CN1223691A - Modification of cryptic splice sites in heterologous genes expressed in fungi - Google Patents

Abstract

The present invention relates to methods for obtaining a fungal host cell comprising a nucleic acid sequence encoding a heterologous polypeptide, wherein at least one cryptic splice site is modified in the nucleic acid sequence. The present invention also relates to a nucleic acid sequence(s) with a modified cryptic splice site(s) as well as nucleic acid constructs, vectors, and host cells comprising said nucleic acid sequence(s). The present invention further relates to methods for recombinant production of a polypeptide encoded by said nucleic acid sequence.

Description

The modifying method of cryptic splice site in the heterologous gene of expressed in fungi

Background of invention

Invention field

The present invention relates to be used to obtain to comprise the method for reorganization fungal host cells of nucleotide sequence of heterologous protein of encoding, wherein in nucleotide sequence, have at least a cryptic splice site to be modified.The present invention also relates to have a modification cryptic splice site isolated nucleic acid sequences and comprise the nucleic acid construct of said nucleotide sequence, carrier, and recombinant host cell.The invention still further relates to and be used to recombinate the method for preparation by the polypeptide of said nucleic acid sequence encoding.

Description of related art

Eukaryotic gene is interrupted by intervening sequence (intron), and said intron must be through modifying to produce function mRNA in the precursor transcript.Before intron elimination process is called as-the mRNA montage.Usually, the tapping point sequence of intron is necessary to the intron montage by formation cover Cable Structure.Splicing signal is located immediately at the place, boundary line of intron splice site.There are total intron sequences GT and AG in the boundary line of intron splice site at 5 ' and 3 ' end respectively usually.Do not report 3 ' splice site except that AG at present, but reported some exceptions of 5 ' GT splice site.For example, there is precedent wherein to replace GT at 5 ' boundary line CT of place or GC.Very preferred nucleotide base behind GT is ANGT, and wherein N is A, C, G, or T (mainly being A or T in yeast specie), still unobvious preferred any special nucleus thuja acid in CT splice site front.In 3 ' splice site AG front mainly is pyrimidine nucleotide base (Py), i.e. C or T.

The scope of being interrupted the intron quantity of fungal gene is one to 12 or more introns (Rymond and Rosbash, 1992, E.W.Jones, J.R.Pringle, and J.R.Broach, the editor, molecule and cytobiology that yeast saccharomyces belongs to, 143-192 page or leaf, press of cold spring harbor laboratory, Plainview, New York; Gurr etc., 1987, Kinghorn, J.R. (editor), the gene structure in the eukaryotic microorganisms, 93-139 page or leaf, LRL press, Oxford University).They can be distributed in the whole gene or be positioned at 5 ' or 3 ' end of gene.Intron mainly is positioned at 5 ' end of gene in yeast saccharomyces cerevisiae.Usually intron length is less than 1kb, and length is less than 400bp in yeast usually, and length is less than 100bp in filamentous fungus.

Appear to yeast saccharomyces cerevisiae intron tapping point sequence 5 '-TACTAAC-3 ' seldom exact in the filamentous fungus intron (Gurr etc., 1987, as preceding).Observe the tract of close or loose similar TACTAAC and general consensus sequence NRCTRAC at the same loci of filamentous fungus intron, wherein N is A, C, and G, or T, and R is A or G.For example, the 4th position T is constant in the consensus sequence of Neuraspora crassa and aspergillus niger deduction.In addition, Nucleotide G, A and C surpass 80% respectively in the 3rd, 6 and 7 positions, though the 7th position flexibility of aspergillus niger more only is 65%.Yet the 1st, 2,5 and 8 position strict degree in Neuraspora crassa and aspergillus niger are all much lower.The equivalent site that other filamentous fungus contains son within it has similar tapping point to stretch, and can not make a clear distinction any trend certainly but sampling is too little.

The heterogenous expression of the gene of coded polypeptide may be used as the zone in the gene coded sequence as intervening sequence or intron with leading to errors in host strain in the fungal host bacterial strain.For example, have now found that the gene quilt montage mistakenly (Gurr etc., 1987, Kinghorn, J.R. (editor), the gene structure in the eukaryotic microorganisms, 93-139 page or leaf, LRL press, Oxford University) of the tool intron of filamentous fungus in yeast saccharomyces cerevisiae.Since parent strain (therefrom obtaining said gene) not this district as intron, so claim that this intron is hidden intron.This inappropriate identification can cause the aberrant splicing of precursor mRNA molecule, and this aberrant splicing causes not producing biologically active polypeptides or generation has bioactive several the polypeptide products of variation.

The purpose of this invention is to provide the cryptic splice site that is used to remove in gene coded sequence is not suitable for montage with the precursor mRNA that stops the fungal host cells heterogenous expression method.

Summary of the invention

The present invention relates to be used to obtain the to recombinate method of fungal host cells, this method comprises that the nucleotide sequence with the coding heterologous polypeptide imports in the fungal host cells, wherein has at least a cryptic splice site to be modified in nucleotide sequence.In one embodiment, by modifying cryptic splice site with at least one the hidden consensus sequence in non--consensus sequence substituted nucleic acids.In another embodiment, modify cryptic splice site by replacing first district that comprises at least one hidden intron or its part with second district (it has at about 40% G+C percentage composition in about 70% scope).In another preferred embodiment, by replacing hidden consensus sequence with non--consensus sequence and modifying cryptic splice site by replacing first district that comprises hidden intron or its part with second district (it has at about 40% G+C percentage composition in about 70% scope).

The nucleic acid construct that the present invention also relates to have the nucleotide sequence of at least one cryptic splice site and comprise said nucleotide sequence, carrier, and host cell.The invention still further relates to and be used to recombinate the method for preparation by the polypeptide of said nucleic acid sequence encoding.

Definition

＂ intron ＂ is defined as untranslated here and interleaves nucleotide sequence, the encoding sequence of its spaced apart gene, and from originally being sheared the mRNA transcript.

＂ exon ＂ is defined as the fragment of open gene here, and it is translated into polypeptide.

＂ originally mRNA transcript ＂ is defined as here by transcribing the mrna precursor mRNA product of generation.

＂ RNA montage ＂ is defined as the excision of the intron sequences of being transcribed by mRNA transcript originally here, and then connects remaining exon to form the mRNA product.

The hidden intron ＂ of ＂ is defined as the district of encoding sequence here, and it is identified as cut intron from mRNA transcript originally mistakenly.Hidden intron preferably has 10-1500 Nucleotide, 20-1000 Nucleotide more preferably, a preferred 30-300 Nucleotide, a most preferred 30-100 Nucleotide.

＂ consensus sequence ＂ is defined as here and is usually located at 5 ' or 3 ' exon-place, intron boundary line and contains the nucleotide sequence of intron splice site.

＂ cryptic splice site ＂ is defined as the site that 5 ' or the 3 ' boundary line (aberrant splicing takes place) that is positioned at hidden intron is located here here.

The hidden consensus sequence ＂ of ＂ is defined as the nucleotide sequence at the place, 5 ' or 3 ' boundary line that usually is positioned at hidden intron (it contains cryptic splice site) here.Hidden consensus sequence preferably is no more than 10 Nucleotide, more preferably is no more than 6 Nucleotide, preferred 3 Nucleotide, most preferred 2 Nucleotide.

＂ aberrant splicing ＂ is defined as the unfavorable excision of sequence area of being transcribed by mRNA transcript originally here, and wherein the section that is excised is used as mistakenly and is interleave nucleotide sequence.

＂ amino acid swing position ＂ is defined as the nucleotide residue that can be replaced (its reason is the degeneracy of the genetic code of fungal host cells) by another Nucleotide here.

＂ reorganization fungal host cells ＂ is defined as the fungal host cells that comprises heterologous nucleic acid sequence here.

The accompanying drawing summary

Fig. 1 shows the restriction map of pUCI9-GFP.

Fig. 2 shows the structure of pShTh34.

Fig. 3 shows to have the hidden GFP cDNA sequence (SEQ ID NO:20) that includes the subarea of the Segment A of being labeled as-D.

Fig. 4 shows the structure of pShTh49.

Fig. 5 shows the structure of pShTh58.1.

Fig. 6 shows the fluorescence spectrum of the GFP that is produced by transformant ShTh5 81.1.

Fig. 7 shows the restriction map of pShTh58.2.

Fig. 8 shows the fluorescence spectrum of the GFP that is produced by transformant ShTh582.1.

Detailed Description Of The Invention

The present invention relates to obtain the method for recombinant fungus host cell, comprise the coding heterologous polypeptide Nucleotide sequence imports in the fungal host cells, wherein has a hidden montage position in nucleotide sequence at least Point is modified. Said nucleotide sequence may be genome sequence and corresponding cDNA and RNA Sequence. Nucleotide sequence is preferably the cDNA sequence.

The allos mRNA of the heterologous polypeptide that produces by the recombinant fungus host cell of will encoding or by The cDNA that said mRNA is synthetic is with the mRNA that obtains from parental cell or by said The synthetic cDNA of mRNA makes comparisons, and can determine cryptic splice site. Parental cell is allos The source of mRNA. In addition, the amino acid order by inferring with the nucleotide sequence of parental cell and it Row are compared, can from fungal host cells by the amino acid order of the polypeptide of nucleotide sequence allos coding Determine cryptic splice site in the row. Also can utilize being total to of boundary line or reliable fungi introne splice site Have intron sequences (Rymond and Rosbash, 1992, as aforementioned; Gurr etc., 1987, As aforementioned) determine cryptic splice site.

Cryptic splice site is by replacing hidden consensus sequence and/or using Second Region with non--consensus sequence (it has the G+C percentage composition that arrives in about 70% scope about 40%, is preferably about 40%-approximately 60%, more preferably about 40%-about 50%) replace first district comprise hidden introne or its part Modify.

Can replace the hidden total order of 5 ' and 3 ' end with non--consensus sequence by method known in the art Row, these methods include but not limited to, the oligonucleotides directed mutagenesis, homology is recombinated again, direct mutagenesis, PCR mutagenesis, and chemical synthesis. In preferred embodiments, 5 ' hidden consensus sequence is GT, GC, or CT, 3 ' hidden consensus sequence is AG. In more preferred embodiment, 5 ' hidden consensus sequence is GTANGT, GCANGT, or CTANGT, and wherein N is A, C, G, or T. In another more preferred embodiment, 3 ' hidden consensus sequence is CAG, TAG, or AAG. If the somewhere surpasses a synthetic fragment, utilize known in the art Method these fragments can be annealed into jointly a fragment. Then by using the widow to this gene specific 5 ' and 3 ' remaining part of nucleotide sequence around the synthetic fragment of nucleotide primer amplification can be rebuild whole Individual coded sequence.

The nucleotides which kind of nucleotides replaces hidden consensus sequence preferably depends on codon use table, as The codon of the aspergillus fungi host cell that nextpage is shown uses the table I. Hidden consensus sequence is excellent Choosing is replaced by non--consensus sequence, wherein corresponding to the nucleotides of amino acid swing position by different Nucleotides replaces to produce identical amino acid.

Table 1

GCT	Aln
		GCC	Aln
GCA	Aln
		GCG	Aln
		CGT	Arg
CGC	Arg
		CGA	Arg
CGG	Arg
		AGA	Arg
AGG	Arg
AAT	Asn
		AAC	Asn
		GAT	Asn
GAC	Asn
TGT	Cys
		TGC	Cys
		CAA	Gln
CAG	Gln
GAA	Glu
		GAG	Glu
		GGT	Gly
GGC	Gly
		GGA	Gly
GGG	Gly
CAT	His
		CAC	His
		ATT	Ile
ATC	Ile
		ATA	Ile
		TTA	Leu

TTG	Leu
		CTT	Leu
CTC	Leu
		CTA	Leu
GTG	Leu
AAA	Lys
		AAC	Lys
		ATG	MET
		TTT	Phe
TTC	Phe
CCT	Pro
		CCC	Pro
CCA	Pro
		CCG	Pro
		TCT	Ser
TCC	Ser
		TCA	Ser
TCG	Ser
		AGT	Ser
AGC	Ser
ACT	Thr
		ACC	Thr
ACA	Thr
		ACG	Thr
		TGG	Trp
		TAT	Tyr
TAC	Tyr
GTT	Vnl
		GTC	Vnl
GTA	Vnl
		GTG	Vel

Utilize and above-mentioned be used for the same procedure that non--consensus sequence replaces hidden consensus sequence and can finish usefulness Second Region replaces first district of hidden introne or its part. In one embodiment, Second Region with First district has the oligonucleotides of equal number. In preferred embodiments, at hidden introne circle 5 ' and/or 3 ' both sides of line, first and second districts are preferably 10-500 nucleotides, more preferably 10-200 nucleotides, most preferably 10-100 nucleotides. In hidden introne, branch point sequence Not essential. In preferred embodiments, hidden intron sequences comprises at least seven nucleotides The branch point sequence of a-b-c-d-e-f-g, wherein a is A, C, G, or T; B is A or G, C is C, and d is T; E is A or T; F is A; G is C. In more preferred enforcement side In the case, branch point sequence contains at least seven nucleotides, and wherein a is A, C, G, or T; B is A; C is C, and d is T; E is A; F is A; G is C.

In preferred embodiments, the amino acid sequence of the heterologous polypeptide that produces of fungal host cells with The amino acid sequence of wild type peptide is identical. In another preferred embodiment, fungal host is thin The quantity of the amino acid residue in the heterologous polypeptide that born of the same parents produce and the amino acid residue in the wild type peptide Quantity is identical. In another preferred embodiment, non--consensus sequence and hidden consensus sequence tool The nucleotides that equal number is arranged.

The amino acid sequence of the heterologous polypeptide that the recombinant fungus host cell produces is different from wild type peptide Amino acid sequence, the former has the insertion of one or more amino acid residues or disappearance and/or one Or a plurality of amino acid residues are by the replacement of different amino acid residues. Preferably, the amino acid variation is to belong to In less important character, it is the folding or active conserved amino acid replacement of not appreciable impact protein; Be typically 1 to about 30 amino acid whose little disappearances; Amino-or the little extension of carboxyl-end, as amino-The methionine residues of end; The little connection peptide of about 20-25 residue at the most; Or be beneficial to the little of purifying and prolong Stretch, such as poly--histidine section, epitope or in conjunction with the territory. The conservative example that replaces basic amino acid (as Arginine, lysine, histidine), acidic amino acid (such as glutamic acid and aspartic acid), polarity ammonia Base acid (such as glutamine and asparagine), hydrophobic amino acid (such as leucine, isoleucine, valine), Aromatic amino acid (such as phenylalanine, tryptophan, tyrosine) and p1 amino acid (such as glycine, third ammonia Acid, serine, threonine, methionine) in the group.

Therefore, term ＂ heterologous polypeptide ＂ does not refer to the concrete length of coded product here, therefore bag Draw together peptide, oligopeptides, and protein. In addition, term ＂ heterologous polypeptide ＂ can comprise combination formation product Two or more polypeptide. Heterologous polypeptide can obtain from following source: protokaryon source (for example, gemma The hydrolase of bacillus specie, that is, AMS, protease, lipase, etc.), eucaryon (for example, is originated The actrapid monotard, human growth hormone (HGH), the ox renin, I2GdBN, egfp, etc.), And be different from fungal host originated from fungus (for example, the myceliophthora laccase, pore fungus laccase, The Coprinus peroxidase, Humicola lipase, aspergillus amylase, etc.). Heterologous polypeptide also May comprise the hybridization polypeptide, it comprises obtain partially or completely many from least two different polypeptide The combination of peptide sequence, wherein at least one polypeptide is that allos (for example, is fused to fungal host Coding myceliophthora lacquer in the signal peptide of coding aspergillus niger glucoamylase and the nucleotide sequence of propetide The nucleotide sequence of enzyme). Heterologous polypeptide can further comprise the naturally occurring allele of aforementioned polypeptides Variant and artificial variant.

Preferably, heterologous polypeptide is hormone, enzyme, acceptor, or reporter molecule. Comparatively preferred real Execute in the scheme, heterologous polypeptide is oxidoreducing enzyme, transferase, and hydrolase, lyase, isomerase, Or ligase. In more preferred embodiment, heterologous polypeptide is aminopeptidase, amylase, and carbohydrase, Carboxypeptidase; Catalase, cellulase, chitinase, cutinase, the DNA enzyme, esterase, Alpha-galactosidase, beta galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase Enzyme, haloperoxidase, invertase, laccase, lipase, mannosidase, halogen spot dextranase, Oxidizing ferment, pectin decomposing enzyme, peroxidase, phytase, polyphenol oxidase, albumen water Separate enzyme, ribalgilase, and zytase.

In another more preferred embodiment, heterologous polypeptide is that Aequorea victoria is green Look fluorescence protein (GFP). Many biologies (comprise Escherichia coli, yeast, plant cell is wriggled Worm, fly, and mammal) in, GFP has as general reporter molecule to be needed many conforming with The characteristics of wanting its can make gene expression in vivo and protein positioning be observed (Chalfie etc., 1994, science 263:802-805; Delagrave etc., 1995, biology/technology 13: 151-154; Heim etc., 1995, natural 373:663-664; Sheen etc., 1995, Plant magazine 8:777-784; Prasher, 1995, TIG 8:320-323; Haseloff And Amos, 1995, TIG 8:328-329). GFP is not yet arranged as in filamentous fungi The report of the application of gene expression reporter molecule.

The present invention also relates to the separation of modifying cryptic splice site that has with method generation of the present invention Nucleotide sequence. Have the nucleotide sequence of modifying cryptic splice site and further comprise genome sequence and right The cDNA that answers and RNA sequence, and should be appreciated that employed ＂ nucleotide sequence ＂ phrase relates to here And all such variants comprise synthetic DNA.

The present invention also relates to comprise the nucleic acid construct of said nucleotide sequence. ＂ nucleic acid construct ＂ one As think nucleic acid molecules (or for strand-or for double-stranded), it is from naturally occurring gene Isolated or it be modified to and contain the nucleic acid sections (it is not by existing in addition with occurring in nature Mode combines with mutually arranged side by side). In nucleic acid construct of the present invention, nucleotide sequence can be gene Group, cDNA, semi-synthetic origin, or synthetic origin.

The present invention also relates to comprise the recombinant expression vector of nucleic acid construct of the present invention.Recombinant expression vector can be anyly can carry out the recombinant DNA operating process expediently, and can cause the carrier that nucleotide sequence (it has the cryptic splice site of at least one modification) is expressed.The selection of carrier depends primarily on the affinity of the fungal host cells that carrier and this carrier be directed into.Carrier can be line style or closed loop plasmid.Carrier system may be to contain single carrier or plasmid or the two or more carrier or the plasmid that will be fed to the whole DNA in the fungal host genome jointly.

Said carrier is the carrier of self-replicating, that is, exists and it duplicates the carrier that does not rely on chromosome duplication with the outer entity form of karyomit(e), for example, plasmid, extra-chromosomal element, minichromosomes, or artificial chromosome.Carrier contains any instrument that guarantees self-replicating that is useful on.In addition, said carrier can be can be incorporated in the genome when it is imported in the fungal cell into and carrier that the karyomit(e) of integrating with its duplicates.For integration, carrier can be dependent on that one of tool is at least modified the nucleotide sequence of cryptic splice site or any other element of carrier comes to make the carrier stable integration in genome by homology or non-homogeneous recombination method.Another is desirable, and carrier can contain and is used in reference to conducting and crosses the additional nucleotide sequence that the homologous recombination method makes integration process in its genome that is incorporated into fungal host.Additional nucleotide sequence can make carrier be incorporated in the host cell gene group in the accurate position of karyomit(e).In order to be increased in the possibility that the exact position is integrated, here should preferred two nucleotide sequences to improve the probability of homologous recombination, these two sequences contain the nucleic acid of sufficient amount respectively, are preferably 400bp-1500bp, 800bp-1000bp more preferably, and with corresponding target sequence height homology.These nucleotide sequences be with the fungal host cells genome in any sequence of target sequence homologous, and can be non-coding sequence or encoding sequence.

For self-replicating, carrier also can comprise can make carrier carry out the replication orgin of self-replicating in question host cell.The example that is used for the replication orgin of yeast host cell is the combination of 2u replication orgin and CEN3 and ARS1.Any replication orgin compatible with the fungal host cells of selecting all can be used.

Carrier of the present invention preferably contains makes one or more selected markers of being screened easily by transformant.Selected marker is that its product provides biocide or virus resistance, heavy metal resistance, and prototroph is to auxotroph, and the gene of similar resistance.Selected marker can be selected from following group echo but be not limited to these, this group comprises amdS (acetamidase), argB (ornithine carbamyl transferring enzyme), bar (phosphinothricin Transacetylase), hygB (hygromix phosphotransferase), niaD (nitrate reductase), pyrG (Orotidine-5 '-'-phosphoric acid-decarboxylase), and sC (vitriol adeninyl transferring enzyme), and trpC (o-amino benzoyl acid synthase).In the aspergillus cell, preferably utilize the amdS of Aspergillus nidulans or aspergillus oryzae and the bar mark of pyrG mark and streptomyces hygroscopicus.In addition, can finish selection by common-transfection (described in WO91/17243), selected marker is on an independent carrier here.

In carrier, will comprise at least one nucleotide sequence of modifying splice site and effectively be connected on the regulating and controlling sequence, it is necessary that this regulating and controlling sequence is expressed the encoding sequence of its bonded nucleotide sequence.Term ＂ regulating and controlling sequence ＂ is meant here and comprises encoding sequence the expression necessary or favourable component of all its existence to nucleotide sequence.Regulating and controlling sequence can be natural concerning the nucleotide sequence of coding heterologous polypeptide or be obtained by external source.Such regulating and controlling sequence includes but not limited to following sequence, leader sequence, polyadenylation sequence, former peptide sequence, promotor, signal sequence, and transcription terminator.Minimum, regulate sequence and comprise promotor and transcribe and translate stop signal.Expression under instructing at regulating and controlling sequence in this mode that makes encoding sequence finish expression under the condition compatible with regulating and controlling sequence, will effectively be connected on the regulating and controlling sequence according to the gene that the present invention will utilize.Term ＂ encoding sequence ＂ is defined as here when the control following time that places above-mentioned regulating and controlling sequence and is transcribed into mRNA, and is translated into the sequence of heterologous polypeptide.The boundary line of encoding sequence depends on the translation initiation codon of 5 ' end and translation stop codon of 3 ' end.Encoding sequence includes but not limited to, DNA, cDNA, and recombinant nucleic acid sequence.

As mentioned above, nucleotide sequence of the present invention can effectively be connected with suitable promoter sequence.Promoter sequence is to be used to the nucleotide sequence that fungal host cells that this nucleotide sequence expresses is discerned.Promoter sequence contains the regulating and controlling sequence of transcribing and translating, the expression of their mediation heterologous polypeptides.Promotor can be anyly can show transcriptional activity in selected fungal host cells, and any nucleotide sequence that can obtain from the gene of coding and host cell homology or allogenic polypeptide.The example that is used in reference to the suitable promotor that nucleic acid construct of the present invention is transcribed in the seal wire shape fungi is the promotor that obtains from the following proteinic gene of encoding, these protein are aspergillus oryzae TAKA amylase, rice rhizopus niger aspartate protease, the neutral α-Dian Fenmei of aspergillus niger, aspergillus niger acid acceptance α-Dian Fenmei, aspergillus niger or Aspergillus awamori glucoamylase (glaA), rice rhizopus niger lipase, the aspergillus oryzae Sumizyme MP, the aspergillus oryzae triose-phosphate isomerase, the Aspergillus nidulans acetamidase, with and heterozygote.In yeast host, a useful promotor is yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate (eno-I) promotor.More preferred promotor is a TAKA amylase, NA2-tpi (deriving from the hybrid promoter of the gene of neutral α-Dian Fenmei of coding aspergillus niger and coding aspergillus oryzae triose-phosphate isomerase), and glaA promotor.

Nucleotide sequence of the present invention also can effectively be connected 3 ' end of terminator sequence.The nucleotide sequence of terminator sequence mutual-coding heterologous polypeptide can be natural or be obtained by external source.Any have the terminator of function all to can be used for the present invention in selected fungal host cells, but the preferred especially terminator that from the following proteinic gene of encoding, obtains, as aspergillus oryzae TAKA amylase, the aspergillus niger glucoamylase, Aspergillus nidulans o-amino benzoyl acid synthase, aspergillus niger alpha-glucosidase and yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate.

Nucleotide sequence of the present invention also can effectively be connected with suitable leader sequence.Leader sequence is to the very important mRNA non-translational region of fungal host translation.Leader sequence effectively can be connected to 5 ' end of the nucleotide sequence of coding heterologous polypeptide.Leader sequence can be natural concerning the nucleotide sequence of coding heterologous polypeptide or be obtained by external source.Any have the leader sequence of function all to can be used for the present invention in selected fungal host cells, but the leader sequence that especially preferably from the following proteinic gene of encoding, obtains, as aspergillus oryzae TAKA amylase, aspergillus oryzae triose-phosphate isomerase.

The polyadenylation sequence also can effectively be connected to 3 ' end of nucleotide sequence of the present invention.The polyadenylation sequence is to be discerned by fungal host when transcribing and poly adenosine residue is added into sequence on the transcript mRNA.The nucleotide sequence of polyadenylation sequence mutual-coding heterologous polypeptide can be natural or be obtained by external source.Any have the polyadenylation sequence of function all to can be used for the present invention in selected fungal host cells, but the preferred especially polyadenylation sequence that from the following proteinic gene of encoding, obtains, as aspergillus oryzae TAKA amylase, the aspergillus niger glucoamylase, Aspergillus nidulans o-amino benzoyl acid synthase, the aspergillus niger alpha-glucosidase.

For fear of destroying the necessity of cell and reduce the degradable amount of polypeptide expressed in cell to greatest extent for obtaining the heterogenous expression polypeptide, the preferred product secretion that generates is in the expression of the polypeptide gene of outside.For this point, heterologous polypeptide of the present invention can be connected the aminoterminal signal peptide of polypeptide and be connected.Signal peptide is to make the aminoacid sequence of heterologous polypeptide from the fungal host internal secretion to substratum.Signal peptide can be natural concerning the nucleotide sequence of coding heterologous polypeptide or be obtained by external source.5 ' end of nucleic acid sequence encoding sequence of the present invention contains signal peptide coding region regularly, and it is connected natively with this sections of the coding region of coding excretory heterologous polypeptide in the translation frame.In addition, to contain that part to the coding region of coding excretory heterologous polypeptide be the signal peptide coding region of external source to 5 ' of encoding sequence end.Usually the place of not containing signal peptide coding region at encoding sequence may require the external source signal peptide.In addition, the external source signal peptide can simply replace the natural signals peptide to obtain the reinforcement secretion of the heterologous polypeptide that required.The external source signal peptide coding region can obtain from following gene, as derive from the amylase or the glucoamylase gene of aspergillus species, derive from the lipase or the proteinase gene of meter rhizopus niger, and derive from the α-factor gene of yeast saccharomyces cerevisiae, or calf renninogen protogene.The effective signal peptide of fungal host cells is an aspergillus oryzae TAKA amylase signal peptide, aspergillus niger neutral starch enzyme signal peptide, rice rhizopus niger aspartate protease signal peptide, Humicola lanuginosus cellulase signal peptide, or rice rhizopus niger lipase signal peptide.Yet, anyly can make that heterologous polypeptide excretory signal peptide all can be used for the present invention in the selected fungal host.

Nucleotide sequence of the present invention can be connected to a kind of preceding peptide-coding region.Propetide is the N-terminal aminoacid sequence that is positioned at propolypeptide or proenzyme.Then produce the polypeptide of sophisticated tool biochemical activity from propolypeptide cutting propetide.Formed polypeptide is called propolypeptide or proenzyme.Propolypeptide generally is a non-activity, but then can change sophisticated activated polypeptide by catalysis or autocatalysis into from propolypeptide or proenzyme cutting propetide.Should before peptide-coding region can be natural to heterologous polypeptide or obtain by external source.Peptide-coding region can obtain from yeast saccharomyces cerevisiae α-factor gene or Myceliophthora thermophila laccase gene (WO95/33836) before the external source.

Those skilled in the art all know be used to connect said elements with the method that makes up recombinant expression vector of the present invention (referring to, for example, Sambrook etc., molecular cloning, laboratory manual, second edition, cold spring port, New York, 1989).

The present invention also relates to reorganization fungal host cells, preferred these fungal host cells when utilizing recombinant vectors of the present invention with method generation of the present invention.The preferred carrier transformant that comprises nucleotide sequence of the present invention that utilizes, then vector integration is to host chromosome.＂ transformation ＂ refers to have at least a carrier of modifying the nucleotide sequence of cryptic splice site to import in the fungal host cells with comprising, and makes carrier exist with the outer carrier format of the karyomit(e) of chromosomal integration body or self-replacation.It has been generally acknowledged that to be integrated with and be beneficial to the maintenance more stably in cell of this nucleotide sequence.Can make vector integration to host chromosome by above-mentioned homology or non-homogeneous reorganization.

The gene of the heterologous polypeptide of encoding and its source are depended in the selection of fungal host cells to a great extent.Fungal host cells may be yeast cell or filamentous fungal cells.

＂ yeast ＂ herein comprises ascosporogenous yeast (Saccharomycetes), produces the sporidium yeast, and the yeast that belongs to deuteromycetes (budding yeast genus).Ascosporogenous yeast is divided into Spermophthoraceae and Saccharomycetaceae.The latter comprises four subfamilies, i.e. Schizosaccharomycoideae (for example, Schizosaccharomyces), Nadsonioideae, Lipomycetoideae, and yeast subfamily (for example Pichia, genus kluyveromyces and yeast belong).Produce the sporidium yeast and comprise Leucosporidium, Rhodosporidium, lock is thrown yeast belong, Filobasidiella and line ustilago class.The yeast that belongs to deuteromycetes is divided into two sections.Sporobolomycetaceae (for example, Sorobolomyces and Bullera) and Cryptococcaceae (for example, mycocandida).Because yeast classification is having variation in the future, for the object of the invention, the yeast definition is according to (Skinner.F.A.Passmore.S.M. and Davenport.R.R, editor described in biology of yeast and the yeast activity, SAB's special topic investigation the 9th phase of series, 1980).Know in this area biology of yeast and yeast genetics handle (referring to, for example, yeast biochemistry and genetics, Bacil.M., Horecker.B.J. and Stopani, A.O.M. edits, the 2nd edition, 1987; Yeast, Rose.A.H. and Harrison.J.S. edit, second edition, 1987; Yeast molecular biology, Strathern etc., editor, 1981).

＂ fungi ＂ herein comprises the phyla Ascomycotina, Basidiomycotina, and chytrid subphylum and Zygomycotina are (as definition such as Hawksworth, Ainsworth of fungi and Bisby ' s dictionary, the 8th edition, 1995, CAB International, university press, Cambridge, Britain) and the oomycetes subphylum (it is incorporated in Hawksworth etc., 1995,, the 171st page as preceding) and the fungi (Hawksworth etc. of all mitospore, 1995, as preceding).Ascomycotina representative group comprises, for example, and Neurospora, Eupenicillium sp (=film lead fungi genus), naked born of the same parents' shell (=Aspergillus), Eurotium (=Aspergillus) and the definite yeast of listing above.The example of Basidiomycotina comprises mushroom, rust staining germ, and black tassel bacteria.Chytrid subphylum representative group comprises, for example, and Allomyces, little Blastocladia, Coelomomyces, and aquatic fungi.Oomycetes subphylum representative group comprises that for example, saprolegnia aquatic fungi (water mo(u)ld) is as Achyla.The example of mitospore fungi comprises Aspergillus, Eupenicillium sp, mycocandida and Alternaria.Zygomycotina representative group comprises, for example, and Rhizopus and Mucor.

＂ filamentous fungus ＂ comprises all thread fungus forms (as definition such as Hawkswarth, 1995, as preceding) of Eumycotina and oomycetes subphylum.The characteristics of said filamentous fungus are that its vegetative mycelium is made up of following material: chitin, Mierocrystalline cellulose, dextran, chitosan, mannosans and other complex polysaccharide.Nourish and grow is that carbon katabolism is the good oxygen metabolism of obligate by the mycelia elongation.On the contrary, nourishing and growing of yeast (as yeast saccharomyces cerevisiae) is by sprouting single celled thalline, and carbon katabolism is fermentating metabolism.

In one embodiment, fungal host cells is a yeast cell.In preferred embodiments, yeast host cell is mycocandida, genus kluyveromyces, yeast belong, Schizosaccharomyces, the cell of Pichia and Yarrowia species.In preferred embodiments, yeast host cell is a brewing yeast cell, the saccharomyces carlsbergensis cell, and the saccharomyces diastaticus cell, Crewe is yeast cell not, promise ground yeast cell, saccharamyces oviformis cell.In another preferred embodiment, yeast host cell is the Kluyveromyces lactis cell.In another the most preferred embodiment, yeast host cell is a Yarrowia lipolytica cell.

In another embodiment, fungal host cells is a filamentous fungal cells.In preferred embodiments, filamentous fungal host cell is the cell (but being not limited to these) of following species: the mould genus of top spore, Aspergillus, fusarium, Humicola, myceliophthora, Mucor, Neurospora, Eupenicillium sp, Thielavia, the curved mould genus of strength of China, Trichoderma.In embodiment preferred more, filamentous fungal host cell is the Aspergillus cell.More in the embodiment preferred, filamentous fungal host cell is the mould genus cell of top spore at another.In another preferred embodiment, filamentous fungal host cell is the fusarium cell.More in the embodiment preferred, filamentous fungal host cell is the Humicola cell at another.More in the embodiment preferred, filamentous fungal host cell is the myceliophthora cell at another.More in the embodiment preferred, filamentous fungal host cell is the Mucor cell at another.More in the embodiment preferred, filamentous fungal host cell is the Neurospora cell at another.More in the embodiment preferred, filamentous fungal host cell is the Eupenicillium sp cell at another.More in the embodiment preferred, filamentous fungal host cell is the Thielavia cell at another.More in the preferred embodiment, filamentous fungal host cell is the curved mould genus cell of strength of China at another.More in the embodiment preferred, filamentous fungal host cell is the Trichoderma cell at another.In highly preferred embodiment, filamentous fungal host cell is the aspergillus oryzae cell, aspergillus niger cell, smelly aspergillus cell or aspergillus japonicus cell.In another the most preferred embodiment, filamentous fungal host cell is sharp sickle spore cell or F.graminearum schw cell.In another the most preferred embodiment, filamentous fungal host cell is Humicola insolens cell or Humicolalanuginosus cell.In another highly preferred embodiment, filamentous fungal host cell is a Myceliophthora thermophila cell.In another the most preferred embodiment, filamentous fungal host cell is the mould cell of meter black wool.In another the most preferred embodiment, filamentous fungal host cell is the Neuraspora crassa cell.In another the most preferred embodiment, filamentous fungal host cell is the penicillium purpurogenum cell.In another the most preferred embodiment, filamentous fungal host cell is the mould cell of blue or green ground shuttle spore shell.In another the most preferred embodiment, the Trichoderma cell is the viride cell, Trichoderma longibrachiatum cell, Trichodermaharzianum cell, or the mould cell of healthy and free from worry wood.

Reorganization fungal host cells of the present invention further comprises the sequence of one or more snippets one or more factors of encoding, and these factors are beneficial to the expression of heterologous polypeptide, for example, and activator (as trans-acting factor), sex-linkage molecule, and processing protease.The nucleic acid of one or more these factors of coding preferably is not connected on the nucleic acid of coding heterologous polypeptide effectively.Activator is protein (Kudla etc., 1990, the 9th phase of EMBO magazine: 1355-1364 that a kind of nucleotide sequence of activated code polypeptide is transcribed; Jarai and Buxton, 1994, current genetics 26:2238-244; Verdier, 1990, yeast 6:271-297).The nucleotide sequence of coding activator can be by obtaining in the following gene: the gene of the protoheme activator 1 (hapl) of coding yeast saccharomyces cerevisiae, the gene of the semi-lactosi metabolism protein 4 (ga14) of coding yeast saccharomyces cerevisiae, and the ammonia of coding Aspergillus nidulans is regulated the gene of albumen (are4).Other embodiment, referring to the said Verdier in front, 1990 and MacKenzie etc., 1993, common micro-organisms magazine 139:2295-2307.The sex-linkage molecule is correctly folding protein (Hartl etc., 1994, TIBS 19:20-25 of a kind of auxiliary another kind of polypeptide; Bergeron etc., 1994, TIBS 19:124-128; Demolder etc., 1994, biotechnology magazine 32:179-189; Craig, 1993, science 260:1902-1903; Gething and Sambrook, 1992, natural 355:33-45; Puig and Gilbert, 1994, journal of biological chemistry 269:7764-7771; Wang and Tsou, 1993, FASEB magazine 7:1515-11157; Robinson etc., 1994, biology/technology 1:381-384).The nucleotide sequence of coding sex-linkage molecule can obtain from the gene of the following material of encoding, and as the aspergillus oryzae protein disulfide-isomerase, yeast saccharomyces cerevisiae calcium connects albumen, yeast saccharomyces cerevisiae BiP/GRP78 and yeast saccharomyces cerevisiae Hsp70.Other example, referring to Gething and Sambrook, 1992, as previously mentioned and Hartl etc., 1994, as previously mentioned.Processing protease is a kind of proteolytic enzyme (Enderlin and Ogrydziak, 1994, yeast 10:67-79 that can cut propetide with the polypeptide that produces ripe tool biochemical activity; Fuller etc., 1989, institute of NAS reports 86:1434-1438; Julius etc., 1984, cell 37:1075-1089; Julius etc., 1983, cell 32:839-852).The nucleotide sequence of coding processing protease can obtain from the gene of the following material of encoding: aspergillus niger Kex2, yeast saccharomyces cerevisiae dipeptidyl aminopeptidase, yeast saccharomyces cerevisiae Kex2 and Yarrowia lipolytica two bases processing endoproteinase (xpr6).Any have the factor of function all to can be used among the present invention in the fungal host cells of selecting for use.

The fungal cell can form by a kind of protoplastis that comprises, protoplast transformation and cell walls regenerated method, and the mode of knowing with everybody transforms.The method that is suitable for transforming the Aspergillus host cell is at EP238023 and Yelton etc., and 1980, institute of NAS reports among the 81:1470-1474 to be described.Be suitable for transforming the method for fusarium species such as Malardier etc., gene 78:117-156,1989, or described in the common unsettled U.S. serial 08/269,449.Yeast conversion can be utilized the method described in the following publication: Becker and Guarente, Abelson, J.N. and Simon, M.I. (editor), yeast genetics guide and molecular biology, Enzymology method, the 194th volume, pp182-187, publishing company of institute, New York; Ito etc., 1983, bacteriology magazine 153:163; With Hinnen etc., 1978, institute of NAS reports 75:1920.

The present invention also relates to produce the method for heterologous polypeptide, this method is included in and cultivates the reorganization fungal host cells under the condition that is beneficial to the heterologous polypeptide expression.Utilize method known in the art, fungal cell of the present invention is cultivated in the nutritional medium that is suitable for the heterologous polypeptide generation.For example; cell can be suitable under heterologous polypeptide expression and/or the separation condition in the suitable medium neutralization, and by shaking culture, small-scale or large-scale fermentation method (comprise continuously in laboratory or industrial fermentation jar; in batches, batch charging or solid state fermentation) cultivate.Utilize method known in the art (referring to, for example, Bennett, J.W. and LaSure, L., editor, polygene in the fungi is handled, press of institute, CA, 1991), in the suitable nutritional medium of carbon containing and nitrogenous source and inorganic salt, cultivate.Suitable medium can be provided or prepared according to disclosed composition the (for example catalogue at U.S. typical case culture collection center) by retailer.If heterologous polypeptide is secreted in the nutritional medium, can from substratum, directly reclaim polypeptide.If heterologous polypeptide is not secreted, then from cellular lysate, reclaim.

Expressed heterologous polypeptide can detect by method known in the art, and this method is special to special peptides.These detection methods may comprise the utilization of specific antibody, the formation of enzyme product, or the disappearance of enzyme substrates.For example, if heterologous polypeptide has enzymatic activity, can utilize enzyme assay.In addition, be available if heterologous polypeptide is had specific polyclone or monoclonal antibody, then utilize the antibody of polypeptide to carry out immunoassay.Enzyme detects and immunoassay technology is well known to those skilled in the art.

Can reclaim formed heterologous polypeptide with method known in the art.For example, polypeptide can reclaim from nutritional medium by ordinary method, and these methods include, but is not limited to centrifugal, filters extracting, spraying drying, evaporation, or precipitation.The polypeptide that is reclaimed can be further purified by multiple chromatography (for example, ion exchange chromatography, gel-filtration chromatography, affinity column chromatography method, or similar chromatography) then.

The following example has further described the present invention, but scope of the present invention is not limited to these embodiment.

Embodiment

Embodiment 1: Oligonucleolide primers

Explanation according to manufacturer, utilize 394 type DNA/RNA synthesizer (Applied Biosystems, Inc. of applying biological system, Foster City, CA) synthetic following Oligonucleolide primers: 95-48 TGTCACTACTTTCTCTTATGG (SEQ ID NO:1) 95-89 GTAATGGTTGTCTGGTAAAAG (SEQ ID NO:2) 95-448 TATCGGCCGCACCGGCCAAGATGAGTAAAGGAGAAGAACTT

(SEQ?ID?NO:3)95-449 ATACATGCATTTATTTGTATAGTTCATCCATGCCATGTGT(SEQ?ID?NO:4)95-656 TGTTACAAACTCAAGAAGGAT(SEQ?ID?NO:5)95-1202?ATGAGTAAAGGAGAAGAACTTTTC(SEQ?ID?NO:6)95-1411AAGACTCGAGCCGAGGTCAAGTTCGAGGGCGATACCCTTTGTTAACCGCATCGAGCTCAAGGGCATTGACTTCAAGGAGGACGGC(SEQ?ID?NO:7)95-1412GCTTGTCGGCCATGATGTAGACGTTATGTGAGTTATAGTTGTACTCCATCTGTGGCCAAGAATGTTGCCGTCCTCCTTGAAGT(SEQ?ID?NO:8)951413?CATCATGGCCGACAAGCCAAAGAACGGCATCAAGGTTAACTTCAAGATCCGCCACAACATTAAGGACGGCAGCGTTCAGCTCGC(SEQ?ID?NO:9)95-1414CGCCGATCGGAGTGTTCTGCTGATAATGGTCGGCGAGCTGAACGCTGCCG(SEQ?ID?NO:10)95-1415?AAGACTCGAGCCGAGGTCAAG(SEQ?ID?NO:11)95-1422?TCAAGCTTTATGTCCAAGGGCGAGGAGCTCTTCACTGGAGTTGTC(SEQ ID?NO:12)95-1457?GATGCTCGAGTCTTGTAGTTCCCGTCATCTTTGTAAAA(SEQ?IDNO:13)95-1458?GATGCGATCGGCGATGGCCCTGTCCTTTTACCAGACAA(SEQ?IDNO:14)95-1464?TGAGAATTCGGATCCTTATTTGTATAGTTCATCCATGCC(SEQ?IDNO:15)96-67TCCATTTAAATATGAGCAAGGGCGAGGAGCTCTTCACTGGAGTTGTC(SEQ?ID?NO:16)96-68?TTCCTTAATTAATTATTTGTATAGTTCATCCATGCC(SEQ?ID?NO:17)GFP2:?TGGAATAAGCTTTATGAGTAAAGGAGAAGAACTTTT(SEQ?ID?NO:18)GFP1:?AAGAATTCGGATCCCTTTAGTGTCAATTGGAAGTCT(SEQ?ID?NO:19)

Embodiment 2:DNA order-checking

Utilize the 373A of applying biological system type automated DNA sequenator (applying biological system, FosterCity, CA), on every chain, all use Taq polymerase cycle-sequencing, and adopt fluorescently-labeled dideoxy nucleotide (Giesecke etc., 1992, virological method magazine 38:47-60) and M13 reverse primer (48) and M13 (20) forward primer (New England's Bioexperiment is real, Beverly, MA) and by sequenced dna exclusive primer, thereby measure nucleotide sequence.

Embodiment 3:Aequoren virtoria egfp (GFP) is analyzed

Utilize Perkin-Elmer Cetus LS50B photofluorometer (Perkin-Elmer Corp., Norwalk, CT) generation of detection GFP.Specifically, the protein extract with 100 microlitres is in place in the microtitration flat board in 96 holes in Perkin-Eimer Cetus LS50B flat bed reader.Extract is placed under the light of 395nm, read emmission spectrum value from 400 to 600nm.

(Thornwood is NY) with GFP filter for installation (colourity technology company, Brattleboro, VT) the mycelial GFP fluorescence of observation for Carl Zeiss, Inc. to utilize Zeiss Axioplan microscope.

Embodiment 4: the structure of expression vector pShTh34

Make up filamentous fungus expression vector pShTh34 GFP structure gene being placed TAKA amylase promotor, under the control of signal sequence and terminator.

(Promega, Madison WI), change into cDNA with total RNA (it is by standard method isolated from Aequoria victoria (Sambrook etc., 1989, as preceding)) to utilize the AMV reversed transcriptive enzyme that manufacturer recommends.Utilize then according to the GFP sequence (Prasher etc., 1992, the gene 11 1:229-233 that delivered in the past; The gene pool number of registering on the books M62653) designed PCR primer, and UITma ^TM(Perkin Elmer, Foster City is CA) by pcr amplification cDNA for polysaccharase.The sequence of primer is shown in front SEQ IDNOS:18 and 19.

The restriction endonuclease site is inserted into 5 ' (the Hind III site) and 3 ' (EcoR I and BamH I site) of primer, and this GFP cDNA that helps pcr amplification is cloned in the pUC19 carrier of little modification.Making up details is LacZ Shine-Dalgarno AGGA, and and then 5 ' Hind III site adds extra T and GFP ATG codon thereafter, produces following DAN sequence: PLacZ-AGGAAAGCTTTATG-GFP at the merging point of LacZ promotor GFP.At the 3 ' end of GFP cDNA, corresponding to the BamH I that the base pair of 770 Nucleotide in the GFP sequence of delivering produces by PCR, EcoR I joining region (as shown in Figure 1) is fused on the EcoR I site in the pUC19 multiple clone site (MCS).

Utilize pUC19-GFP as template, pass through pcr amplification GFP structure gene with Oligonucleolide primers 95-448 described in the embodiment 1 and 95-449.Amplified reaction comprises following component: each 200 micromolar dATP, and dCTP, dGTP, and dTTP, the 50ng template, each 30 picomole primer, 1 * Taq polymerase buffer and 0.5 Taq of unit polysaccharase (the Stratagene cloning system, La Jolla, CA).Reactant is pressed following scheme incubation in the Ericomp thermal cycler: 94 ℃ of following 5 minutes circulation primary; 94 ℃ of each circulations 1 minute, 60 ℃ 1 minute, 74 ℃ of totally 30 circulations in 1 minute; 74 ℃ of following 15 minutes circulation primary.Utilize these primers Sfi I restriction enzyme site can be added on the upstream that is right after the ATG initiator codon, and Nsi I site is added on the downstream that is right after the GFP terminator codon.Utilize the agarose electrophoresis standard method to isolate this fragment.With formed fragment subclone to pMWR1 to produce pShTh34 as shown in Figure 2.

The filamentous fungus of embodiment 5:pShTh34 transforms

(KS) cotransformation advances in the aspergillus oryzae HoWB104pyrG protoplastis for fungi heredity storage center, Kansas City with pShTh34 and pPyrG.With every ml2 * 10 ⁷The protoplastis of concentration transforms.The protoplastis of 100 μ l and the DNA of 10 μ g were placed 30 minutes on ice.Add SPTC (40%PEG4000,0.8M sorbyl alcohol, 0.05M Tris pH8.0, the 0.05MCaCl of 1ml ₂) and with protoplastis 34 ℃ of following incubations 20 minutes.The direct bed board of protoplastis is being comprised on the flat board of minimum medium (every liter: 6g NaNO ₃, 0.52g KCl, 1.52g KH ₂PO ₄, 1ml trace metal solution, 1g glucose, 500mg MgSO ₄-7H ₂O, the pure agar of 342.3g sucrose and 20g, pH are 6.5).Trace metal solution (1000X) comprises every liter of 22gZnSO ₄-7H ₂O, 11g H ₃BO ₃, 5g MnCl ₂-4H ₂O, 5g FeSO ₄-7H ₂O, 1.6gCoCl ₂-5H ₂O, 1.6g (NH ₄) ₆Mo ₇O ₂₄, and 50g Na ₄EDTA.With flat board at 37 ℃ of following incubation 5-7 days.Transfer to transformant on the flat board that contains same medium but do not have sucrose and at 37 ℃ of following incubation 3-5 days.Under identical condition, come the purifying transformant by line spore and the isolating bacterium colony of picking with same flat board.Formed transformant is named as aspergillus oryzae ShTh340.

Embodiment 6:GFP extracting

Filter out the transformant that can express GFP in the transformant of aspergillus oryzae ShTh340 described in the embodiment 5 with embodiment 3 described fluorometrys.Under 37 ℃, in the 12 hole microtitration flat boards, in 4ml MY51 substratum static cultivation 1-5 days, said cultivation base comprised following component for every liter: 50g maltose, 2g MgSO with 10 aspergillus oryzae ShTh340-19 transformant ₄-7H ₂O, 10g KH ₂PO ₄, 2gK ₂SO ₄, 2g Citric Acid, 10g yeast extract, 0.5ml trace metal solution as described in example 5 above, 1g urea, and 2g (NH ₄) ₂SO ₄Collect hypha body, transfer in the 1.5ml Eppendorf tube, and place dry ice last 5 minute.Then Eppendorf tube is placed on SpeedVac (Savant instrument company, Farmingdale, NY) in, and drying at room temperature is spent the night under vacuum.Utilize the aseptic lancet exsiccant culture of in pipe, crushing.It is that it comprises the Pepstatin of 1mM PMSF and 0.1mM among 50mM sodium phosphate-0.5M NaCl of 5.5 that the culture of crushing is suspended in 400 microlitre pH.(DuPont instrument company, Newtown CT), formed bead at 20 minutes under the full speed to mycelial fragment with the little whizzer of MC12V type Sorvall.The supernatant liquor of 200 microlitres is transferred in the new Eppendorf tube, and measured according to the method described in the embodiment 3.

Produce detectable fluorescence without any aspergillus oryzae ShTh340-19 transformant.

Embodiment 7:mRNA analyzes

From embodiment 6 described aspergillus oryzae ShTh340-19 transformant, isolate total RNA with Timberlake and Barnard method (1981, cell 26:29-37).

(Bethesda research laboratory, Gaithersburg MD), synthesize specificity GFP cDNA according to shop instruction to utilize 3 ' Race test kit.React from total RNA of said transformant and specificity 5 ' the Oligonucleolide primers 95-1202 one described in 3 ' UAP Oligonucleolide primers and the embodiment 1 with 1 microgram.The amplified reaction thing contains following component: each 200 micromolar dATP, dCTP, dGTP, and dTTP, every kind of each 1 picomole of primer, 50ng template, the Taq polysaccharase of 1 * Taq polymerase buffer and 0.5 unit.By following program with reactant incubation in the Ericomp thermal cycler: 94 ℃ of circulations in 5 minutes 1 time; 94 ℃ 1 minute, 50 ℃ of 1 minutes and 72 ℃ circulation in 1 minute 30 times; 74 ℃ 5 minutes the circulation 1 time.Utilization has MODN primer 95-1202 or 95-88 and embodiment 1 described any antisense primer 95-89 or 95-656, and the cDNA product is carried out the nested PCR amplification.PCR condition such as above-mentioned.Utilize TA clone test kit, the PCR product cloning is advanced the pCR II according to manufacturer's explanation.(Quiagen, Chatsworth CA) extract plasmid DNA according to manufacturer's explanation from transformant, and insert fragment screening transformant according to embodiment 2 described method order-checking plasmids by utilizing the QIAwell-8 plasmid kit then.

Embodiment 8: the evaluation of hidden intron

Order-checking described in the embodiment 7 subclone be divided into three groups, be listed in (Fig. 3, SEQ ID NO.20) in the table 1 as follows.First group of two disappearance that are called Segment A and fragment D that contain in the GFP encoding sequence.Segment A starts from Nucleotide 347 (ATG Nucleotide equals 1,2,3 in the GFP encoding sequence) with sequence GTG, and ends at Nucleotide 397 with sequence A AG; Fragment D starts from Nucleotide 448 with sequence GTA, and ends at Nucleotide 503 with sequence TAG.Second group contains the single disappearance that is called fragment B.Fragment B starts from Nucleotide 380 with sequence GTA, and ends at Nucleotide 463 with sequence C AG.The 3rd group contains the single disappearance that is called fragment C.Fragment C starts from Nucleotide 380 with sequence GTA, and ends at Nucleotide 503 with sequence TAG.These deletion fragment sequence both sides are top listed Nucleotide, meet the standard that is identified as filamentous fungus intron (it has desired 5 ' and the 3 ' splice site that has), and may be the hidden intron that gets off by the wrong montage of the GFP mRNA in the aspergillus oryzae.

Table 2: the distribution of hidden intron

Intron quantity

A and D 15

B 1

C 5

D 3

The structure of embodiment 9:pShTh49 expression vector

In order in the aspergillus host, to express the GFP gene, determined deduction cryptic splice site is modified.Make up pShTh49 (a kind of coli expression carrier) to comprise correct GFP gene.Specifically, utilize embodiment 4 identical condition of describing and embodiment 1 described Oligonucleolide primers 95-1422 and 95-1457, amplification is from 5 ' end of the GFP gene of pUC19-GFP.Utilize these primers that Xho I site 323bp is imported in ATG initiator codon downstream.Utilize the agarose electrophoresis standard method to isolate this fragment, (InvitrogenCorp., La Jolla CA) advance the pCR II to produce pShTh46 according to the explanation of manufacturer with its subclone to utilize TA clone test kit then.Utilize condition and embodiment 1 described Oligonucleolide primers 95-1464 and the 95-1458 identical with embodiment 4, amplification from 3 ' end of the GFP gene of pUC19-GFP with the upstream of Pvu I site 191bp importing in terminator codon.Utilize TA clone test kit the PCR product cloning to be advanced the pCR II to produce pShTh47 then according to the explanation of manufacturer.Utilize applying biological system 394 type DNA/RNA synthesizers, explanation (applying biological system according to manufacturer, Foster City, CA), and utilize aspergillar codon usage chart (referring to the table I, as preceding) to synthesize the in-line coding sequence (being used to make up the base 323 to 565 of needs) of GFP remainder.Synthesize the oligonucleotide fragment of three sections 84 bases and oligonucleotide fragment (95-1411,95-1412, the 95-1413 of one section 50 base, 95-1414), and make its common annealing, with T4 archaeal dna polymerase (Boehringer Mannheim, Indianapolis IN) forms two strands.Utilize and embodiment 4 described the same terms and embodiment 1 described Oligonucleolide primers 95-1414 and 95-1415, by the formed fragment of pcr amplification.Utilize the agarose electrophoresis standard method to isolate the fragment that is increased, utilize TA clone test kit then and it is cloned into the pCR II to produce pShTh45 according to the explanation of manufacturer.Assembling is from pShTh45, the GFP fragment of pShTh46 and pShTh47, and synthetic GFP allelotrope (gfp49) is imported the pUC19 derivative, and (it comprises the LacZShine-Delgarno sequence, then be the Hind III, the BamH I, EcoR I restriction enzyme site) to produce pShTh49 (Fig. 4).

Thereby, in determined hidden intron observed 5 ' and 3 ' splice site each variation has all taken place.In addition, in the segmental total length of design, being positioned at codon swing position G+C content as possible just increases.Generally speaking, the G+C content of gene increases to 44.5% (the fragment of synthetic property design, increasing to 51% by 33.3%) from 38.5%.

The conversion of embodiment 10:pShTh49

(Bethesda research laboratory, Gaithersburg MD), and observe transformant under fluorescent microscope as described in Example 3 according to the explanation of manufacturer pShTh49 to be transformed into bacillus coli DH 5 alpha.With transformant in 37 ℃ of wave and culture that in 5ml Luria-Bertani substratum, (replenished sec.-propyl-β-D-sulfydryl galactopyranoside (IPTG)).After 14 hours, induce gfp49 with IPTG, use the Zeiss fluorescence microscope to the fluorescence intestinal bacteria as described in embodiment 5, this shows that gfp49 is a kind of functional protein, and it can fluoresce under the condition identical with real GFP.

Embodiment 11: the structure of expression vector pShTh58.1

At first, thus by utilizing embodiment 4 identical condition of describing and embodiment 1 described Oligonucleolide primers 96-67 and 96-68 amplification to make up pShTh58.1 (a kind of filamentous fungus expression vector) from the fragment of pShTh49.This fragment is to utilize the agarose electrophoresis standard method and isolating.Formed GFP encode fragment contains single Swa I and Pac I restriction enzyme site at 5 ' and 3 ' end respectively.Digest this fragment with Swa I and Pac I then, separate, and be connected in the pBANe13 carrier DNA to produce pShTh58.1 (Fig. 5) with the agarose electrophoresis standard method.

The conversion of embodiment 12:pShTh58.1

Utilize the scheme identical, pShTh58.1 is transformed among the aspergillus oryzae HowB425 with embodiment 5.Formed transformant is named as the ShTh581 bacterial strain.

The expression of embodiment 13:gfp49

As described in embodiment 6, five ShTh581 transformant are cultivated in the microtiter plate that contains the MY51 substratum, be used for the TATA promotor that GFP produces to induce.When 3 days and 4 days, collect mycelium.Then as separation as described in the embodiment 4 from these mycelial intracellular protein, and as analyzing the situation that exists of GFP as described in the embodiment 3.Wherein 5 detect in the transformant 4 with the optical excitation of 395nm the time luminous value peak appears, it is corresponding to the luminescence peak (Fig. 6) of GFP when the 509nm.These results show that the correction of the mRNA of gfp49 causes the correct expression of GFP in aspergillus oryzae (it can produce fluorescigenic GFP).

Embodiment 14: the structure of expression vector pShTh58.2

By (5-primer 3-primer, Boulder make up expressed in fungi carrier pShTh58.2 thereby CO) handle pShTh58.1 with the Morph mutagenesis kit.According to the explanation of manufacturer, primer 96-83 and the pShTh58.1 of 14ng are mixed mutually to produce pShTh58.2 (it produces W57C sudden change (Fig. 7)).

The expression of embodiment 15:gfp58.2

As described in embodiment 4, a ShTh582 transformant is cultivated in the microtiter plate that contains the MY51 substratum.When 3 days and 4 days, collect mycelium.Then as separation as described in the embodiment 4 from these mycelial intracellular protein, and as analyzing the situation that exists of GFP as described in the embodiment 6.Find that this conversion physical efficiency produces a kind of material, this material sends peak fluorescence, its luminescence peak corresponding to GFP (Fig. 8) at the 509nm place with the optical excitation of 395nm the time.These results show that the correction of the mRNA of gfp49 causes the correct expression of GFP in aspergillus oryzae (it can produce fluorescigenic GFP).

The Southern of embodiment 16:GFP transformant analyzes

Spore (GFP has hidden intron and GC content) and ShTh581.1 (GFP has hidden intron and GC content and W57C sudden change) and in contrast ShTh590.1 (wild-type GFP) and BANe130.1 (pBANe13 does not have GFP) 37 ℃ of following incubated overnight in the YEG substratum with transformant ShTh582.1.Filter mycelium with MiFacloth, and with distilled water rinsing three times.The unnecessary water of draining.With the liquid nitrogen freezing mycelium and utilize mortar and the pestle grind into powder.With Purgene DNA separating kit (Gentra system house.Research TrianglePark, NC) isolation of genomic DNA.

Digest the genomic dna that two micrograms are taken from each sample with the Pme I, and on 1% agarose, carry out fractional separation by length.In each step, make the gel sex change, neutralization is immersed among the 20X SSC 10 minutes.Utilize Schleicher and Schuell TurboBlotter that the DNA of digestion is transferred to nitrocellulose filter last 3 hour, UV layer connection DNA.Utilize BoehringerMannheim tag system (Boehringer Mannheim, Indianapolis, IN) detection membrane.Under 42 ℃, (Boehringer Mannheim, Indianapolis IN) carried out prehybridization 1 hour with film with Easy Hyb.Utilize pShTh58.2DNA, oligonucleotide 96-67 and 96-68, (BoehringerMannheim, Indianapolis IN) make the GFP probe carry out the DIG mark to reach Boehringer Mannheim Dig dna marker mixture.After its sex change, quantitative probe also adds 1ng/ml.Detection membrane spends the night then.Outwell probe, use 2XSSC-0.1%SDS twice of film of wash-out (each 5 minutes) under the room temperature, and use 0.1XSSC-0.1%SDS twice of film of wash-out (each 15 minutes) down at 65 ℃.The scheme that provides by following Boehringer Mannheim, and (Boehringer Mannheim, Indianapolis IN) detect the Nucleotide of Dig-mark to utilize Lumi-Phos 530.These films were placed film following 20 minutes.

These results show at transformant ShTh582.1, have observed the GFP band among ShTh581.1 and the ShTh590.1, and do not observe the GFP band in the BANe130.1 transformant.

The preservation of microorganism

According to budapest treaty, following bacterial strain has been deposited in agricultural research institute patent culture collection center (NRRL), northern regional research laboratory, 1815 institute streets, Peoria, Illinois State 61604, the U.S..

Bacterial strain preserving number preservation date

Bacillus coli DH 5 alpha pShTh58.2 NRRL B-21584 on June 6th, 1996

This bacterial strain is preservation under following prerequisite, and promptly during present patent application unsettled, this culture is for being obtained according to the titular people that 37C.F.R § 1.14 and 35U.S.C. § 122 determine by the patent and trademark council.This preservation thing is represented the pure basically culture of each institute's preservation strain.Corresponding application or its subsequent application in subject application propose in foreign country, and when the foreign patent method required preservation, this preservation thing also was obtainable.Yet, should know that the availability of preservation thing does not constitute destroying the Patent right theme working of an invention permission that government authorizes.

Because these embodiments are intended to illustrate several aspect of the present invention, thereby its scope of the present invention described herein and that require is not limited by specific embodiments disclosed herein.Scope of the present invention comprises any equivalent embodiments.Really, by previous description, except those embodiment of described herein and demonstration, various modifications of the present invention it will be apparent to those skilled in the art that.Such modification is also included within the scope of accessory claim.

This paper has quoted various reference, and their disclosed content this paper is with its integral body reference in the lump.

Sequence table (1) general information:

(ⅰ) applicant:

(A) title: Novo Nordisk Biotech company

(B) street: 1445 Drew roads

(C) city: Davis

(D) state: California

(E) country: the U.S.

(F) zip code: 95616-4880

(G) phone: (916) 757-8100

(H) fax: (916) 758-0317

(ⅱ) denomination of invention: the modifying method of cryptic splice site in the heterologous gene of expressed in fungi

(ⅲ) sequence number: 20

(ⅳ) address:

(A) addressee: North America Novo Nordisk company

(B) street: 405 Lexington streets, the 64th layer

(C) city: New York

(E) country: the U.S.

(F) zip code: 10174-6401

(V) computer-reader form:

(A) media type: floppy disk

(B) computer: IBM PC compatible

(C) operating system: PC-DOS/MS-DOS

(D) software: PatentIn Release#1.0, version #1.30

The data of (VI) current application:

(A) application number: wait to specify

(B) applying date: on June 20th, 1997

(C) classification number:

(ⅷ) lawyer/proxy's data:

(A) name: Agris Dr., Cheryl H.

(B) registration number: 34,086

(C) reference/certificate number: 4855.204-WO

(ⅸ) telecommunication information:

(A) phone: 212-867-0123

(B) fax: the information of 212-878-9655 (2) SEQ ID NO.1:

(ⅰ) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO.1:TGTCACTACT TTCTCTTATG G 21 (2) SEQ ID NO.2 information:

(ⅰ) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO.2:GTAATGGTTG TCTGGTAAAA G 21 (2) SEQ ID NO.3 information:

(ⅰ) sequence signature:

(A) length: 41 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:3:TATCGGCCGC ACCGGCCAAG ATGAGTAAAG GAGAAGAACT T 41 (2) SEQ ID NO:4 information:

(ⅰ) sequence signature:

(A) length: 40 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:4:ATACATGCAT TTATTTGTAT AGTTCATCCA TGCCATGTGT 40 (2) SEQ ID NO:5 information:

(ⅰ) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:5:TGTTACAAAC TCAAGAAGGA T 21 (2) SEQ ID NO:6 information:

(ⅰ) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:6:ATGAGTAAAG GAGAAGAACT TTTC 24 (2) SEQ ID NO:7 information:

(ⅰ) sequence signature:

(A) length: 85 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:7:AAGACTCGAG CCGAGGTCAA GTTCGAGGGC GATACCCTTT GTTAACCGCA TCGAGCTCAA 60GGGCATTGAC TTCAAGGAGG ACGGC 85 (2) SEQ ID NO:8 information:

(ⅰ) sequence signature:

(A) length: 83 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:8:GCTTGTCGGC CATGATGTAG ACGTTATGTG AGTTATAGTT GTACTCCATC TGTGGCCAAG 60AATGTTGCCG TCCTCCTTGA AGT 83 (2) SEQ ID NO:9 information:

(ⅰ) sequence signature:

(A) length: 84 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:9:CATCATGGCC GACAAGCCAA AGAACGGCAT CAAGGTTAAC TTCAAGATCC GCCACAACAT 60TAAGGACGGC AGCGTTCAGC TCGC 84 (2) SEQ ID NO:10 information:

(ⅰ) sequence signature:

(4) length: 50 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅲ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:10:CGCCGATCGG AGTGTTCTGC TGATAATGGT CGGCGAGCTG AACGCTGCCG 50 (2) SEQ ID NO:11 information:

(ⅰ) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:11:AAGACTCGAG CCGAGGTCAA G 21 (2) SEQ ID NO:12 information:

(ⅰ) sequence signature:

(A) length: 45 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:12:TCAAGCTTTA TGTCCAAGGG CGAGGAGCTC TTCACTGGAG TTGTC 45 (2) SEQ ID NO:13 information:

(ⅰ) sequence signature:

(A) length: 38 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:13:GATGCTCGAG TCTTGTAGTT CCCGTCATCT TTGTAAAA 38 (2) SEQ ID NO:14 information:

(ⅰ) sequence signature:

(A) length: 38 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅲ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:14:GATGCGATCG GCGATGGCCC TGTCCTTTTA CCAGACAA 38 (2) SEQ ID NO:15 information:

(ⅰ) sequence signature:

(A) length: 39 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:15:TGAGAATTCG GATCCTTATT TGTATAGTTC ATCCATGCC 39 (2) SEQ ID NO:16 information:

(ⅰ) sequence signature:

(A) length: 47 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:16:TCCATTTAAA TATGAGCAAG GGCGAGGAGC TCTTCACTGG AGTTGTC 47AGTTGTC 47 (2) SEQ ID NO:17 information:

(ⅰ) sequence signature:

(A) length: 36 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:17:TTCCTTAATT AATTATTTGT ATAGTTCATC CATGCC 36 (2) SEQ ID NO:18 information:

(ⅰ) sequence signature:

(A) length: 36 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:18:TGGAATAAGC TTTATGAGTA AAGGAGAAGA ACTTTT 36 (2) SEQ ID NO:19 information:

(ⅰ) sequence signature:

(A) length: 36 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:19:AAGAATTCGG ATCCCTTTAG TGTCAATTGG AAGTCT 36 (2) SEQ ID NO:20 information:

(ⅰ) sequence signature:

(A) length: 751 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: line style

(ⅱ) molecule type: cDNA

( ⅹⅰ ) ：SEQ ID NO:20:ATGAGTAAAG GAGAAGAACT TTTCACTGGA GTTGTCCCAA TTCTTGTTGA ATTAGATGGC 60GATGTTAATG GGCAAAAATT CTCTGTTAGT GGAGAGGGTG AAGGTGATGC AACATACGGA 120AAACTTACCC TTAAATTTAT TTGCACTACT GGGAAGCTAC CTGTTCCATG GCCAACGCTT 180GTCACTACTT TCTCTTATGG TGTTCAATGC TTTTCAAGAT ACCCAGATCA TATGAAACAG 240CATGACTTTT TCAAGAGTGC CATGCCCGAA GGTTATGTAC AGGAAAGAAC TATATTTTAC 300AAAGATGACG GGAACTACAA GACACGTGCT GAAGTCAAGT TTGAAGGTGA TACCCTTGTT 360AATAGAATCG AGTTAAAAGG TATTGATTTT AAAGAAGATG GAAACATTCT TGGACACAAA 420ATGGAATACA ACTATAACTC ACATAATGTA TACATCATGG CAGACAAACC AAAGAATGGC 480ATCAAAGTTA ACTTCAAAAT TAGACACAAC ATTAAAGATG GAAGCGTTCA ATTAGCAGAC 540CATTATCAAC AAAATACTCC AATTGGCGAT GGCCCTGTCC TTTTACCAGA CAACCATTAC 600CTGTCCACGC AATCTGCCCT TTCCAAAGAT CCCAACGAAA AGAGAGATCA CATGATCCTT 660CTTGAGTTTG TAACAGCTGC TGGGATTACA CATGGCATGG ATGAACTATA CAAATAAATG 720TCCAGACTTC CAATTGACAC TAAAGGGATC C 751

Claims (61)

1. the method for the fungal host cells that is used to obtain to recombinate, said method comprises that the nucleotide sequence with the coding heterologous polypeptide imports in the fungal host cells, wherein has at least a cryptic splice site to be modified in nucleotide sequence.

2. according to the process of claim 1 wherein that at least one cryptic splice site replaces at least one hidden consensus sequence by non--consensus sequence and modifies.

3. according to the method for claim 2, wherein hidden consensus sequence is 5 ' hidden consensus sequence.

4. according to the method for claim 3, wherein 5 ' hidden consensus sequence is GT, GC, or CT.

5. according to the method for claim 4, wherein 5 ' hidden consensus sequence is GTANGT, GCANGT, or CTANGT, and wherein N is A, C, G, or T.

6. according to the method for claim 2, wherein hidden consensus sequence is 3 ' hidden consensus sequence.

7. according to the method for claim 6, wherein 3 ' hidden consensus sequence is AG.

8. according to the method for claim 6, wherein 3 ' hidden consensus sequence is CAG, TAG, or AAG.

9. according to the process of claim 1 wherein that the aminoacid sequence of the heterologous polypeptide that produced by fungal host cells is a wild type peptide.

10. according to the process of claim 1 wherein by modifying at least one cryptic splice site with first district that has in that about 40% second district replacement of G+C percentage composition in about 70% scope comprises at least one hidden intron or its part.

11. according to the method for claim 10, wherein the G+C percentage composition is between about 40% to about 60%.

12. according to the method for claim 11, wherein the G+C percentage composition is between about 40% to about 50%.

13. according to the method for claim 10, wherein at least two hidden introns or its part are substituted.

14. according to the process of claim 1 wherein by with at least one the hidden consensus sequence in non--consensus sequence substituted nucleic acids sequence with by modifying at least one cryptic splice site with first district that has in that about 40% second district replacement of G+C percentage composition in about 70% scope comprises at least one hidden intron or its part.

15. according to the process of claim 1 wherein that at least two cryptic splice sites are modified.

16. according to the amino-acid residue that the process of claim 1 wherein that the heterologous polypeptide that produced by fungal host cells and corresponding wild-type polypeptide contain equal amts.

17.-consensus sequence non-according to the process of claim 1 wherein and consensus sequence have the Nucleotide of equal amts.

18. according to the process of claim 1 wherein said nucleic acid sequence encoding hormone, enzyme, acceptor, or reporter molecule.

19. according to the process of claim 1 wherein said nucleic acid sequence encoding enzyme.

20. according to the method for claim 18, wherein said enzyme is an oxydo-reductase, transferring enzyme, lytic enzyme, lyase, isomerase, or ligase enzyme.

21. according to the method for claim 19, wherein enzyme is selected from: aminopeptidase, amylase, carbohydrase, carboxypeptidase; Catalase, cellulase, chitinase, at, DNA enzyme, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucoside, haloperoxidase, saccharase, laccase, lipase, mannosidase, halogen spot dextranase enzyme, oxydase, pectin decomposing enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic ferment, rnase, and zytase.

22. according to the method for claim 18, nucleic acid sequence encoding reporter molecule wherein.

23. according to the method for claim 22, wherein reporter molecule is an Aequorea victoria egfp.

24. according to the process of claim 1 wherein that the fungal cell is a filamentous fungal cells.

25. according to the method for claim 24, wherein filamentous fungal cells is the mould genus of top spore, Aspergillus, and fusarium, Humicola, myceliophthora, Neurospora, Penicillium, Thielavia, the curved strength of China is mould, or the cell of certain kind of Trichoderma.

26. according to the method for claim 24, wherein filamentous fungal cells is the Aspergillus cell.

27. according to the method for claim 26, wherein the Aspergillus cell is the aspergillus oryzae cell, aspergillus niger cell, smelly aspergillus cell, or aspergillus japonicus cell.

28. according to the method for claim 24, wherein filamentous fungal cells is the fusarium cell.

29. according to the method for claim 28, wherein the fusarium cell is sharp sickle spore cell or F.graminearum schw cell.

30. according to the method for claim 24, wherein filamentous fungal cells is the Humicola cell.

31. according to the method for claim 30, wherein the Humicola cell is Humicolainsolens cell or Humicola lanuginosus cell.

32. according to the method for claim 24, wherein filamentous fungal cells is the myceliophthora cell.

33. according to the method for claim 32, wherein the myceliophthora cell is the Myceliophthorathermophila cell.

34. according to the method for claim 24, wherein filamentous fungal cells is the Mucor cell.

35. according to the method for claim 34, wherein the Mucor cell is the mould cell of meter black wool.

36. according to the method for claim 24, wherein filamentous fungal cells is the neurospora cell.

37. according to the method for claim 36, wherein the neurospora cell is the Neuraspora crassa cell.

38. according to the method for claim 24, wherein filamentous fungal cells is the Penicillium cell.

39. according to the method for claim 38, wherein the Penicillium cell is the penicillium purpurogenum cell.

40. according to the method for claim 24, wherein filamentous fungal cells is the Thielavia cell.

41. according to the method for claim 40, wherein the Thielavia cell is the Thielaviaterrestris cell.

42. according to the method for claim 24, wherein filamentous fungal cells is the Trichoderma cell.

43. according to the method for claim 42, wherein the Trichoderma cell is a Trichoderma reesei cell, viride cell, Trichoderma longibrachiatum cell, Trichoderma harzianum cell, or the mould cell of healthy and free from worry wood.

44. according to the process of claim 1 wherein that the fungal cell is a yeast cell.

45. according to the method for claim 44, wherein yeast cell is a Candida, genus kluyveromyces, yeast belong, Schizosaccharomyces, Pichia, or the cell of certain kind among the Yarrowia.

46. according to the method for claim 45, wherein yeast cell is the yeast belong cell.

47. according to the method for claim 46, wherein the yeast belong cell is a brewing yeast cell, the saccharomyces carlsbergensis cell, the saccharomyces diastaticus cell, Saccharomyces douglasii cell, Crewe is yeast cell not, promise ground yeast cell, or Saccharomyces oviformis cell.

48. according to the method for claim 45, wherein yeast cell is the kluyveromyces cell.

49. according to the method for claim 48, wherein the kluyveromyces cell is the Kluyveromyces lactis cell.

50. according to the method for claim 45, wherein yeast cell is the Yarrowia cell.

51. according to the method for claim 50, wherein the Yarrowia cell is the Yarrowialipolytica cell.

52. one kind is used for modifying the method that derives from at least one cryptic splice site of the isolated nucleic acid sequences of fungal host cells heterogenous expression, said method comprises with the hidden consensus sequence in non--consensus sequence substituted nucleic acids sequence and/or by modifying at least one cryptic splice site with first district that has in that about 40% second district replacement of G+C percentage composition in about 70% scope comprises at least one hidden intron or its part.

53. isolated nucleic acid sequences that obtains according to the method for claim 53.

54. nucleic acid construct that comprises the nucleotide sequence of claim 53.

55. recombinant expression vector that comprises the nucleic acid construct of claim 54.

56. according to the carrier of claim 55, wherein nucleotide sequence is connected with promoter sequence effectively.

57. according to the carrier of claim 55, wherein nucleotide sequence is connected with transcription termination signal effectively.

58. according to the carrier of claim 55, it also comprises selected marker.

59. reorganization fungal host cells that comprises the nucleic acid construct of claim 54.

60. reorganization fungal host cells that obtains according to the method for claim 1.

61. a method that is used for allos generation polypeptide in fungal host cells, this method is included in the fungal cell who cultivates claim 59 in the nutritional medium, and reclaims polypeptide from substratum.

Images