CN1307642A - Method for producing polypeptide by modifying copy number of gene - Google Patents

Abstract

The present invention relates to methods for producing a polypeptide, comprising: (a) cultivating a mutant cell under conditions conducive for production of the polypeptide, wherein (i) the mutant cell is related to a parent cell, which parent cell comprises at least two tandem copies of a nucleic acid sequence encoding the polypeptide or a nucleic acid sequence encoding the polypeptide, which nucleic acid sequence comprises repeat sequences at the 5' and 3' ends of the nucleic acid sequence, by the introduction of a nucleic acid construct into the genome of the parent cell at a locus which is within or not within the nucleic acid sequence(s), wherein the introduction of the nucleic acid construct into the locus modifies the copy number of the nucleic acid sequence(s) and the modification of the copy number is not a result of selective pressure; and (ii) the mutant cell produces more or less of the polypeptide than the parent cell when both cells are cultivated under the same conditions; and (b) recovering the poylpeptide from the cultivation medium. The present invention also relates to methods for obtaining a mutant cell and mutant cells.

Description

By changing the method that gene copy number prepares polypeptide

Background of invention

Invention field

The present invention relates to prepare the method for polypeptide by the copy number that changes gene.The invention still further relates to the method for mutant cell and acquisition mutant cell.

Description of Related Art

The continuous development of new genetic engineering technique makes the operation of genetic expression of coded protein become possibility.Yet the operation in gene coding region or transcriptional regulatory district often relates to gene isolation, for increasing or reduce genetic expression to being contained in the operation of the nucleic acid in the gene, reaches to the gene of suitable expressive host importing through operation.

The method that is used for increasing the extensive employing that polypeptide produces is the bacterial strain of multiple copy that obtains to have the gene of coded polypeptide by the method that is called amplification.

United States Patent (USP) 5578461 disclose by with the introduction method of the homologous recombination of the placed in-line a kind of selectable marker gene that increases of gene, wherein, by adding culturing cell in the presence of a large amount of suitable selective agents, can screen the cell of selectable marker gene that contains with the placed in-line a kind of copy that increases of the gene of multiple copy.

The reduction of specific polypeptide production can force forfeiture to realize by the reorganization of destruction, inactivation or the gene by coded polypeptide.

An object of the present invention is to provide the novel method of preparation polypeptide.

Summary of the invention

The present invention relates to be used to prepare the method for polypeptide, comprising:

(a) under the condition that helps polypeptide production, cultivate mutant cell, wherein:

(i) by the locus place of a nucleic acid construct outside the nucleotide sequence copy being imported the genome of parental cell, produce mutant cell, mutant cell is associated with parental cell, this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein in locus, import the copy number that nucleic acid construct has changed nucleotide sequence, and the change of copy number not the result of selective pressure;

(ii) when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more or less polypeptide than parental cell;

(b) from nutrient solution, reclaim polypeptide.

The invention still further relates to the method that obtains mutant cell, comprising:

(a) under the condition that helps polypeptide production, cultivate mutant cell, wherein:

(i) by the locus place of a nucleic acid construct among a copy of nucleotide sequence being imported the genome of parental cell, produce mutant cell, mutant cell is associated with parental cell, this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein in locus, import the copy number that nucleic acid construct has changed nucleotide sequence, and the change of copy number not the result of selective pressure;

(ii) when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more or less polypeptide than parental cell;

(b) from nutrient solution, reclaim polypeptide.

The invention still further relates to the method that obtains mutant cell, comprising:

(a) under the condition that helps polypeptide production, cultivate mutant cell, wherein:

(i) by the locus place of a nucleic acid construct outside nucleotide sequence being imported the genome of parental cell, produce mutant cell, mutant cell is associated with parental cell, this parental cell contains the nucleic acid encoding sequence, described nucleotide sequence contains tumor-necrosis factor glycoproteins at 5 ' and the 3 ' end of this nucleotide sequence, wherein in locus, import the copy number that nucleic acid construct has increased nucleotide sequence, and the change of copy number not the result of selective pressure;

(ii) when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more polypeptide than parental cell;

(b) from nutrient solution, reclaim polypeptide.

The invention still further relates to mutant cell and the method that is used to obtain mutant cell.

The accompanying drawing summary

Fig. 1 is the restriction map of pJaL292.

Fig. 2 is the restriction map of pKS6.

Fig. 3 is the restriction map of pBANe13.

Fig. 4 is the restriction map of pBANe6.

Fig. 5 is the restriction map of pMHan37.

Fig. 6 is the restriction map of pBANe8.

Fig. 7 is the restriction map of pSO2.

Fig. 8 is that the restriction map of pSO122 reaches the structure from pDSY81 and the pDSY82 of pSO 122.

Fig. 9 is the restriction map of pJaI400.

Figure 10 is the structure of pMT1935.

Figure 11 is the restriction map of pJaL394.

Figure 12 is the restriction map of pMT1931.

Figure 13 is the restriction map of pMT1936.

Figure 14 is the restriction map of pGAG3.

Figure 15 is the restriction map of pJaL389.

Figure 16 is the restriction map of pJaL335.

Figure 17 is the restriction map of pJaL399.

Figure 18 is the restriction map of pDM176.

Figure 19 is the restriction map of pHB218.

Figure 20 is the restriction map of pSE39.

Figure 21 is the restriction map of pDSY153.

Detailed Description Of The Invention

In first embodiment, the present invention relates to the method for the preparation of polypeptide, comprise

(a) under the condition that helps polypeptide production, cultivate mutant cell, wherein:

(i) pass through the locus place of a nucleic acid construct outside the copy of nucleotide sequence Import the genome of parental cell, produce mutant cell, mutant cell is associated with parental cell, This parental cell contains the copy of at least two series connection of the nucleotide sequence of coded polypeptide, wherein in base Because importing nucleic acid construct in the seat has increased the copy number of nucleotide sequence, and the increase of copy number is not The result of selection pressure;

(ii) when under the same condition that helps polypeptide to produce, cultivating parental cell and sudden change During cell, mutant cell produces more polypeptide than parental cell;

(b) from nutrient solution, reclaim polypeptide.

Term " genome " is defined herein as the complete cell DNA of a cover, comprises chromosome, people Worker's chromosomal DNA and exchromosomal DNA, i.e. self-replacation sex-controlled inheritance element.

Term " copy number " is defined herein as the gene molecule in each genome that is contained in cell Number.

Term " selection pressure " is defined herein as in the presence of the suitable selective agent that has increased amount and cultivates Cell, described cell contains a kind of expression cassette, this expression cassette with the coding target polypeptides nucleic acid A kind of selectable marker gene that increases that sequence is connected in series makes selectable marker gene and series connection thus The copy number amplification of nucleotide sequence.

The mutant cell of a kind of " producing more polypeptide " is defined herein as that compare with parental cell can From wherein reclaiming the cell of more polypeptide.

In second embodiment, the present invention relates to prepare the method for polypeptide, comprising:

(a) under the condition that helps polypeptide production, cultivate mutant cell, wherein:

(i) pass through the locus place of a nucleic acid construct outside the copy of nucleotide sequence The genome that imports parental cell produces mutant cell, and mutant cell is associated with parental cell, This parental cell contains the copy of at least two series connection of the nucleotide sequence of coded polypeptide, wherein in base Because importing nucleic acid construct in the seat has reduced the copy number of nucleotide sequence, and the reduction of copy number is not The result of selection pressure;

(ii) when under the same condition that helps polypeptide to produce, cultivating parental cell and sudden change During cell, mutant cell is than parental cell generation polypeptide still less;

(b) from nutrient solution, reclaim polypeptide.

The mutant cell of a kind of " produce still less polypeptide " is defined herein as that compare with parental cell can From wherein reclaiming the cell of polypeptide still less.

In the 3rd embodiment, the present invention relates to prepare the method for polypeptide, comprising:

(a) under the condition that helps polypeptide production, cultivate mutant cell, wherein:

(i) produce mutant cell by the genome that the locus place of a nucleic acid construct within a copy of nucleotide sequence is imported parental cell, mutant cell is associated with parental cell, this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein in locus, import the copy number that nucleic acid construct has increased nucleotide sequence, and the increase of copy number not the result of selective pressure;

(ii) when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more polypeptide than parental cell;

(b) from nutrient solution, reclaim polypeptide.

In the 4th embodiment, the present invention relates to prepare the method for polypeptide, comprising:

(a) under the condition that helps polypeptide production, cultivate mutant cell, wherein:

(i) produce mutant cell by the genome that the locus place of a nucleic acid construct within a copy of nucleotide sequence is imported parental cell, mutant cell is associated with parental cell, this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein in locus, import the copy number that nucleic acid construct has reduced nucleotide sequence, and the reduction of copy number not the result of selective pressure;

(ii) when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell is than parental cell generation polypeptide still less;

(b) from nutrient solution, reclaim polypeptide.

In the 5th embodiment, the present invention relates to prepare the method for polypeptide, comprising:

(a) under the condition that helps polypeptide production, cultivate mutant cell, wherein:

(i) by the locus place of a nucleic acid construct outside nucleotide sequence being imported the genome of parental cell, mutant cell is associated with parental cell, this parental cell contains the nucleic acid encoding sequence, this nucleotide sequence in 5 of described nucleotide sequence ' and 3 ' end contains tumor-necrosis factor glycoproteins, wherein in locus, import the copy number that nucleic acid construct has increased nucleotide sequence, and the change of copy number not the result of selective pressure;

(ii) when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more polypeptide than parental cell;

(b) from nutrient solution, reclaim polypeptide.

Term " at least two tandem copies of nucleotide sequence " is defined herein as two or more copies of the nucleotide sequence of coding desired polypeptides, and wherein the copy of nucleotide sequence is arranged in mode one by one in the genome of cell, is with or without intervening sequence.When intervening sequence, the length of intervening sequence should be less than 10,000bp, and preferably less than 5,000bp is more preferably less than 2,000bp, even be more preferably less than 10,00bp is most preferably less than 100bp.Yet intervening sequence can be arbitrary length, as long as this length does not stop the increase or the reduction of copy number.In a preferred embodiment, exist every sequence continuously between the tandem copy of nucleotide sequence.

Term " at 5 ' and the 3 ' tumor-necrosis factor glycoproteins of holding of nucleotide sequence " is defined herein as at 5 ' end of the nucleotide sequence of coding target polypeptides and the nucleotide sequence that 3 ' end all exists.Tumor-necrosis factor glycoproteins can be same direction (forward repetition) each other or is relative direction (oppositely repeating).Tumor-necrosis factor glycoproteins can be arbitrary suitable length, but the about 1000bp of preferably about 100-, the more preferably from about about 500bp of 100-, the most preferably from about about 300bp of 100-.Polypeptide

It comprises peptide, oligopeptides and protein term " polypeptide ", so, be not limited to the coded product of length-specific at this paper.Polypeptide can be the natural or heterology polypeptide of pair cell.Heterologous polypeptide preferably.It is not natural polypeptide that term " heterologous polypeptide " is defined as concerning described cell.But polypeptide wild type peptide or its variant.The recombinant polypeptide that polypeptide is also such, it is the natural polypeptides of cell, and it is one or more coded for the nucleotide sequence of allogenic control sequence for nucleotide sequence by containing, and it participates in the production of polypeptide.The nucleic acid encoding sequence can be passed through operation as described below.Within the scope of term " heterologous polypeptide ", the present invention also comprise such for filamentous fungal cells the recombinant production of endogenous polypeptide, make such expression comprise use non-natural genetic elements for cell, or used through operating the natural element of the mode functionating that exists with non-natural in host cell.Also a kind of hybrid polypeptide of polypeptide, it contains the combination of the partial or complete peptide sequence that obtains from least two kinds of different polypeptide, and one or more polypeptide pair cells wherein can be allogenic.Polypeptide also comprises the naturally occurring allelotrope and the genetically engineered variant of aforementioned polypeptides.

In a preferred embodiment, described polypeptide is antibody or its part, antigen, thrombin, enzyme, hormone or its variant, acceptor or its part, adjusting albumen, structural protein, reporter molecule or translocator matter.

In a preferred embodiment, enzyme is oxydo-reductase, transferring enzyme, lytic enzyme, lyase, isomerase or ligase enzyme.

At one further in the embodiment preferred, enzyme is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, at (cutinase), deoxyribonuclease, dextranase, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase enzyme, haloperoxidase (haloperoxidase), saccharase, laccase, lipase, mannosidase, MUTANASE (mutanase), oxydase, pectin lyase, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, rnase, trans-glutaminases or zytase.

Further in the embodiment preferred, polypeptide is insulin human or its analogue, human growth hormone, people's the 7th factor, erythropoietin or pancreotropic hormone (insulinotropin) at another.The nucleotide sequence of coding allos and recombinant polypeptide

The nucleotide sequence of coding heterologous polypeptide can be available from any protokaryon, eucaryon or other source, as archeobacteria.Be purpose of the present invention, term " available from " as used with given source herein, be meant that polypeptide is produced by this source, or produce by the cell of the gene that has wherein inserted this source.

In the method for the invention, cell can be used for for cell the recombinant production for natural polypeptide.Natural polypeptides can be recombinantly produced, express to increase as placing by gene under the different promotor control coded polypeptide, by using signal sequence to promote the target natural polypeptides to extracellular transportation, and the copy number of the gene of the polypeptide by increasing the natural generation of this cell of coding.The present invention also comprises the recombinant production of this natural polypeptides.

Be used to separate or the technology of the nucleotide sequence of clones coding polypeptide is known in the art, they comprise: separate from genomic dna, and from the cDNA preparation, or its combination.Can carry out like this from such genomic dna cloning nucleotide sequence of the present invention: for example, the polymerase chain reaction of knowing by application (PCR) or the antibody screening of expression library detect the cloning dna fragmentation with shared structure feature.Referring to for example, Innis etc., 1990, " PCR: methods and applications guide " (PCR:A Guideto Methods and Application), Academic Press, New York.Can use other nucleic acid amplification method, for example, ligase chain reaction (LCR) connects that activatory is transcribed (LAT) and based on the amplification (NASBA) of nucleotide sequence.Cloning process can comprise the segmental cutting of the target nucleic acid of the nucleotide sequence that contains coded polypeptide and separate, and fragment is inserted carrier molecule, and recombinant vectors is mixed cell.Nucleotide sequence can be genomic, cDNA, RNA, semisynthetic, synthetic source or arbitrary combination.

Term " isolated nucleic acid sequences " is meant a kind of nucleotide sequence that is substantially free of other nucleotide sequence as used herein, for example measure as agarose gel electrophoresis, pure at least about 20%, preferably pure at least about 40%, more preferably pure at least about 60%, even it is more preferably pure, most preferably pure at least about 90% at least about 80%.

Can be with the isolated nucleic acid sequences of several different methods operation coding heterologous polypeptide, with express polypeptide.Operation to nucleotide sequence before nucleotide sequence inserts carrier is expectation or essential, and this depends on expression vector.It is known for this area to utilize cloning process to carry out the technology that nucleotide sequence modifies.

The modification of nucleic acid encoding sequence may be essential for synthetic similar to this polypeptide basically polypeptide.Term and polypeptide " similar basically " are meant the non-natural existence form of this polypeptide.These polypeptide can be with different from its natural origin isolated polypeptide from the genetically engineered angle.For example, may wish to utilize such as the synthetic a kind of variant polypeptides of rite-directed mutagenesis method, wherein variant is in aspect differences such as specific activity, thermostability, optimal pHs.Similar sequence can make up on the nucleotide sequence basis of this polypeptide of coding, and/or by such nucleotide subsitution is imported, described displacement can not produce the another kind of aminoacid sequence by the polypeptide of nucleic acid sequence encoding, but it is corresponding to the codon preference that is intended to be used to produce the host living beings of enzyme; Perhaps by importing the nucleotide subsitution that can produce the different aminoacids sequence.Generality for nucleotide subsitution is described, as sees Ford etc., and 1991, protein expression and purifying (Protein Expression and Purification) 2:95-107.

But the modification of nucleic acids sequence is with the preparation expression cassette, and wherein nucleotide sequence operationally is connected with one or more control sequences, and this control sequence is in the expression that is suitable for instructing under the condition of control sequence encoding sequence in appropriate host cell.Should understand and express the arbitrary step that comprises that the participation polypeptide produces, include but not limited to transcribe, transcribe post-treatment, translation, translation post-treatment and secretion.

" expression cassette " is defined as a kind of nucleic acid molecule (strand or two strands) at this paper, it is from naturally occurring gene isolation, perhaps modified section (this section is combined in the non-existent mode of nature and arranges, and comprises the required whole control sequences of expression encoding sequence) to comprise nucleic acid.The sequence that term " encoding sequence " is defined as being transcribed into mRNA and is translated into polypeptide at this paper.The border of genome encoding sequence generally is to determine by ribosome bind site (protokaryon) or by ATG initiator codon (eucaryon) (being positioned at the upstream of 5 ' end place open reading frame of mRNA just) and Transcription Termination subsequence (being positioned at the downstream of the open about frame in 3 ' end place of mRNA just).Encoding sequence can include but not limited to DNA, cDNA, RNA and recombinant nucleic acid sequence.

Term " control sequence " is defined as comprising necessary or useful all components for expression of polypeptides at this paper.Every kind of control sequence can be a natural or allogenic sequence for the nucleic acid encoding sequence.Such control sequence includes but not limited to: leader sequence, polyadenylation sequence, propeptide sequence, promotor, signal sequence and transcription terminator.Control sequence comprises promotor, transcription termination signal and translation termination signal at least.Control sequence can provide with joint, in order to introducing specificity restriction site, thereby promotes this control sequence to be connected with nucleic acid encoding sequence encoding district.Term " is operably connected " and is defined as a kind of configuration at this paper, and wherein, control sequence is suitably placed the position with respect to the encoding sequence of dna sequence dna, so that this control sequence instructs the production of polypeptide.

Control sequence can be suitable promoter sequence, the nucleotide sequence that can be expressed the filamentous fungal cells identification of this nucleotide sequence.Promoter sequence comprises the transcriptional control sequence that mediates expression of polypeptides.Described promotor can be any nucleotide sequence that shows transcriptional activity in selected host cell, comprises sudden change, brachymemma and hybrid promoter, and can get own coding and host cell homologous or allogenic, born of the same parents outer or the gene of the interior polypeptide of born of the same parents.

The suitable promotor example that instructs expression cassette to transcribe in bacterial host cell has following promotor: intestinal bacteria lac operon, streptomyces coelicolor gelase gene (dagA), subtilis left side ficoll enzyme (levansucrase) gene (sacB), bacillus licheniformis alpha-amylase gene (amyL), bacstearothermophilus maltose source amylase gene (amyM), bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), subtilis xylA and xylB gene, with protokaryon β-Nei Xiananmei gene (Villa-Kamaroff etc., 1978, the journal 75:3727-3731 of NAS), and tac promotor (DeBoer etc., 1983, the journal 80:21-25 of NAS).More promoter region has description below in the article: " deriving from the useful proteins matter of recombinant bacteria ", Scientific Beauty compatriots, 1980,242:74-94; With Sambrook etc., 1989, the source is the same.

Be used for instructing the suitable promotor example of transcribing at the filamentous fungal host cell expression cassette have the promotor of gene of the following enzyme of own coding: aspergillus oryzae TAKA amylase, rice black root Acarasiales (Rhizomucor miehei) aspartate protease, the neutral αDian Fenmei of aspergillus niger, aspergillus niger acid acceptance αDian Fenmei, aspergillus niger or Aspergillus awamori glucoamylase (glaA), rice black root Acarasiales lipase, the aspergillus oryzae Sumizyme MP, the aspergillus oryzae triose-phosphate isomerase, the Aspergillus nidulans acetamidase, Fusariumoxysporum trypsin-like proteolytic enzyme (United States Patent (USP) 4,288,627), and the sudden change, brachymemma and hybrid promoter.Particularly preferred promotor is NA2-tpi promotor (a kind of promotor heterozygote that gets neutral αDian Fenmei of own coding aspergillus niger and aspergillus oryzae triose-phosphate isomerase gene).

In yeast host, useful promotor is available from yeast saccharomyces cerevisiae (Saccharomycescerevisiae) enolase gene (ENO-I), yeast saccharomyces cerevisiae galactokinase gene (GAL1), yeast saccharomyces cerevisiae alcoholdehydrogenase/Glycerose 3-phosphate dehydrogenase gene (ADH2/GAP) and yeast saccharomyces cerevisiae 3-phoshoglyceric acid kinase gene.Other promotor that can be used for yeast host cell is seen people such as Romanos, 1992, and described in the yeast 8:423-488.In mammalian host cell, useful promotor comprises viral promotors, as from simian virus 40 (SV40), and Rous sarcoma virus (RSV), adenovirus, bovine papilloma virus (BPV), and human cytomegalic inclusion disease virus (CMV).

Described control sequence can also be suitable Transcription Termination subsequence, that is, and and a kind of identification and the sequence that stops transcribing by host cell.This Transcription Termination subsequence is operably connected to 3 of nucleic acid encoding sequence ' end.The arbitrary terminator that works in selected host cell all can be applied to the present invention.

The terminator that preferably is used for filamentous fungal host cell gets the gene of the following enzyme of own coding: aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans o-amino benzoyl acid synthase, aspergillus niger α Polyglucosidase and sharp sickle spore trypsin-like proteolytic enzyme.

In yeast host, preferred terminator is available from the gene of the following enzyme of coding: yeast saccharomyces cerevisiae enolase gene, brewing yeast cell pigment C (CYC1), or yeast saccharomyces cerevisiae Glycerose 3-phosphate dehydrogenase gene.Other promotor that can be used for yeast host cell is seen people such as Romanos, 1992, and described in the yeast 8:423-488, the source is the same.The terminator sequence of mammalian host cell is that this area is known.

Described control sequence can also be suitable leader sequence, i.e. the non-translational region of mRNA, and it is important for the translation of host cell.This leader sequence is operably connected to 5 of nucleic acid encoding sequence ' end.Any leader sequence that works in selected host cell all can be used for the present invention.

The leader sequence that preferably is used for filamentous fungal host cell gets the gene of own coding aspergillus oryzae TAKA amylase and Aspergillus nidulans triose-phosphate isomerase.

The suitable leader sequence that is used for yeast host cell is available from yeast saccharomyces cerevisiae enolase gene (ENO-I), yeast saccharomyces cerevisiae 3-phoshoglyceric acid kinase gene, yeast saccharomyces cerevisiae α-factor and yeast saccharomyces cerevisiae alcoholdehydrogenase/Glycerose 3-phosphate dehydrogenase gene (ADH2/GAP).

Described control sequence can also be the polyadenylation sequence, be a kind of such sequence: it is operably connected to 3 of described nucleotide sequence ' end, and when transcribing, it is added poly-adenosine residue to the mRNA that transcribes by host cell as a signal identification.Any polyadenylation sequence that works in selected host cell all can be used for the present invention.

Preferred polyadenylation sequence gets the gene of the following enzyme of own coding: aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans o-amino benzoyl acid synthase and aspergillus niger α Polyglucosidase.

For yeast host cell useful polyadenylation sequence such as Guo and Sherman 1995, molecular cytobiology 15:5983-5990 is described.Polyadenylation sequence for mammalian host cell is that those skilled in the art are known.

Described control sequence can also be a signal peptide coding region, the aminoacid sequence that its coding is connected with the aminoterminal of described polypeptide, and described polypeptide instructs coded polypeptide to enter the Secretory Pathway of cell.5 of the encoding sequence of described nucleotide sequence ' end can naturally comprise a signal peptide coding region, and described coding region meets natural connection of coding section of translation frame ground and the secreted polypeptides of encoding.5 of described encoding sequence ' end also may comprise the signal peptide coding region of external source for this encoding sequence.If described encoding sequence does not contain signal peptide coding region usually, described external source signal peptide coding region may need.Perhaps, this external source signal peptide coding region also may only substitute the natural signals peptide-coding region, so that the secretion of polypeptide increases.Signal peptide coding region can derive from: amylase of the lipase of the glucoamylase of Aspergillus or amylase gene, Rhizomucor (Rhizomucor) or proteinase gene, yeast saccharomyces cerevisiae α-factor gene, bacillus or proteinase gene or Niu Qianyuan rennet-based because of.Yet any signal peptide coding region that instructs polypeptide expressed to enter selected secretory host cell approach all can be used for the present invention.

Effectively signal peptide coding region is the signal peptide coding region that derives from following gene in host bacterium: the product maltogenic amylase gene of genus bacillus NCIB 11837, the bacstearothermophilus alpha-amylase gene, Bacillus licheniformis subtilisin gene, Bacillus licheniformis β-Nei Xiananmei gene, bacstearothermophilus neutral protease gene (nprT, nprS, nprM), or subtilis prsA gene.More signal peptide is described visible Simonen and Palva, and 1993, microbiology comment 57:109-137.

The effective signal peptide coding region that is used for filamentous fungal host cell is the signal peptide coding region available from following gene: aspergillus oryzae TAKA amylase, aspergillus niger neutral starch enzyme, Rhizomucormiehei aspartate protease gene, pubescence humicola lanuginosa (Humicola lanuginosa) cellulose enzyme gene or pubescence humicola lanuginosa lipase gene.

The useful signal peptide of yeast host cell also can be available from yeast saccharomyces cerevisiae α-factor and yeast saccharomyces cerevisiae saccharase.Other signal peptide that can be used for yeast host cell sees that people such as Romanos are described, 1992, and the source is the same.

Described control sequence also may be a preceding peptide-coding region, and its coding is positioned at the N-terminal aminoacid sequence of polypeptide.The polypeptide that generates is called as " proenzyme " (proenzyme) or " propolypeptide " [or being called as " proenzyme " in some cases (zymogen)].Propolypeptide generally is a non-activity, can divide by the catalysis division or the autocatalysis of peptide before the propolypeptide, and be converted into sophisticated active polypeptide from this propolypeptide.Preceding peptide-coding region can derive from bacillus subtilis alkali proteinase gene (aprE), subtilis neutral protease gene (nprT), yeast saccharomyces cerevisiae α-factor, rice black root Acarasiales aspartate protease gene or Myceliophthora thermophila laccase gene (WO95/33836).

If the two all is present in the aminoterminal of polypeptide signal peptide district and propetide district, so, the propetide district is positioned at the aminoterminal of contiguous polypeptide, and the signal peptide district then is positioned at the aminoterminal in contiguous propetide district.

The expression cassette of described coded polypeptide also may comprise one or more other nucleotide sequences, these nucleic acid sequence encodings are one or more for instructing the useful factor of polypeptide expression, for example, activating transcription factor (such as trans-acting factor), mate molecule and processing protease.The arbitrary factor that works in selected host cell all can be applicable to the present invention.The nucleic acid of one or more these factors of coding needn't be connected with the nucleotide sequence of coding heterologous polypeptide.

Transcriptional activator is protein (Kudla etc., 1990, the EMBO Journal 9:1355-1364 that a kind of nucleotide sequence of activated code polypeptide is transcribed; Jarai and Buxton, 1994, current genetics (Current Genetics) 26:2238-244; Verdier.1990, yeast 6:271-297).The nucleotide sequence of coding activator can obtain from the following gene of encoding: bacstearothermophilus NprA (nprA), yeast saccharomyces cerevisiae protoheme activator protein 1 (hap1), yeast saccharomyces cerevisiae semi-lactosi metabolizable protein 4 (gal4), Aspergillus nidulans ammonia is regulated protein (areA), aspergillus oryzae α-Dian Fenmei activator (amyR).Further example is seen Verdier.1990, the same and MacKenzie in source etc., 1993, general microbiology magazine (Journal of GeneralMicrobiology) 139:2295-2307.

Chaperone is protein (Hard etc., 1994, the TIBS19:20-25:Bergeron etc. that help another polypeptide correctly folding, 1994, TIBS 19:124-128:Demolder etc., 1994, biotechnology magazine (Journal of Biotechnology) 32:179-189; Craig, 1993, science, 260:1902-1903; Gething and Sambrook, 1992, nature, 355:33-45; Puig and Gilbert.1994, journal of biological chemistry (Journal of Biological Chemistry) 269:7764-7771; Wang and Tsou, 1993, The FASEB Journal 7:1515-11157; Robinson etc., 1994.Bio/Technology 1:381-384; Jacobs etc., 1993, molecular microbiology (Molecular Microbiology) 8:957-966).The nucleotide sequence of coding chaperone can be available from the following gene of coding: subtilis GroE protein, subtilis PrsA, aspergillus oryzae protein disulfide-isomerase, yeast saccharomyces cerevisiae calnexin, yeast saccharomyces cerevisiae BiP/GRP78 and yeast saccharomyces cerevisiae Hsp70.Further example is referring to Gething and Sambrook, people such as the same and Hard in 1992 sources, and 1994 sources are the same.

Processing protease is former proteolytic enzyme (Enderlin and Ogrydziak, 1994, the yeast 10:67-79 to produce sophisticated chemical-biological activities polypeptide of cutting peptide; Fuller etc., 1989, institute of NAS newspaper, 86:1434-1438; Julius etc., 1984, cell, 37:1075-1089; Julius etc., 1983, cell, 32:839-852; U.S. Patent No. 5,702,934).The nucleotide sequence of coding processing protease can be available from the following gene of coding: yeast saccharomyces cerevisiae dipeptides acyl aminopeptidase, yeast saccharomyces cerevisiae Kex2, Yarrowia lipolytica two bases (dibasic) processing endo-protease (xpr6) and Fusarium oxysporum (Fusarium oxysporum) metalloprotease (p45 gene).

Also may wish to add and regulate sequence, this regulates sequence can regulate the polypeptide expression relevant with the growth of host cell.The example of regulation system response chemical irritant or physical stimulation thing (comprising the existence of regulating compound) arranged and cause the unlatching of genetic expression or close those.Regulation system in the prokaryotic system comprises lac, tac, trp operon system.In the yeast, can use GAL1 alive system of ADH2 system.In filamentous fungus, can use TAKA αDian Fenmei promotor, aspergillus niger glucoamylase promotor and aspergillus oryzae glucoamylase promotor as regulating sequence.Other example of regulating sequence has those that can make gene amplification.In eukaryotic system, be included in the presence of the methotrexate Tetrahydrofolate dehydrogenase of amplification, and with the metallothionein gene of heavy metal amplification.In these cases, the nucleotide sequence of coding heterologous polypeptide will operationally be connected with this adjusting sequence.

Above-mentioned various nucleotide sequence and control sequence can be joined together and produce the recombinant expression vector that may comprise one or more suitable restriction sites, and described restriction site can be for inserting or substitute the nucleic acid encoding sequence in such site.Described nucleotide sequence also can be expressed by this sequence or the above-mentioned expression cassette that comprises this sequence are inserted the suitable carrier that is used for expressing.When producing recombinant expression vector, encoding sequence is in this carrier, makes this encoding sequence be operably connected with being used to express with suitable control sequence.

Described recombinant expression vector can be any carrier (for example plasmid or a virus), and this carrier can experience DNA reorganization operation easily and can cause the expression of nucleic acid encoding sequence.The selection of this carrier generally will be depended on the consistency of the host cell that this carrier and this carrier are introduced into.This carrier can be shape material grain or closed hoop plasmid.This carrier can be a self-replicating type carrier, that is, a kind of carrier that exists as extrachromosomal entity, duplicating of it is independent of chromosome duplication, for example plasmid, extra-chromosomal element, minichromosome or artificial chromosome.Described carrier can comprise any method that ensures self-replicating.Perhaps, this carrier also can be such carrier: when introducing host cell, it is integrated into genome and duplicates with the karyomit(e) that it was integrated into.Described carrier system can be single carrier or plasmid, or two or more carriers or plasmid, and they comprise all DNA with host cell gene group to be imported jointly, or a kind of transposon.

Described carrier preferably comprises one or more selected markers that allows easily to select cell transformed.A kind of selected marker is a kind of gene, and its product can provide biocide resistance or virus resistance, to the resistance of heavy metal, the prototroph of auxotroph etc.The example of the alternative mark of bacterium is the dal gene of subtilis or Bacillus licheniformis, or give antibiotics resistance, as the mark of amicillin resistance (amp), kalamycin resistance (kan), chlorampenicol resistant (cam) or tetracyclin resistance (tet).The suitable mark that is used for mammalian cell is Tetrahydrofolate dehydrogenase (dfhr), hygromix phosphotransferase (hygB), aminoglycoside phosphotransferase II and phleomycin resistant gene.The mark that is suitable in the yeast host cell is ADE2, HIS3, LEU2, LYS2, MET3, TRP1 and URA3.The selected marker that is used for filamentous fungal host cell can be selected from the material that includes but not limited to down group: amdS (acetamidase), argB (ornithine carbamyl transferase), bar (phosphinothricin Transacetylase), hygB (hygromix phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5), sC (sulfuric acid adenylic acid (AMP) transferring enzyme) and trpC (o-amino benzoyl acid synthase), and the equivalent that derives from other kind.

Described carrier preferably comprises such element, that is, this element allows described vector integration to go into host cell gene group or described carrier to be independent of the genome of this cell and self-replicating in this cell.

Just be integrated into the genome of host cell, described carrier may rely on any other (going into this carrier stable integration genomic by homologous recombination or non-homogeneous reorganization) element of nucleic acid encoding sequence or this carrier.Perhaps, this carrier also may comprise and is used in reference to conducting and crosses the other nucleotide sequence that homologous recombination is integrated into the host cell gene group.This other nucleotide sequence can make vector integration go into chromosomal accurate locational genome.In order to increase the possibility of integrating on the accurate position, the conformability element should preferably comprise the nucleic acid of q.s, for example at least 100～10,000 base pair, preferably at least 400～10,000 base pair, most preferably at least 800～10,000 base pair, they are the height homologous with corresponding target sequence, thereby improve the possibility of homologous recombination.Integrated element can be with the host cell gene group in any sequence of target sequence homologous.In addition, integrated element can also be a nucleotide sequence non-coding or coding.On the other hand, described carrier can be integrated into the genome of host cell by non-homogeneous reorganization.

With regard to self-replicating, described carrier can further comprise a kind of replication orgin, and it can make this carrier self-replicating in described filamentous fungal cells.The replication orgin example of bacterial origin is: the replication orgin of pUB110, pE194, pTA1060 and pAM β 1 that plasmid pBR322, pUC19, pACYCl77 and pACYC 184 that permission is duplicated in intestinal bacteria and permission are duplicated in bacillus.Used replication orgin is replication orgin combination, and the combination of ARS4 and CEN6 of 2 μ replication orgin, ARS1, ARS4, ARS1 and CEN3 in yeast host.Replication orgin one have the replication orgin that to make its function in host cell be the sudden change of responsive to temperature type (see, 1978, institute of NAS reports 75:1433) as, Ehrlich.

The method that is used to connect the factor described herein and makes up recombinant expression vector be well known to those skilled in the art (referring to for example, J.Sambrook, E.F.Fritsch and T.Maniatus, 1989, " molecular cloning, laboratory manual ", the 2nd edition, Cold Spring Harbor, New York).Cell

The inventive method can comprise prokaryotic cell prokaryocyte such as bacterium with any cell that contains the nucleotide sequence of the target polypeptides of encoding, or eukaryotic cell such as Mammals, insect, plant and fungal cell.Cell can be wild-type or mutant cell.For example, mutant cell experiences the cell of traditional mutagenesis or genetic manipulation.In addition, cell can be reconstitution cell, comprises the nucleotide sequence of the heterologous polypeptide of encoding as defining herein, and it is used for the recombinant production of heterologous polypeptide valuably.

Useful prokaryotic cell prokaryocyte be bacterial cell as, gram positive bacterium includes but not limited to the cell of bacillus, as Alkaliphilic bacillus (Bacillus alkalophilus), bacillus amyloliquefaciens (Bacillus amyloliquefaciens), bacillus brevis (Bacillus brevis), Bacillus circulans (Bacillus circulans), Bacillus coagulans (Bacillus coagulans), Bacillus lautus, bacillus lentus (Bacillus lentus), Bacillus licheniformis (Bacilluslicheniformis), bacillus megaterium (Bacillus megaterium), bacstearothermophilus (Bacillus stearothermophilus), subtilis and bacillus thuringiensis (Bacillus thuringiensis).Or the cell of streptomyces, as shallow Streptomyces glaucoviolaceus (Streptomyces lividans) and mouse ash streptomycete (Streptomyces murinus), or gram negative bacterium, as the kind (Pseudomonas sp.) of intestinal bacteria and Rhodopseudomonas.

In a preferred embodiment, cell is the fungal cell." fungi " comprises Ascomycota (Ascomycota) as used herein, Basidiomycota (Basidiomycota), chytrid door (Chytridiomycota) and Zygomycota (Zygomycota) (Hawksworth etc., Ainsworth and Bisby ' s Dictionary of The Fungi, the 8th edition described, 1995, CABinternational.University Press, Cambridge, UK) and oomycetes door (Oomycota) (as Hawksworth etc., 1995, described in the source is the same, 171 pages) and all mitospore type (mitosporic) fungies (Hawksworth etc., 1995 sources are the same).Representational Ascomycota for example comprises, Neurospora (Neurospora), and penicillium belongs to (Eupenicillium=Penicillium (Penicillium)), Emericella (Emericella,=Aspergillus), Eurotium (Eurotium ,=Aspergillus) and true yeat.The representativeness group of Basidiomycota comprises mushroom, Rust and Ustilago.The representativeness group of chytrid door comprises as Allomyces (Allomyces), little Blastocladia (Blastocladiella), Coelomomyces (Coelomomyces) and aquatic fungi.The representativeness group of oomycetes door comprises as saprolegnia (Saprolegniomycetous) aquatic fungi (water mold) as Achyla (Achlya).Mitospore type fungi comprises Alternaria (Alternaria), Aspergillus, mycocandida (Candida) and Penicillium.Representativeness group in conjunction with the bacterium door comprises mucor (Mucor) and Rhizopus (Rhizopus).

In a preferred embodiment, the fungal cell is a yeast cell." yeast " used herein comprises ascosporogenous yeast (Endomycetale (Endomycetales)), produces the basidiosporangium yeast and belongs to the yeast (Blastomycetes) of partly knowing fungi.Ascosporogenous yeast can be divided into Spermophthoraceae (Spermophthoraceae) and Saccharomycetaceae (Saccharomycetaceae).The latter comprises four subfamily Schizosaccharomycoideae (Schizosaccharomycoideae, kind (Schizosaccharomyces) as Schizosaccharomyces), Nadsonioideae (Nadsonioideae), Lipomycetoideae (Lipomycoideae) and yeast subfamily (Saccharomycoideae is as the kind of genus kluyveromyces (Kluyveromyces), Pichia (Pichia), yeast belong (Saccharomyces)).Produce the basidiosporangium yeast and comprise that Filobasidiella (Filobasidiella), Filobasidium, Leucosporidium (Leucosporidim), Rhodosporidium (Rhodosporidium) and lock throw yeast belong (Sporidiobolus).Belong to the yeast of partly knowing fungi and be divided into two sections, Sporobolomycetaceae (Sporobolomycetaceae, kind as Bullera (Bullera) and Sporobolomyces (Sporobolomyces)) and Cryptococcaceae (Cryptococcaceae is as the kind of mycocandida (Candida)).Because being sorted in, zymic may change in the future, for the present invention, and can be with definition described in yeast such as biology of yeast and the activity (Skinner etc., 1980, Soc.App.Bacteriol.Symposium Series No.9,1980).Zymic biology and yeast genetics are operating as known in this field.(see as yeast bio chemistry and genetics (Biochemistry and Genetics of Yeast), Bacil, M., Horecker, B.J. and Stopani, A.O.M. compile the 2nd edition, and 1987; Yeast (The Yeasts), (J.S. compiles for Rose, A.H., and Harrison) the 2nd edition, 1987; And yeast belong zymic molecular biology (TheMolecular Biology of the Yeas Saccharomyces), Strathern etc. compile 1981).

In a preferred embodiment, yeast cell is the bacterial strain that mycocandida, Hansenula (Hansenula), genus kluyveromyces, Pichia, yeast belong, Schizosaccharomyces or Yarrowia belong to.

In a most preferred embodiment, yeast cell is saccharomyces carlsbergensis (Saccharomycescarlsbergensis), yeast saccharomyces cerevisiae, saccharomyces diastaticus (Saccharomyces diastaticus), Saccharomyces douglasii, kluyveromyces (Saccharomyces kluyveri), promise ground yeast (Saccharomyces norbensis) or Saccharomyces oviformis bacterial strain.In another the most preferred embodiment, yeast cell is Kluyveromyces lactis (Kluyveromyces lactis) cell.In another the most preferred embodiment, yeast cell is a Yarrowia lipolytica cell.

In another preferred embodiment, the fungal cell is a filamentous fungal cells." filamentous fungus " comprises whole thread form in the classification of all Mycophytas (Eumycota) and oomycetes door (Oomycota) (as Hawksworth etc., 1995, the source is the same).The general feature of filamentous fungus is that the mycelia body wall is made up of chitin, Mierocrystalline cellulose, dextran, chitosan, mannosans and other complex polysaccharide.The trophicity growth is by the mycelia elongation, and the carbon source metabolism is an aerobic-type.On the contrary, zymic trophicity growth is by the sprouting of monokaryon thalline as yeast saccharomyces cerevisiae, and the carbon source metabolism can be a fermented type.In a preferred embodiment, filamentous fungal cells is as follows, but the kind of the genus that is not limited thereto: Acremonium (Acremonium), Aspergillus, fusarium (Fusarium), Humicola (Humicola) Mucor (Mucor), myceliophthora (Myceliophthora), Neurospora (Neurospora), Penicillium (Penicillium), Scytalidium (Scytalidium), Thielavia (Thielavia), Tolypocladium and Trichoderma (Trichoderma) bacterial strain.

In more preferred, filamentous fungus is Acremonium, Aspergillus, fusarium, Humicola, Mucor, myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium or Trichoderma cell.

In most preferred embodiment, filamentous fungus is Aspergillus awamori (Aspergillus awamori), aspergillus japonicus (Aspergillus japonicus), Aspergillus nidulans (Aspergillus nidulans), aspergillus niger (Aspergillus niger) or aspergillus oryzae (Aspergillus oryzae) cell.In another preferred embodiment, filamentous fungal cells is a bar spore shape sickle spore (Fusarium bactridioides), Fusariumcerealis, Fusarium crookwellense, machete sickle spore (Fusarium culmorum), fusarium graminaria (Fusarium graminearum), the red sickle spore of standing grain (Fusarium graminum), and spore sickle spore (Fusarium heterosporum), albizzia sickle spore (Fusarium negundi), point sickle spore (Fusarium oxysporum), racemosus sickle spore (Fusarium reticulatum), pink sickle spore (Fusarium roseum), Williams Elder Twig sickle spore (Fusarium sambucinum), colour of skin sickle spore (Fusarium sarcochroum), intend branch spore sickle spore (Fusarium sporotrichioides), Fusarium sulphureum, Fusarium torulosum, Fusariumtrichothecioides, Fusarium venenatum cell.In another preferred embodiment, filamentous fungal cells is Humicola insolens, pubescence humicola lanuginosa, rice black wool mould (Mucormiehei), Myceliophthora thermophila, Neuraspora crassa (Neurosporacrassa), penicillium purpurogenum (Penicillium purpurogenum) or Thielavia terrestris cell.In another preferred embodiment, filamentous fungal cells is Trichoderma harzianum, healthy and free from worry wood mould (Trichoderma koningii), Trichoderma longibrachiatum, Trichoderma reesei or viride (Trichoderma viride) cell.

Useful mammalian cell comprises the got immortalized cells of Chinese hamster ovary cell (CHO), Hela cell, young cavy nephrocyte (BHK), COS cell or arbitrary quantity, as available from American type culture collection.Nucleic acid construct

In the method for the invention, nucleic acid construct is imported in such locus in the genome of parental cell, described locus is not on the permanent staff among the nucleotide sequence of yard target polypeptides.Perhaps, nucleic acid construct is imported parental cell in such locus, described locus perhaps is arranged in the nucleotide sequence that contains tumor-necrosis factor glycoproteins in of the tandem copy of nucleotide sequence.

Nucleic acid construct can be strand or double-stranded arbitrary nucleic acid molecule, and it can be synthetic DNA, and is isolating or through modifying containing such nucleic acid segment from natural gene, described section with can not naturally occurring mode in conjunction with and side by side.Nucleic acid construct can be linearity or ring-type.In addition, nucleic acid construct can be contained in the carrier, can be the linearizing fragment of Restriction Enzyme cutting, or can be the linear fragment of pcr amplification.

Nucleic acid construct can contain any nucleotide sequence of any size.In one embodiment, the nucleic acid construct body length is between about 10-20000bp; The about 100-15000bp of preferred length, the more preferably about 500-15000bp of length, even the more preferably about 1000-15000bp of length, the most preferably about 1000-10000bp of length.

Nucleic acid construct can be used as two or more isolated fragment transfered cells.In using two segmental situations, two fragments so that two fragments can experience homologous recombination once transfered cell, form single fragment at segmental a 3 ' end and another the total sufficiently long nucleic acid sequence homology (overlapping) of 5 ' end.The product fragment becomes the form that is suitable for the reorganization of cell sequence then.Can use plural fragment, these fragments make it experience homologous recombination each other through design, the final form that is suitable for the reorganization of cell sequence that forms.

Should know, two or more nucleic acid constructs can be imported into cell with ring-type or linear form with method of the present invention, and wherein fragment does not contain as above-mentioned overlap.This area is known, and for some biology, the cytotropic importing of multiple construct can cause it to be integrated in same locus.

Nucleic acid construct can contain coding or noncoding DNA sequence.Encoding sequence is as definition herein.

In a preferred embodiment, nucleic acid construct contains selected marker.The example of described selected marker as previously described.

In a preferred embodiment, construct only contains the carrier sequence or contains and selected marker bonded carrier sequence, comprises the carrier sequence that contains replication orgin, as escherichia coli vector sequence (as: pUCI9, pBR322 or pBluescript).For example a kind of escherichia coli vector that contains replication orgin reclaims construct because colibacillary replication orgin can promote to integrate the back from host genome.With can from host genome, reclaiming construct behind the digestion with restriction enzyme genomic dna, be to connect construct and the transformed into escherichia coli that reclaims subsequently.

In a further preferred embodiment, nucleic acid construct does not contain the encoding sequence of the nucleotide sequence of polypeptide or its part.In a preferred embodiment, nucleic acid construct contains and nucleic acid encoding sequence homologous sequence not, integrates or destroy nucleotide sequence to stop construct.

Preferably, nucleic acid construct is no more than 40% with the homology of the nucleotide sequence of coding target polypeptides, preferably is no more than 30%, more preferably is no more than 20%, even more preferably is no more than 10%, does not most preferably have homology.Purpose for the present invention, the homology of two nucleotide sequences is measured like this: by Wilbur-Lipman method (Wilbur and Lipman, 1983, institute of NAS newspaper 80:726-730) is measured, that is: use LASERGENETM MEGALIGNTM software (DNASTAR, Inc., Madison, WI), adopt identity table and the multiple reduced parameter of following sequence: (gap penalty) penalized in the gap is 10, and gap length to penalize (gap length penalty) be 10.In pairs reduced parameter is: Ktuple=3, and the gap penalizes=and 3, window (windows)=20.

In another preferred embodiment, nucleic acid construct contains the copy of the nucleotide sequence of at least one polypeptide or its part.In another preferred embodiment, nucleic acid construct contains the nucleotide sequence homologous sequence with coded polypeptide.

When the nucleic acid construct transfered cell of the nucleotide sequence copy that contains one or more coding target polypeptides, the increase of copy number is greater than the intravital nucleotide sequence copy number of the structure sum in intracellular nucleic acid sequence copy numbers and the transfered cell before the importing construct.Perhaps, when the nucleic acid construct transfered cell of the copy of the nucleotide sequence that contains one or more coding target polypeptides, the minimizing of copy number is greater than importing the intravital nucleotide sequence copy number of the structure sum in the intracellular nucleic acid sequence copy numbers and transfered cell before the construct.But, may be contained in the method marks packets of for example unique restriction enzyme sites and make up intravital nucleic acid, the feasible sequence copy numbers that can identify the construct that in fact is integrated into cellular genome.

In another preferred embodiment, nucleic acid construct contains transferable element, i.e. transposon.A transposon is a kind of DNA isolated fragment, but it self inserts the different loci in homocellular other dna sequence dna.Protein necessary in the transfer process is encoded in transposon.But the end of transposon is normally identical is opposite directions.

In a preferred embodiment, nucleic acid construct can contain one or more control sequences, and as promotor self or with selected marker, wherein control sequence is not operably connected with the nucleotide sequence of coding target polypeptides through integrating.This class control sequence can be promotor, signal sequence, former peptide sequence, transcription terminator, polyadenylation sequence, enhancer sequence and attenuator sequence and intron splice site sequence.The sequence of each control sequence pair cell or coded polypeptide can be natural or allogenic.

In another embodiment preferred, nucleic acid construct contains the control sequence except promotor.

In another embodiment preferred, nucleic acid construct does not contain control sequence.

In another embodiment preferred, nucleic acid construct is pDSY82, pDSY112, pMT1612, pMT1936, pLRF2, pDSY153 or pHB218.The nucleic acid construct transfered cell

Can pass through known multiple physics in this area or chemical process with the nucleic acid construct transfered cell, include but not limited to: the conversion of transfection or transduction, electroporation, microinjection, microparticle bombardment, alkali salt or protoplastis mediation.

Nucleic acid construct can be for example to the importing of bacterial host cell, by protoplast transformation (see as, Chang and Cohen, 1979, molecule General Genetics (Molecular GeneralGenetics), 168:111-115), utilize competent cell (see as, Young and Spizizin, 1961, bacteriology magazine (Journal of Bacteriology), 81:823-829, or Dubnau and Davidoff-Abelson, 1971, molecular biology magazine (Journal of MolecularBiology), 56:209-221), by electroporation (see as, Shigekawa and Dower, 1988. biotechnology (Biotechniques), 6:742-751), or by coupling (see as, Koehler and Thorne, 1987, the bacteriology magazine, 169:5771-5278) etc. method realizes.

The proper method that is used to transform the Aspergillus cell is described in EP 238 023 and Yelton etc., and 1984, institute of NAS reports 81:1470-1474.The proper method that is used to transform the fusarium cell is described in Malardier etc., and 1989, gene 78:147-156 and WO 96/00787.

Can utilize Becker and Guarente, yeast genetics and molecular biology guide (Guide toYeast Genetics and Molecular Biology), Enzymology method (Methods ofEnymology), 194:182-187; Ito etc., 1983, bacteriology magazine, 153:163; And Hinnen etc., 1978, institute of NAS newspaper, transformed yeast described in the 75:1920.

Can utilize Graham and Van der Eb, 1978, virusology, the calcium phosphate precipitation method is directly absorbed transformed mammalian cell among the 52:546.Also can use other methods known in the art such as electroporation.

When nucleic acid construct is carrier, depend on that selected cell is integrated into cellular genome at random by homology and/or non-homogeneous reorganization.

Nucleic acid construct can import parental cell by the integration (REMI) of restriction enzyme mediation, this method of REMI is described in Schiestl and Petes, 1991, institute of NAS newspaper, 88:7585-7589, this method is to cause plasmid DNA usually to be integrated into genome in the site that is limited by the added limitations enzyme subsequently with the plasmid DNA of Restriction Enzyme digestion with the Restriction Enzyme transfered cell.The advantage of REMI is that it can produce such sudden change, and promptly Tu Bian molecular basis can be easy to differentiate.

In another embodiment preferred, nucleic acid construct imports parental cell with the form of ring molecule.

In another embodiment preferred, nucleic acid construct imports parental cell with the form of the part of carrier.

In another embodiment preferred, nucleic acid construct imports parental cell with the form of linear fragment.The screening of mutant cell

Behind the nucleic acid construct transfered cell, next step is a mutant cell of isolating the target nucleic acid sequence copy numbers with change from the group that estimates mutant cell, wherein when cultivating parental cell and mutant cell under identical conditions, mutant cell produces more or less polypeptide than parental cell.The separation of mutant cell is preferably initial passes through to measure when cultivating parental cell and mutant cell under identical conditions, with respect to the polypeptide of parental cell mutant cell generation.The separation of mutant cell can comprise this area known at the method for polypeptide and/or be used to measure the method for nucleotide sequence copy number.The method that is used to measure gene copy number is that this area is known, and comprises Southern analysis, quantitative PCR or PCR in real time.

At first utilize standard bed board technology to carry out purifying by nucleic acid construct being imported the mutant group of inferring that obtains in the biological cell, (see as, Lawrence as those technology that are used for classical mutagenesis, C.W., 1991, Christine Guthrie and Gerald R.Fink compile, Enzymology method, 194 volumes, 273-281, Academic Press, Inc., San Diego), monospore separates, or adds rich technology.Standard bed board technological selection ground uses with the method for the polypeptide that detects expectation.But, no matter being used to identify whether the method for the mutant cell that has target polypeptides is used with the bed board culture, the purified mutant strain of inferring preferably further characterizes, with increase or the minimizing that confirms that peptide produces more than nucleic acid sequence encoding.In addition, also expect the mensuration of nucleotide sequence copy number, to confirm that increase or minimizing that polypeptide produces are the results that the nucleotide sequence copy number changes.

Can identify the mutant cell that specific polypeptide produces to be increased by the detection method at polypeptide known in the art.The method that polypeptide detects includes but not limited to the use of specific antibody, measures enzymic activity by the formation of mensuration enzyme product or the minimizing of enzyme substrates, at the clear area band and the biological activity assay that contain on the agar plate of enzyme substrates.

In a preferred embodiment, the amount of comparing the polypeptide that mutant cell produces with parental cell exceeds or has more at least 20%, preferably at least 50%, more preferably at least 75%, more preferably at least 100%, more preferably 100%-1000% at least, even more preferably 200%-1000% at least, most preferably 500%-1000% at least.

Can utilize the above-mentioned identical method at polypeptide to identify the mutant cell that no longer can produce specific polypeptide or the reduction of generation ability, wherein than parental cell, the output of measurement is zero or reduces.

In a preferred embodiment, the amount of comparing the polypeptide that mutant cell produces with parental cell reduces at least 20%, and preferably at least 50%, more preferably at least 75%, most preferably at least 100%.Locus

In the method for the invention, can import nucleic acid construct in " locus outside the target nucleic acid sequence " is meant in any intron sequences that nucleic acid construct is not imported in polypeptid coding sequence, its control sequence or the nucleic acid sequence encoding sequence.When intervening sequence is present between the nucleotide sequence tandem copy, construct can be imported in these intervening sequences.Perhaps, in the method for the invention, nucleic acid construct can be imported in " locus within the target nucleic acid sequence ", and this is meant nucleic acid construct is imported in any intron sequences in polypeptid coding sequence, its control sequence or the nucleic acid sequence encoding sequence.

Control sequence comprises and is operably connected with nucleotide sequence and participates in all components that polypeptide produces.These control sequences are including, but not limited to promotor, signal sequence, former peptide sequence, transcription terminator, leader sequence and polyadenylation sequence as described here.Each control sequence can be natural or allogenic with respect to encoding sequence.

When locus was not within the target nucleic acid sequence, locus can be adjacent with above-mentioned control sequence or non-conterminous.Preferably, locus is non-conterminous.Locus can be in same karyomit(e) or same extra-chromosomal element with the target nucleic acid sequence, or is in coloured differently body or the external element of coloured differently.In addition, the locus pair cell can be natural or allogenic.

In a preferred embodiment, locus is apart from 5 ' or 3 ' end of nucleotide sequence 100bp at least, preferred 1000bp at least, and more preferably 2000bp at least, even more preferably 3000bp at least are more preferably 4000bp at least, and most preferably at least 10,000bp.

In a further preferred embodiment, locus is positioned on the different karyomit(e) with the nucleotide sequence of coding target polypeptides.

In a further preferred embodiment, peptide was different from the polypeptide by nucleic acid sequence encoding more than locus was encoded.

In a further preferred embodiment, locus is the nucleic acid encoding sequence.With the nucleic acid construct rescue locus that inserts and the purposes of target construct

The invention still further relates to the method for recovering (rescue) locus with the nucleic acid construct that inserts, comprise and from the mutant cell of identifying, separate (i) nucleic acid construct, and 3 ' and 5 ' flanking region of (ii) genomic locus, integrated nucleic acid construct in the described locus; And 3 ' and 5 ' flanking region of identified gene seat.

Can by the known method in this area as with restriction enzyme digestion and subsequently be connected and intestinal bacteria transform, inverse PCR, random primer gene go on foot and move (walking) PCR or detect method isolating nucleic acid construct and flanking region such as mutant cell library.Have or do not have 3 ' and the isolating nucleic acid construct of 5 ' flanking region be called " target construct " at this.

The target construct comprises apart from the 100-9000bp between nucleic acid construct integration site upstream and/or the downstream, preferred 200-9000bp, more preferably 500-7000bp, even more preferably 1000-7000bp, most preferably 1000-3000bp.

Target construct of the present invention can be imported into different cells changing the generation of polypeptide, and modified polypeptides is similar, identical or different fully in described polypeptide and the naive cell.Other cells can be identical with naive cell or belong to different kinds or different genus.If naive cell is the fungal cell, other cells are preferably the fungal cell.If naive cell is a bacterial cell, then other cells are preferably bacterial cell.If naive cell is a mammalian cell, then other cells are preferably mammalian cell.

When cell is different cell, the integration of target construct preferably occurs in such target gene seat, the locus sequence homology of the naive cell that itself and this target construct is originated, that is: identical or enough similar, make target construct and cell DNA can experience homologous recombination, produce the sudden change of expectation.Therefore, the sequence preference of target construct and the preliminary election site homology that will carry out the cell chromosome DNA of homologous recombination.But, shoulding be those of ordinary skills knows, the target construct depends on cell in the probability that target gene seat point inserts again because the range of frequency of homologous recombination can be from the such yeast of yeast saccharomyces cerevisiae almost 100%, change to be low to moderate in Aspergillus 1%.The target construct can be binned in non-target and decides to integrate in the locus by non-homogeneous, causes the change of the nucleotide sequence copy number of coding target polypeptides.

Preferably, target is decided locus and is comprised that the flanking sequence that has with the target construct has and be higher than 40% homology, preferably is higher than 60%, more preferably is higher than 70%, even more preferably is higher than 80%, most preferably is higher than the dna sequence dna of 90% homology.The homology degree of two sequences can be measured with Wilbur-Lipman method described herein.

The target construct can contain 3 ' and 5 ' district any or the two all have, this depends on expectation single intersection or replacement.In addition, can modify the target construct to proofread and correct any error event, as rearrangement, tumor-necrosis factor glycoproteins, deletion or insertion, these mistakes occur in nucleic acid construct originally imported and be integrated into cellular genome in the locus place process, this originally sequence recover from this locus at first.

Above-mentioned target construct can use as the linear kernel nucleotide sequence form of Restriction Enzyme cutting, or can or insert appropriate carriers by cyclisation.For example, cyclic plasmid or dna fragmentation preferably adopt single target sequencing row.Linear plasmid or dna fragmentation preferably adopt two target sequencing row.The target construct is once transfered cell (described cell contains the nucleotide sequence of the target polypeptides of encoding), just locate to be integrated into the genome of cell at the target gene seat or at non-target gene seat (but preferred target gene seat), its can be positioned within the nucleotide sequence of coding target polypeptides or outside.The target gene seat can be positioned at phase homologous chromosomes or identical extra-chromosomal element with target dna sequence, or is positioned at coloured differently body or the external element of coloured differently.When cultivating mutant cell and parental cell under the same conditions,, integrate the copy number of the nucleotide sequence that has changed coded polypeptide with respect to parental cell.In a preferred embodiment, the target construct contains selected marker.

Randomly, the target construct can be with two or more isolating pieces transfered cells.For example, when using two fragments, the intersegmental dna sequence dna that has in a fragment 3 ' end and another fragment 5 ' end homology (overlapping) of sheet, one is carried first target sequencing row in two fragments, and another carries second target sequencing row.Once transfered cell, two fragments can experience homologous recombination, and it is two single fragments of first and second target sequencing row of the overlap between the fragment originally that formation has flank.The product fragment is the form that is suitable for the reorganization of cellular targets sequence homology then.Can use the fragment through designing more than two, make it can experience homologous recombination to each other, the final product that is suitable for the reorganization of cellular targets sequence homology that forms.

In case target construct transfered cell, the target construct can further be increased by comprising a kind of selected marker that increases, described selected marker has such character, promptly by culturing cell in the presence of suitable selective agent, to select to contain the cell of selected marker amplification copy.

In a preferred embodiment, one or more target constructs are imported the target gene seat.In a further preferred embodiment, each target construct changes the not copy number of another nucleotide sequence of homopolypeptide of encoding.In a further preferred embodiment, two or more target constructs import the target gene seat together, and additivity ground or effect synergistically are with the copy number of the nucleotide sequence that changes coded polypeptide.Cultivate the method for mutant cell and recovery polypeptide

Utilize the known method in this area training objective polypeptide in the nutritional medium that is suitable for the polypeptide generation to produce the selected mutant cell that raises or reduce.For example; cell can be cultivated by shaking culture, by in suitable medium make described polypeptide can be expressed and/or isolating condition under carry out, cultivate with the small-scale in fermentor tank or the industrial fermentation jar or large scale fermentation (comprise continuously ferment, batch fermentation, fed-batch fermentation or solid state fermentation) in the laboratory.This cultivation be use methods known in the art at suitable nutritional medium (comprising carbon source and nitrogenous source and inorganic salt) (referring to as Bennett.J.W. and LaSure, L., compile, fungal gene operation addendum (More GeneManipulations in Fungi), Academic Press carries out in CA.1991).Suitable medium can or can prepare by disclosed composition (for example products catalogue of American type culture collection) from supplier's acquisition.If polypeptide excretory words can directly reclaim polypeptide from nutrient solution.If polypeptide is not secreted, then from cell lysate, reclaim.

Can utilize at the known method in this area of polypeptide, as the method detection polypeptide of those methods of previous description or description in an embodiment.

Can reclaim polypeptide by the known method in this area.For example, can be centrifugal by including but not limited to, filtration, extraction, spraying drying, evaporation or sedimentary ordinary method reclaim described polypeptide from nutrient medium.

Can be further purified polypeptide by the whole bag of tricks known in the art, these methods include but not limited to: chromatography (for example, ion-exchange, affine, hydrophobic, chromatofocusing and size exclusion), electrophoretic method (isoelectrofocusing of for example preparation type), differential solubleness (for example ammonium sulfate precipitation), perhaps extract (referring to for example, " protein purification " (Protein Purification), J.C.Janson and Lars Ryden compile, VCH Publishers, New York, 1989).Obtain the method for mutant cell

The present invention also designs a kind of method that obtains mutant cell.

In first embodiment, the method that obtains mutant cell comprises

(a) with a nucleic acid construct therein nucleic acid construct be integrated in the locus place outside the nucleotide sequence copy under the condition of genome of parental cell and import parental cell, form mutant cell, wherein this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein nucleic acid construct is integrated into the copy number that has increased nucleotide sequence in the locus, and the increase of copy number not the result of selective pressure; When cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more polypeptide than parental cell;

(b) when under the same condition that helps polypeptide to produce, cultivating parental cell and mutant cell, identify the mutant cell that produces more polypeptide than parental cell.

In second embodiment, the method that obtains mutant cell comprises

(a) with a nucleic acid construct therein nucleic acid construct be integrated in the locus place outside the nucleotide sequence copy under the condition of genome of parental cell and import parental cell, form mutant cell, wherein this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein nucleic acid construct is integrated into the copy number that has reduced nucleotide sequence in the locus, and the reduction of copy number not the result of selective pressure; When cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell is than parental cell generation polypeptide still less;

(b) when under the same condition that helps polypeptide to produce, cultivating parental cell and mutant cell, identify the mutant cell that produces polypeptide still less than parental cell.

In the 3rd embodiment, the method that obtains mutant cell comprises

(a) nucleic acid construct is integrated under the condition of genome of parental cell and imports parental cell in the locus place of nucleic acid construct in one of nucleotide sequence copy therein, form mutant cell, wherein this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein nucleic acid construct is integrated into the copy number that has increased nucleotide sequence in the locus, and the increase of copy number not the result of selective pressure; When cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more polypeptide than parental cell;

(b) when under the same condition that helps polypeptide to produce, cultivating parental cell and mutant cell, identify the mutant cell that produces more polypeptide than parental cell.

In the 4th embodiment, the method that obtains mutant cell comprises

(a) nucleic acid construct is integrated under the condition of genome of parental cell and imports parental cell in the locus place of nucleic acid construct in one of nucleotide sequence copy therein, form mutant cell, wherein this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein nucleic acid construct is integrated into the copy number that has reduced nucleotide sequence in the locus, and the reduction of copy number not the result of selective pressure; When cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell is than parental cell generation polypeptide still less;

(b) when under the same condition that helps polypeptide to produce, cultivating parental cell and mutant cell, identify the mutant cell that produces polypeptide still less than parental cell.

In the 5th embodiment, the method that obtains mutant cell comprises

(a) with a nucleic acid construct therein nucleic acid construct be integrated at the locus place outside the nucleotide sequence copy under the condition of genome of parental cell and import parental cell, form mutant cell, wherein this parental cell contains the nucleic acid encoding sequence, described nucleotide sequence contains tumor-necrosis factor glycoproteins at 5 ' and the 3 ' end of this nucleotide sequence, wherein nucleic acid construct is integrated into the copy number that has increased nucleotide sequence in the locus, and the change of copy number not the result of selective pressure; When cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more polypeptide than parental cell;

(b) when under the same condition that helps polypeptide to produce, cultivating parental cell and mutant cell, identify the mutant cell that produces more polypeptide than parental cell.

The present invention further describes by the following embodiment that should not be construed as the restriction scope of the invention.

Embodiment bacterial strain and substratum

Starting strain is pyrG-minus aspergillus oryzae HowB42S, aspergillus oryzae JaL250, bacillus coli DH 5 alpha (GIBCO-BRL, Gaithersburg, MD) and intestinal bacteria HB101 (GIBCO-BRL, Gaithersburg, MD).

PDA contains 39g/l potato dextrose agar (Difco), unless there is other dated especially, pyrG auxotroph is added the 10mM uridine.

Every liter of the MY25 substratum of pH 6.5 is by 25g maltose, 2.0g MgSO ₄7H ₂O, 10gKH ₂PO ₄, 2.0g citric acid, 10g yeast extract, 2.0g K ₂SO ₄, 2.0g urea and the solution composition of 0.5ml trace metal.MY25 shake-flask culture base with 1: 100 or dilution in 1: 1000, is used for microtitration growth experiment (MY25/100 or MY25/1000) with glass distilled water.Culture is 34 ℃ of growths.

Every liter of 2X MY salt (pH 6.5) solution is by 4g MgSO ₄7H ₂O, 4g K ₂SO ₄, 20gKH ₂PO ₄, 4g citric acid, 1ml trace metal and 2ml CaCl ₂2H ₂O (100g/l stores stoste) forms.

Minimum medium transform dull and stereotyped every liter by 6g NaNO ₃, 0.52g KCl, 1.52g KH ₂PO ₄, 1ml trace metal solution, 1g glucose, 500mg MgSO ₄-7H ₂O, the Noble agar of 342.3g sucrose and 20g (pH 6.5) is formed.Minimum medium transforms dull and stereotyped (pH6.5) every liter by 6gNaNO ₃, 0.52g KCl, 1.52g KH ₂PO ₄, 1ml trace metal solution, 1g glucose, 500mg MgSO ₄-7H ₂O, and the Noble agar of 20g is formed.

Every liter of trace metal solution (1000X) is by 22g ZnSO ₄-7H ₂O, 11g H ₃BO ₃, 5gMnCl ₂4H ₂O, 5g FeSO ₄7H ₂O, 1.6g CoCl ₂5H ₂O, 1.6g (NH ₄) ₆Mo ₇O ₂₄, and 50g Na ₄EDTA forms.

COVE dull and stereotyped every liter by 343.3g sucrose, 20ml COVE salts solution, 10ml 1M ethanamide, 10ml 3M CsCl and 25g Nobel agar.Every liter of COVE trace metal salts (50X) solution is by 26g KCl, 26g MgSO ₄7H ₂O, 76g KH ₂PO ₄With the solution composition of 50ml COVE trace metal.Every liter of COVE trace metal solution is by 0.04g NaB ₄O ₇10H ₂O, 0.040gCuSO ₄5H ₂O, 0.70g FeSO ₄H ₂O, 0.80g Na ₂MoO ₂2H ₂O and 10g ZnSO ₄Form.

Every liter of YEG substratum is made up of 5g yeast extract and 20g glucose.

BASTA contains 342.3g sucrose for dull and stereotyped every liter, 20ml COVE salts solution, and 10ml 1M urea, the whole BASTA concentration of 25g Noble agar and 5mg/ml is used to screen transformant.The upper panel that is used for the BASTA conversion has the same composition of above-mentioned BASTA flat board.BASTA shifts dull and stereotyped the same, just contains 10mg/ml BASTA.The structure of embodiment 1 aspergillus oryzae HowB430

Structure contains from pubescence humicola lanuginosa (LIPOLASE ^TMGene, Novo Nordisk A/S, Bagsvaerd, Denmark) the aspergillus oryzae HowB430 of lipase gene.

Contain the leading hybrid promoter of TAKA/NA2-tpi as following structure, from the lipase gene of pubescence humicola lanuginosa, AMG terminator and as the pBANe8 of the total length Aspergillus nidulans amd S gene of selective marker.

Utilize PCR, primer 1 below adopting and 2 inserts and is positioned at pToC90 (Christensen etc., 1988, physiotechnology, 6:1419-1422) the NsiI site of total length amd S gene flank, primer 3 below adopting and 45 ' ends at the leading hybrid promoter of pJaL292 (Fig. 1) NA2-tpi insert the EcoRI site, insert the SwaI site at its 3 ' end.(Foster City is CA) according to manufacturers's explanation synthetic primer for Applied Biosystems, Inc. with Applied Biosystems Model 394DNA/RNA synthesizer.Primer 1:S '-ATGCATCTGGAAACGCAACCCTGA-3 ' primer 2: 5 '-ATGCATTCTACGCCAGGACCGAGC-3 ' primer 3:5 '-TGGTGTACAGGGGCATAAAAT-3 ' primer 4:5 '-ATTTAAATCCAGTTGTGTATATAGAGGATTGTGG-3 '

Utilize pToC90 or the pJaL292 of about 0.2 μ g to prepare amplified reaction (100 μ l) as template.Each reaction contains following composition: 0.2 μ g plasmid DNA, 48.4pmol forward primer, 48.4pmol reverse primer, each 1 mM of dATP, dCTP, dGTP and dTTP, 1x Taq dna polymerase buffer liquid, and 2.5U TaqDNA polysaccharase (Perkin-Elmer Corp., Branchburg, NJ).Be reflected in the Ericomp thermal cycler and carry out incubation with following program: 95 ℃ of circulations in 5 minutes, be subsequently 30 times the circulation: 95 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 2 minutes.

The PCR product is electrophoresis in 1% sepharose, the amdS fragment of alleged occurrence 2.7kb and the NA2-tpi fragment of 0.6kb.

The PCR product utilizes TA clone test kit according to manufacturers's indication subsequently, and (CA) subclone is gone into pCRII for Invitrogen, SanDiego.(Qiagen.Inc..Chatsworth CA) extracts plasmid DNA from transformant, the screening transformant by utilize the QIAwell-8 plasmid kit according to manufacturers's indication then.With NsiI or EcoRI/SwaI restrictive diges-tion plasmid DNA, confirm to exist respectively NsiI amdS fragment and the SwaI/EcoRI NA2-tpi fragment of 2.7 kb and 0.6 kb by agarose electrophoresis then.For confirming the PCR product, with product Applied Biosystems Model373A automated DNA sequenator (Applied Biosystems.Inc., Foster City, CA) utilize two the chain survey sequencing row (Gieseckes etc. of primer walking technology to product, 1992, the virological method magazine, 38:47-60), described technology is utilized dyestuff to stop chemical method and has been adopted M13 oppositely (48) and M13 forward (20) primer (New England Billabs, Beverly, and treat the special primer of DNA of order-checking MA).Plasmid from correct transformant digests with Restriction Enzyme then, the plasmid through digestion is separated on 1% sepharose, according to manufacturers's indication FMC SpinBind test kit (FMC, Rockland, ME) purifying.

The pKS6 (Fig. 2) that contains TAKA amylase promotor, polylinker, AMG terminator and Aspergillus nidulans pyrG gene cuts to remove TAKA amylase promotor through EcoRI and SwaI enzyme.This zone substitutes with NA2-tpi PCR product, to produce pBANe 13 (Fig. 3).

Digest pBANe 13 to remove Aspergillus nidulans pyrG gene with NsiI.This zone substitutes with above-mentioned total length amdS gene PCR product, to produce pBANe 6 (Fig. 4).

Adopt following primer 5 and 6 SwaI and PacI site to be inserted the flank of the pubescence humicola lanuginosa lipase gene (Fig. 5) of total length pMHan37 by PCR:

Primer 5:5 '-ATTTAAATGATGAGGAGCTCCCTTGTGCTG-3 '

Primer 6:5 '-TTAATTAACTAGAGTCGACCCAGCCGCGC-3 '

Amplified reaction (100 μ l) contains following composition: the pMHan37 of 0.2 μ g, 48.4pmol primer 5,48.4pmol primer 6, each 1mM of dATP, dCTP, dGTP and dTTP, 1x TaqDNA polymerase buffer, and 2.5U TaqDNA polysaccharase.Be reflected in the Ericomp thermal cycler and carry out incubation with following program: 95 ℃ of circulations in 5 minutes, be subsequently 30 times the circulation: 95 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 2 minutes.2 μ l reaction product electrophoresis in sepharose confirms the amplification of the lipase gene product of about 900bp.

Utilize TA clone test kit subclone to go into pCRII subsequently the lipase gene product of pcr amplification.By utilizing the QIAwell-8 plasmid kit from transformant, to extract plasmid DNA, screen transformant then.With SwaI/PacI restrictive diges-tion plasmid DNA, carry out dna sequencing to confirm the PCR product according to aforesaid method.

By with SwaI and PacI digestion lipase gene being cut out from the pCRII plasmid, subclone goes among the pBANe6 of SwaI/PacI digestion to obtain pBANe8 (Fig. 6) subsequently.

Digest pBANe8 with PmeI, utilize 40mM Tris-acetate-1mM EDTA disodium (TAE) damping fluid to be prepared the type agarose electrophoresis then, separate and contain the linear PmeI fragment of NA2-tpi promotor, the lipase gene and the AMG terminator of pubescence humicola lanuginosa.

Obtain aspergillus oryzae HowB430 by transforming aspergillus oryzae HowB425 with linear PmeI fragment as follows.

In 100 milliliter of 1% yeast extract-2% peptone-1% glucose under 32 ℃ with 150 rev/mins of stir culture aspergillus oryzae HowB425 16-18 hour.Reclaim mycelium through 0.45 millimeter membrane filtration, stay on the filter membrane up to about 10 milliliters.With 25 milliliters of 1.0-1.2M MgSO ₄-10mM sodium phosphate (pH6.5) washing is filtered as described above, and washing as described above until 10 milliliters of residues, is resuspended in 10 milliliters 5mg/ml NOVOZYM 234 then in 125 milliliters of Ehrlenmeyer flasks once more ^TM(Novo Nordisk A/S.Bagsvaerd., Denmark) (1.2M MgSO ₄-10mM sodium phosphate, the filtering solution of pH6.5 (0.45 micron)).Suspension under 50 rev/mins mild stirring in about 1 hour of 37 ℃ of incubations, to produce protoplastis.The protoplastis of 10 ml volumes/sporophore product is added 30 milliliters of Corex centrifuge tubes, cover, in large vol rotary head frame centrifugal 15 minutes, reclaim protoplastis with 3600 * g with 5 milliliters of 0.6M sorbyl alcohols-10mM Tris-HCl pH 7.5.Reclaim protoplastis with Pasteur's imbibition device from the damping fluid interface.With the STC washing of 5 times of volumes, centrifugal then, washing and centrifugal as described above once more.With protoplastis be resuspended in STC to final concentration be every milliliter 2 * 10 ⁷Protoplastis.

The amdS screening that aspergillus oryzae HowB425 transforms is 2 * 10 with concentration ⁷/ milliliter protoplastis carries out.10 μ gDNA add in 100 milliliters of protoplastiss.Add volume then and be 250 milliliters PEG solution (60%PEG 4000-10mMCaCl ₂,-10mM Tris-HCl pH 8.0), mixture was placed 30 minutes in 37 ℃.Add 3 milliliters of 1M sorbyl alcohol-10mM CaCl ₂-10mM Tris pH 7.5 (STC) is plated on mixture the Cove flat board of adding the 10mM uridine that is used for amd S screening.With flat board in 34 ℃ of incubation 7-10 days.Transformant is transferred to the flat board of same medium, in 37 ℃ of incubation 3-5 days.Adopt the flat board of same medium (no sucrose) to select isolating bacterium colony by the spore method of scoring, the purifying transformant under the same conditions.The structure of embodiment 2 plasmid pSO122, pDSY81 and pDSY82

As following structure plasmid pSO122, to contain the 1.5kb fragment of aspergillus oryzae pyrG gene.

From aspergillus oryzae 1560 genomic library construction pSO2 (Fig. 7).The genomic library of aspergillus oryzae 1560 is at first by (New England Biolabs.Beverly, MA) part digests aspergillus oryzae 1560 genomic dnas structure with Sau3A.Condition according to manufacturer recommendation adopts 4 Sau3A of unit to digest 10 μ g aspergillus oryzaes, 1560 genomic dnas.Be reflected at 65 ℃ and carry out, with sampling (from 0-50 minute) at interval in 5 minutes.Sample is placed on ice, by adding the EDTA termination reaction of 10 μ M.With these digests electrophoresis on 1% sepharose that has the pyridine of bromine second, cut out the gel that contains 3kb-9kbDNA.(New England Biolabs.Beverly MA) utilizes Beta-Agarase I purify DNA from the gel stripping and slicing to the method that use is provided by manufacturers.(Clontech.Palo Alto CA) spends the night in 16 ℃ under the condition of manufacturer recommendation, and the DNA of selected size is connected into the EMBL4 arm according to manufacturers indication.(Stratagene, La Jolla is CA) with ligation thing packing and titration to utilize Gigapack II package kit according to the method for manufacturers.Obtain 16000 reorganization plaques altogether, the method amplification library that utilizes manufacturers to provide.

Described in the method that is provided as EMBL 4 arms, with genomic library suitably dilution to obtain 7000 plaques of every 150mm culture dish.The employing standard method (Sambrook etc., 1989, the source is the same) plaque is transferred to Hybond-N+ ring-type filter membrane (Amersham.Cleveland.OH).Utilize the crosslinked fixedly filter membrane of UV, and at 42 ℃ of prehybridizations (5X SSPE, 35% methane amide).Use the 500bp fragment that constitutes by aspergillus niger pyrG to detect genomic library with low rigorous degree (35% methane amide, 5X SSPE, 42 ℃), described fragment with random primer dna marker test kit (BoebringerMannheim, Indianapolis.IN) with ³²The P mark.Be separated to 3.8 kbHindIII fragments from a plaque, subclone is gone into pUC 118 cloning vectors, preparation pSO2.

Utilize primer 7 as follows and 8, adopt PCR the BamHI restriction site to be imported 5 ' end of the pyrG gene of pSO2, produce pSO122.Primer 7 and 8 synthesizes with AppliedBiosystems Model 394 DNA/RNA synthesizers with manufacturers's indication.

Primer 7:5 '-GCGGGATCCCTAGAGTAGGGGGTGGTGG-3 '

Primer 8:5 '-GCGGGATCCCCCCTAAGGATAGGCCCTA-3 '

Amplified reaction (50 μ l) contains following composition: 2ng pSO2,48.4pmol forward primer, 48.4pmol reverse primer, each 1mM of dATP, dCTP, dGTP and dTTP, 1x Taq dna polymerase buffer liquid, and 2.5U TaqDNA polysaccharase.Be reflected in the Ericomp thermal cycler and carry out incubation with following program: 95 ℃ of circulations in 5 minutes, be subsequently 30 times the circulation: 95 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 2 minutes.By electrophoretic separation PCR product on 1% sepharose.

Digest the isolating PCR chief of the Xiongnu in Acient China with BamHI, and (BamH I site CA) produces pSO122 (Fig. 8) for Stratagene, La Jolla to be cloned into pBluescript SK-.Only homology between aspergillus oryzae HowB430 and the pSO122 genome is inserted segmental 5 ' end at pyrG, because all the other pyrG fragments are deleted from aspergillus oryzae HowB430 as described in embodiment 1.

To decide frequency and because pSO122 contains two BamHI sites, made up derivative pDSY81 and the pDSY82 (Fig. 8) of two pSO122 in order to reduce at the target in this homology zone of genome, one of them BamHI site is destroyed.By partly digesting pSO122 with BamHI, mend flat 5 ' with the Klenow fragment and dangle, through the connection closed plasmid, make up pDSY81 and pDSY82, be transformed into bacillus coli DH 5 alpha (Sambrook etc., 1989, the source is the same) then.By using the QIAwell-8 plasmid kit to extract plasmid DNA screening transformant, determine whether that with BamHI restrictive diges-tion plasmid DNA a BamHI site is destroyed then.Have a disrupted plasmid in BamHI site and digest with NsiI/BamHI, destroyed to measure which BamHI site.Embodiment 3 usefulness pSO122, pDSY81 or pDSY82 transform aspergillus oryzae HowB430

Protoplastis as preparation aspergillus oryzae HowB430 as described in the embodiment 1.With (protoplastis concentration 2 * 10 in 0.1 milliliter of protoplastis in 14 milliliters of Falcon polypropylene tube of DNA equal portions (EcoRI with 4-12 U makes ring-type pSO122 and pDSY81 linearizing, or makes the pDSY82 linearizing with 15UBamH I) adding of 5-15 μ l ⁷/ milliliter), add 250 μ l 60%PEG4000-10mMCaCl then ₂-10mM Tris-HCl (pH7), gentle mixing was in 37 ℃ of incubations 30 minutes.Any that transforms available 5 μ g ring-type pSO122,6 μ g linearizing pDSY81 or 6 μ g linearizing pDSY82 carries out.Add 3 milliliters of SPTC (1.2M sorbyl alcohol-10mM CaCl then ₂-10 mM TrispH 8), mixing suspension gently.Top-layer agar (1X COVE salt, 1%NZ amine, 0.8M sucrose, 0.6%Noble agar) or 3 milliliters of STC substratum with 12 milliliters of thawings mix with suspension, and suspension is plated on the minimum medium flat board.Dull and stereotyped in 37 ℃ of incubation 3-5 days.

The transformation frequency that ring-type pSO122 transforms is about 100-200 transformant/μ g.Obtained the aspergillus oryzae HowB430 library of about 120,000 transformants.

The transformation frequency that EcoRI REMI pDSY81 transforms is about 60-100 transformant/μ g.Obtained the EcoRI REMI library of the aspergillus oryzae HowB430 of about 28,000 transformants.

The transformation frequency of BamH I REMI pDSY82 is about 80-110 transformant/μ g.Obtained the BamH I REMI library of the aspergillus oryzae HowB430 of about 27,000 transformants.

Also utilize pDSY81 such as above-mentioned HindIII and the SalIREMI library that has prepared aspergillus oryzae HowB430.

The transformation frequency that Hind III REMI pDSY81 transforms is about 80-120 transformant/μ g.Produced the Hind III REMI library of the aspergillus oryzae HowB430 of about 35,000 transformants.

The transformation frequency of SalI REMI pDSY81 is about 80-110 transformant/μ l.Obtained the SalI REMI library of the aspergillus oryzae HowB430 of about 25,000 transformants.

The set in the library of aspergillus oryzae HowB430 is named as follows respectively: " h " is pSO122; " e " is the pDSY81 with EcoRI digestion, transforms in the presence of EcoRI subsequently; " b " is the pDSY82 with BamHI digestion, transforms in the presence of BamHI subsequently; " hIII " is the pDSY81 with HindIII digestion, transforms in the presence of HindIII subsequently; " s " is the pDSY81 with SalI digestion, transforms in the presence of SalI subsequently.123 ＂ h ＂ set are arranged, 28 ＂ e ＂ set, 23 ＂ b ＂ set, 55 ＂ hIII ＂ set and 25 ＂ s ＂ set.

Above-mentioned library is merged into the group of each about 1000 transformants, is stored in 10% glycerine in-80 ℃.Embodiment 4: the lipase expression screening

Identify the lipase expression of the sudden change of aspergillus oryzae HowB430 described in the embodiment 3 library ＂ h ＂, ＂ e ＂, ＂ b ＂, ＂ s ＂ and ＂ hIII ＂.

For 96 orifice plates screenings, use by 1000 times of the diluted MY25 substratum of isopyknic sterilized water and 2X MY salt (pH 6.5) formulations prepared from solutions.For 24 orifice plate screening methods, use by 100 times of the diluted MY25 substratum of isopyknic sterilized water and 2X MY salt (pH 6.5) formulations prepared from solutions.

Elementary 96 orifice plates screening comprises that the dilution spore is gone into MY25/1000 from independently gather in the library, makes when 50 milliliters of substratum are dispensed into each hole, spore of average every hole inoculation.After the inoculation, 96 orifice plates were grown 7 days in 34 ℃ under quiescent conditions.Then as following evaluation lipase activity.Targeted mutagenesis body direct inoculation is gone into to contain 24 orifice plates of MY25/100,34 ℃ of growths 7 days.Then as following evaluation lipase activity.The targeted mutagenesis body is plated on the COVE flat board to produce spore, is plated on the PDA flat board again,, in 24 orifice plates, test 4 single bacterium colonies of each isolate then with aforesaid method to produce single bacterium colony.

Lipase is analyzed being prepared as follows of substrate: before the use, p-nitrophenyl butyric acid storing solution substrate is diluted (21 μ l p-nitrophenyl butyric acid/milliliter DMSO) at 1: 50 go into MC damping fluid (4mM CaCl ₂-100mM MOPS pH 7.5).Preparation standard lipase (LIPOLASE ^TM, Novo Nordisk A/S, Bagsvaerd, Denmark), to contain 40 LU/ml MC damping fluids, contain 0.02% alpha-olefin sulphonate/salt (AOS) stain remover in the described damping fluid.With standard substance place 4 ℃ standby.Use preceding with the dilution in 1: 40 in the MC damping fluid of standard lipase.The meat soup sample dilutes in containing the MC damping fluid of 0.02%AOS stain remover, and 20 μ l equal portions are added in the hole of 96 orifice plates, adds the substrate of 200 μ l dilution subsequently.Utilize the orifice plate readout instrument, in 405nm place record absorbancy, the difference of twice reading that logging interval is about 1 minute.With respect to lipase criterion calculation lipase units per ml (LU/ milliliter).

360 of the transformants that the pSO 122 that is used for further estimating transforms, 44 of the transformants that pDSY81 or pDSY82 REMI transform have been identified through 96 orifice plates screenings and 24 orifice plate results of screening subsequently.These are compared with aspergillus oryzae HowB430 with control strain aspergillus oryzae HowB427 through the transformant of identifying, produce higher levels of lipase.Embodiment 5: shake bottle, fermentation and the evaluation of lipase gene copy number

The highest mutant strain of lipase output described in the embodiment 4 is plated on the COVE flat board, is used to shake the spore of bottle and fermentation assessment with generation.

By the inoculation of the spore suspension (0.02%Tween-80 adds the spore of COVE flat board) of 300-500 milliliter being gone in 125 ml shake flasks in 25 milliliters the MY25 substratum (pH 6.5), shake the bottle assessment.Shook bottle 3 days with 200 rev/mins 34 ℃ of following cultivations.In the 2nd day and sampling in the 3rd day, measure lipase activity as described in example 4 above.

Identical mutant strain is being contained by Nutriose, yeast extract, (NH ₄) ₂HPO ₄, MgSO ₄7H ₂O, citric acid, K ₂SO ₄, CaCl ₂H ₂In 2 liters of laboratory ferment jars of the substratum that O and micro-metals constitute, grew 8 days with 1000-1200 rev/min under 34 ℃ of pH7.Measure lipase activity as described in example 4 above.

Lipase copy number in the aspergillus oryzae mutant strain is by the PCR in real time assay determination, pcr analysis adopts Applied Biosystems Prism Model 7700 sequenator (AppliedBiosystems, Inc., Foster City CA) carries out according to manufacturers's indication.Each genomic dna goods to lipase and single copy gene contrast oliC carry out real-time PCR reactions.Growing 24 hours on 5 milliliters of YEG substratum in 34 ℃ of spores on the little culture dish flat board mutant strain.From each culture, collect mycelium by filtering, be transferred to 1.7 milliliters centrifuge tube through No. 1 filter paper of Whatman (Whatman, Springfield Mill, Britain).Frozen bacteria filament in liquid nitrogen is in SpeedVac (Savant Instruments., Inc., Famiingdale., NY) dried overnight under the middle room temperature.(Qiagen, Chatsworth CA) obtain genomic dna according to manufacturers's indication to utilize DNeasy Kit.By ratio, calculate the average lipase copy number of each bacterial strain according to lipase replicon quantity and oli C replicon quantity.Utilize the genomic dna of aspergillus oryzae HowB430 to produce the typical curve that is used to analyze.Use following primer and probe groups to carry out the amplification of real-time lipase gene: lipase gene probe: 6FAM-5 '-TGGCCAGTCCTATTCGTCGAGAGGTC-3 '-TAMRA lipase gene forward primer (lipo 9F): 5 '-CTCCCTTGTGCTGTTCTTTGTCT-3 ' lipase gene reverse primer (lipo 111R): 5 '-CTGTGCAAAGAGATTGAACTGGTTA-3 '

Using following primer and probe groups to carry out oliC increases in real time: oliC probe: 6FAM-5 '-TGGGTATGGGTTCCGCCGCC-3 '-TAMRAoliC forward primer (oliC4F): 5 '-GATGGTCCAGGTCTCCCAGAA-3 ' oliC reverse primer (oliCl22R): 5 '-CAGGGTTGCGGGAGACA-3 '

6FAM is the abbreviation of fluorescence reporter molecule 6-Fluoresceincarboxylic acid, and 5 ' end of itself and probe is covalently bound, and TAMRA is the abbreviation of 6-carboxyl tetramethyl-rhodamine, and it is to hold bonded to bury in oblivion agent by connecting arm and probe 3 '.

For typical curve,, and primer sets and probe groups all carried out PCR in real time with 1: 10,1: 100,1: 1000 and 1: 10000 serial dilution aspergillus oryzae HowB430 genomic dna.In order to analyze other bacterial strain,, and primer sets and probe groups all carried out PCR in real time with 1: 50 and 1: 100 or with 1: 100 and 1: 200 dilution gene group DNA.(Foster City CA) carries out real-time PCR reactions for Applied Biosystems, Inc. to utilize TaqMan PCR reagent test kit according to manufacturers's indication.Reaction contains 1X TaqMan buffer A, 3.5mM MgCl ₂, each 200 μ M of dATP, dCTP, dGTP and dUTP, 0.025U/ml AmpliTaq Gold, 0.01U/ml AmpErase, and the lipase gene of 100nM or oliC probe.0.9 μ M adds each lipase primer with final concentration.0.3 μ M adds each oliC primer with final concentration.Utilize following cycling condition on AppliedBiosystems Prism Model 7700 sequential detection instrument, to react, i.e. 50 ℃ of 1 circulations in 2 minutes, 95 ℃ of 1 circulations in 10 minutes, and 40 circulations: 95 ℃ 15 seconds, 60 ℃ 1 minute.Utilize Sequence Detector v 1.6 to analyze raw data.

What obtain the results are shown in as following table 1, and aspergillus oryzae HowB427 that wherein will be in contrast or the lipase output standard of aspergillus oryzae HowB430 turn to 1.0, and the average lipase gene copy number of aspergillus oryzae HowB430 is standardized as 1.0.

The lipase gene copy number of expression of table 1 lipase and mutant strain

Strain construction thing library shaking flask is average relative copy HowB430 HowB425+pBANe8 NA 1.0 1.0HowL371.3 pSO122 h 2.5 1.56HowL500.1 pSO122 h 2.7 1.25HowL795.4 pSO122 h 3.8 1.75HINL981 pDSY81 hIII 5.9 5.62HINL949 pDSY81 hIII 5.7 5.81HINL917 pDSY81 hIII 5.6 5.38HINL980 pDSY81 hIII 4.6 3.81SALL678 pDSY81 s 3.7 2.19SALL714 pDSY81 s 3.4 2.56BAML5 pDSY82 b 3.0 1.62HINL985 pDSY81 hIII 2.9 1.56ECOL56 pDSY82 e 2.7 1.50HINL990 pDSY81 hIII 2.4 1.62HINL955 pDSY81 hIII 2.4 2.37HINL933 pDSY81 hIII 2.3 1.75 as a result

As shown in table 1, when growing in shaking bottle, HowB430 compares with the control strain aspergillus oryzae, and mutant strain produces many approximately 2-6 lipase doubly.When (all bacterial strains not being tested) in fermentor tank, the mutant strain comparison of testing in the fermentor tank produces many approximately 2-5 lipase doubly according to bacterial strain aspergillus oryzae HowB427.The structure of embodiment 6 pMTI936

Utilize following according to manufacturers indication by Applied Biosystems Model 394DNA/RNA synthesizer synthetic primer, make up pMT1936, make it to contain the palB gene of the aspergillus oryzae 1560 that is shown among the WO 98/11203.100752：5-GGTTGCATGCTCTAGACTTCGTCACCTTATTAGCCC-3′100753：5′-TTCGCGCGCATCAGTCTCGAGATCGTGTGTCGCGAGTACG-3′100754：5′-GATCTCGAGACTAGTGCGCGCGAACAGACATCACAGGAACC-3′100755：5-CAACATATGCGGCCGCGAATTCACTTCATTCCCACTGCGTGG-3′

Be set forth in the genomic dna of the aspergillus oryzae 1560 that the method the embodiment 1 obtains from utilization, utilize the sequence of the N-terminal portions of pcr amplification aspergillus oryzae palB 5 ' flanking sequence and coding palB product.0.05 μ gDNA template and each 5pmol of two primers (primer 100755 and 100754) have approximately been used.As use polysaccharase Pwo as described in the manufacturers increase (Boehringer Mannheim, Indianapolis, IN).40 circulations have been passed through in amplification.Partial reaction product usefulness phenol extraction, ethanol sedimentation, usefulness Restriction Enzyme EcoRI and XhoI digestion, the fragment of separating about 1.05kb with agarose gel electrophoresis.

As the sequence of above-mentioned acquisition aspergillus oryzae palB 3 ' flanking sequence and coding palB gene product C-terminal portions, except adopting primer 100753 and 100752 to increase and before reclaiming about 1.5kb fragment, digesting the PCR product with Restriction Enzyme XhoI and XbaI with gel electrophoresis.

The digestion and the PCR fragment of purifying as mentioned above are connected with the 2.7kb EcoRI-XbaI fragment of carrier pJaL400 (Fig. 9) purifying with the method that the three parts connects, obtain pMT1935 (Figure 10).5 ' the flank and the 3 ' flank that separate the palB of pMT1935 by BssHII, the SpeI that introduce by PCR primer 100754 and 100753 with the XhoI site.

In order between the 5 ' flank of the palB of pMT1935 and 3 ' flank, to insert aspergillus oryzae pyrG gene, the 3.5kb HindIII fragment cloning that will contain the pJaL394 (Figure 11) of multiple pyrG gene flank go into through the HindIII enzyme cut, among the pBluescript II SK-of dephosphorylized, purifying.Obtained to have the plasmid of the insertion fragment of either direction.Selected a plasmid pMT1931 (Figure 12), wherein the SpeI site of pBluescript polylinker is positioned at pyrG gene downstream, and the XhoI site is positioned at the pyrG upstream region of gene.The pyrG gene separates with the SpeI-XhoI fragment of 3.5kb, and inserts in SpeI and XhoI pMT1935 digestion, purifying, produces and destroys plasmid pMT1936 (Figure 13).

The alternative palB of pyrG destroy box can with 5.5kb AseI-PuvI fragment (AseI and PuvI the palB of reality 5 ' with 3 ' flanking sequence in cut) form from pMT1936, separate.Embodiment 7: the AseI/PvuI palB with pMT1936 destroys box conversion aspergillus oryzae and lipase screening

Use available from the AseI/PvuI fragment of the 5.5kb of pMT1936 and transform aspergillus oryzae HowB430 with as described in example 3 above same conversion method.The linear fragment that is used to transform separates by the following method: with AseI and PvuI digestion pMT1936, utilize the QiAquick gel extraction kit according to manufacturers's indication isolating fragment to be separated on 1% sepharose.Then by go up growth test transformant at minimum medium flat board (pH 6.5 or pH 8.0).As the average lipase gene copy number of mensuration as described in the embodiment 5.

The result shows have 13 to contain the palB-phenotype in 128 transformants of test, can not be shown in 8.0 times growths of pH as it.With the bacterial strain of 13 palB-phenotypes and 13 energy at the transformant of 8.0 times growths of pH through the spore purifying, in shaking bottle, cultivate and assess, adopt respectively and measure lipase generation in the shake-flask culture thing described in embodiment 4 and 5.Measure average lipase gene copy number as described in example 5 above.

The results are shown in following table 2, wherein the lipase of aspergillus oryzae HowB430 produces with average lipase gene copy number and is standardized as 1.0.5 can not produce more the palB-bacterial strain of greasiness enzyme than aspergillus oryzae HowB430 and all lose 50% or more lipase expression cassette.

Table 2

Bacterial strain palB phenotype is shaken the average copy number relatively of bottle result

HowB430 + 1.0 1.0

DEBYIO.3 - 2.2 1.0

palB24-l - 1.7 0.38

palB29-I - 1.0 0.31

palB46-l - 0.6 0.31

palB78-l - 1.6 0.44

The linearizing pDSY138 of palB91-I-1.3 0.38 embodiment 8 usefulness NdeI transforms aspergillus oryzae and lipase expression screening

Use isolate conversion aspergillus oryzae HowB430, utilize the method described in the embodiment 3 to reclaim transformant from the NdeI linearizing pDSY138 of aspergillus oryzae DEBY932 (WO 98/11203).Altogether the transformant of 180 recovery is being cultivated in the MY25 of 1/100 intensity substratum on the 24 hole microtiter plates,, be used for as analysis lipase as described in the embodiment 4 in the 4th day and the 6th day sampling.The transformant that produces the highest preceding 11 transformants of lipase and 1 average lipase output is tested on 24 hole microtiter plate substratum again through the spore purifying.The transformant of these purifying too in the MY25 of complete intensity in shaking bottle according to embodiment 5 described assessments.Two strains that output is the highest such as embodiment 5 are set forth in 2 liters of fermentor tanks and cultivate.Equally as measurement lipase activity as described in the embodiment 4.As the average lipase gene copy number of mensuration as described in the embodiment 5.

Gained the results are shown in following table 3, and wherein the lipase of aspergillus oryzae HowB430 produces with average lipase gene copy number and is standardized as 1.0.Two the highest lipase generation bacterium produce the lipase activity with the substantially the same amount of aspergillus oryzae DEBY932, but the copy number of its lipase gene also increases.

Table 3

The average copy number relatively of strain fermentation result

HowB430 1.0 1.0

138T83.l.l 2.2 1.81

138T102.l.1 1.9 1.81 embodiment 9: the structure of aspergillus oryzae HowB432

By with containing NA2-tpi promotor, pubescence humicola lanuginosa (CAREZYME ^TMGene, NovoNordisk A/S, Bagsvaerd, Denmark) cellulose enzyme gene and the linear fragment of the AMG terminator of plasmid pGAG3 (Figure 14) transform aspergillus oryzae JaL250, obtain aspergillus oryzae HowB432.

Make up aspergillus oryzae JaL250 by leaving out neutral protease I gene (npI) from aspergillus oryzae JaL 142 (Christensen etc., 1988, biology/technology (Bio/Technology) 6:1419-1422).BalI fragment by the 1.1kb of the middle body of npI gene among the plasmid pJaL389 (Figure 15) of will encoding exchanges with the HindHI fragment of the 3.5kb of pJaL335 (Figure 16), make up the plasmid of npI disappearance, wherein said plasmid pJaL389 contains the SacI genomic fragment of the 5.5kb of coding npI gene, and the HindHI fragment of described 3.5kb contains the pyrG gene that flank is a tumor-necrosis factor glycoproteins.Thus, obtain plasmid pJaL399 (Figure 17).SacI fragment with 7.9kb transforms aspergillus oryzae JaLI42.Utilization analyzes as Southern as described in the embodiment 7 and the secundum legem method is analyzed transformant by the tracing analysis of IEF proteolytic enzyme.

There are two to have and compare altered Southern collection of illustrative plates with parent strain in 35 transformants, show no neutral protease I activity by IEF.In addition, Southern analyzes demonstration, and one of two transformants have the complete disappearance of npI gene, are called aspergillus oryzae JaL228.

Altogether with 2.3 * 10 ⁷The conidium of aspergillus oryzae JaL228 is plated on the minimum medium flat board of adding 0.1%5-fluoro-vitamin B13 (FOA) and 10mM uridine.Obtain 8 FOA resistance bacterium colonies.Utilize the Southern trace of the genomic dna of 8 bacterium colonies that 401bp pyrG repeat region detects to confirm, the pyrG gene is excised by reorganization at repeat region.Aspergillus oryzae JaL228 shows from the 2.7kb of the expection size of two repeat regions and two bands of 3.1kb.If the pyrG gene is lost by the reorganization between the repeat region, then the 3.1kb band can disappear, and only keeps the 2.7kb band.All 8 FOA resistance bacterium colonies show this kind band pattern.The segmental order-checking of the PCR that is connected between 401bp repeats to copy in having contained the npI gene and being retained in 8 bacterium colonies confirms, has excised the pyrG gene by the reorganization between tumor-necrosis factor glycoproteins.One of them bacterium colony is called aspergillus oryzae JaL250.

By containing the SwaI/PacI fragment of pubescence humicola lanuginosa cellulose enzyme gene from pDM176 (Figure 18) from separation, and fragment connected into the pBANe6 of SwaI/PacI digestion, make up pGAG3.The SwaI/PacI fragment of pDM176 and the pBANe6 of SwaI/PacI digestion are separated on 1% sepharose, and (Qiagen Inc., Chatsworth CA) separate according to manufacturers's indication with the QIAquick gel extraction kit before connection.Connect product and be used for transformed into escherichia coli DH5 α cell, then by utilizing the QIAwell-8 plasmid kit from transformant, to extract plasmid DNA according to manufacturers's indication, whether the restrictive diges-tion plasmid DNA exists with the fragment that confirms correct size, and with the mensuration of the method described in the embodiment 1 dna sequence dna, screening transformant.

Digest pGAG3 with PmeI then, separate linear expression cassette by preparation type agarose electrophoresis by using the TAE damping fluid.Use linear expression cassette to transform aspergillus oryzae JaL250 then.

It is every milliliter 2 * 10 with concentration as described in example 1 above ⁷The aspergillus oryzae JaL250 that the protoplastis of individual protoplastis carries out selecting with amdS transforms.Above-mentioned 10 μ g linear fragments are added 1O μ l protoplastis.Add PEG (the 60%PEG4000-10mM CaCl that volume is 250 μ l then ₂-10mMTris-HCl pH 8.0), mixture is placed 37 ℃ 30 minutes.Add 3 milliliters of STC substratum, mixture is plated on the COVE flat board of having added the 10mM uridine that is used for the amdS selection.At 34 ℃ of culture plate 7-10 days.Then transformant is transferred to the flat board of same medium, in 37 ℃ of incubation 3-5 days.By the spore method of scoring and utilize the isolating bacterium colony of dull and stereotyped picking of sucrose-free same medium, the purifying transformant.The linearizing pDSY138 of embodiment 10 usefulness NdeI transforms aspergillus oryzae and cellulase expression screening

Utilize embodiment 3 described methods to transform aspergillus oryzae HowB432 with the pDSY 138 (WO 98/11203) of NdeI digestion.Reclaimed 240 transformants altogether, on its 24 hole microtiter plates as the MY25 substratum that grows in 1/4 intensity as described in the embodiment 4, except being the 3rd day and sampling in the 5th day, and following analysis cellulase activity.

Measure cellulase activity according to following method.By in the damping fluid of 100mM MOPS (pH 7.0) in 80 ℃ dissolved substance 10 minutes, preparation contains the substrate solution of 2% carboxyazo methylcellulose gum.Use CAREZYME ^TM(Novo Nordisk A/S, Bagsvaerd, Denmark) is as standard.The storage stoste of preparation 2.5-25ECU/ milliliter is with by correspondingly diluting CAREZYME in 100mM MOPS (pH7.0) damping fluid ^TMMake up typical curve.The standard substance and the sample (diluting from shake bottle and fermentor tank) of 5 μ l equal portions are added the independently hole on 96 orifice plates.With volume is that the 2% carboxyazo methocel solution of 65 μ l moves into each hole and mixes.Be reflected at 45 ℃ of incubations 30 minutes, mix termination reaction subsequently by adding 215 μ l terminators.At first with 0.2gZnCl ₂Be suspended among the 20ml 250mM MOPS (pH 7.0), again suspension added 80 milliliters of acidifying ethanol (every liter of ethanol contains 1.1 milliliters of concentrated hydrochloric acids), the preparation terminator.The flat board that will contain terminator changeed part centrifugal 10 minutes in 3000.The 100 μ l equal portions of each suspension move in 96 orifice plates, measure absorbancy in 600nm.Utilize linear regression, the slope of bioassay standard product and sample, intercept and relation conefficient.

With 20 transformants that yield of cellulase is the highest through the spore purifying, and in 24 hole microtiter plates again the test.8 cellulase-producing purifying transformants that output is the highest as described in example 5 above, are tested in shaking bottle in the MY25 of complete intensity again through the spore purifying.2 the highest cellulase-producing transformants also utilize as described in example 5 above same medium and condition to grow in 2 liters of fermentor tanks.As above-mentioned mensuration cellulase activity.Utilize the same procedure described in the embodiment 5 to measure the cellulase copy number, the primer is as follows, and uses aspergillus oryzae HowB432 genomic dna to be standard.Calculate the cellulose enzyme gene copy number of each bacterial strain by the ratio of cellulase replicon quantity and oliC replicon quantity.Cellulose enzyme gene probe: 6FAM-CAGCCTGTCTTTTCCTGCAACGCC-TAMRA cellulose enzyme gene forward primer (CARE119F): CCAAGAAGGCTCCCGTGAA cellulose enzyme gene reverse primer (CARE186R): GAAGTCCGTGATACGCTGGAA

Gained the results are shown in following table 4, wherein the plain enzyme gene copy number of the yield of cellulase of aspergillus oryzae HowB432 and average fiber is standardized as 1.0, the result shows, aspergillus oryzae C 138T205.1.1 has than aspergillus oryzae HowB432 and has more 50% cellulose enzyme gene copy, this with ferment in yield of cellulase increase by 50% consistent.

Table 4

The average copy number relatively of strain fermentation result

HowB432 1.0 1.0

C138T205.l.l 1.5 1.56

C138T21.l.l 1.15 1.0 embodiment, 11 glucose transporter gene overexpression plasmid pHB218 and pDSY153 and the structure that stops control plasmid pDSY152 and pDSY155

Make up the plasmid of the glucose transporter gene of overexpression aspergillus oryzae DEBY599.3 (WO 98/11203), if whether can cause the output of pubescence humicola lanuginosa lipase cellulase to increase to measure the glucose transporter overexpression.By pcr amplification glucose transporter open reading frame, respectively SwaI and PacI site are placed 5 ' and the 3 ' end of ORF.Utilize the Applied Biosystems Model 394 following primers of DNA/RNA synthesizer synthetic and 0.2 milligram of pDSY112 (WO98/11203) to be used from amplification according to manufacturers's indication: 961176:5 '-ATTTAAATGGTCCTCGGTGGATCAAGC-3 ' 961177:5 '-TTAATTAATTAGTCCTGTCTGCGCTGGT-3 '

Condition that is used to increase and parameter are set forth in embodiment 1.10 milliliters of PCR reaction product of electrophoresis on sepharose obtain the 1.5kb fragment of expecting.Utilize pPCR-Script according to manufacturers's indication ^TMTest kit (Stratagene, La Jolla, CA) clone PCR products.Adopt to connect product transformed into escherichia coli DH5 α cell, with QIAWell-8 plasmid kit isolated plasmid dna from several transformants.Contain the insertion fragment of 1.5kb with NotI and EcoRI digested plasmid to determine which clone.Shown in agarose gel electrophoresis, 6 insertion fragments among 11 clones of analysis with correct size.One of them clone pDSY119 is carried out agarose gel electrophoresis by PacI and SwaI digestion with digestion product.From gel, downcut the SwaI/PacI band of 1.5kb, use QIAQuick gel extraction kit purify DNA from the gel stripping and slicing.With standard method (Sambrook etc., 1989, the source is the same) pBANe13 (Fig. 3) of this 1.5kb fragment with the Swal/PacI cutting is connected.Connect product and be used for transformed into escherichia coli DH5 α cell, isolated plasmid dna from several transformants.Contain the insertion fragment of the 1.5kb of expection with the Swal/PacI digested plasmid to determine which clone.The gained plasmid is called pHB218 (Figure 19).

The pHB218 that to have made up a wherein selective marker be the bar gene is used for transforming the pyrG+ bacterial strain.By restrictive diges-tion, agarose gel electrophoresis and utilize QIAQuick gel extraction kit purifying, from pHB218, separate SwaI/PacI and insert fragment.To insert fragment connects into pSE39 (Figure 20) and utilizes SwaI/PacI digestion.Connect product and be used for transformed into escherichia coli DH5 α cell, as above-mentioned from several bacterium colonies isolated plasmid dna.Contain the insertion fragment of the 1.5kb of expection with the SwaI/PaeI digested plasmid to determine which clone.As the sequence of mensuration plasmid as described in the embodiment 1, to confirm having lacked terminator codon at amino acid 9 pDSY153 (Figure 21).Embodiment 12 usefulness pHB218 transform aspergillus oryzae HowB430 and lipase screening

Transform aspergillus oryzae HowB430 with pHB218, utilize embodiment 3 described methods to reclaim transformant.Reclaimed 120 transformants that have pHB218, as growing in as described in the embodiment 5 in the MY25 substratum that shakes in the bottle, as embodiment 4 identify lipase activity after the 2-3 that is set forth in days.As mensuration lipase gene copy number as described in the embodiment 5.

The results are shown in table 5, wherein the lipase output of aspergillus oryzae HowB430 is standardized as 1.0 with average lipase gene copy number.As shown in Table 5, in shaking bottle, the transformant with lipase gene copy number of increase produces more lipase, and the aspergillus oryzae 218T95 that has lost the lipase gene copy produces less lipase.

Table 5 bacterial strain shaking flask as a result average relative copy number HowB430 1.0 1.0218T56 1.8 5.33218T87 1.7 4.00218T18 1.8 2.87218T43 1.6 2.53218T95 0.9 0.47 embodiment 13 usefulness pDSY153 transforms aspergillus oryzae DEBY10.3 and lipase screening

Transform aspergillus oryzae DEBY10.3 with pDSY153, utilize embodiment 3 described methods to reclaim transformant.Reclaimed 216 transformants that have pDSY153, as growing in as described in the embodiment 5 in the MY25 substratum that shakes in the bottle, as embodiment 4 identify lipase activity after the 2-3 that is set forth in days.As mensuration lipase gene copy number as described in the embodiment 5.

The results are shown in table 6, wherein the lipase output of aspergillus oryzae DEBY10.3 is standardized as 1.0 with average lipase gene copy number.The result shows that in shaking bottle, the transformant with lipase gene copy number of increase produces more lipase, and the lipase that the transformant that the lipase gene copy reduces produces reduces.

Table 6

The bacterial strain shaking flask is average relative copy number DEBYIO.3 1.0 1.0 1,53T,208 1.43 2.87 1,53T,214 1.35 2.93 1,53T,171 1.25 1.19 153,T90 0.4 0.56 153,T11 0.2 0.44 as a result

Embodiment 14 makes up pLRF2

Make up the derivative pLRF2 of pMT1612 (BASTA resistance), to contain palB promotor, open reading frame and terminator.

Utilize the genomic fragment of following oligonucleotide from aspergillus oryzae genomic dna amplification palB gene: 5 '-CATATGCACAATACTCACACCAGTAGGCGACCAC-Y5 '-CATATGCTGGTTGTGATCACAGCGACTGGGATGG-3 '

Utilize aspergillus oryzae How B430 genomic dna as template, use the senior genome PCR of Clontech test kit (Clontech.Palo Alto., CA) amplified production according to manufacturers's indication.Reaction conditions is: 94 ℃ 1 minute; 35 following circulations: 94 ℃ 30 seconds, 68 ℃ 6 minutes; And 68 ℃ of 1 round-robin 6 minutes.Obtain the product of about 4.7kb of expection, according to manufacturers's indication use TA clone test kit 72 ℃ following 10 minutes with the Taq archaeal dna polymerase with 3 ' A adding product.

Utilize Invitrogen Topo TA clone test kit that the product subclone is gone into pCR2.1, the insertion fragment in the screening intestinal bacteria transformant.Moving (primr walking) from the nucleotide sequence of the palB fragment of three subclone pLRF1 by the primer step measures.All three subclones all have 3 sequence changes: the T of position 1910 becomes C (swing position is so it is reticent), and the A in the terminator of the about 110bp of terminator codon becomes G, and may change that A becomes T in 3885 positions of amino-acid residue.For the A that proofreaies and correct in 3885 positions becomes T, the oligonucleotide below using utilize Morph rite-directed mutagenesis test kit (Five Prime-Three Prime, Inc., Boulder, CO) carry out rite-directed mutagenesis, from 5 ' to 3 ' according to manufacturers's indication:

5′-CCTGGCGACTTCGGAAGATGGAACTCACAG-3′

The template that is used for rite-directed mutagenesis is pLRF2.PLRF2 makes up like this: digest pLRF1 with NdeI, separate 4.6kb palB fragment, its subclone is gone into to be digested by NdeI and in the pMT1612 (WO 98/11203) of shrimp alkaline phosphotase Phosphoric acid esteraseization (phosphatased).After the sudden change, measure the nucleotide sequence of several escherichia coli clonings, identify that the T of 3385 positions wherein has been changed the clone into A.In addition, move by primer step, measured and contained the nucleotide sequence that desirable T is changed one of rite-directed mutagenesis clone into the pLRF2 of A, to confirm not introduce other change.Embodiment 15:palB-phenotype complementary and be used for the screening of the transformant that lipase produces

By at aspergillus oryzae strain DEBY10.3 and using wild-type palB gene and the complementation of palB-phenotype in one of the destruction of the aspergillus oryzae HowB430 palB described in embodiment 5 and 7 transformant respectively, confirmed the relation that palB-phenotype and lipase produce to be increased.This complementation will cause lipase to produce minimizing.

Select the pLRF2 of BASTA resistance to transform one of aspergillus oryzae DEBY10.3 or pal B destructive aspergillus oryzae HowB430 bacterial strain aspergillus oryzae pal B76-1-1 with method as described in embodiment 3.Also the pMT1612 with the BASTA resistance transforms bacterial strain in contrast.Among the aspergillus oryzae DEBY10.3, obtain 26 and 11 transformants with pLRF2 and pMT1612 respectively.In aspergillus oryzae HowB430 palB76-1-1, obtain 28 and 14 transformants with pLRF2 and pMT1612 respectively.

All transformants are measured the palB phenotype through the spore purifying and on the minimum medium flat board of pH6.5 and pH8.0.For aspergillus oryzae DEBY10.3 and aspergillus oryzae HowB430 palB76-1-1, the result is shown in following table 7 and table 8 respectively.The transformant of all pLRF2 aspergillus oryzae DEBY 10.3 is palB+, and all pMT1612 aspergillus oryzae DEBY 10.3 transformants are palB-.In aspergillus oryzae palB76-1-1 group, there are 27 to be palB+ in 28 pLRF2 transformants, and have 13 to be palB-in 14 pMT1612 transformants.

By as described in embodiment 4, each transformant is inoculated in the 24 hole microtiter plates that contain 1/100 intensity MY25 substratum (pH6.5), measure the ability that transformant produces lipase.Each inoculation of each transformant is gone in 3 holes, and flat board is shaken down cultivation in 34 ℃ with 150 rev/mins.In the 3rd day and the 5th day sampling, and as analysis as described in the embodiment 4.As the average lipase gene copy of mensuration as described in the embodiment 5.

For aspergillus oryzae DEBY10.3 and aspergillus oryzae palB76-1-1, the result is shown in following table 7 and table 8 respectively.For these bacterial strains result standard is turned to 1.0.

Table 7

The average copy number relatively of the relative LU/ml microtitre of bacterial strain palB phenotype

DEBY10.3 - 1 1

pLRF2-1 + 0.9 1.17

pLRF2-2 + 0.8 1.19

pLRF2-3 + 1.3 3.5

pLRF2-4 + 0.5 0.61

pLRF2-5 + 0.7 0.94

pLRF2-6 + 1.1 1.61

pLRF2-7 + 0.69 0.67

pLRF2-8 + 0.85 0.89

pLRF2-9 + 0.63 0.56

pLRF2-10 + 1.1 1.44

pLRF2-11 + 0.8 0.83

pLRF2-12 + 0.6 0.56

pLRF2-13 + 1.1 1.21

pLRF2-14 + 0.5 0.39

pLRF2-15 + 0.6 0.67

pLRF2-16 + 0.5 0.39

pLRF2-17 + 0.8 1

pLRF2-18 + 0.8 0.89

pLRF2-19 + 0.7 0.78

pLRF2-20 + 0.7 1.06

pLRF2-21 + 0.8 0.9

pLRF2-22 + 1 1.17

pLRF2-23 + 0.9 0.89

pLRF2-24 + 0.8 0.89

pLRF2-25 + 0.5 0.56

pLRF2-26 + 0.6 0.67

pMT1612-1 - 1.3 1.05

pMT1612-2 - 1.3 1.05

pMT1612-3 - 0.73 0.39

pMT1612-4 - 1.1 1?pMT1612-5 - 1.1 0.94?pMT1612-7 - 1.2 1.5?pMT1612-8 - 1.1 0.94?pMT1612-9 - 1 0.94pMT1612-10 - 1.3 1.39pMT1612-11 - 1.3 1.44pMT1612-12 - 1.1 1.05

8 palB LU/ml HowB430 + 1 1pLRF2-1 + 0.95 1pLRF2-2 + 1.4 2.13pLRF2-3 + 1.2 1.53pLRF2-4 + 1.4 2pLRF2-5 + 1.2 1.2pLRF2-6-1.7 1.47pLRF2-7 + 0.9 1pLRF2-8 + 1.2 1.47pLRF2-9 + 1.1 1.2pLRF2-10 + 1 1.13pLRF2-11 + 0.9 0.87pLRF2-12 + 1.3 1.53pLRF2-13 + 0.7 0.5pLRF2-14 + 0.9 0.87pLRF2-16 + 0.7 0.6pLRF2-17 + 1.1 1.53pLRF2-18 + 1.29 2pLRF2-19 + 1.1 1.27pLRF2-20 + 0.6 0.6pLRF2-21 + 0.9 0.87pLRF2-22 + 1.2 1.33pLRF2-24 + 0.8 0.87 pLRF2-25 + 1.2 1.67 pLRF2-26 + 0.8 1.07 pLRF2-27 + 0.7 0.87 pLRF2-28 + 1.4 1.33 pLRF2-29 + 1.3 2.27 pLRF2-32 + 0.8 0.93pMT1612-1-1.4 0.93pMT1612-2-1.6 1.27pMT1612-3-1.3 0.93pMT1612-4 + 1.3 1.2pMT1612-5-1.6 2.2pMT1612-6-1.5 1pMT1612-8-1.6 1.27pMT1612-10-1.6 1.2pMT1612-11-1.8 1.13pMT1612-12-1.2 0.73pMT1612-13-1.4 1.13 76-1-1-1.4 1

There are several bacterial strains to lose or obtained the copy of lipase gene.The frequency that copy number changes in all 4 groups is quite high, from 45%-66%.The forfeiture of copy number or acquisition meet finely with reduction or the rising that lipase is expressed respectively.

Be not limited to specific embodiments disclosed herein in this statement and claimed the present invention, because these embodiments are intended to illustrate several aspect of the present invention.Any equivalent embodiments all falls into scope of the present invention.In fact, except shown here and description, be conspicuous to modification of the present invention as can be known by above stated specification for those of ordinary skills.This class is revised and is also thought the scope that falls into appended claims.

All mention herein be used to describe and disclose draw the customizing messages of open text open text be incorporated herein by reference.Open text discussed above is just to its disclosing before the application submits day to.Should not think that described content is that the contriver admits disqualification to enjoy because of formerly inventing and has than this open applying date formerly around here.

Should be appreciated that and the invention is not restricted to ad hoc approach described herein and composition or its variant.Scope of the present invention is to be understood that also term used herein only is intended to describe specific embodiment, and is not intended to restriction, because only should be limited by the accompanying claims.

Unless otherwise defined, all technology used herein and scientific terminology have the identical meanings that those of ordinary skill is known usually in the technical field of the present invention.Although implement or test the present invention in can use any or the material or the method that are equal to similar with those disclosed herein, preferably method and material have been described.

Claims (37)

1. method that is used to prepare polypeptide comprises:

(a) under the condition that helps polypeptide production, cultivate mutant cell, wherein:

(i) produce mutant cell by the genome that the locus place of a nucleic acid construct outside the copy of nucleotide sequence is imported parental cell, mutant cell is associated with parental cell, this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein in locus, import the copy number that nucleic acid construct has changed nucleotide sequence, and the change of copy number not the result of selective pressure;

(ii) when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more or less polypeptide than parental cell;

(b) from nutrient solution, reclaim polypeptide.

2. the method for claim 1, wherein in locus, import the copy number that nucleic acid construct has increased nucleotide sequence, and when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more polypeptide than parental cell.

3. the method for claim 1, wherein in locus, import the copy number that nucleic acid construct has reduced nucleotide sequence, and when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell is than parental cell generation polypeptide still less.

4. method that is used to prepare polypeptide comprises:

(a) under the condition that helps polypeptide production, cultivate mutant cell, wherein:

(i) produce mutant cell by the genome that the locus place of a nucleic acid construct among a copy of nucleotide sequence is imported parental cell, mutant cell is associated with parental cell, this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein in locus, import the copy number that nucleic acid construct has changed nucleotide sequence, and the change of copy number not the result of selective pressure;

(ii) when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more or less polypeptide than parental cell;

(b) from nutrient solution, reclaim polypeptide.

5. the method for claim 4, wherein in locus, import the copy number that nucleic acid construct has increased nucleotide sequence, and when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more polypeptide than parental cell.

6. the method for claim 4, wherein in locus, import the copy number that nucleic acid construct has reduced nucleotide sequence, and when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell is than parental cell generation polypeptide still less.

7. method that is used to prepare polypeptide comprises:

(a) under the condition that helps polypeptide production, cultivate mutant cell, wherein:

(i) produce mutant cell by the genome that the locus place of a nucleic acid construct outside nucleotide sequence is imported parental cell, mutant cell is associated with parental cell, this parental cell contains the nucleic acid encoding sequence, described nucleotide sequence contains tumor-necrosis factor glycoproteins at 5 ' and the 3 ' end of this nucleotide sequence, wherein in locus, import the copy number that nucleic acid construct has increased nucleotide sequence, and the change of copy number not the result of selective pressure;

(ii) when cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more polypeptide than parental cell;

(b) from nutrient solution, reclaim polypeptide.

8. each method among the claim 1-7, wherein nucleic acid construct and nucleotide sequence have the homology less than 40%.

9. each method among the claim 1-8, wherein locus is positioned at different karyomit(e) or is positioned at identical karyomit(e) with nucleotide sequence with nucleotide sequence.

10. each method among the claim 1-9, wherein nucleic acid construct is contained in the carrier.

11. each method among the claim 1-9, wherein nucleic acid construct is a kind of ring molecule.

12. each method among the claim 1-9, wherein nucleic acid construct is a kind of linear fragment.

13. each method among the claim 1-12, wherein nucleic acid construct comprises selective marker.

14. the method for claim 13, wherein said selective marker is dal, amp, and kan, cam, tet, dfhr), hygB, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, URA3, amdS, argB, bar, hygB, niaD, pyrG, sC or trpC.

15. each method among the claim 1-14, wherein parental cell is prokaryotic cell prokaryocyte or eukaryotic cell.

16. the method for claim 15, wherein prokaryotic cell prokaryocyte is a bacterial cell.

17. the method for claim 16, wherein bacterial cell is selected from bacillus, streptomyces and Rhodopseudomonas cell.

18. the method for claim 15, wherein eukaryotic cell is a mammalian cell.

19. the method for claim 15, wherein eukaryotic cell is the fungal cell.

20. the method for claim 19, wherein eukaryotic cell is a filamentous fungal cells.

21. the method for claim 20, wherein filamentous fungal cells is selected from Acremonium, Aspergillus, fusarium, Humicola, Mucor, myceliophthora, Neurospora, Penicillium, Scytalidium, Thielavia, Tolypocladium or Trichoderma cell.

22. the method for claim 19, wherein the fungal cell is a yeast cell.

23. the method for claim 22, wherein yeast cell is selected from mycocandida, Hansenula, genus kluyveromyces, Pichia, yeast belong, Schizosaccharomyces or Yarrowia genus.

24. each method among the claim 1-23, wherein polypeptide is a recombinant polypeptide.

25. each method among the claim 1-24, wherein polypeptide is a heterologous polypeptide.

26. each method among the claim 1-25, wherein polypeptide is antibody or its part, antigen, Rh factor, enzyme, hormone or its variant, acceptor or its part, adjusting albumen, structural protein, reporter molecule or translocator matter.

27. the method for claim 26, wherein enzyme is oxydo-reductase, transferring enzyme, lytic enzyme, lyase, isomerase or ligase enzyme.

28. the method for claim 27, wherein enzyme is aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, at, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase enzyme, saccharase, laccase, lipase, mannosidase, MUTANASE (mutanase), oxydase, pectin lyase, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, rnase or zytase.

29. each method among the claim 1-28, wherein nucleic acid construct is pDSY82, pDSY112, pMT1612, pMT1936, pLRF2, pDSY153 or pHB218.

30. a method that is used to prepare polypeptide comprises

(a) pass through a nucleic acid construct at outside the copy of nucleotide sequence or the locus place within the sequence of one of nucleotide sequence copy, import the genome of parental cell, form mutant cell, wherein this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein nucleic acid construct is integrated into the copy number that has changed nucleotide sequence in the locus, and the change of copy number is not subjected to selective pressure; When cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more or less polypeptide than parental cell;

(b) when under the same condition that helps polypeptide to produce, cultivating parental cell and mutant cell, separate the mutant cell that produces more or less polypeptide than parental cell;

(c) identify the locus that wherein has been integrated with nucleic acid construct;

(d) produce the wherein ruined cell of corresponding gene seat;

(e) under the condition that helps polypeptide to produce, cultivate this cell;

(f) from nutrient solution, reclaim polypeptide.

31. a method that is used to prepare polypeptide comprises

(a) pass through the locus place of a nucleic acid construct outside nucleotide sequence, import the genome of parental cell, form mutant cell, wherein this parental cell contains the nucleic acid encoding sequence, described nucleotide sequence contains tumor-necrosis factor glycoproteins at 5 ' and the 3 ' end of this nucleotide sequence, wherein nucleic acid construct is integrated into the copy number that has increased nucleotide sequence in the locus, and the change of copy number is not subjected to selective pressure; When cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more polypeptide than parental cell;

(b) when under the same condition that helps polypeptide to produce, cultivating parental cell and mutant cell, separate the mutant cell that produces more polypeptide than parental cell;

(c) identify the locus that wherein has been integrated with nucleic acid construct;

(d) produce the wherein ruined cell of corresponding gene seat;

(e) under the condition that helps polypeptide to produce, cultivate this cell;

(f) from nutrient solution, reclaim polypeptide.

32. a method that is used to obtain mutant cell comprises

(a) with a nucleic acid construct therein nucleic acid construct be integrated in the locus place outside the nucleotide sequence copy under the condition of genome of parental cell and import parental cell, form mutant cell, wherein this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein nucleic acid construct is integrated into the copy number that has changed nucleotide sequence in the locus, and the change of copy number is not subjected to selective pressure; When cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more or less polypeptide than parental cell;

(b) identify when under the same condition that helps polypeptide to produce, cultivating parental cell and mutant cell, produce the mutant cell of more or less polypeptide than parental cell.

33. mutant cell that produces by the method for claim 32.

34. a method that is used to obtain mutant cell comprises

(a) with a nucleic acid construct therein nucleic acid construct be integrated in the locus place among the copy of nucleotide sequence under the condition of genome of parental cell and import parental cell, form mutant cell, wherein this parental cell contains at least two placed in-line copies of nucleic acid encoding sequence, wherein nucleic acid construct is integrated into the copy number that has changed nucleotide sequence in the locus, and the change of copy number is not subjected to selective pressure; When cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more or less polypeptide than parental cell;

(b) identify when under the same condition that helps polypeptide to produce, cultivating parental cell and mutant cell, produce the mutant cell of more or less polypeptide than parental cell.

35. mutant cell that produces by the method for claim 34.

36. a method that is used to obtain mutant cell comprises

(a) with a nucleic acid construct therein nucleic acid construct be integrated at the locus place outside the nucleotide sequence under the condition of genome of parental cell and import parental cell, form mutant cell, wherein this parental cell contains the nucleic acid encoding sequence, described nucleotide sequence contains tumor-necrosis factor glycoproteins at 5 ' and the 3 ' end of this nucleotide sequence, wherein nucleic acid construct is integrated into the copy number that has increased nucleotide sequence in the locus, and the increase of copy number is not subjected to selective pressure; When cultivating parental cell and mutant cell under the same condition that helps polypeptide to produce, mutant cell produces more polypeptide than parental cell;

(b) identify when under the same condition that helps polypeptide to produce, cultivating parental cell and mutant cell, produce the mutant cell of more polypeptide than parental cell.

37. mutant cell that produces by the method for claim 36.

Images