gln V41 Gln Tyr Thr Asr, Leu Glu Gly Ser Arg Tyr Gln VA 1 Ar~ Trp Arg Asn Thr Gly A3n Phe V_l Gly Gly Lys Gly Trp Asn Pro Gly Thr Gly Arg Thr ATC AAC TAC GGC GGC TAC TTC A~C CCC CAG GGC Aac GGC TAC CTG GCC 455 Ile Asn Tyr Gly Gly Tyr Phe Asn Pro Gln Gly Asn Gly Tyr Leu Al4 GTC TAC GGC TGG ACC WC A~C CCG CTC GTC GAG TAC TAT GTC ATC GAG 503 Val Tyr Gly Trp Thr Arg Asn Pro Leu VA1 Glu Tyr Tyr V~l Ilo Glu TCG TAC GGC ACG TAC AAT CCC GGC AGC QG GCT CAG TAC AaG GGC ACA 551 Ser Tyr Gly Thr Tyr Asn Pro Gly Ser Gln Ala Gln Tyr Lys Gly Thr TTC TAT ACC GAC GGC GAT CAG TAT GAC ATC m GTG AGC ACC CGC TAC 599 Phe Tyr Thr Asp Gly A3p Gln Tyr Asp Ile Phe Val Ser Thr Arg Tyr Asn 1Gl0n Pro Ser Ile Asp Gly Thr Arg Thr Phe Gln Gln Tyr Trp Ser ATC CGC AAG AAC AAG CGT GTC GGA GGC TCG GTC AAC ATG CAG Aac CAC 695 Ile Ar~ Lys Asn Lys Arg V~l Gly Gly Ser V~l Asn Met Gln Asn His Phe Asn Al4 Trp Gln Gln His Gly Met Pro Leu Gly Gln Hls Tyr Tyr Gln Va1 Val Al_ Thr Glu Gly Tyr Gln Ser Ser Gly Glu Ser Asp Ile 210 _35_ 220 WO 95/15390 2 1 7 8 0 0 8 PCT/US9J/13612~
TAT GTT CAG ACA CAC ~ r~:Lrr~r ACeCCGCATG ACAAAAGTCC GTTAGTTACA
Tyr V~l Gln Thr His 8~6 OW~ r~r.~r~r~r~ ~rrr~Grr~r ~rr~r~r.~r AGTCACTGCC ATCATGTCAG 906 TCGGA~AAAC ATCGCAGAAT Wl~.ll~llO rr~r~rGrr~ T~GCCTGAGA CATCTCTCTG 966 GCCATGCATT ll~ A TACTTGTTw GCAGTCGCTT wll~,u_lAC ~ 7lll..T 1026 AGTCATTCTT TTTCTGTACA TACTTCTTCC.TCAACTTTAG AGCACACTw ~:W~ iOlC~:; 1086 AGCATGCATC ~r~r~r~r,rrG CATCATGTAA TTAGTTA 1123 ( 2 ) INFORMATION FOR SEQ ID NO: 2:
( i ) SEQUENCE cHaRAo l ~LS, lW
(A) LENGTH: 227 ~rlino .~cids (B) TYPE: ~mino acid (D) TOPOLOGY: linezlr (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESC~IPTION: SEQ ID NO:2:
et V~l Ser Leu Lys Ser V2.1 Leu A1~ Al~ Al2l Thr Ala V~l Ser Ser l~ Ile Al~ Al Pro Phe Asp Phe Val Pro Arg Asp Asn Ser Thr Alcl eu Gln Al~ Arg Gln V~ l Thr Pro Asn Gly Glu Gly Trp His Asn Gly 35 ~0 45 yr Phe Tyr Ser Trp Trp Ser Asp Gly Gly Gly Gln V~l Gln Tyr Thr Asn Leu Glu Gly Ser Arg Tyr Gln V~l Arg Trp Arg Asn Thr Gly Asn he V ~ l Gly Gly Lys Gly Trp Asn Pro Gly Thr Gly Arg Thr Ile Asn yr Gly Gly Tyr Phe Asn Pro Gln G1y Asn Gly Tyr Leu Al V~l Tyr ly Trp Thr Arg Asn Pro Leu V 1 Glu Tyr Tyr V~l e Glu Ser Tyr Gly Thr Tyr Asn Pro Gly Ser Gln Ala Gln Tyr Lyg Gly Thr Phe Tyr Thr Asp Gly Asp Gln Tyr Asp Ile Phe Val Ser Thr Arg Tyr Asn Gln ro Ser Ile Asp Gly Thr Arg Thr Phe Gln Gln Tyr Trp Ser Ile Arg 165 : 170 175 ys Asn Ly~ Arg V~l Gly Gly Ser V~l Asn Met Gln Asn ~li9 Phe Asn Al~ Trp Gln Gln ~i9 Gly Met Pro Leu Gly Gln ~i9 Tyr Tyr Gln V~l V~l Al~ Thr Glu Gly Tyr Gln Ser Ser Gly Glu Ser Asp Ile Tyr V~1 ~ WO 95/15390 2 1 7 8 0 0 8 PCT/US94~13~S12 ln Thr Hi3 (2) INFOR~ATION FOR SEQ ID NO:3:
(i) SEQUENCE r~R~r~'RTqTICS:
Al LENGT~: 130' base pAirs B TYPE: nucle:.c ~cid C I s~ n~.nNPq~: single I D' TOPOLOGY: 1 ne~r (ii) ~OLECULE TYPE: cDNA
(iii) n~o~ c~L: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANIS~I: Coprinus cinereus ( ix) FEATURE:
( A ) NAME / E~EY: CDS
(B) LOCATION: 5..1096 (xi) SEQUENCE ~ srl: SEQ ID NO:3:

Xet Lys Leu Ser Leu Leu Ser Thr Phe Ala Ala Val Ile Ile Gly Al~ Leu A1A Leu Pro Gln Gly Pro Gly Gly Gly Gly Ser Val Thr Cys Pro Gly Gly Gln Ser Thr Ser Asn Ser Gln Cys Cys Val Trp Phe Asp V~l Leu Asp Asp Leu Gln Thr Asn Phe Tyr Gln Gly Ser Lys Cys Glu Ser Pro VA1 Arg Ly3 Ile Leu Arg Ile Val Phe ~lis Asp Al~ Ile Gly Phe Ser Pro Al~ Leu Thr Al~ Al~ Gly Gln Phe Gly Gly Gly Gly Ala Asp Gly Ser Ile Ile Ala ~is Ser Asn Ile Glu Leu Al~ Phe Pro Ala 100 105 , 110 Asn Gly Gly Leu Thr Asp Thr V~l Glu Al~ Leu Arq Al~ Val Gly Ile Asn E~i9 Gly Val Ser Phe Gly Asp Leu Ile Gln Phe Ala Thr Al~ V~l Gly Met Ser Asn Cys Pro Gly Ser Pro Arg Leu Glu Phe Leu mr Gly 145 _37_ 155 WO 95/15390 2 l 7 8 0 0 8 PCT/US94/13612--A AGC AAC ~GT TCC CAA CCC TCC CCT CCT TCG TTG ATC CCC GGT CCC 529 ArSI Ser Asn Ser Ser Gln Pro Ser Pro Pro Ser Leu Ile Pro Gly Pro Gly Asn Thr Val Thr Ala Ile Leu Asp Arg Met Gly As~ Ale Gly Phe Ser Pro Asp Glu Val V~ l Asp Leu Leu Ala A1~ ~i8 Ser ~eu Ala Ser 195 ~ 200 205 Gln Glu Gly Leu Asn Ser Ala Ile Phe Arg Ser Pro Leu Asp Ser Thr CCT CAA GTT TTC GAT ACC CAG TTC TAC ATT GAG ACC TTG CTC AAG GGT
Pro Gln V~l Phe Asp Thr Gln Phe Tyr Ile Glu Thr Leu :Leu Lys Gly 721 Thr Thr Gln Pro Gly Pro Ser Leu Gly Phe Ala Glu Glu Leu Ser Pro Phe Pro Gly Glu Phe Arg Met Arg Ser Asp A1~ Leu Leu Ala Ar~ Asp Ser Ar~ Thr Ala Cys Ars~ Trp Gln Ser Met Thr Ser Ser Asn Glu Val Met Gly Gln Ar~7 Tyr ~a~ Xa~ Xaa Met Al2 Lys Met Ser Val Leu Gly 290 295 ~ 300 Phe Asp Ar~ Asn Ala Leu Thr Asp Cys Ser Asp V~l Ile Pro Ser Al GTG TCC AAC AAC GCT GCT CCT GTT ATC CCT GGT GGC CTT ACT GTC GAT
V~l Ser Asn Asn A1~ A1~ Pro V~1 Ile Pro Gly Gly Leu Thr V~1 Asp Asp Ile Glu V~l Ser Cys Pro Ser Glu Pro Phe Pro Glu Ile A1~L Thr Ala Ser Gly Pro Leu Pro Ser Leu Ala Pro Al2 Pro AAGATGGTAC Alc~:,. Ul~,l CTCATCATCC CTCTTAGCTA TTTATCCAAT CTATCTACCT 1163 ATCTATGCAG lll~ .l ATCACCACAG r~ c~ r~A~r~ CAATGCAACG 1223 r~r~ TCAGCAAAAA AATAAATCAG ~ r~r~r TAATGAGGCC AGTTTGCGTG 1283 GTGTCAGAAG ~ JrArr ~ TCGG 1307 (2) INFOR~ATION FOR SEQ ID NO:4:
( i ) SEQtlENOE rl T~R ~rrrRR T.~TIcs (A) LENGTH: 363 a~ino Acids (B) TYPE: amino ncid (D) IY~POLOGY: line~r WO 95ll5390 PCI'/US94113612 (ii) MOLECULE TYPE: protoin ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
et Ly3 Leu Ser Leu Leu Ser Thr Phe A1A Ala Vzl Ile Ile Gly Al eu A1A Leu Pro Gln Gly Pro Gly Gly Gly Gly Ser Val Thr Cys Pro ly Gly Gln Ser Thr Ser Asn Ser Gln Cys Cys Val Trp Phe Asp Val Leu Asp Asp Leu Gln Thr Asn Phe Tyr Gln Gly Ser Lys cy9 Glu Ser Pro VA1 Arg Lys Ile Leu Arg Ile VA1 Phe His Asp Ala Iie Gly Phe er Pro Ala Leu Thr A1A A1A Gly Gln Phe Gl~ Gly Gly Gly Ala As ly Ser Ile Ile A1A His Ser Asn Ile Glu Leu A1A Phe Pro A1A Asn ly Gly Leu Thr Asp Thr VA1 Glu Ala Leu Arg Ala Val Gly Ile Asn His Gly VA1 Ser Phe Gly Asp Leu Ile Gln Phe Ala Thr A1A Val Gl 130 135 1~0 Met Ser Asn Cys Pro Gly Ser Pro Arg Leu Glu Phe Leu Thr Gly Arg Ser Asn Ser Ser Gln Pro Ser Pro Pro Ser Leu Ile Pro Gly Piro Gly sn Thr V~l Thr Ala Ile Leu Asp Arg Met Gly Asp A1A Gly Phe Ser ro Asp Glu VA1 V~1 Asp Leu Leu A1A A1D His Ser Leu Ala Ser 1 195 200 205 G n Glu Gly Leu A~n Ser A1A Ile Phe Arg Sor Pro Leu Asp Ser Thr Pro Gln V~l Phe Asp Thr Gln Phe Tyr Ile Glu Thr Leu Leu Lys Gly Thr Thr Gln Pro Gly Pro Ser Leu Gly Phe A1A Glu Glu Leu Ser Pro Phe 24.5 250 255 ro Gly Glu Phe Arg Met ~Arg Ser Asp A1A Leu Leu Ala Arg Asp Ser rg Thr Ala Cys Arg Trp Gln Ser Met Thr Ser Ser Asn Glu VA1 Met Gly Gln Arg Tyr ~ZL ~AA XA~ Met A1A Lys Met Ser VA1 Leu Gly Phe Asp Ar5j Asn AlA Leu Thr Asp Cys Ser Asp Val Ile Pro Ser AlA VA1 2~ 78008 WO 95/15390 ~ PCT/US94/13612--Ser Asn A~n Ala Al~ Pro V~l Ile Pro Gly Gly Leu Thr V~l A~p A~p Ile Glu Val Ser Cy~ Pro Ser Glu Pro Phe Pro Glu Ile Al~ Thr ~l~

Ser Gly Pro Leu Pro Ser Leu AIa Pro P.la Pro

Claims (24)

What we claim is:

1. An Aspergillus foetidus host cell comprising a nucleic acid sequence encoding a heterologous enzyme operably linked to a promoter.

2. The host cell of Claim 1 in which the enzyme is selected from the group consisting of a catalase, laccase, oxidase, phenoloxidase, oxidoreductases, cellulase, xylanase, peroxidase, lipase, esterase, cutinase, protease, aminopeptidase, carboxypeptidase, phytase, pectinase,pectin lyase, amylase, glucoamylase, alpha-galactosidase, beta-galactosidase, alpha-glucosidase, beta-glucosidase, mannosidase, isomerase, invertase, rinonuclease, chitinase, and deoxyribonuclease.

3. The host cell of Claim 1 in which the promoter is a fungal promoter.

4. The host cell of Claim 1 in which the protein is a fungal enzyme.

5. The host cell of Claim 1 which also comprises a selectable marker.

6. The host cell of Claim 5 in which the marker is a selected from the group consisting of argB, trpC, pyrG, amdS, and hygB.

7. The host cell of Claim 3 in which the promoter is selected from the group consisting of the promoters from A.
oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger glucoamylase, A. niger neutral .alpha.-amylase, A. niger acid stable .alpha.-amylase, Rhizomucor miehei lipase and a native A foetidus promoter.

8. An Aspergillus foetidus bost cell comprising a nucleic acid sequence encoding a heterologous fungal enzyme operably linked to a fungal promoter, and a selectable marker.

9. The cell of Claim 8 in which the enzyme is selected from the group consisting of a catalase, laccase, phenoloxidase, oxidase, oxidoreductases, cellulase, xylanase, peroxidase, lipase, hydrolase, esterase, cutinase, protease and other proteolytic enzymes, aminopeptidase, carboxypeptidase, phytase, lyase, pectinase and other pectinolytic enzymes, amylase, glucoamylase, .alpha.-galactosidase, .beta.-galactosidase, .alpha.-glucosidase, .beta.-glucosidase, mannosidase, isomerase, invertase, transferase, ribonuclease, chitinase, and deoxyribonuclease.

10. The host cell of Claim 9 which comprises a fungal enzyme selected from the group consisting of a lipase, a xylanase and a cellulase.

11. The host cell o$ Claim 8 in which the promoter is selected from the group consisting of the promoters from A.
oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger glucoamylase, A. niger neutral .alpha.-amylase, A. niger acid stable .alpha.-amylase, Rhizomucor miehei lipase, and a native A. foetidus promoter.

12. The host cell of Claim 8 in which the selectable marker is selected from the group consisting of args, trpC, pyrG, amdS, and hygB.

13. The host cell of Claim 8 which comprises a nucleic acid sequence encoding a fungal lipase, operably linked to a TAKA-amylase promoter, and further comprising an amdS
marker.

14. The host cell of Claim 8 which comprises a nucleic acid seguence encoding a fungal xylanase, operably linked to a TAKA-amylase promoter or an AMG promoter, and further comprising an amdS or hygB marker.

15. A method for producing an enzyme of interest which comprises culturing an Aspergillus foetidus host cell comprising a nucleic acid sequence encoding a heterologous protein operably linked to a promoter, under conditions which permit expression of the protein, and recovering the protein from culture.

16. The method of Claim 15 in which the protein is a eukaryotic enzyme.

17. The method of Claim 15 in which the promoter is a fungal promoter.

18. The method of Claim 16 in which the protein is a fungal enzyme.

19. The method of Claim 16 in which the enzyme is selected from the group consisting of a catalase, laccase, phennoloxidase, oxidase, oxidoreductases, cellulase, xylanase, peroxidase, lipase, hydrolase, esterase, cutinase, protease and other proteolytic enzymes, aminopeptidase, carboxypeptidase, phytase, lyase, pectinase and other pectinolytic enzymes, amylase, glucoamylase, .alpha.-galactosidase, .beta.-galactosidase, .alpha.-glucosidase, .beta.-glucosidase, mannosidase, isomerase, invertase, transferase, ribonuclease, chitinase, and deoxyribonuclease.

20. The method of Claim 15 which also comprises a selectable marker.

21. The method of Claim 20 in which the marker is a selected from the group consisting of argB, trpC, pyrG, amdS, and hygB.

22. The method of Claim 15 in which the promoter is selected from the group consisting of the promoters from A.
oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger glucoamylase, A. niger neutral .alpha.-amylase, A. niger acid stable .alpha.-amylase, and Rhizomucor miehei lipase.

23. An Aspergillus foetidus host cell comprising a recombinant nucleic acid sequence encoding a homologous enzyme operably linked to a promoter.

24. A method for producing an enzyme of interest which comprises culturing an Aspergillus foetidus host cell comprising a recombinant nucleic acid sequence encoding a homologous enzyme operably linked to a promoter, under conditions which permit expression of the enzyme, and recovering the enzyme from culture.