CN1139456A - Aspergillus foetidus expression system - Google Patents

Abstract

The present invention relates to a novel expression system in which Aspergillus foetidus host cells are used to express heterologous enzymes.

Description

Aspergillus foetidus expression system

Field of the present invention

The present invention relates to host cell useful in recombinant protein production.Specifically, the present invention relates to the fungal host cells of Aspergillus, can be with its high level expression recombinant protein, particularly enzyme.

Background of the present invention

In recent years, the use of recombinant host cell in heterologous protein is expressed simplified greatly the proteinic mass production of commercial value, certainly, also is available by purifying only from its natural origin.Recently, selected many expression systems to be used for therefrom producing any given protein, comprising protokaryon and eucaryon host.The selection of suitable expression system usually depends on not only that host cell produces the proteinic ability of suitable productive rate with active condition, and arranged by proteinic end-use.

Although usually use Mammals and yeast cell, begin now to recognize that be very useful with filamentous fungus as the host cell of recombinant protein production as eucaryon host.The filamentous fungus that is used at present or is proposed to be used in described purpose is a Neurospora crassa, Acremonium chrysogenum, Tolypocladium geodes, volume branch Mucor and Trichoderma reesei.In addition, used the host cell of some kind of Aspergillus especially effectively as recombinant protein production.Aspergillus is the imperfect fungi fungi; it is characterized in that aspergillum is made up of the conidium stem that ends at vesicle, each stem has one or the two-layer specialized cell that forms simultaneously successively, is called stigma or bottle stalk; and the spore of asexual formation, be called conidium.Reported with recombinant plasmid transformed Aspergillus nidulans (Ballance et al.Biochem.Biophys.Res.Comm.112:284-289,1983), but find to transform frequency quite low.Described aspergillus niger and aspergillus oryzae have been used for recombinant production protein.But, do not show that as yet other kinds with Aspergillus can be used for proteinic recombinant production, and in fact, because the low expression and/or the excessive production of proteolytic enzyme or mycotoxins, all kinds that are not Aspergillus all are suitable for being used for this purpose as host cell, and can not infer another kind from this ability of a kind.Express Australia antigen(AA) (Hongdi with smelly aspergillus, et al ActaMicrobiologica Sinica 30:98-104,1990), but also do not have report to use it for the protein of expressing any other type, and do not report that it can produce protein with high yield.A kind of ideal expression system is not have proteolytic enzyme and mycotoxins to produce basically and do not have and give birth to the excretory protein in a large amount of, but than the expression level height of known host cell.The invention provides the new Aspergillus expression system that meets these requirements now.

The present invention's summary

The invention provides the smelly aspergillus host cell of the nucleotide sequence that contains the isodynamic enzyme of encoding." isodynamic enzyme " refers to not be naturally occurring in the host cell, thereby or it carried out modifying the natural protein that has changed native sequences.In preferred embodiments, described protein is the allos fungal enzyme.Described nucleotide sequence can be operated with a promotor that suits and link to each other, and described promotor can instruct nucleotide sequence transcribing in selected host cell.

The present invention relates to the method for recombinant production enzyme, described method is included in and causes expressing under the condition of described enzyme, cultivates the smelly aspergillus of the nucleotide sequence that contains the isodynamic enzyme of encoding, and reclaims described enzyme then from culture.In preferred embodiments, described enzyme is a fungal enzyme.

Host cell of the present invention and method in the recombinant production of various fungal enzymes with other known aspergillus kinds for example aspergillus niger or aspergillus oryzae compare, have an unexpected effect.Detailed description of the present invention

Smelly aspergillus belongs to the Nigri group of Aspergillus.The member of Nigri group, for example aspergillus niger is the conidium group who is characterised in that radial conidial head and is black; Spherical vesicle; Stem is smooth transparent, or under vesicle pigment is arranged; Be with or without metulae, and usually painted (" The Genus Aspergillus ", by K.B.Raper and D.I.Fennel, TheWilliams and Wikins Company, Baltimore, 1965).The mutant of these bacterial strains is different on spore color and decorative pattern, or also comprises other microbial characteristics in this group.In the Nigri of Aspergillus group, many opinions have been passed through in defining of taxonomical unit, and this is because the main main colony colour that relies on of classified catalogue institute and produce the conidium structure variation (that is, Raper and Fennel, together above) is arranged.Raper is smelly aspergillus and smelly aspergillus acidus mutation and smelly aspergillus pallidus mutation with smelly aspergillus-relevant taxonomical unit that Fennel identifies.

Smelly aspergillar general feature is for there being two row stigmas; Conidial head keeps gloomy brown or olive brown; Conidium be spherical or when maturation subglobular, irregular but coarse meticulously.More particularly, being characterized as of this kind: work as slowly in room temperature (24-26 ℃) Czapek ' s solution agar colony growth phase, in 10 to 2 weeks, diameter is 3.5-4.5cm, vegetative hyphae is a white or yellow, growth submergence degree is big or formation is quite fine and close and coarse relatively surface, smooth or be the no circular groove or the shallow circular groove of radial circular groove, abundant olive brown is arranged to the brownish black conidial head in some bacterial strains, except that the edge of growing, in other bacterial strains, sporulation is neatly but abundant; There is not exudate or not remarkable; The bacterium colony back side is yellow to orange, become reddish-brown when aging, and smell is very strong, and pungency is arranged, the actinomycetes shape.Conidial head begins little, and is spherical to radial, keeps like this in crowded bacterium colony central zone always, and other become irregular gradually near colony edge, are cleaved into several very regular posts, and overall diameter usually is 200-300 μ, but obtains 500 μ at some bacterial strain; Most of conidium diameter is 25-35 μ, but some bacterial strain obtains 40-50 μ, than the whole surface of major part or less vesicle 3/4ths on can educate; Two row stigmas are arranged, and painted in brown shade, nascent somewhat variable, great majority are 7-12 μ * 3.0-5.0 μ, and are longer once in a while, and the secondary great majority are 7-8 μ * 2.5-3.0 μ; Conidium sphere or subglobular have brown wall, usually seem very smooth but irregular and very coarse when ripe, and most of diameters are 4.0-4.5 μ, and having does not have between obvious spore.

Bacterium colony strain growth on malt extract agar is rapid slightly, reach 5-6cm at the fortnight interior diameter, smooth, velvety, the vegetative mycelium submergence, colourless or just a little a bit yellow, a lot of sporulations are arranged all the time, dark brown shade, no circular groove or inapparent circular groove is arranged, there is faint yellow shade at the back side to almost colourless; Smell is not remarkable.Conidial head is cleaved into many remarkable bifurcateds and fine and close posts usually, and diameter reaches 300-350 μ in most of bacterial strains, but reaches 600-800 μ in other bacterial strain; Conidial head is than the more uniform spinule that has on Czapek agar.The detailed description of conidial head sees above.At first these kinds have been described by Thom and Raper (A Manual of the Aspergilli 219-220, Fig.61C, 1945).

Smelly aspergillus pallidus mutation (Nakazawz, Simo, and Watanabe, J.agr.Chem.Xoc.Japan 12:961-962, Fig.10,1936) be characterised in that growth phase on Czapek solution agar is when restricted, at 10 days interior diameters of room temperature (24-26 ℃) is 2.0-2.5cm, plane or very shallow circular groove, fine and close basic mycelium is arranged, no sporulation is white or yellow at the edge, but has crowded conidial head to olive-brown and near dark olive in the shade black to Chactura or olive in lead; The back side begins colourless, and flavescence then becomes dark yellow brown when aging; It is inapparent to belong to smell in kind, can not distinguish.Conidial head is spherical in shape radial, typically has a diameter from 500-600 μ, is cleaved into seldom and unsharp post usually; Conidium is smooth, colourless or light brown, and length is the 1 * wide 8-16 μ of being usually, has longer once in a while; Vesicle sphere or subglobular, diameter 50-60 μ on the head of maximum all can educate on whole surface; Two row stigmas are arranged, brown, one-level be generally 10-15 μ * 3.5-5.0 μ at an early age, on the head of aging, reach 30-40 μ, the secondary great majority are 7-10 μ * 3.0-4.0 μ; Conidium becomes sphere or inferior spherical from the ellipse to the oval and smooth or approximate smooth gradually, and diameter is 3.5-4.5 and more coarse, on the liquid slide glass, but remarkable continuously and not.

Bacterium colony is grown rapider on Fructus Hordei Germinatus, and is smooth usually velvety and a lot of sporulations are arranged, in the black shade of dark olive.The conidium diameter of movement reaches 700-800 μ, and is identical with situation on Czapek agar basically, but sophisticated conidium is 3.0-3.5 μ, and sphere has spinule, and surface markers is longitudinally arranged.The main aspect that this difference is different from described kind is that growth is subjected to more restriction on Czapek agar, and bigger two-dirnentional structure is arranged, and its conidium structure is olive colour darker, does not have tangible conidium to divide crutch on the ripe head on the malt agar.

Smelly aspergillus acidus (Nakazawa, Simo and Watanabe, J.Agr.Chem.Soc.Japan 12:960-961, fig.8,1936) growth phase is when slow on Czapek liquid agar to be characterised in that bacterium colony, and room temperature (24-26 ℃) was 4.0-5.0cm in 10-14 days, be initially cotton-shaped and near white to faint yellow, sporulation is less, and the later stage produces less relatively spherical radial, at edge and inferior marginarium the brownish black conidial head is arranged; The yellow shade in the back side becomes dark yellow brown when aging gradually; Smell is not remarkable; Conidial head is relatively large, and diameter is 350-400 μ, is not cleaved into distinct post; Conidium is short and wide relatively, is generally 600-800 μ * 20-30 μ, rare 1mm length, vesicle sphere or subglobular, diameter reaches 80-85 μ and all can educate on whole surface; The biserial stigma, brown, one-level is 20-40 μ * 4.6 μ, secondary is 6-10 μ * 2.5-3.5 μ; Conidium is spherical flat, brown to some, and diameter is 4.0-4.5 μ, and thick relatively wall seems smooth or surperficial somewhat irregular, but does not have spinule or little wrinkle.

Bacterium colony on Fructus Hordei Germinatus, grow rapider form at 10 days Endospores irregular, wide circular groove, smooth or very close fold, vegetative hyphae bulk-growth submergence degree is big, bright golden yellow; As above, band conidial head on short conidium but big than on Czapek, diameter reaches 500-600 μ, and conidium post is clearly arranged a lot.The aspect that this variation is different from described kind is that bacterium colony sporulation degree on Czapek and malt agar is lower, its conidial head and structure division are bigger, the conidium that suitable weak point and broad are arranged particularly has bright yellow mycelium on malt agar.

Be to be understood that the smelly aspergillus of term used in specification sheets and claim not only is included in contained biology in above-mentioned three kinds, and be included in those that or now have been divided into other classes in the classified catalogue of change, but, they should have morphology same as described above or cultural characteristic, and can be smelly aspergillus and mutation different name thereof.For example different name includes, but is not limited to A.aureus Nakazawa, A.aureus var.pallidusnakazawa, Simo and Watanabe.Also possible different name is A.citricusMosseray (A.Musallam Revision of the Black Aspergiilusspecies, Ph.D.thesis, Universitu of Utrecht).

Begin to determine candidate host cells by estimating the proteolytic enzyme level that produces by the various isolates of planting more than 15 in the different sorted group of Aspergillus.In acid, neutral and alkaline pH achieves the above object by removing at casein to detect on the plate.Surprisingly, it is best to find that several members of Nigri group finish, i.e. their proteolytic enzyme amount minimums of producing, any recombinant protein that described proteolytic enzyme can be degraded and be produced.Based on this standard, selected several kinds further to study, comprise smelly aspergillus, aspergillus japonicus, aspergillus japonicus sour jujube spore mutation, microorganism Aspergillus aculeatus, Ta Limushi aspergillus, carbon black aspergillus and nipa palm aspergillus.

Transform the trial of selected kind then.The effort of beginning concentrates on standard rice aspergillus transformation technology (Christensen et al., Bio/Technology 6:1419-1422,1988; European application 87 103806.3) use.In a word, with the relevant aspergillus oryzae method that forms protoplastis, the screening of conversion and amdS or hygromycin B (hygB) marker gene has obtained the cotransformation body.Expression vector contains aspergillus oryzae TAKA-amylase gene and from the transcription termination signal of aspergillus niger glucoamylase gene, in addition, also has allogeneic coding sequence.Transformation frequency does not wait to 10/ μ g DNA from 1/ μ g DNA.Describe in detail in the following example in the cotransformation test with expression vector, the frequency of cotransformation is 0-60%.

The kind of observing conversion then is to determine the expression level of various isodynamic enzymes.The isodynamic enzyme of being tested comprises Humicola lanuginosa lipase (HLL), Humicola insolens zytase (zytase), Humicola insolens cellulase (cellulase), Coprinus cinereus peroxidase (CiP) and Candidaantarctica lipase A.Surprisingly, smelly aspergillus all has best expression of results for one or more enzymes, but in some cases, all comparison is according to the enzyme productive rate height of aspergillus oryzae strain.Specifically, in the vibration flask was cultivated, a fetid aspergillic strain was produced the HLL (every liter of about 1 gram) of high level.The summary of these test-results sees Table 2.

Clearly illustrate that as the result several isolates of this kind can both expressing heterologous albumen.Therefore, this ability is not limited to single isolate or bacterial strain, but the whole feature of this kind.This area professional will be appreciated that other bacterial strains of these kinds or isolate also can be used for expressing heterologous protein.At U.S. typical case culture collection center (ATCC, 12301 Parklawn Drive, Rockille Maryland 200852); Agricultural Research Service Culture Collection (NRRL, 1815North University Street, Peoria, Illinois 61604); Fungal GeneticsStock Center (FGSC, Kansas); Deutsche Sammlung vonMikroorganismen und Zellkuturen (DSM, Mascheroder Weg1B, D-3300 Braunschweig, Germany); Institute of Applied Microbiology (IAM, TodyoUniversity 1-1,1-Chome, Yayoi, Bunkyo-ku, Tokyo113, Japan); Institute for Fermentation (IFO, 17-85 uso-Honmachi 2-chome, Yodogawa-ku, Osaka 532, Japan); (Netherlands) many bacterial strains of described each kind all are that the public is available for CBS, Oosterstraat 1,3740 AG Baarn with Centraal Bureau voor Schimmelcultures.

This area professional will appreciate that also successfully transforming host as herein described plants carrier, promotor and the selected marker that is not limited to use concrete proof.As a rule, transforming aspergillus oryzae, those useful in aspergillus niger and Aspergillus nidulans technology also are applicable to host cell of the present invention.For example, although amdS and hygB selected marker are preferred, other useful selected markers comprise argB (Aspergillus nidulans and aspergillus niger), trpC (aspergillus niger or Aspergillus nidulans) or pyrG (aspergillus niger or Aspergillus nidulans) mark.Promotor can be any dna sequence dna that shows strong transcriptional activity in these kinds, and can derive from the outer and intracellular protein of Codocyte, as amylase, and glucoamylase, proteolytic enzyme, lipase, the gene of cellulase and glycolytic ferment.Described suitable promotor can derive from aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartate protease, the aspergillus niger glucoamylase, the neutral α-Dian Fenmei of aspergillus niger, the gene of aspergillus niger acid stable alpha-amylase and Rhizomucor miehei lipase.The example of glycolytic ferment gene promoter is TPI, ADH and PGK.Promotor also can be a homologous promoter, the promotor of promptly natural smelly aspergillus gene.The preferred promotor of the present invention is an aspergillus oryzae TAKA amylase promotor.TAKA amylase is the α-Dian Fenmei of knowing (Todaet al., Proc.Japam Acad.58 Ser.B.:208-212,1992).Promoter sequence also can have connexon so that import the specificity restriction site, thereby helps promoter sequence is linked to each other with selected gene or with selected signal peptide or proparea.Terminator can obtain from the source identical with promotor with the polyadenylic acid sequence.Also enhancer sequence can be inserted construct.

For fear of because of obtaining the expression product smudge cells of having to, and make the possible degradation amount minimum of cell inner expression product, preferably product is secreted into the extracellular.In order to reach this purpose, in preferred embodiments, required gene is linked to each other with the signal or the leading peptide that can make expression product enter the emiocytosis approach.The gene that the proparea can derive from from the secretory protein of any biology maybe can be natural proparea.The useful source in described proparea is the glucoamylase or the amylase gene of Aspergillus, the amylase gene of Bacillaceae, the lipase of Rhizomucor miehei or proteinase gene, the gene of cereuisiae fermentum α-factor or ox prochymosin gene.Best proparea derives from the gene of aspergillus oryzae TAKA amylase, the neutral α-Dian Fenmei of aspergillus niger, aspergillus niger acid alpha-amylase, lichenoid form bacillus α-Dian Fenmei, Bacillus NCIB 11837 product Fructus Hordei Germinatus (maltogenic) amylase or lichenoid form bacillus subtilisin.A kind of effective signal sequence is an aspergillus oryzae TAKA amylase signal, Rhizomucor miehei lipase signal.In addition, also can use expressed proteic natural proparea.

The gene of the required product that links to each other with the terminator functional nucleotide sequence with promotor can be mixed and maybe can place it in the carrier that contains selected marker in the independent carrier or plasmid that can be integrated in the host strain genome.Described carrier system can be single carrier or plasmid or two or more carriers or the plasmid that contains the whole DNA that is integrated in the genome together.Carrier or plasmid can be linear or closed ring molecules.According to the preferred embodiment of the invention, transform the host with two carriers, one of them contains selected marker, and another contains remaining allogeneic dna sequence DNA to be imported, comprise promotor, gene and the transcription terminator and the polyadenylic acid sequence of coding desired protein.

Can use host cell of the present invention expressing required protokaryon or eucaryon isodynamic enzyme, and preferably be used to express the eucaryon enzyme.Described kind is useful especially, has promptly agreed they are used for foodstuffs industry.Described kind also is particularly suitable for expressing heterologous fungal enzyme (Regulatory Aspects of Microbial Food Enzymes Third Edition, The Association of Microbiaa Food Enzyme Producers, Brussels, Belgium).Can express enzyme with new expression system, as catalase, laccase, phenol oxidase, oxydase, oxydo-reductase, cellulase, zytase, peroxidase, lipase, lytic enzyme, esterase, at (cutinase), proteolytic enzyme and other proteolytic ferments, aminopeptidase, carboxypeptidase, phytase (phytase), lyase, polygalacturonase and other hydrolyzed pectins (pectinolytic) enzyme, amylase, glucoamylase, alpha-galactosidase, beta-galactosidase enzymes, alpha-glucosidase, beta-glucosidase enzyme, mannosidase, isomerase, sucrase, transferring enzyme, rnase, chitinase and deoxyribonuclease.This area professional should be appreciated that term " fungal enzyme " not only comprises natural fungal enzyme, and comprises by aminoacid replacement, and disappearance adds or other can improve activity, thermostability, the change of pH tolerance etc. and the fungal enzyme modified.

Also can be with the natural protein of the described host cell of host cell recombinant production of the present invention.The example of described application includes but not limited to smelly aspergillus natural protein is placed under the control of different promoters to improve described protein expression, utilize signal sequence that required natural protein is transported to the extracellular rapidly, or increase the proteinic copy number that produces by the main body host cell.Therefore, the present invention also comprises the recombinant production of homologous protein, uses natural non-existent genetic elements in the host cell thereby described expression comprises, or uses the natural element of not bringing into play function through processing in mode common in described host cell.

To utilize following non-limiting examples to further specify the present invention.I proteolytic enzyme detects

Detection is observed its extracellular protein enzyme bglii simultaneously from the amount of at least 15 bacterial strains more than 50 not of the same race with the proteolytic enzyme determining to be produced by each isolate.In order to prepare the cultivation inoculum, the 10ml aqua sterilisa is added in the old culture of each bacterial strain of 7-10 days in the 9cm plate, scrape spore gently from the mycelium to make thick suspension.[the ASPO4 substratum contains 1g/lCaCl with 2.5ml suspension inoculation 100mlASPO4 substratum ₂, 2g/l yeast extract, 1g/lMgSO ₄, 5g/l KH ₂PO ₄, the 2g/l citric acid, 0.5mlTrace Metal solution (contains 14.3g/lZnSO ₄7H ₂O, CuSO ₄5H ₂O, 0.5g/lNiCl ₂6H ₂O, 13.8g/lFeSO ₄7H ₂O, 8.5g/lMnSO ₄H ₂O and 3g/l citric acid), 1g/l urea, 2g/l (NH ₄) ₂SO ₄, the 20g/l Star Dri 5 in tap water (stoste of 8ml25%, the sterilization back adds) is transferred to 4.5 or 6.5 with pH before the sterilization, and the sterilization back is transferred to 4.5 with the 8ml0.1M/100ml citric acid with pH].With flask 30 and/or 37 ℃ of cultivations, on the shaker of rotation with 200rpm shaking culture 5 days, under continuous illumination.With the supernatant liquor of each nutrient solution centrifugal 5 minutes with 2500rpm, be used for tyrosine clarification plate then and detect, determine the proteolytic enzyme level of producing as each fungi kind of the potential candidate bacterium of recombinant protein expression.

Clarify experiment by the following casein plate of finishing.The plate substratum is by the 20g/l skimmed milk, and the 29g/l agarose runs the 0.2M Citrate trianion-phosphate buffered saline buffer of sample test with being used at pH5 and pH7, and the glycosides propylhomoserin NaOH damping fluid composition that is used for running at pH9 the sample test.Milk powder and 100ml damping fluid mixed be incorporated in 60 ℃ of maintenances.Agarose is mixed with the 400ml damping fluid, and high-temperature sterilization is 5 minutes then.After the cooling, add the hot milk mixture a little, mixture is inverted 2-3 time lightly so that mix.Substratum is poured in the 150mm plate, and every plate uses 50-70ml, then 5 ℃ of storages up to use.

Before being about to use, on the agar of every plate, do 12 apertures.Each strain fermentation supernatant liquor of 25 μ l is added in the different plates at different pH, then 37 ℃ of overnight incubation.For the flat board of pH9, add the 0.5M glacial acetic acid so that the tyrosine precipitation is carried out visual inspection to any clarifying district then.Then measure each plate settling section size (that is, diameter never distinguishes＞2cm) and district's type (clarification, fuzzy or fall between).

Assess the extracellular protein production of these bacterial strains again with the supernatant liquor of each culture.(San Diego, California) the 8-16% gradient gel is estimated protein pattern to the Novex for preparing with the explanation by manufacturers.75 μ l (3 and 5 days) culture supernatant sample and 20 μ l5X are dissociated, and (damping fluid dissociates damping fluid=4mlTris-HCl, pH6.8,1gSDS, the 617mg dithiothreitol (DTT) and to 10ml distilled water) and glycerine/tetrabromophenol sulfonphthalein (10-20mg is added in about 10ml80-90% glycerine, puts 1-2 hour then with dissolving in boiling water) mix, boiled 5 minutes, cooling, last sample runs sample at 60-200V and arrives the gel bottom up to the tetrabromophenol sulfonphthalein tracer dye.(BioradLaboratories, Hercules CA) dye gel silver with Biorad Silver Stain Plus Protocol.Think that those isolates of a large amount of bands are arranged is not too suitable to the new host of potential, and think collection of illustrative plates clarify relatively and have only 1-4 main band those can be used for further testing.

Make a general survey of the synthesis result of proteolytic enzyme detection and protein pattern, suitable potential candidate strain all are members of Nigri group to find great majority.Based on these results, select for use following isolate to carry out Study on Transformation: smelly aspergillus E46, smelly aspergillus CBS 103.14, smelly aspergillus pallidus mutation (NRRL356), smelly aspergillus N0953 (NRRL337; ATCC1-254), aspergillus japonicus A1438 (CBS 568.65), microorganism Aspergillus aculeatus N1136 (CBS 101.43), microorganism Aspergillus aculeatus N1454 (CBS 172.66), microorganism Aspergillus aculeatus N1455 (CBS 186.67), aspergillus japonicus sour jujube spore mutation N0956 (IAM13871), nipa palm aspergillus A528 (CBS 139.48), nipa palm aspergillus A530 (CBS137.52), nipa palm aspergillus E419 (CBS 137.52), carbon black aspergillus A3993 (IBT4977), carbon black aspergillus ATCC1025, tower wood Richter scale aspergillus E112 (ATCC 10836), tower wood Richter scale aspergillus N2266 (IFO 4358) and tower wood Richter scale aspergillus N2267 (IFO 4142), also with these culture collections at Novo NordiskBiotech Culture Collection, Davis Califonia.II vector construction A selected marker carrier uses carrier pJaL77 and pJaL154 when conversion has the host cell of hygromycin B resistance selected marker.This selected marker is based on E.coli hygromycin B phosphotransferase gene, and described gene is positioned in pJaL77 under the control of TAKA promotor, is positioned in pJaL154 under the control of amdS promotor.In brief, by these carriers of following structure.Give the gene of hygromycin B resistance from Boehringer Mannheim purchase as plasmid pHph-1.Described gene is furnished with the ATG codon and through the suitable restriction site of PCR at amino and C-terminal, the primer of use is: 5 '-GCT CAG AAGCTT CCATCC TAC ACC TCA GCAATG TCG CCT GAA CTC ACC GCG ACG TCT-3 ' (N-end) and 3 '-CGT CCG AGG GCA AAG GAA TAG CTCCAGAGATCT CAT GCT-5 ' (C-end).With restriction enzyme BamHI and XhoI cutting PCR fragment, be cloned into corresponding site among the aspergillus expression vector pToC68 (referring to WO91/17243) then to obtain pJaL77.

By following structure plasmid pJaL154.With following primer (drawn area is represented and amdS promotor homology): CCT GGA TCC TCT GTG TTA GCT TAT AG and CCT GCA TGC CGC CAG GAC CGA CGA GCA AG. clone amdS promoter mutation body I9+I666 (Hynes et al.Mol.Cell.Biol.3 (8): 1430-1439 through PCR from plasmid pCaHj406,1983 and Katz et al.MolGenGenet.220:373-376,1990).With the PCR fragment that BamHI and SphI cut the 694bp that contains the amdS promotor, be cloned into the corresponding site of pJaL77 then, so that change the TAKA promotor among the pJaL77 into the amdS promotor.

By with the 2.7kb fragment cloning of p3SR2 (Hynes et al., with above) in XbaI cutting and dephosphorylized pUC19 plasmid and make up the plasmid pToC90 that contains the amds mark.The derivative that is called pToC186 removes promoter region and contains the known amdS of raising genetic expression (Hynes et al. is with above; Corrick et al., Gene 53:63-91,1987) two sudden changes (I9 and I66) outside, identical with pToC90.The B expression vector

1 Humicola insolens zytase.Carrier pHD414 is the derivative of plasmid p775 (EP238 023).Opposite with this plasmid, pHD414 has a distinctive restriction site district between TAKA promotor and AMG terminator.By removing the long fragment (containing unnecessary RE site) of the terminal about 200bp of terminator 3 ', remove the fragment (also containing unnecessary site) that promotor 5 ' terminal about 250bp grows then and make up described plasmid.By with NarI (being positioned at the pUC carrier) and XbaI (3 ' to terminator) cracking, mend flat sophisticated end with Klenow archaeal dna polymerase+dNTP subsequently, the cmy vector fragment and the fragment of carrier segments being removed repeatedly again 20bp on gel.This plasmid is called pHD413.With StuI (promotor be arranged in 5 ' end) and PvuII (at the pUC carrier) cutting pHD413, on gel, separate and in riotous profusionly connect again, obtain pHD414.The segmental E.coli bacterial strain of about 1100bp zytase HindII/XbaI cDNA that will contain in pYES is deposited in DSM with DSM6995.By from a clone, separate zytase cDNA fragment with the HindII/XbaI cracking.Through agarose gel electrophoresis, the described fragment of electroelution purifying prepares to carry out ligation then.The cDNA fragment is connected among the pHD414 to obtain pAXX40-1-1.Xylanase gene and proteinic sequence are shown in SEQ ID NO 1 and 2, and described gene is with DSM (Deutsche SammlungVon Mikrooroganismen und Zellkulturen GmbH) 6995 preservations.

2 Humicola insolens cellulases.In WO 91/17243, can find the detailed features of Humicola insolens cellulase.With restriction enzyme BamHI and SalI cracking, from pCaHj201, cut the cellulase coding region fragment of 926bp and make up be used for cellulase expression expression vector from pCaHj418.Through the described fragment of preparation property gel electrophoresis purifying, the pHD414 (seeing above-mentioned) with BamHI and XhoI processing links to each other then with standard technique.Cellulose enzyme gene and aspergillus niger glucoamylase that the expression vector pCaHj418 of gained contains under the control of aspergillus oryzae TAKA amylase promoter transcription stop the subarea.

3 Humicola langinosa lipase.At EP305 and U.S. series application No.07/236, reported the separation and the expression of H.langinosa lipase gene in 605, all the elements are incorporated herein by reference.In a word, with method extracted total RNA from the H.langinosa mycelium of describing as people (Biochenistry 18:5294-5299,1979) such as people such as Bodl (EMBO J 3:1097-1102,1984) and Chirgwin.It is described to press Aviv and Leder (PNAS USA 69:1408-1412,1972), carries out two round-robin affinity chromatographys and obtain containing the RNA of Poly (A) in few (dT)-Mierocrystalline cellulose.Carrier pSP62-K2 and the synthetic cDNA of pCDVI-PL that people (Nature 319:640-646,1986) such as method of describing with Okayama and Berg (Molec.Cell.Biol.2:161-170,1982) and Noma describe.Synthetic cDNA is transformed into the hsdR-of E.coli MC1000, in the M+ derivative (Casadaban and Cohen, J.Mol.Bol.138:179-207,1980) to obtain recombinant clone.

At Applied Biosystems, synthetic 32 ten pentamer oligodeoxyribonucleotide mixtures on the Inc.DNA synthesizer

A??A??A??A??A

d(?TT?AA?TG?TT?AA)，

H.langinosa lipase mRNA complementation in G G G G G one of them and the Phe-Asn-Gln-Phe-Asn coding region is then through the PAGE purifying.About 10000 E.coli recombinant chous in the H.langinosacDNA library are forwarded on the Whatman540 filter paper.Press people described (Nucleic Acids Res.7:2115-2135,1979) dissolving bacterium colonies such as Gergen, fixing then.People such as filter paper and Boel (EMBO J3:1097-1102,1984) is described ³²The H.langinosa lipase specificity ten pentamer mixtures hybridization of P-mark.Finish filter paper hybridization and washing at 37 ℃ and 43 ℃ respectively, used the amplifying screen radioautograph then 24 hours.Bacterium colony pHLL702.3 and pHLL702.4 standard method (Birnboim andDoly from two hybridization, Nucleic Acids Res.7:1513-1523,1979) separate a small amount of plasmid DNA for preparing, method with Maxam and Gilbert (Methods Enzymol.65:499-560,1980) determines that DNA inserts segmental dna sequence dna.

In order to help further making up, be added to 5 ' and the 3 ' end of cDNA by the following dna sequence dna that will contain the specific limited site with cDNA.With the Sau961 digestion pHLL702.3 of digestion 3 ' non-translational region cDNA, then, fill and lead up the end of gained with e. coli dna polymerase (Klenow fragment) and four kinds of dNTP.Digest described DNA with cutting 3 ' SacI subsequently to initial methionine codon cDNA.Through the 0.9kb cDNA of agarose gel electrophoresis purifying gained fragment; Electroelution, ligation is carried out in preparation then.Synthetic 927 and two oligonucleotide of the conduct 5 ' linker of 928bp.Design described linker so that HindIII and BamHI site are added to cDNA 5 ' before initial Met codon.Activate described two oligomers with ATP and T4 polynueleotide kinase, annealing each other, then with the pUC19 carrier that digests with HindIII and HincII in the 0.9kbcDNA sequence of purifying link to each other purifying on 0.7% sepharose.The plasmid of gained has carried and has been the segmental H.langinosa lipase of 0.9kb BamHI portability cDNA.BamHI digests and after purifying 0.9kbcDNA fragment on the sepharose, its p775 with BamHI and Phosphoric acid esteraseization is linked to each other, and to obtain p960, wherein lipase cDNA is positioned at transcribing under the control of aspergillus oryzae TAKA promotor and aspergillus niger AMG terminator.

In order to prepare pMHan37, by using from Aspergillus nidulans tpiA gene (McKnightet al, Cell 46:143-147,1986) corresponding district replaces modifying p960 at 60 base pairs of the aspergillus oryzae TAKA of H.langinosa lipase gene upstream promotor 5 ' non-translational region.In the PCR reaction, use synthetic oligonucleotide and another primer, the former contains 5 ' non-translational region from Aspergillus nidulans tpiA both sides, each end in this district all has 20 bases and the p9609 sequence homology outside non-translational region just in time, and the latter is contained the BssHII site in the TAKA promoter region.Because mutagenic primer contains the BamHI site near the ATG initiator codon, thus described PCR fragment digested with BamHI and BssHII, the sequence difference between and then be cloned among the p960 that partly digests with BssHII with BamHI.Determine 200 bases of ATG upstream among the MHan37 with dna sequence analysis.p960 and the pMHan37 is as follows: pMHan37 CATGCTTGGAGTTTCCAACTCAATTTACCTCTATCCACACTTCTCTTp960 CATGCTTGGAG...GATAGCAACCGACAACATCACATCAAGCTCTCCpMHan37 CCTTCCTCAACAATAAACCCCACAGGGG..GGATCCp960 CTTCTCTGAATCCTCTATATACACAACTGGGGATCC contains the sequence of the primer in BamHI site: 5 ' GCTCCTCATGGTGGATCCCCAGTTGTGTATATAGACCATTGAGGAAGGAAGAGAAG TGTGGATAGAGGTAAATTGAGTTGGAAACTCCAAGCATGGCATCCCTTGC, 35 Coprinus cinereus peroxidase. The separation of Coprinus cinereus peroxidase and clone are referring to WO 92/16634.In a word, Coprinuscinereus (IFO 8371) mycelium extracting from homogenate, press people such as Boel (EMBO J, 3:1097-1102) and people (Biochemistry 18:5294-5299) such as Chrigwin described, when maximum peroxidase activity, collect total RNA.It is described to press Aviv and Leder (PNASUSA 69:1408-1412,1972), carries out two round-robin affinity chromatographys and obtain containing the RNA of Poly (A) in few (dT)-Mierocrystalline cellulose.By the explanation of manufacturers, with the synthetic cDNA of the cDNA synthetic agent box of Invitrogen.To transfer on the Whatman540 filter paper from about 50000 intestinal bacteria recombinant chous in CoprinuscinereuscDNA library.Press people described (Nucleic Acids Res.7:2115-2135,1979) dissolving bacterium colonies such as Gergen, fixing then.With filter paper at 0.2X SSC, 32P-mark.65 ℃ of of hybridization of among the 0.1%SDS with the peroxidase specific probe hybridization of 430 base pairs of and washings of finishing filter paper, used the amplifying screen radioautograph then 24 hours, at the temperature washing filter paper that increases gradually, used the amplifying screen radioautograph then 24 hours.In this way, identified more than 50 positive colony.With standard method (Birnboimand Doly, Nucleic Acids Res.7:1513-1523,1979) plasmid DNA of the little preparation of separation from the bacterium colony of hybridization, use two method of deoxidation (the Sanger et al. of Sanger then, PNAS USA 74:5463-5467,1977) determine that cDNA inserts segmental dna sequence dna.Cut out peroxidase CDNA fragment with HindIII/XhoI from carrier, with the corresponding purifying of sepharose, electroelution prepares to carry out ligation.HD414 with HindIII/XhoI digestion links to each other with the cDNA fragment, and to obtain pCip, wherein, cDNA is positioned at transcribing under the control of aspergillus oryzae TAKA promotor and aspergillus niger AMG terminator.Prepare pJVi9 from pCip, promptly lack the just in time SacI before the peroxidase initiator codon, KpnI, HindIII, PstI, SalI and BamHI restriction site.

The cDNA sequence of coding Coprinus cinereus peroxidase is shown in SEQ IDNO 3 and 4.

6 fusariun solani at.At expression vector pCaHj427 contains and is positioned at aspergillus oryzae TAKA-amylase promotor and aspergillus niger glucoamylase and stops subarea (Christiansenet al., Fig. 1, together above) Fusarium solani f.pisi at coding region (the Soliday et al. under the control, J.Bacteriol.171:1942-1951,1989).By above-mentioned usefulness its with pToC90 cotransformation fetid aspergillic strain NRRL341, NRRL357 and CBS103.14.

7 Candida antarctica lipase B.Expression vector pMT1335 contains and is positioned at aspergillus oryzae TAKA-amylase promotor and aspergillus niger glucoamylase and stops Candida antarctica lipase B gene under the control of subarea (Christiansen et al., Fig. 1 is with above).Transform fetid aspergillic strain CBS103.14, NRRL356, NRRL357 and NRRL341 by this carrier of above-mentioned usefulness and pToC90.

Listed the summary of the expression vector of preparation in the table 1.

Table 1 is used for the expression vector of the new host's candidate strain of cotransformation

Carrier	The gene of coding	Promotor	Terminator
				pMHan37	H.lanuginosa lipase (HLL)	TAKA-amylase	????AMG
pAXX40-1-1	The H.insolens zytase	TAKA-amylase	????AMG
				pCaHj418	The H.insolens cellulase	TAKA-amylase	????AMG
pJVi9	Coprinus cinereus peroxidase (CiP)	TAKA-amylase	????AMG
				pMT1229	Candida antarctica lipase A	TAKA-amylase	????AMG
pCaHj427	Fusarium solani at	TAKA-amylase	????AMG
				pMT1335	Candida antarctica lipase B	TAKA-amylase	????AMG

III transforms the aspergillus host

Transform the experimental strain that remains with following general method, remove the exception that specifies: with spore inoculating 100ml YDP (the Sherman et al.Methodsin Yeast Genetics that is transformed bacterial strain, Cold Spring Harbor Laboratory, 1981), in 34 ℃ of shaking culture 1-2 days.Filter the collection mycelium by miracloth, use 200ml 0.6M MgSO then ₄Washing.With mycelium suspended at 15ml1.2M MgSO ₄, 10mM NaH ₂PO ₄, among the pH=5.8.Suspension in cooled on ice, is added 1ml and contains in the damping fluid of 120mg BSA (Sigma type H25), slowly stir in 37 ℃ and continue to cultivate 1.5-2.5 hour,, in sample, can observe a large amount of protoplastiss up at microscopically.

By the miracloth filtering suspension liquid, filtrate is transferred in the sterile test tube, with 5ml0.6 M sorbyl alcohol, 100mM Tris-HCl, pH=7.0 covers.With 2500rpm centrifugal 15 minutes, from MgSO ₄Protoplastis is collected at the top of layer.STC (1.2M sorbyl alcohol, 10mM Tris-HCl, pH=7.5,10mMCaCl with two volumes ₂) be added in the protoplastis suspension,, then with 1000Xg with centrifugal 5 minutes of mixture.The protoplastis particle is resuspended among the 3mlSTC, and then precipitation.Repeat this process, then protoplastis is resuspended among the 0.2-1mlSTC.

100 μ l protoplastis suspension are mixed with the suitable DNA of 5-25 μ g in 10 μ lSTC.With the expression vector that contains desired structure gene (seeing Table 1) and each bacterial strain of plasmid cotransformation that contains selected marker.Plasmid pToC90 and pToC186 contain Aspergillus nidulans amdS gene, transform growth screening on the substratum that with the ethanamide is only nitrogen source then with it.Transform with plasmid pJaL77 and pJaL154, screen the hygromycin B resistance then.

Mixture was placed 25 minutes in room temperature.Add 0.2ml 60%PEG4000 (BDH29576), 10mM CaCl ₂With 10mM Tris-HCl pH=7.5, carefully mix twice, add identical solution of 0.85ml and careful the mixing at last.Mixture was placed 25 minutes in room temperature, with 2500Xg centrifugal 15 minutes, then particle is resuspended in the 2ml1.2M sorbyl alcohol.After more than precipitating once, protoplastis is layered on the suitable plate.Protoplastis is layered on contains 1.0M sucrose, pH=7.0 10mM ethanamide is to grow to suppress background in the minimum medium (Cove, Biochem.Biophys.Acta 113:51-56,1966) of nitrogenous source (if amdS is a selected marker) and 20mM CsCl.If hygB is a selected marker, then uses the 10mM SODIUMNITRATE to be nitrogenous source, and have 150 μ g/ml hygromycin B.As finally centrifugal, resuspended and sprawl the another kind of scheme of step, can add 8mlSTC and mixes with protoplastis,, in 3 each that select in the plates, add 3ml then, rotate then with the covering plate.In 37 ℃ cultivate 4-7 days after, pick and have conidial bacterium colony, be suspended in it in sterilized water and spread out to separate single bacterium colony.Repeat described process, after separating for the second time, the spore of single bacterium colony is stored as the transformant of determining again.The expression of IV assessment recombinant protein

Behind said process, with the single isolate of one of expression vector in the table 1 with the selected bacterial strain of mentioning in the above-described embodiments of plasmid cotransformation that contains selected marker.Detect each cotransformation body to determine whether to have expressed required gene with suitable detection method then.

A lipase

Containing 50g/l maltodextrin, 2g/lMgSO ₄7H ₂O2g/l, KH ₂PO ₄, 3g/lK ₂SO ₄, 4g/l citric acid, 8g/l yeast extract, 3g/l (NH ₄) ₂SO ₄, 0.5ml trace-metal solution, 4ml50% urea solution (autoclaving separately), 1l distilled water is cultivated the cotransformation body of related lipase enzymic activity in the M400Da substratum of pH6.0, with tap water the 5g/l yeast extract is made 800ml.Before autoclaving, pH is transferred to 4.5.After the sterilization, add the 1M urea (to obtain the final concentration of 10/l) of 166ml filtration sterilization and the 1M NaNO of 35.3ml filtration sterilization ₃(to obtain 0.3% final concentration).

With right-nitrophenyl butyric ester (pNB) is that substrate detects the lipase activity of cultivating in the filtrate.By being added to, 104.6 μ lpNB prepare pNB stoste among the 5mlDMSO.With 90 μ l50mM Tris, pH7. is added in each hole of titer plate.Add 10 μ l samples to each hole, titer plate was vibrated about 1 minute and mix.Before being about to detection, 20 μ lpNB stostes and 970 μ l50mMTris damping fluids (pH7) are lumped together, mix then.Before will detecting lipase activity with commercially available plate reader, 100 μ lpNB-Tris mixtures are added in each sample well, measure absorption value in 405nm after 3 minutes.Detection is a responsive to temperature type, so each sample sets is all used interior mark.The slope that each sample is determined is directly relevant with lipase activity; The linearity range that detects is about 0.005-5 μ g/ml.In such detection, determined that the specific activity of H.lanuginosa lipase is about 4000LU/mg, and the specific activity of candiyeast lipase A is about 400LU/mg.

The B zytase

The all zytase transformant of growth in containing the substratum of following component is in g/l: maltodextrin 50; MgSO ₄7H ₂O, 2.0; KH ₂PO ₄, 10.0; K ₂SO ₄, 2.0; Citric acid 2.0; Yeast extract, 10.0; AMG trace-metal solution, 0.5ml; Urea, 2.0; PH6.0.All transformant are all long as buried stir culture thing at 34 ℃.

Be used in the Citrate trianion phosphate buffered saline buffer, the 0.2%AZCL-xylan that suspends among the pH6.5 (Megazyme Co.Australia) is determined the xylanase activity in nutrient solution.Nutrient solution is diluted 100 times usually, and the nutrient solution with 10 μ l dilution mixes with 1mlo.2%AZCL-xylan substrate then.In 42 ℃ mixture is incubated 30 minutes.Every diaphragm 5 minutes is with the reaction mixture mixing.When insulation finishes, precipitated indigested substrate in centrifugal 5 minutes with 10000rpm.The blue dyes that the absorption value quantitative analysis that is used in 595nm discharges from this substrate, the amount of the enzymic activity of criterion calculation nutrient solution of making from the zymin of known activity then.Determine interior zytase unit (EXU) according to the enzyme standard of preparation under the same conditions.

The C cellulase

At MY50 substratum (50g/l maltodextrin, 2g/lMgSO ₄7H ₂O, 10g/lKH ₂PO ₄, 2g/lK ₂SO ₄, 2g/l citric acid, 10g/l yeast extract, 0.5ml trace-metal, 2.0g urea) in, the cellulase transformant is grown to the buried culture in the time of 34 ℃.

With the 0.2%AZCL-HE-Mierocrystalline cellulose (Megazyme) that is suspended in 0.1M Citrate trianion-phosphate buffered saline buffer (pH6.5) is substrate, measures cellulase activity.Use the 0.1M citrate buffer, pH6.5 dilutes culture, and the nutrient solution that 10 μ l are diluted mixes with the 1ml0.2%AZCL-HE-Mierocrystalline cellulose.At 42 ℃ mixture is incubated 30 minutes, every diaphragm vibration in 5 minutes simultaneously.After the insulation, precipitated indigested substrate in centrifugal 5 minutes with 10000rpm.Blueness in 595nm spectrophotometer quantitative measurment supernatant liquor is then from determining the amount of enzymic activity with the typical curve of the plain enzyme standard making of known fiber.Determine inner cellulose unit of enzyme (ECU) according to the enzyme standard of making under the same conditions.

The D peroxidase

Containing 50g/l maltodextrin, 2g/lMgSO ₄7H ₂O2g/lKH ₂PO ₄, 3g/lK ₂SO ₄, 4g/l citric acid, 8g/l yeast extract, 3g/l (NH ₄) ₂SO ₄, 0.5ml trace-metal solution, 4ml50% urea solution (high-temperature sterilization respectively) at 1l distilled water, is cultivated CiP cotransformation body in the M400Da substratum of pH6.0.

Be substrate or use the rocket immunoelectrophoresis monitoring superoxide expression of enzymes of comparing with the concentration known standard with ABTS.For immunodiffusion(ID), (1.3g/lTrisbase, 0.6g/l toxilic acid melt 1% agarose in pH7), are cooled to 55 ℃ then at the TM damping fluid.The rabbit anti-serum of the anti-CiP of 400 μ l is mixed with the 15ml agarose, sprawl, be solidificated on the plate of 10cm * 10cm.Will be in 37 ℃, CDM agar (the 1g/l K of the CiP transformant of in CDM, having grown 7 days ₂SO ₄, 30g/l sucrose, 0.3g/l NaNO ₃, 0.05g/lKCl, 0.05g/lMgSO ₄7H ₂O, 0.001g/l FeSO ₄7H ₂O, 0.001g/lZnSO ₄7H ₂O, 0.0005g/l CuSO ₄5H ₂O, 20g/l maltodextrin, 15g/l agarose) culture sample is used in the 5 mm holes that agar plate is made.Make protein diffusion 48 hours.R dyes plate with Coomassie blue, general visual inspection protein-antibody settling region.As standardized solution, be that 500,1000 and 2000 superoxide unit of enzyme (PODU)/ml uses purifying in concentration; 1PODU is the enzyme amount of per minute catalysis 1 μ mol hydrogen peroxide under standard conditions.

For (2, two (3-ethyl benzo thiazole phenanthroline-6-sulphonate) methods of 2 '-azino are determined peroxidase, and with 2ml2mM ABTS[0.110gABTS, Boehringer Mannheim No.102946 is at 0.1 M phosphate buffered saline buffer (10.63g Na with ABTS ₂HPO ₄2H ₂O p.a.M6580,5.49KH ₂PO ₄P.a.M4873 adds softening water to 1l) 30 ℃ of preheatings 10 minutes.In glass test tube, to wherein adding 10.6mMH2O2 solution (1.0g Perhydrol Suprapur 30%H2O2 Merck7298 is reaching in the softening water of 25ml), with 0.2ml sample or standard (standard=5.0mgKem-En-Tec, 1 grade, No.4140A dilutes 400 times in reaching the phosphate buffered saline buffer of 25ml).In 30 ℃ of reactions 3 minutes.In the absorption value of 418nm, measured 3 minutes milli Q softening water measure sample.Provide the best reflection of peroxidase activity by the difference of absorption value: Δ A=A (75 seconds)-A (15 seconds).The difference of absorption value should be between 0.15-0.30 corresponding to the 0.05-0.1 PODU/ml in the sample.

The E at.At tributyrin agar (13% maltodextrin, 0.3%MgSO ₄7H ₂O, 0.5%KH ₂PO ₄, 0.4% citric acid, 0.6%K ₂SO ₄, 0.5% yeast extract, 1% tributyrin, 1% urea, 0.3%NaNO ₃0.5ml trace-metal, 2% agar, the pH4.5) ability of screening selected transformant production extracellular at, the clarification by tributyrin detects.

At 37 ℃ of bacterial strains that produce maximum settling section with M400Da substratum (it is described to see above) assessment in the vibration flask is cultivated.By as mentioned above, determine extracellular at activity with the p-nitrophenyl butyric ester.In all transformant, it is the smelly aspergillus CBS103.14 transformant that is called CBS 103.14/CaHj427.1 that the at that output is the highest is produced bacterial strain.In 3 days of vibration flask cultivation, the cell that described transformant is produced is that the level of at approximates the amount of being produced by aspergillus oryzae contrast transformant Qu-1-1 greatly.In (2 liters) were cultivated on a small scale, described transformant was produced the extracellular at of about 1 grams per liter.VI result and discussion

Table 2 has been summed up the expression level of the various allos fungal enzymes of being produced by the different hosts of the present invention.As can be seen from the table, all bacterial strains have all successfully been expressed at least a required gene.Under several situations, new host strain has produced beyond thought high-caliber enzyme.For example, have a fetid aspergillic strain at least in vibration flask nutrient solution (about 1g/l), produced wonderful high-caliber HLL, show that these kinds can express a large amount of heterologous proteins.In fact, the production level of the HLL that is produced by these transformant seems and best elementary aspergillus oryzae transformant, for example HL-23 equally high or than its height.Similar, two bacterial strains are with similar high level expression lipase B.

With aspergillus oryzae, smelly aspergillus also is a kind of outstanding zytase production host.The vibration flask productive rate of this kind of enzyme approximately is 2 times of the level that arrives seen in the best aspergillus oryzae transformant.

Table 2 is expressed fungal enzyme in smelly aspergillus

Kind/bacterial strain	Selective marker	The gene of being expressed	Turn over number (number positive)	Express productive rate (vibration flask)
					Smelly aspergillus E46	?amdS ?amdS	CiP HLL	42(1) 42(22)	0.1g/l 0.06-0.1g/l
Smelly aspergillus CBS103.14	?amdS ?amdS	RLL lipase B	25(11) 58(35)	0.4g/l 1.0g.l
					Smelly aspergillus pallidus mutation NRRL356	?amdS ?amdS	HLL lipase B	12(1) 151(60)	0.5g/l 1.25g/l
Smelly aspergillus N0953	?amdS ?amdS ?hygB ?amdS	HLL zytase zytase cellulase	34(26) 28(16) 17(6) 39(16)	1.0-1.5g/l 0.08g/l 0.12g/l 0.4g/l
					Aspergillus oryzae A 1560 contrasts (from 20 the most original transformant that filter out)	?amdS ?amdS ?amdS ?amdS ?amdS	CiP HLL cellulase zytase lipase A	Contrast contrast contrast contrast contrast	0.25g/l 1g/l 0.75-1g/l 0.1g/l 0.3g/l

As what from listed data, can see, many fetid aspergillic strains all can be produced the various heterologous proteins of significant quantity, therefore determine that the surrogate as standard black aspergillus and aspergillus oryzae host system is useful, and in some cases, compare with using these known hosts, may be better.

The preservation of biomaterial

Following biomaterial has been deposited in Agricultural ResearchService Culture Collection (NRRL) 1815North UniversityStreet; The E.coli DH5 α NRRL B-21164 that the E.coli DH5 α NRRL B-21163 that the E.coli DH5 α NRRL B-21162 that Peoria, the E.coli DH5 α NRRL B-21161 that and Illinois 61604. clone registration numbers contain pJVi9 contain pCaHJ418 contains pMT1229 contains pAXX40-1-1 contains the smelly aspergillus E46 of the E.coli DH5 α NRRL B-21165 NRRL B-21167 of pMHan37

Sequence table (1) physical data: (i) applicant:

(A) name that: Novo Nordisk Biotech, Inc.

(B) street: 1445 Drew Avenue

(C) city: Davis, california

(D) country: United states of America

(E) postcode: (ZIP): 95616-4880

(F) phone: (916) 757-8100

(G) fax: (916) 757-0317 is the invention exercise question (ii): Aspergillus foetidus expression system is the sequence number (iii): 4 (iv) appropriate address:

(A) addressee: Novo Nordisk of North America, Inc.

(B) street: 405 Lexington Avenue, Suite 6400

(C) city: New York

(D) continent: New York

(E) country: USA

(F) postcode: 1017 4-62 01 (v) computer-reader form:

(A) media type: floppy disk

(B) computer: IBN PC compatibility

(C) operating system: PC-DOS/MS-DOS

(D) software: PatentIn Release #1.0, Version #1.25 (vi) current application materials:

(A) application number: US

(B) applying date: 29-NOV-1994

(C) classification number: (viii) proxy/act on behalf of data:

(A) name:

(B) number of registration: 31,274

(C) reference/number of documents: 4119.204-WO (ix) communications data:

(A) phone: 212-867-0123

(B) data of fax: 212-867-0298 (2) SEQ ID NO:1: (i) sequence signature:

(A) length: 1123 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): DNA (genome) (iii) supposes: do not have (iv) antisense: do not have (v) clip types: inner (vi) source:

(A) biology: Humicola insolens

(C) individual isolate: DSM 6995 (ix) feature:

(A) title/keyword: CDS

(B) position: 126..806 (xi) sequence description: SEQ ID NO:1:AATACGACTC ACTATAGGGA ATATTAAGCT TGGTACCGAG CTCGGATCCA CTAGTAACGG 60CCGCCAGTGT GCTCTAAAGC GCCGCTTCTT CAGTTGTGTA CGATCATCCA GCAACTCGCA 120GCACC ATG GTC TCG CTC AAG TCT GTC CTC GCG GCC GCC ACG GCT GTG 167

Met?Val?Ser?Leu?Lys?Ser?Val?Leu?Ala?Ala?Ala?Thr?Ala?Val

1???????????????5??????????????????10AGC?TCT?GCC?ATT?GCT?GCC?CCT?TTT?GAC?TTC?GTT?CCT?CGG?GAC?AAC?TCG????????????215Ser?Ser?Ala?Ile?Ala?Ala?Pro?Phe?Asp?Phe?Val?Pro?Arg?Asp?Asn?Ser?15??????????????????20??????????????????25??????????????????30ACG?GCC?CTT?CAG?GCT?CGA?CAG?GTG?ACC?CCC?AAC?GGC?GAG?GGC?TGG?CAC????????????263Thr?Ala?Leu?Gln?Ala?Arg?Gln?Val?Thr?Pro?Asn?Gly?Glu?Gly?Trp?His

35??????????????????40??????????????????45AAC?GGC?TAC?TTC?TAC?TCG?TGG?TGG?TCC?GAC?GGC?GGA?GGC?CAG?GTT?CAG????????????311Asn?Gly?Tyr?Phe?Tyr?Ser?Trp?Trp?Ser?Asp?Gly?Gly?Gly?Gln?Val?Gln

50??????????????????55??????????????????60TAC?ACC?AAC?CTC?GAG?GGC?AGC?CGC?TAC?CAG?GTC?AGA?TGG?CGT?AAC?ACC????????????359Tyr?Thr?Ash?Leu?Glu?Gly?Ser?Arg?Tyr?Gln?Val?Arg?Trp?Arg?Asn?Thr

65??????????????????70??????????????????75GGC?AAC?TTC?GTC?GGT?GGT?AAG?GGT?TGG?AAC?CCG?GGA?ACC?GGC?CGC?ACG????????????407Gly?Asn?Phe?Val?Gly?Gly?Lys?Gly?Trp?Asn?Pro?Gly?Thr?Gly?Arg?Thr

80??????????????????85??????????????????90ATC?AAC?TAC?GGC?GGC?TAC?TTC?AAC?CCC?CAG?GGC?AAC?GGC?TAC?CTG?GCC????????????455Ile?Asn?Tyr?Gly?Gly?Tyr?Phe?Asn?Pro?Gln?Gly?Asn?Gly?Tyr?Leu?Ala?95?????????????????100?????????????????105?????????????????110GTC?TAC?GGC?TGG?ACC?CGC?AAC?CCG?CTC?GTC?GAG?TAC?TAT?GTC?ATC?GAG????????????503Val?Tyr?Gly?Trp?Thr?Arg?Asn?Pro?Leu?Val?Glu?Tyr?Tyr?Val?Ile?Glu

115?????????????????120?????????????????125TCG?TAC?GGC?ACG?TAC?AAT?CCC?GGC?AGC?CAG?GCT?CAG?TAC?AAG?GGC?ACA????????????551Ser?Tyr?Gly?Thr?Tyr?Asn?Pro?Gly?Ser?Gln?Ala?Gln?Tyr?Lys?Gly?Thr

130?????????????????135?????????????????140TTC?TAT?ACC?GAC?GGC?GAT?CAG?TAT?GAC?ATC?TTT?GTG?AGC?ACC?CGC?TAC?????????????????599Phe?Tyr?Thr?Asp?Gly?Asp?Gln?Tyr?Asp?Ile?Phe?Val?Ser?Thr?Arg?Tyr

145?????????????????150?????????????????155AAC?CAG?CCC?AGC?ATC?GAC?GGC?ACC?CGG?ACG?TTC?CAG?CAG?TAC?TGG?TCT?????????????????647Asn?Gln?Pro?Ser?Ile?Asp?Gly?Thr?Arg?Thr?Phe?Gln?Gln?Tyr?Trp?Ser

160?????????????????165?????????????????170ATC?CGC?AAG?AAC?AAG?CGT?GTC?GGA?GGC?TCG?GTC?AAC?ATG?CAG?AAC?CAC?????????????????695Ile?Arg?Lys?Asn?Lys?Arg?Val?Gly?Gly?Ser?Val?Asn?Met?Gln?Asn?His175?????????????????180?????????????????185?????????????????190TTC?AAC?GCG?TGG?CAG?CAG?CAC?GGA?ATG?CCG?CTC?GGC?CAG?CAC?TAC?TAC?????????????????743Phe?Asn?Ala?Trp?Gln?Gln?His?Gly?Met?Pro?Leu?Gly?Gln?His?Tyr?Tyr

195?????????????????200?????????????????205CAG?GTC?GTC?GCC?ACC?GAG?GGC?TAC?CAG?AGC?AGT?GGC?GAG?TCC?GAC?ATC?????????????????791Gln?Val?Val?Ala?Thr?Glu?Gly?Tyr?Gln?Ser?Ser?Gly?Glu?Ser?Asp?Ile

210?????????????????215?????????????????220TAT?GTT?CAG?ACA?CAC?TAAGCGACGC?ACCCCGCATG?ACAAAAGTCC?GTTAGTTACA?????????????????846Tyr?Val?Gln?Thr?His

The data of 225TGCCGGGTGA AAAGGAGCTA TGCTATGGGC GCGGCAAGAC AGTCACTGCC ATCATGTCAG 906TCGGAAAAAC ATCGCAGAAT GGTGTTCTTC CGCATGGGAA TTGCCTGAGA CATCTCTCTG 966GCCATGCATT TTCTTGTTCA TACTTGTTGG GCAGTCGCTT GGTTGCCTAC CTCTGTTTAT 1026AGTCATTCTT TTTCTGTACA TACTTCTTCC TCAACTTTAG AGCACACTGG CGGCCGCTCG 1086AGCATGCATC TAGAGGGCCG CATCATGTAA TTAGTTA 1123 (2) SEQ ID NO:2: (i) sequence signature:

(A) length: 227 amino acid

(B) type: amino acid

(D) topological framework: linearity is molecule type (ii): protein (xi) sequence description: SEQ ID NO:2:Met Val Ser Leu Lys Ser Val Leu Ala Ala Ala Thr Ala Val Ser Ser 15 10 15Ala Ile Ala Ala Pro Phe Asp Phe Val Pro Arg Asp Asn Ser Thr Ala

20??????????????????25??????????????????30Leu?Gln?Ala?Arg?Gln?Val?Thr?Pro?Asn?Gly?Glu?Gly?Trp?His?Asn?Gly

35??????????????????40??????????????????45Tyr?Phe?Tyr?Ser?Trp?Trp?Ser?Asp?Gly?Gly?Gly?Gln?Val?Gln?Tyr?Thr

50??????????????????55??????????????????60Asn?Leu?Glu?Gly?Ser?Arg?Tyr?Gln?Val?Arg?Trp?Arg?Asn?Thr?Gly?Asn?65??????????????????70??????????????????75??????????????????80Phe?Val?Gly?Gly?Lys?Gly?Trp?Asn?Pro?Gly?Thr?Gly?Arg?Thr?Ile?Asn

85??????????????????90??????????????????95Tyr?Gly?Gly?Tyr?Phe?Asn?Pro?Gln?Gly?Asn?Gly?Tyr?Leu?Ala?Val?Tyr

100?????????????????105?????????????????110Gly?Trp?Thr?Arg?Asn?Pro?Leu?Val?Glu?Tyr?Tyr?Val?Ile?Glu?Ser?Tyr

115?????????????????120?????????????????125Gly?Thr?Tyr?Asn?Pro?Gly?Ser?Gln?Ala?Gln?Tyr?Lys?Gly?Thr?Phe?Tyr

130?????????????????135?????????????????140Thr?Asp?Gly?Asp?Gln?Tyr?Asp?Ile?Phe?Val?Ser?Thr?Arg?Tyr?Asn?Gln145?????????????????150?????????????????155?????????????????160Pro?Ser?Ile?Asp?Gly?Thr?Arg?Thr?Phe?Gln?Gln?Tyr?Trp?Ser?Ile?Arg

165?????????????????170?????????????????175Lys?Asn?Lys?Arg?Val?Gly?Gly?Ser?Val?Asn?Met?Gln?Asn?His?Phe?Asn

180?????????????????185?????????????????190Ala?Trp?Gln?Gln?His?Gly?Met?Pro?Leu?Gly?Gln?His?Tyr?Tyr?Gln?Val

195?????????????????200?????????????????205Val?Ala?Thr?Glu?Gly?Tyr?Gln?Ser?Ser?Gly?Glu?Ser?Asp?Ile?Tyr?Val

The data of 210 215 220Gln Thr His225 (2) SEQ ID NO:3: (i) sequence signature:

(A) length: 1307 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): cDNA (iii) supposes: do not have (iv) antisense: do not have (vi) originate:

(A) biology: Coprinus cinereus (ix) feature:

(A) title/keyword: CDS

(B) position: 5...1096 (xi) sequence description: SEQ ID NO:3:TACT ATG AAG CTC TCG CTT TTG TCC ACC TTC GCT GCT GTC ATC ATC GGT 49

Met?Lys?Leu?Ser?Leu?Leu?Ser?Thr?Phe?Ala?Ala?Val?Ile?Ile?Gly

1???????????????5??????????????????10?????????????????15GCC?CTC?GCT?CTA?CCC?CAG?GGT?CCT?GGA?GGA?GGC?GGG?TCA?GTC?ACT?TGC????????????97Ala?Leu?Ala?Leu?Pro?Gln?Gly?Pro?Gly?Gly?Gly?Gly?Ser?Val?Thr?Cys

20??????????????????25??????????????????30CCC?GGT?GGA?CAG?TCC?ACT?TCG?AAC?AGC?CAG?TGC?TGC?GTC?TGG?TTC?GAC???????????145Pro?Gly?Gly?Gln?Ser?Thr?Ser?Asn?Ser?Gln?Cys?Cys?Val?Trp?Phe?Asp

35??????????????????40??????????????????45GTT?CTA?GAC?GAT?CTT?CAG?ACC?AAC?TTC?TAC?CAA?GGG?TCC?AAG?TGT?GAG???????????193Val?Leu?Asp?Asp?Leu?Gln?Thr?Asn?Phe?Tyr?Gln?Gly?Ser?Lys?Cys?Glu

50??????????????????55??????????????????60AGC?CCT?GTT?CGC?AAG?ATT?CTT?AGA?ATT?GTT?TTC?CAT?GAC?GCG?ATC?GGA???????????241Ser?Pro?Val?Arg?Lys?Ile?Leu?Arg?Ile?Val?Phe?His?Asp?Ala?Ile?Gly

65??????????????????70??????????????????75TTT?TCG?CCG?GCG?TTG?ACT?GCT?GCT?GGT?CAA?TTC?GGT?GGT?GGA?GGA?GCT???????????289Phe?Ser?Pro?Ala?Leu?Thr?Ala?Ala?Gly?Gln?Phe?Gly?Gly?Gly?Gly?Ala?80??????????????????85??????????????????90??????????????????95GAT?GGC?TCC?ATC?ATT?GCG?CAT?TCG?AAC?ATC?GAA?TTG?GCC?TTC?CCG?GCT???????????337Asp?Gly?Ser?Ile?Ile?Ala?His?Ser?Asn?Ile?Glu?Leu?Ala?Phe?Pro?Ala

100?????????????????105?????????????????110AAT?GGC?GGC?CTC?ACC?GAC?ACC?GTC?GAA?GCC?CTC?CGC?GCG?GTC?GGT?ATC???????????385Asn?Gly?Gly?Leu?Thr?Asp?Thr?Val?Glu?Ala?Leu?Arg?Ala?Val?Gly?Ile

115?????????????????120?????????????????125AAC?CAC?GGT?GTC?TCT?TTC?GGC?GAT?CTC?ATC?CAA?TTC?GCC?ACT?GCC?GTC???????????433Asn?His?Gly?Val?Ser?Phe?Gly?Asp?Leu?Ile?Gln?Phe?Ala?Thr?Ala?Val

130?????????????????135?????????????????140GGC?ATG?TCC?AAC?TGC?CCT?GGC?TCT?CCC?CGA?CTT?GAG?TTC?TTG?ACG?GGC???????????481Gly?Met?Ser?Asn?Cys?Pro?Gly?Ser?Pro?ArG?Leu?Glu?Phe?Leu?Thr?Gly

145?????????????????150?????????????????155AGG?AGC?AAC?AGT?TCC?CAA?CCC?TCC?CCT?CCT?TCG?TTG?ATC?CCC?GGT?CCC???????????529Arg?Ser?Asn?Ser?Ser?Gln?Pro?Ser?Pro?Pro?Ser?Leu?Ile?Pro?Gly?Pro160?????????????????165?????????????????170?????????????????175GGA?AAC?ACT?GTC?ACT?GCT?ATC?TTG?GAT?CGT?ATG?GGC?GAT?GCA?GGC?TTC??????????????????????????577Gly?Asn?Thr?Val?Thr?Ala?Ile?Leu?Asp?Arg?Met?Gly?Asp?Ala?Gly?Phe

180?????????????????185?????????????????190AGC?CCT?GAT?GAA?GTA?GTT?GAC?TTG?CTT?GCT?GCG?CAT?AGT?TTG?GCT?TCT??????????????????????????625Ser?Pro?Asp?Glu?Val?Val?Asp?Leu?Leu?Ala?Ala?His?Ser?Leu?Ala?Ser

195?????????????????200?????????????????205CAG?GAG?GGT?TTG?AAC?TCG?GCC??ATC?TTC?AGG?TCT?CCT?TTG?GAC?TCG?ACC?????????????????????????673Gln?Glu?Gly?Leu?Asn?Ser?Ala?Ile?Phe?Arg?Ser?Pro?Leu?Asp?Ser?Thr

210?????????????????215?????????????????220CCT?CAA?GTT?TTC?GAT?ACC?CAG?TTC?TAC?ATT?GAG?ACC?TTG?CTC?AAG?GGT??????????????????????????721Pro?Gln?Val?Phe?Asp?Thr?Gln?Phe?Tyr?Ile?Glu?Thr?Leu?Leu?Lys?Gly

225?????????????????230?????????????????235ACC?ACT?CAG?CCT?GGC?CCT?TCT?CTC?GGC?TTT?GCA?GAG?GAG?CTC?TCC?CCC??????????????????????????769Thr?Thr?Gln?Pro?Gly?Pro?Ser?Leu?Gly?Phe?Ala?Glu?Glu?Leu?Ser?Pro240?????????????????245?????????????????250?????????????????255TTC?CCT?GGC?GAA?TTC?CGC?ATG?AGG?TCC?GAT?GCT?CTC?TTG?GCT?CGC?GAC??????????????????????????817Phe?Pro?Gly?Glu?Phe?Arg?Met?Arg?Ser?Asp?Ala?Leu?Leu?Ala?Arg?Asp

260?????????????????265?????????????????270TCC?CGA?ACC?GCC?TGC?CGA?TGG?CAA?TCC?ATG?ACC?AGC?AGC?AAT?GAA?GTT??????????????????????????865Ser?Arg?Thr?Ala?Cys?Arg?Trp?Gln?Ser?Met?Thr?Ser?Ser?Asn?Glu?Val

275?????????????????280?????????????????285ATG?GGC?CAG?CGA?TAC?NNN?NNN?NNC?ATG?GCC?AAG?ATG?TCT?GTT?CTC?GGC??????????????????????????913Met?Gly?Gln?Arg?Tyr?Xaa?Xaa?Xaa?Met?Ala?Lys?Met?Ser?Val?Leu?Gly

290?????????????????295?????????????????300TTC?GAC?AGG?AAC?GCC?CTC?ACC?GAT?TGC?TCT?GAC?GTT?ATT?CCT?TCT?GCT??????????????????????????961Phe?Asp?Arg?Asn?Ala?Leu?Thr?Asp?Cys?Ser?Asp?Val?Ile?Pro?Ser?Ala

305?????????????????310?????????????????315GTG?TCC?AAC?AAC?GCT?GCT?CCT?GTT?ATC?CCT?GGT?GGC?CTT?ACT?GTC?GAT?????????????????????????1009Val?Ser?Asn?Asn?Ala?Ala?Pro?Val?Ile?Pro?Gly?Gly?Leu?Thr?Val?Asp320?????????????????325?????????????????330?????????????????335GAT?ATC?GAG?GTT?TCG?TGC?CCG?AGC?GAG?CCT?TTC?CCT?GAA?ATT?GCT?ACC?????????????????????????1057Asp?Ile?Glu?Val?Ser?Cys?Pro?Ser?Glu?Pro?Phe?Pro?Glu?Ile?Ala?Thr

340?????????????????345?????????????????350GCC?TCA?GGC?CCT?CTC?CCC?TCC?CTC?GCT?CCT?GCT?CCT?TGATCTCCTC??????????????????????????????1103Ala?Ser?Gly?Pro?Leu?Pro?Ser?Leu?Ala?Pro?Ala?Pro

The data of 355 360AAGATGGTAC ATCCTGCTCT CTCATCATCC CTCTTAGCTA TTTATCCAAT CTATCTACCT 1163ATCTATGCAG TTTCTGTTCT ATCACCACAG GAAGCAAGAA AGAAAAACAA CAATGCAACG 1223TGAGCAGAAA TCAGCAAAAA AATAAATCAG TATACTACAG TAATGAGGCC AGTTTGCGTG 1283GTGTCAGAAG TAAGTACGAC TCGG, 1307 (2) SEQ ID NO:4: (i) sequence signature:

(A) length: 363 amino acid

(B) type: amino acid

(D) topological framework: linearity is molecule type (ii): protein (xi) sequence description: SEQ ID NO:4:Met Lys Leu Ser Leu Leu Ser Thr Phe Ala Ala Val Ile Ile Gly Ala 15 10 15Leu Ala Leu Pro Gln Gly Pro Gly Gly Gly Gly Ser Val Thr Cys Pro

20??????????????????25??????????????????30Gly?Gly?Gln?Ser?Thr?Ser?Asn?Ser?Gln?Cys?Cys?Val?Trp?Phe?Asp?Val

35??????????????????40??????????????????45Leu?Asp?Asp?Leu?Gln?Thr?Asn?Phe?Tyr?Gln?Gly?Ser?Lys?Cys?Glu?Ser

50??????????????????55??????????????????60Pro?Val?Arg?Lys?Ile?Leu?Arg?Ile?Val?Phe?His?Asp?Ala?Ile?Gly?Phe?65??????????????????70??????????????????75??????????????????80Ser?Pro?Ala?Leu?Thr?Ala?Ala?Gly?Gln?Phe?Gly?Gly?Gly?Gly?Ala?Asp

85??????????????????90??????????????????95Gly?Ser?Ile?Ile?Ala?Mis?Ser?Asn?Ile?Glu?Leu?Ala?Phe?Pro?Ala?Asn

100?????????????????105?????????????????110Gly?Gly?Leu?Thr?Asp?Thr?Val?Glu?Ala?Leu?Arg?Ala?Val?Gly?Ile?Asn

115?????????????????120?????????????????125His?Gly?Val?Ser?Phe?Gly?Asp?Leu?Ile?Gln?Phe?Ala?Thr?Ala?Val?Gly

130?????????????????135?????????????????140Met?Ser?Asn?Cys?Pro?Gly?Ser?Pro?Arg?Leu?Glu?Phe?Leu?Thr?Gly?Arg145?????????????????150?????????????????155?????????????????160Ser?Asn?Ser?Ser?Gln?Pro?Ser?Pro?Pro?Ser?Leu?Ile?Pro?Gly?Pro?Gly

165?????????????????170?????????????????175Asn?Thr?Val?Thr?Ala?Ile?Leu?Asp?Arg?Met?Gly?Asp?Ala?Gly?Phe?Ser

180?????????????????185?????????????????190Pro?Asp?Glu?Val?Val?Asp?Leu?Leu?Ala?Ala?His?Ser?Leu?Ala?Ser?Gln

195?????????????????200?????????????????205Glu?Gly?Leu?Asn?Ser?Ala?Ile?Phe?Arg?Ser?Pro?Leu?Asp?Ser?Thr?Pro

210?????????????????215?????????????????220Gln?Val?Phe?Asp?Thr?Gln?Phe?Tyr?Ile?Glu?Thr?Leu?Leu?Lys?Gly?Thr225?????????????????230?????????????????235?????????????????240Thr?Gln?Pro?Gly?Pro?Ser?Leu?Gly?Phe?Ala?Glu?Glu?Leu?Ser?Pro?Phe

245?????????????????250?????????????????255Pro?Gly?Glu?Phe?Arg?Met?Arg?Ser?Asp?Ala?Leu?Leu?Ala?Arg?Asp?Ser

260?????????????????265?????????????????270Arg?Thr?Ala?Cys?Arg?Trp?Gln?Ser?Met?Thr?Ser?Ser?Asn?Glu?Val?Met

275?????????????????280?????????????????285Gly?Gln?Arg?Tyr?Xaa?Xaa?Xaa?Met?Ala?Lys?Met?Ser?Val?Leu?Gly?Phe

290?????????????????295?????????????????300Asp?Arg?Asn?Ala?Leu?Thr?Asp?Cys?Ser?Asp?Val?Ile?Pro?Ser?Ala?Val305?????????????????310?????????????????315?????????????????320Ser?Asn?Asn?Ala?Ala?Pro?Val?Ile?Pro?Gly?Gly?Leu?Thr?Val?Asp?Asp

325?????????????????330?????????????????335Ile?Glu?Val?Ser?Cys?Pro?Ser?Glu?Pro?Phe?Pro?Glu?Ile?Ala?Thr?Ala

340?????????????????345?????????????????350Ser?Gly?Pro?Leu?Pro?Ser?Leu?Ala?Pro?Ala?Pro

355?????????????????360

Claims (24)

1 contains the smelly aspergillus host cell that can operate the nucleotide sequence of the coding isodynamic enzyme that links to each other with promotor.

The host cell of 2 claims 1, wherein said enzyme is selected from catalase, laccase, phenol oxidase, oxydase, oxydo-reductase, cellulase, zytase, peroxidase, lipase, lytic enzyme, esterase, at, proteolytic enzyme and other proteolytic ferments, aminopeptidase, carboxypeptidase, phytase, lyase, polygalacturonase and other pectin hydrolases, amylase, glucoamylase, alpha-galactosidase, beta-galactosidase enzymes, alpha-glucosidase, beta-glucosidase enzyme, mannosidase, isomerase, sucrase, transferring enzyme, rnase, chitinase and deoxyribonuclease.

The host cell of 3 claims 1, wherein said promotor is a fungal promoters.

The host cell of 4 claims 1, wherein said protein is fungal enzyme.

The host cell of 5 claims 1 also contains selected marker.

The host cell of 6 claims 5, wherein said mark is selected from argB, trpC, pyrG, amdS and hygB.

The host cell of 7 claims 3, wherein said promotor is selected from aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartate protease, aspergillus niger glucoamylase, the neutral α-Dian Fenmei of aspergillus niger, aspergillus niger acid stablizing α-Dian Fenmei and Rhizomucor miehei lipase.

8 smelly aspergillus host cells contain the nucleotide sequence that coding and fungal promoters and selected marker can be operated the allos fungal enzyme that links to each other.

The cell of 9 claims 8, wherein said enzyme is selected from catalase, laccase, phenol oxidase, oxydase, oxydo-reductase, cellulase, zytase, peroxidase, lipase, lytic enzyme, esterase, at, proteolytic enzyme and other proteolytic ferments, aminopeptidase, carboxypeptidase, phytase, lyase, polygalacturonase and other pectin hydrolases, amylase, glucoamylase, alpha-galactosidase, beta-galactosidase enzymes, alpha-glucosidase, beta-glucosidase enzyme, mannosidase, isomerase, sucrase, transferring enzyme, rnase, chitinase and deoxyribonuclease.

The host cell of 10 claims 9 contains and is selected from lipase, the fungal enzyme of zytase and cellulase.

The host cell of 11 claims 8, wherein said promotor is selected from the amylase from aspergillus oryzae TAKA, Rhizomucor miehei aspartate protease, the aspergillus niger glucoamylase, the neutral α-Dian Fenmei of aspergillus niger, the promotor of aspergillus niger acid stablizing α-Dian Fenmei and Rhizomucor miehei lipase.

The host cell of 12 claims 8, wherein said selected marker is selected from argB, trpC, pyrG, amdS and hygB.

The host cell of 13 claims 8 contains the nucleotide sequence that can operate the coding fungi lipase that links to each other with TAKA-amylase promotor, but also contains the amdS mark.

The host cell of 14 claims 8 contains coding and can operate the nucleotide sequence of the fungi zytase that links to each other with TAKA amylase promotor or AMG promotor, but also contains amdS or hygB mark.

15 produce required method of protein, are included in can express to cultivate under the described proteinic condition to contain the smelly aspergillus host cell that coding and promotor can be operated the nucleotide sequence of the heterologous protein that links to each other, and reclaim described protein then from nutrient solution.

The method of 16 claims 15, wherein said protein are the eucaryon enzymes.

The method of 17 claims 15, wherein said promotor is a fungal promoters.

The method of 18 claims 16, wherein said protein is fungal enzyme.

The method of 19 claims 16, wherein said enzyme is selected from catalase, laccase, phenol oxidase, oxydase, oxydo-reductase, cellulase, zytase, peroxidase, lipase, lytic enzyme, esterase, at, proteolytic enzyme and other proteolytic ferments, aminopeptidase, carboxypeptidase, phytase, lyase, polygalacturonase and other pectin hydrolases, amylase, glucoamylase, alpha-galactosidase, beta-galactosidase enzymes, alpha-glucosidase, beta-glucosidase enzyme, mannosidase, isomerase, sucrase, transferring enzyme, rnase, chitinase and deoxyribonuclease.

The method of 20 claims 15 also comprises a selected marker.

The method of 21 claims 20, wherein said mark is selected from argB, trpC, pyrG, amdS and hygB.

The method of 22 claims 15, wherein said promotor is selected from the amylase from aspergillus oryzae TAKA, Rhizomucor miehei aspartate protease, the aspergillus niger glucoamylase, the neutral α-Dian Fenmei of aspergillus niger, the promotor of aspergillus niger acid stablizing α-Dian Fenmei and Rhizomucor miehei lipase.

23 contain the smelly aspergillus host cell that can operate the nucleotide sequence of the coding homology enzyme that links to each other with promotor.

24 produce the method for desired proteins, are included in can express to cultivate under the described proteinic condition to contain the smelly aspergillus host cell that coding and promotor can be operated the recombinant nucleic acid sequence of the homologous protein that links to each other, and reclaim described protein then from nutrient solution.